#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:49 GMT TreeBASE (cc) 1994-2008 Study reference: Siahaan S., Sakamoto H., Shinoda T., & Takamatsu S. 2018. Geographic and temporal distributions of four genotypes found in Erysiphe gracilis, a powdery mildew of evergreen oak (Erysiphales). Mycoscience, 59(2): 110-118. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20935] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=13; TAXLABELS Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH3608 Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH4107 Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH5536 Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5381 Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5725 Erysiphe_gracilis_genotype_II_ex_Q._myrsinaefolia_MUMH6161 Erysiphe_gracilis_genotype_III_ex_Q._glauca_MUMH5868 Erysiphe_gracilis_genotype_III_ex_Q._glauca_TUAMH3181 Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5839 Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5842 Erysiphe_gracilis_genotype_IV_ex_Q._salicina_MUMH5804 Erysiphe_japonica_ex_Q._crispula_MUMH4163 Erysiphe_japonica_ex_Q._serrata_MUMH4582 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40988] TITLE 'Matrix in file "E. gracilis.nexus"'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1761; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH3608 ------GTGAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCAT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCT-ACCATTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCA---------------------AAA-CCCCATCA--------------CTCCTTGATTTTCAATCAAAATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTGTCTGTGGATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAGTCCTTGG-TAAACAGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTAGGGCTTCTCCTGCC-TAGTAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCCGGTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH4107 ------GTGAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCAT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCT-ACCATTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCA---------------------AAA-CCCCATCA--------------CTCCTTGATTTTCAATCAAAATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTGTCTGTGGATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAGTCCTTGG-TAAACAGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTAGGGGTTCTCCTGCC-TAGTAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCCGGTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH5536 ------G?GAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCAT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCT-ACCATTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCG?CGACAGCGACTAGCCA---------------------AAA-CCCCATCA--------------CTCCTTGATTTTCAATCAAAATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTGTCTGTGGATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAGTCCTTGG-TAAACAGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTAGGGGTTCTCCTGCC-TAGTAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCCGGTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5381 --------GAGGTT-AGCCATGGCAGTTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGT--GTTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--TCATGTAGTCTAAGGCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCAAGCT-ACCATTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACCAGCCA---------------------AAACCCCCACCA--------------CTCGTTGACTTTCAGTC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTGTCTGTGGATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAG--GACAGTTCTTGG-TAGACAGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTATGGGCTCTCCTGCC-TAGTAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCTCGTGGG-CCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5725 -------------------------GTTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGT--GTTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--TCATGTAGTCTAAGGCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCAAGCT-ACCATTTTGTGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACCAGCCA---------------------AAACCCCCACCA--------------CTCGTTGACTTTCAGTC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-------GATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAG--GACAGTTCTTGG-TAGACAGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTATGGGCTCTCCTGCC-TAGTAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCTCGTGGG-CCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_II_ex_Q._myrsinaefolia_MUMH6161 CAGAGCGTGAGGTTCAGCCATGGCAGTTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGT--GGTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--TCATGTAGTCTAAGGCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCAAGCT-ACCATTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACTAGCCA---------------------AAACCCCCACCA--------------CTCCTTGACTTTCAGTC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-----------AGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAG--GACAGTTCTTGG-TAGACAGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTG-AAAGGTCCTTATGGGCTCTCCTGCC-TAGTAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCTCGTGGG-CCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_III_ex_Q._glauca_MUMH5868 