#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:58 GMT TreeBASE (cc) 1994-2008 Study reference: Douanla-meli C., & Langer E. 2008. Phylogenetic relationship of Marasmius mbalmayoensis sp. nov. to the the tropical African Marasmius bekolacongoli complex based on nuc-LSU rDNA sequences. Mycologia, 100(3): 445-454. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2089] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=29; TAXLABELS Amyloflagellula_inflata Crinipellis_campanella_DAOM1 Crinipellis_maxima_DAOM196 Marasmiellus_DMC_027 Marasmiellus_palmivorus_AY6394 Marasmius__mbalmayoensis_001b Marasmius_anomalus Marasmius_bekolacongoli_005a Marasmius_bekolacongoli_005b Marasmius_bekolacongoli_BRNM_6 Marasmius_bekolacongoli_BRNM69 Marasmius_capillaris_DED4345 Marasmius_delectans Marasmius_fulvoferrugineus Marasmius_graminum Marasmius_haematocephalus Marasmius_mbalmayoensis_001a Marasmius_mbalmayoensis_001c Marasmius_megistus_002a Marasmius_nodulocystis_007 Marasmius_nodulocystis_009 Marasmius_oreades_BRNM_576445 Marasmius_rotula_AF261345 Marasmius_rotula_AY207238 Marasmius_siccus Marasmius_sp Marasmius_wynneae_BRNM_693350 Marasmius_wynneae_BRNM_693619 Marasmiuso_megistus_002b ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3267] TITLE Marasmius_nLSU_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=617; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amyloflagellula_inflata TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTT-TC---A--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT--GTGA-GGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTTGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCATTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Crinipellis_campanella_DAOM1 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC---G-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGA-CGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC-CAGTGCATT-GTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAACCTTGCTT-----------TGTACTTCCTGGTTGACGGGTCAGCATCAGTTTTGACTGCTGGAAAAGGCTT--GGGAATGTGGCATCTCCGGATGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGTTGCG--GCCGGG---------ACCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Crinipellis_maxima_DAOM196 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC---------CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGTGCATT-GTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAACCTTGCTT---------GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTTGACTGCTGGAAAAAGGCTTG-GGAATGTGGCATCTCCGGATGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCAC-TTGCG--GCCGGGA---------CCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmiellus_DMC_027 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAG---TCG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTC-CCAGTGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCTAGG-GATCAACCTTGCTT---------GGCGTACTTCCTAGTTGACGGGTCAGCATCAGTTTTGATCATTGGAAAAAGGCTTGGGGAATGTGGCATCTCCGGATGTGTTATAGCCCCTTGTTGTATACAGTGATTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT---------CCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmiellus_palmivorus_AY6394 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGATAGTC---------CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTC-CCAGTGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCTAGG-GATCAACCTTGCTT---------GGCGTACTTCCTAGTTGACGGGTCAGCATCAGTTTCGATCACTGGAAAAAGGCTTGGGGAATGTGGCATCTCCGGATGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT---------CCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius__mbalmayoensis_001b TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC-----GCTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC-CAGGGCATT-GTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTTGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCAAGCCGCAAGGCCGGGT--TTCG---CCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGCCTTGAAT Marasmius_anomalus --------------GAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TCG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGACCGGG-GATCAGCCTTGCTTCT--GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGATCATTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGTT-TC-G-A-CCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_bekolacongoli_005a TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC--G---CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTT-AGTCGCGTTAGCCAGG-GATCAGCCTTGCTTTT--GTGA-GGTGCACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCATTGGAAAAAGGCTTGGGGAATGTGGCACTTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGTT-TC--GA-CCACGCTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_bekolacongoli_005b TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC--G---CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTT-AGTCGCGTTAGCCAGG-GATCAGCCTTGCTTTT--GTGA-GGTGCACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCATTGGAAAAAGGCTTGGGGAATGTGGCACTTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGCTCGTGCTTAGGATGCTGGCGAAATG-GCTTTAAGCGACCCG-------- Marasmius_bekolacongoli_BRNM_6 -------------TGAAGAGGGAAAAGCTCAA-TTTAAAATCTGGAAGCT-TC-----GCTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGC--TTT-GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCATTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGTT-TC---GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_bekolacongoli_BRNM69 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC---G--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGATCATTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTCG--ACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_capillaris_DED4345 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC--------GTTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATTTGTGGTGCGCTCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTTGTAAATTCCATCTAAAGCTAAA?ATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGTAGTC-AGTCGCGTTGGCCGGG-GATCAGCTCTGC--TT-------GGTGTACTTCCTGGTTAACGGGTCAGCATCAGTTTCGATCGCCGGAAAAGGGTTTGAGGAATGTGGCAACCTCGGTTGTGTTATAGCCTCTTATCGTATACGGCGGCTGGGACTGAGGA--ACTCAGCACGT??????????????-??