CAGAGCGTGAGGTTCAGCCATGGCAGTTGCCGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGT--GTTGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCAAGCT-ACCATTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGATGGCGACTAGCCA---------------------AAACCCCCACCA--------------CTCCTTGACTTTCAGTC--AACAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT---TGTGGATTAGTGGCCGATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAG--GACAGTTCTTGG-TAAGCAAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTATGGGCTCTCCTGCC-TAGTAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCCCGTGGG-CGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_III_ex_Q._glauca_TUAMH3181 CAGAGCGTGAGGTTCAGCCATGGCAGTTGCCGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGT--GTTGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCAAGCT-ACCATTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGATGGCGACTAGCCA---------------------AAACCCCCACCA--------------CTCCTTGACTTTCAGTC--AACAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-----------------CGATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAG--GACAGTTCTTGG-TAAGCAAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTATGGGCTCTCCTGCC-TAGTAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCCCGTGGG-CGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5839 CAGAGCGTGAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCGT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCC-ACCATTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCA---------------------AAA--ACCATCA--------------GTCCTTGACTTTCAATC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-------GATTAGTGGCCGATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAG--GACAGTCTTGGTTTAAACAAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTTGGGGCTCTCCTGCCTTAGTAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCC-GTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGT---- Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5842 CAGAGCGTGAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCGT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCC-ACCATTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCA---------------------AAA--ACCATCA--------------GTCCTTGACTTTCAATC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------------------GATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAG--GACAGTCTTGGTTTAAACAAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTTGGGGCTCTCCTGCCTTAGTAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCC-GTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA--------- Erysiphe_gracilis_genotype_IV_ex_Q._salicina_MUMH5804 CAGAGCGTGAGGTCCAGCCATAGCAGTTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCGT--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT--CCTTGTAGTCTAAGGCAAGA-TTTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCC-ACCATTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCA---------------------AAA--ACCATCA--------------GTCCTTGACTTTCAATC--AATAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------GGATTAGTGGCCGATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAG--GACAGTCTTGGTTTAAACAAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTTGGGGCTCTCCTGCCTTAGTAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGGGTGTCGAGGGAGCCC-GTGGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCAGTAGTCATA Erysiphe_japonica_ex_Q._crispula_MUMH4163 CAGAGCGAGAGGTCCAGCCATGGCAGTTGTCGTGCGCTGGATCTCGACCCTCCACCCGTGTCGACTTGTATTTTTGTTGCTTTGGCGGGCCGGGCCGGCGCCCATGGTCGCGTTTCGTACGATGAG-CATGGCGTGAGCGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTTTAACACCCAAACTCATGTTGTCCCCCTGTTGTCTAAG?CAAAG-ATTTAAGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCTCGAGCTAACCATTTT-GGTGTGGCTGCGGTATTGGGGCTCGCTGAATCTCGGCGGCCCTTAAAGGCAGTGGCGGGGCTAACGTCGGCTCTACGCGTAGTAATAGATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAAAGAAGAAGAAGAAGA-----AAA-----AACA--------------CTTCTTGACTTTAGATC--AATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCATCCAGAG--TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_japonica_ex_Q._serrata_MUMH4582 CAGAGCGAGAGGTCCGGCCATGGCAGTTGTCATGCGCTGGA--TCGACCCTCCACCCGTGTCGACTTGTATTTTTGTTGCTTTGGCGGGCCGGGCTAGCGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCGTGAGCGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTTTAACACCCAAACTCATATTGTCCCCCTGTTGTCTAAGGCAAAAGATTTAAGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCTCGAGCT-ACCATTT--TGTGTGGCTTCGGTATTGGGGCTCGCTGAATCTCGGCGGCCCTTAAAGGCAGTGGCGGGGCTAACGTCGGCTCTACGCGTAGTAATAAATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAAAAAAGAAGAAGAGAGAAACAAAAACAAAAACAAAAACAAAAACACTCTTCTTGACTTTAGGAT--CATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTTGGGCGCTGCTGATCATCCAGAG--TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAACTACCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTTGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN TREES; TITLE Erysiphe_gracilis; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH5536, 2 Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH4107, 3 Erysiphe_gracilis_genotype_I_ex_Q._glauca_MUMH3608, 4 Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5381, 5 Erysiphe_gracilis_genotype_II_ex_Q._glauca_MUMH5725, 6 Erysiphe_gracilis_genotype_II_ex_Q._myrsinaefolia_MUMH6161, 7 Erysiphe_gracilis_genotype_III_ex_Q._glauca_TUAMH3181, 8 Erysiphe_gracilis_genotype_III_ex_Q._glauca_MUMH5868, 9 Erysiphe_gracilis_genotype_IV_ex_Q._salicina_MUMH5804, 10 Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5842, 11 Erysiphe_gracilis_genotype_IV_ex_Q._glauca_MUMH5839, 12 Erysiphe_japonica_ex_Q._serrata_MUMH4582, 13 Erysiphe_japonica_ex_Q._crispula_MUMH4163; TREE Fig._2 = [&R] ((((1,2,3),(((4,5),6),(7,8))),(9,10,11)),(12,13)); END;