--------?????GTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_delectans TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TCG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC-CAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-GATCAGCCTTGCTTTT--GTGA-GGTGTACTTCCTGGT-GACGGGTCAGCATCAGTTTCGACCATTGGAGAAAGGCTTGGGGAATGTGGCAC-TTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--GCTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_fulvoferrugineus TAGTAACTGCGAGTGAA?AGGGAAAAGCTCAAATTTAAAATCTGGCAGTT-TC---A--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGGATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-GATCAGCCTTGCTTTT--GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTCGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_graminum TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC-TT--G--ATTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGGATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT--GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGA---TCG--TCCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCT----- Marasmius_haematocephalus ------CTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC-----GCTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTC-CCAAGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_mbalmayoensis_001a TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC--G---CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC-CAGGGCATT-GTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTTGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC---GCCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_mbalmayoensis_001c TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCT-TC---G--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTTGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTCG--ACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_megistus_002a TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAG-T-TTG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAATGCAAT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCAGCCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTTGGGTGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC---GCCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_nodulocystis_007 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC-TTTG-A--TTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGC--TTCTGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTCCGGGTGTGTTATAGCCCCTTGTTGTATACAGCGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGA--TTC--GTCCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_nodulocystis_009 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC-TTTG---ATTGTCCGAGT-TGTAATTTAGAGAAGTGCTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTCT--GTGA-GGTGTACTTCCTGGT-GACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTCCGGGTGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGA--TTCGT--CCACCTTCGTGCTTAGGATGCTGGCATAATG-GTTGTAACCGACCCGCCCTGCAC Marasmius_oreades_BRNM_576445 -------TGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TC---G--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-GATCAGCCTTGCTTTT--GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTTGACCACTGGAGAAAGGCTCGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTCGTATACAGTGATTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC-GA-CCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_rotula_AF261345 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TCAG---GTTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGTAGTC-AGTCGCGTTGGCCGGG-GATCAGCTCTGCTTTT--GTGG-GGTGTACTTCCTGGTTAATGGGTCAGCATCAGTTTCGATCGCCGGAAAAGGGTTTGAGGAATGTGGCAACCTCGGTTGTGTTATAGCCTCTTATCATATACGGCGGCTGGGACTGAGGA--ACTCAGCACCC-------TCTGGT-----------------GTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_rotula_AY207238 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TCA--G-GTTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC-CAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGTAGTC-AGTCGCGTTGGCCGGG-GATCAGCTCTGCTTTT--GTGG-GGTGTACTTCCTGGTTAACGGGTCAGCATCAGTTTCGATCGCCGGAAAAGGGTTTGAGGAATGTGGCAACCTCGGTTGTGTTATAGCCTCTTATCGTATACGGCGGCTGGGACTGAGGA--ACTCAGCAC-CCT------CTGG-----------------TGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_siccus TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGTC-TTTG---ATTGTCCGAAT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTCT--GTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCACTGGAAAAAGGCTTGGGGAATGTGGCACCTCCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGA--TCGT---CCACGTTCGTGCTTAGGATGCTGGCATAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_sp TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC--TCG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGATTA-CCAGGGTATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-GATCAGCCTTGCTT-TA-GTGA-GGTGTACTTCCTGGTTAACGGGTCAGCATCAGTTTCGACCACTGGAGAAAGGCTTTGGGAATGTGGCACCTCCGGGTGTGTTATAGCCCTTTGTTGTATACAGTGATTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TC---GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_wynneae_BRNM_693350 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TC---G--CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGGATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGACCGGG-GATCAGCCTTGCCTTT-GGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCGACCATTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--GACCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmius_wynneae_BRNM_693619 TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCC-TC--G---CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTATAAGTCTCCTGGGATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAGGGCATT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGACCGGG-GATCAGCCTTGCCTTTG-GTGA-GGTGTACTTCCTGGT-GACGGGTCAGCATCAGTTTCGACCATTGGAAAAAGGCTTGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTCGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC--G-CCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA Marasmiuso_megistus_002b TAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCT?????GT-TTG-----CTGTCCGAGT-TGTAATTTAGAGAAGTGTTACCCGTGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTA-CCAATGCAAT-GTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA-ACAAGTACCGTGAG-GGAAAGATGAAAAGAA-CTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTG-AAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCAGG-GATCAGCCTTGCTTTT-TGTGA-GGTGTACTTCCTGGTTGACGGGTCAGCATCAGTTTCAGCCACTGGAAAAAGGCTTGGGGAATGTGGCACCTTTGGGTGTGTTATAGCCCCTTGTTGTATACAGTGGTTGGGACTGAGGA--ACTCAGCACGCCGCAAGGCCGGGT--TTC-GA-CCACGTTCGTGCTTAGGATGCTGGCAAAATG-GCTTTAAGCGACCCGTCTTGAAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Marasmius_nLSU_rDNA) = N: 1-617; CODONPOSSET CodonPositions (CHARACTERS = Marasmius_nLSU_rDNA) = N: 1-617; END; BEGIN TREES; TITLE Tb9118; LINK TAXA = Taxa1; TRANSLATE 1 Marasmius_fulvoferrugineus, 2 Marasmius_wynneae_BRNM_693350, 3 Amyloflagellula_inflata, 4 Marasmius_anomalus, 5 Marasmiellus_DMC_027, 6 Marasmius_megistus_002a, 7 Marasmius_bekolacongoli_BRNM69, 8 Marasmius_nodulocystis_007, 9 Marasmius_rotula_AF261345, 10 Marasmius_graminum, 11 Marasmius_bekolacongoli_005b, 12 Marasmius_haematocephalus, 13 Marasmius_wynneae_BRNM_693619, 14 Marasmiellus_palmivorus_AY6394, 15 Marasmius_rotula_AY207238, 16 Marasmius__mbalmayoensis_001b, 17 Marasmius_delectans, 18 Crinipellis_campanella_DAOM1, 19 Marasmius_mbalmayoensis_001a, 20 Marasmius_sp, 21 Marasmius_mbalmayoensis_001c, 22 Marasmius_bekolacongoli_BRNM_6, 23 Marasmius_capillaris_DED4345, 24 Marasmiuso_megistus_002b, 25 Marasmius_oreades_BRNM_576445, 26 Marasmius_siccus, 27 Marasmius_bekolacongoli_005a, 28 Marasmius_nodulocystis_009, 29 Crinipellis_maxima_DAOM196; TREE con_50_maj_rule = [&R] (((1,(2,13),((8,10,26,28),((18,29),(5,14))),(3,7,12,22,(11,27),(6,24),(16,19,21)),(17,(20,25))),4),(9,15,23)); END;