#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 11:48 GMT TreeBASE (cc) 1994-2008 Study reference: Mctaggart A.R., & Shivas R.G. 2017. Genera of phytopathogenic fungi: GOPHY 1. Studies in Mycology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21061] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=83; TAXLABELS Aecidium_nymphoidis Ceratocoma_jacksoniae Miyagia_pseudosphaeria Puccinia_abrupta Puccinia_acroptili Puccinia_arthrocnemi Puccinia_aucta Puccinia_bassiae Puccinia_boroniae Puccinia_brachypodii Puccinia_canaliculata Puccinia_carduorum Puccinia_caricina Puccinia_carissae Puccinia_chrysanthemi Puccinia_cnici Puccinia_convolvuli Puccinia_cynodontis Puccinia_dampierae Puccinia_dichondrae Puccinia_duthiae Puccinia_flavascentis Puccinia_gastrolobii Puccinia_geitonoplesii Puccinia_gilgiana Puccinia_gnaphaliicola Puccinia_graminis Puccinia_grevillieae Puccinia_haemodori Puccinia_hemerocallidis Puccinia_heterospora Puccinia_horiana Puccinia_hypochaeridis Puccinia_iridis Puccinia_kuehnii Puccinia_lagenophorae Puccinia_levis_trichloaene Puccinia_liberta Puccinia_loranthicola Puccinia_ludwigii Puccinia_magnusiana Puccinia_malvacearum Puccinia_melanocephala Puccinia_menthae Puccinia_muehlenbeckiae Puccinia_myrsiphylli Puccinia_nakanishikii Puccinia_operculinae Puccinia_paululla Puccinia_pelargoni_zonalis Puccinia_polysora Puccinia_pritzeliana Puccinia_psidii Puccinia_purpurea Puccinia_rhagodiae Puccinia_rhaphidophorae Puccinia_saccardoi Puccinia_scleriae Puccinia_sparganioidis Puccinia_striiformis Puccinia_stylidii Puccinia_tetragoniae Puccinia_unica Puccinia_ursiniae Puccinia_xanthii Puccinia_xanthosiae Sphaerophragmium_acaciae Uromyces_appendiculatis Uromyces_appendiculatis_crassitunicatus Uromyces_bidenticola Uromyces_geranii Uromyces_lomandracearum Uromyces_orientalis Uromyces_pisi_sativi Uromyces_salsolae Uromyces_scaevolae Uromyces_setariae_italicae Uromyces_striatus_Medicago Uromyces_tenuicutis Uromyces_trifoli Uromyces_viciae_fabae Uromyces_vignae Uromyces_wedeliae ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45231] TITLE Pucciniaceae_28S_CO3_SIM; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1677; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aecidium_nymphoidis CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGACAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGCTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTT-----AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTGAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C--TTAAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC----------TTTTTG-AGGTGGGACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCATATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGAATTATGAGTTACCAACTAACAGATCATC-- Ceratocoma_jacksoniae CTAACAAGGATTCCCCTAGTAATGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCAGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTACTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-CATGT-GCACTATATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTATGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TGATTAGTTCAACCCTTCTT------AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-TCCC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGATATATATGCAGTAAGCATGACTTTTTTGTT----GTGTGGAACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGCAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGTGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCAATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTTGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACATGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGTGTATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTATAACAGTAGCACTAGCTCGAATTATAAGTTACCAACTAACAGATCATC-- Miyagia_pseudosphaeria CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTTTAAGTCTGTTGAAAGGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACGATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT---C----AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAGTTTTTGGGTGTTGGAGAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCT--TTT-----------AGGTGGAACAA-ATCA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCTAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_abrupta CTACCAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGTATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTCT----AAGGGTGTATTCTAATGA-TTAACAGACCAACATCAGTTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCT--TTA---------T-TGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCACAATGAAAGTAAATGTAAATGGGAAC-TC--T--------------TT---------T------------------------GAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_acroptili CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAGGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCCTTT---C----AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTGAGCCC--CTT-----TT--G-GGGTGGAACAC-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_arthrocnemi CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGGGTCTGAGTTGTAATTTTGAGAACTATTTTCAGTGCTGGACCATGTATAAGTCTGCTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AG----TATGATATAGTCTCCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTC--------AGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTGGAGTGTTGGAGAAGGG-{AT}TTAAGGAAATGTAGCAG----TCTATGACTGTGTTA---TA--G-T-CC----TGAA-CGTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCATGAA--CTTGTTC----ATGTGGAACAA-ATTA----ATGTTC-TTCTTGCTGAGGAT-GTTGGTGGAATAGCTTCAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGCAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------TA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGTCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAATTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGGACTCTTTTTATAACAGTAGCACTAGCTAGAATTATAAGTTACCA{AG}CTAACAGATCATC-- Puccinia_aucta CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTT---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAATGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGT-GT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTT-----------AGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTGAGGAAATGTAGCAG-TGATTTATTGCTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TATGATGC-TTAAGATTGAGGA-----AGGCAGCAAGCATAA-----ATATT----ATGTGGAACAA-ATTA----ATGTTC-TTCTTGCTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------GA----------------------AAAGTGCACCATTGACCAGTCCAGAATATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAAGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATAAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGGTTCACGTCATTATCGGGACCCTTTTTCTAACAGTAGCCCTAGCTCGAATTATAAGTTACCAACTAACAGATCATC-- Puccinia_bassiae CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCGTGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AC----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATCAGTTCAACCTTTTT--------AGGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCATG-TCAAAAGT----GTGTGGAACAA-ATCA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGGAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGTCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAATTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGGACTCTTTTTATAACAGTAGCACTAGCTAGAATTATAAGTTACCAACTAACAGATCATC-- Puccinia_boroniae CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTCTT-----AAGGGAGTATTCTAATAA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TTTCTGACTGTGTTA---TA--T-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACAAC---TTTGTT----GTGTGGAACAA-AGTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGGGTAGCACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCAATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAGGCTCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTCTAACAGTAGCACTAGCTCGAATTATAAGTTACCAA{CT}TAACAGATCATC-- Puccinia_brachypodii CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTC-----AAAGGGAGTATTCTAATGA-TTAACAAACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAA{CT}GTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCAA------TTTT----GTGTGGAACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------TA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_canaliculata CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCTTTTCT------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-C-C--CTAAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----------TTTTA-AGGTGGAACAATATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGGATTATGAGTTACCAACTAACAGATCATC-- Puccinia_carduorum CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAGGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT---C----AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTGAGCCC--CCT-----TTGGG-GGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCTAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_caricina CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGG-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC----------TTTTAA-AGGTGGGACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTGAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGGTTTCATGGGATTCACGTCAT------------------------------------------------------------------- Puccinia_carissae CTAACAAGGATTCCCCTAGTAATGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTCCC-AGTAT-GT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGTAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTG-TTATTAGTTCAGCCTCTCTC-----AAGGGGTGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGGCTGTGTTA---TA--G-T-CCA---TAAA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----TGTTT-------GGGTGGGACCA-ATT-A---CGGTCT-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGA-TTGAAACCCTTATGCGGAATGAAAGTGAATGTAAATGGGAAC-----CCCC-----------CT---------GT----------------------GGGATGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_chrysanthemi CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATATACAAGTCTTCTGAAAAGAAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CCACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTAATAGTTCAACCTTTTTTA-----AAAGGAGTATTCTATTGA-TTAACAGACCAACATCAGTTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGACTGTGTTA---TA--T-T-C-CTTCTGGA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_cnici CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTCAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTTTGTTGAAAAGCAACATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AC----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT--TA----AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCCGATTT-----TTTTT-GGGTGGGACAA-ATTA----ATGTCT-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCTAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_convolvuli CTAACAAGGATTCCCCCAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGACT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCATTTTTTTT--AAATGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCCT--TTT-----TTTTT-GGGTGGAACAA-ATTG----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGAGAAC-TT--T--------------TT---------TT----------------------GGAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_cynodontis ------------------------------GAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTA--------ATGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCAGC-TTCTTGTT----GTGTGGAACAA-ATCA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGTGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCCAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACATTCACATGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCCTTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACGGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTATAACAGTAGCACTAGCTCGGATTATAAGTTACCAA{CT}TAACAGATCATC-- Puccinia_dampierae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCCTTTTTTTTTTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTATATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGG---------------------------------------------------------------------------------------------------------------- Puccinia_dichondrae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCACCCTTTTCTC-----AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACAAC----TTGTT----GTGTGGGGCAA-ATTA----ATGCTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------TA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGGGCGCTAGGAGGGTATCATACGTTTGATGTACAACGTTCTCTAAATATAGGGGTAGTACTATTTATTGTAAGTGAGATATTTTTTTTTGTATCAATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAACTAGGGTCTCAATGGCCTGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTTGCACTAGCGGTAACTTTCACAGTGTTTCAGGCACTAGAGTATATAGAAGCTCCTTTCACAATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTCTAACAGTAGCACTAGCTCGAATTATAAGTTACCAACTAACAGATCATC-- Puccinia_duthiae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTGTGATATGGA------CTACC-AGTGC-AT----TATGATACAGATTCTAAGAGTC{AG}AGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAGTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTATT---------GGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCAC-----ACTA-------GTGTGGAACTC-AAT-ATG-TGGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAATTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGATGA-TTGAAATCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_flavascentis CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTACTGGACCATGTATAAGTCTGTTGAAAGGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTCTT-----GAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGGCTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCAAC----TTGTT----GTGTGGAACAA-ATTA----ATGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------TA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTTAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTATAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAAAGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAATTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGTGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATAATCGGGACGATTTTTATAACAGTAGCACTAGCTCGAATTATTAGTTACCAA{CG}TAACAGATCATC-- Puccinia_gastrolobii CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGTTACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT--CT----AAGGGTGTATTCTAATGA-TTAACAGACCAACATCAGTTTTTGAGTGTTGGAGAAGGG-TTCAAGGAAATGTGGCAG----TCTCTGACTGTGTTATTTTA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCA--TCT-----TT--T-TGGTGGAACAA-ATTG----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_geitonoplesii CTAACAAGGATTCCCCCAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCTTTTT------ATAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCTTTT-------------AGGTGGAACAA-ATT---A-TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGT-TTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-----T--------------TT---------TT----------------------TAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCAAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAGCGTTCACTAAATATGGGGGTAGTACTATTTATTGTGAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCAGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCTCTAATTAAGGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGAATTATGAGTTACCAA{CT}TAACAGATCATC-- Puccinia_gilgiana CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TA{CT}GATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC-----TTATTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_gnaphaliicola CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCCTTTT-------CAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----------CTTTT-GGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAGCGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTCTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCAGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAACACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCTGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCTCCCTTTACCATTTCAGATGGTGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGAATTATGAGTTACCAACTAACGGATCATC-- Puccinia_graminis CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTATT----AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCAA----TTTATT----GTGTGGAACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_grevillieae ---------ATTCCCTTACTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---GTTTC---------AGAGTCAGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATTGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTCT----TGAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTATTGGATAAGGG-TTTAAGGAAATGTAGCAG----TTTCTAACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGCTTTAAGATTGAGGT-----ATGCAGCAAGCCCTTCTTGAA--------GGGTGGAACAT-ATT---GTATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTTATGCGCAATGAAAGTAAATGTAAATGGGACC-----T--------------TT---------TT----------------------TGAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGA----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGACGTAAGTGCAGAAGGGGCGCTAGGAGGGTATCATACGTTTGATGTACAACGCTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGAGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTTACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCAGTAACTTTCACATGTTTTCAAGCACTAGAGTATATTGAGGCACCCTTCACTATTTCAGATGGGGTATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGAACCATTTTTATAACAGTAGCACTAGCTCGAATTATTAGTTACCAACTAACAGACCATC-- Puccinia_haemodori CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC------TTTTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_hemerocallidis CTAACAAGGATTCCCCCAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTATGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCTTTTT------ATAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCTTTT-------------AGGTGGAACAA-ATT---A-TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGT-TTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-----T--------------TT---------TT----------------------TAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCAAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAGCGTTCACTAAATATGGGGGTAGTACTATTTATTGTGAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCAGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCTCTAATTAAGGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGAATTATGAGTTACCAACTAACAGATCATC-- Puccinia_heterospora CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCC---CTTTC---------AGGTTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTACTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CTACC-AGTAT-GT----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTCTTT------ATGGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-CTTAAGGAAATGTAGCAG----TCTTTGACTGTGTTA---TA--G-A-CC----TGAG-CTTTGA--TGCAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCACT---TGATT-------GTGCGGAACAA-ATTAA---TGTTCT-TCTTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTTA-TAGAAACCCTGATGCGTAATGAAAGTAAATGTAAATGGGATC-----CTCT-----------TC---------TG----------------------GGGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_horiana CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTCTT------AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAACAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_hypochaeridis --------GATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTTTAAGTCTGTTGAAAAGCAGCATCATTGAAGGTGATAATCCTGTTTATGATATGGA------CTCCC-AGTGT-GA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACGATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTT-----AAAGGAGTATTCTAATGA-TTAACAGACCAACATGAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGATTGTGTTA---TA--G-A-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----GTGCAGTAAGCTG--TTAATTTTTTAAA-AGGTGGAACAC-ATTA----ATGTTT-TACTTACTGAGGAT-GTTGGTGCAATAGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-ATTGAAACCCTTATGCAGAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCTAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTTGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_iridis CTAACAAGGATTCCCCCAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACATGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCCTTTC--------AGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGG-----ATGCAGTAAGC------CTTTT-------AGGTGGAACAA-ATC-A---TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGT-TTGAAACCCTTATGCACAATGAAAGTAAATGTAAATGGGAAC-----T--------------TT---------TT----------------------CAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_kuehnii CTAACAAGGATTCCCTTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTT-----TAAAGGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAAGGTGATAATCCTGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACACTTAAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTTTTT-AAAAGGAGTATTCTAAAAG-ATAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGGAATGTAGCAG----TCTTTGACTGTGTTA---TA--GAC-CT----TGAG-CTTTGA--TGCAATGC-TTAAGATTGAGGA-----ATGCAGTAAACCCTTGTTTTTG-------GGGAGAAATAA-AATAATATTTTCTT-TTATTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGATTTGAAACCCTTATGCATAATGAAAGTGAATGTAAATGGGATC-----C--------------TC---------TTTTTTTTTCCAAAAGAAAAGGGGGGGGAGCACCATTGACCAGTCTTGATTATTTATATGAGGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTATTTGAATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTGGGAGTAATAAGTCTATGATTTAGGGACGTAAGTGCAGAAGGGTCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGAGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAGTAGGAGGTCATGCCTGATTGGTTTTATAGTGACTCTAGCACTAGCAGCGACTTTCACAGGGTTTCAAGCACTAGAGTATATTGAAGCACCTTTTACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGAACCCTTTTCCTAACAGTAGCACTAGCTCGAATTATTAGTTATCAGCTAACAGATCATC-- Puccinia_lagenophorae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC-----TTATTTTTTTA-AGGTGGAATAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_levis_trichloaene ------------CCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTCTTCTTTTTTAGAGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAATGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CCACC-AGTAT-GT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTG-TTATTAGTTCAGCCCTTTT------GGGGGGTGTATTCTAATGATTTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-CTTATGGAAATGTAGCAG----TCCCTGACTGTGTTA---TA--G-T-CC----AGAG-CTTTGA--TGCAATGC-CTAAGATTGAGGT-----ACGCAGTAAGCC-----AATTA-------TGGTGGGAGTT-TCT-AGG-AATTCC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTTATGCGGAATGAAAGTAAATGTAAATGGGAAC-----CTG------------TT---------AA----------------------AGGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_liberta CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCTTTTCT------CAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGACTGTGTTA---TA--G-T-C-C--TTGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----------TTTTA-AGGTGGAACAT-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGAT{CT}GTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC{AG}AAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGC{AG}AATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGGATTATGAGTTACCAACTAACAGATCATC-- Puccinia_loranthicola CTAACAAGGATTCCCTTAGTAATGGCGAATGAACAGGGATAAGCCCAAATTTGTAATCAGGCC---CTTTC---------AGGGTCTGAGTTGTAATTGTGAGATCTGCT{AT}TCAGGGCTGGTCCATATATAAGTCTGTTGAAAAGCAGTATCATTGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGCTC-AT----TGTGATGCAGTTTCTAAGAGTCAAGTTGTTTGGGAATGCAGCTTCAAGTGGGTGGT{AT}AATTCCATCTAAGGCTAAATATAGGTGAGAGACC{AG}ATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGTGTGAAATTGCTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-GTATTAGTTCAGCCTTATCAT-----CAAGGTGTATTCTAATTA-TTAACAGACCAGCATCAACTTTTGAGTATTGGATAAGGA-CTCAAGTAAATGTGGCAG----TCTTTGACTGTGTTA---TA--G-T-CT----TGAGAGTTTGA--TACAATGC-TTAAGGTTGAGGA-----AT{GT}CAGTAAGCACTTGATGTGTGGGAATGGTCTTGTATAA-{AG}GA---T-{AC}TTTTC-TACTTACTGAGGAT-GCTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGTTTTGAAACCCTTATGCATAATGAAAGTAAATGCAAGTGGGATC-----T--------------{AG}T---------TA----------------------CTAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCAGTTCTGACGTGCAAATC{AG}ATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCTGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCAAATGATTAGAGGCCTTGGGGGGTTTATAAATGTAGTAGGTGTAATAAGTCTATGATTTAGGGACGTAAGTGCAGAAGGGGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCATCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCAGGAGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATAGGGATAGGGAGTCATGCCTGATCGGTTTTATAGTAACTCTAGCACTGGCAGTTACTTTCACAGGGTTTCAAGCACTAGAGTATATTGATGCACCCTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACCCTTTTTATAACAGTAGCACTAGCTCGAATGATGAGTTACCAACTAACAGATCATC-- Puccinia_ludwigii CTAACAAGGATTCCCCTAGTCATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT---T----TTGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGGCTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCC--CTA---------G-GGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_magnusiana CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGGGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCCTTTTCTT---AAGGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CCA---TAAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCAC------TTTATT----GTGTGGGACAA-ATTA----ATGTTC-TTCTTACTGAGGATAGTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGAAC-----T--------------GT---------AA----------------------AAGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_malvacearum CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTT------AAAGGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAACGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCTGTTAT-----------GGGTGGAACAA-ATT---A-TTGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG--TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------TA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAAGGGGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCAATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCTGGAGTAGAACCGCTGAATGCATTTGAGATCCCTCTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCAGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATTGAAGCGCCCTTTACTCTTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGAACCCTTTTCCTAACAGTAGCACTAGCTCGAATTATTAGTTACCAGCTAACAGATCATC-- Puccinia_melanocephala CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAGTCCCGTTTATGATATGGA------CTCCC-AGTGC-AA----TATGTTACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTT-----AAAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-CTTAAGGAAATGTGGCAG----TCTCTGACTGTGTTA---TA--G-A-CC----TGAG-CTTTGA--TACAATGC-CTAAGATTGAGGA-----AGGCAGTAAGCGCCAC-TTGTG-------GTGTGGGACTA-ATT-A---TAGTCC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_menthae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTACATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTG-TTATTAGTTCAACCTTTT--------CAGGGTGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCA--TTT--------TT-TGGTGGAACAA-ATCA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGACC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_muehlenbeckiae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTT-------AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGTGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-ATAAGATTGAGGA-----ATGCAGTAAGCC------------TTTT-GGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTTGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCAAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCAGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGGATTATGAGTTACCAACTAACAGATCACC-- Puccinia_myrsiphylli CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTC------AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACT------TTATT----GTGTGGGACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGCTTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTCATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG---TTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAAGGGGCGCTAGGAGGGTATCATACGTTTGATGTACAACGTTCTCTAAATATAGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCTATTTTTTGAGCTTACTTTCATTCAGCTCTGAGTCCTAC{AG}GTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAGGCTCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGCT------------------------------------------------------- Puccinia_nakanishikii CTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGACAAGCCCAAATTTGTAATCTGGCT---CTTTT---------AGAGTCTGAGTTGTAATTTTGAGAGCTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AC----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTT-------AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-CTTAAGGAAATGTAGCAG----TTTCTGACTGTGTTA---TA--G-A-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCCAC-TTGTG-------GTGTGGGATTA-ACT-A---TAGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGA-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_operculinae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGCATGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTCT------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGGTTTTAAGGAAATGTAGCAG----TCTTTGACTGTGTTA---TA--G-TCC-C---TAAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----------TTTTA-AGGTGGAACAT-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC{AG}AAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_paululla CTAACAAGGATTCCCTTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGAGT---CTTTC---------AGAGTCAGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATACAAGTCTGTTGAAAAGCAGCATCATGGAGGGTGATAATCCTGTTTATGATATGGA------CTACCAAGTGC-TT----TATGATACAGTTTCTAAGAGTCAAGTTGTTTGGGAATGCAGCTTAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTATGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTGTTAGTTCAACTTG---------AAAGGGTGTATTCTAACCA-TTAACAGACCAACATCAGTTTTTGAGTGTTGGAGAAGGG-CTGATGTAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-TA----TTGG-CTTTGATTTACAATGC-TTAAGACTGAGGA-----ATGCAGTAAGCTACTTTATTGT-------GGTTGAAACAA-ATT---C-ATGTTT-TTCTTACTGAAGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTGATGCATAATGAAAGTAAATGTAAATGGGAAC-----T--------------TT---------TTTTTTTTTTTTATTGG-------AAAGTGCACCATTGACCAGTCCTGATTATTTATATGATGGTACTGAGTAAGAGCAAATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCAGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCAAAGTTTCCCTCAGGATAGCAAAGACTCAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGGGCGCTAGGAGGGTATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCTGCACCGGGAGTAGAACCTCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTATAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCACTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCATGTGATTATCGGAACCCTTTTTATAACAGTAGCACTAGCTCGAATTATTAGTTACCAACTAACAGATCATC-- Puccinia_pelargoni_zonalis CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTT---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCTGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTAC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTGTTAGTTCAACCTTTT--CT----AAAGGAGTATTCTAACGA-TTAACAGACCAATATCAATTTTTGGGTGTTGGATAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CTC---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCT--TTT---------A-AGGTGGAACAT-ATTG----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_polysora CTAACAAGGATTCCCTTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTAACT---CCTTT-----AACAAGAGTTAGAGTTGTAATTTTGAGAACTGTTTTCTGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAAGGTGATAATCCTGTTTATGACATGGGTGTTCTCTACC-AGTGC-TT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTATTTATTAGTTCAACCTTTTTCTTT--AAAGGGTGTACTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAAGGAATGTAGCAGCCATTTTATGACTGTGTTT---TATAGAC-TT----TGAA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_pritzeliana CTAACAAGGATTCCCCCAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTT---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACCTGTTA-TTATTAGTTCAACCCTTTT------ATGGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGGCTGTGTTA---TA--G-T-CC----TGAA-CTTTGA--TACAATGC-TTAGGATTGAGGT-----ATGCAGTAAGCCTTCTTTTTTTT{GT}GGGGGAGGTGGAGCAA-ATT---AATTGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGA-TAAAAACCCTTATGCACAATGAAAGTAAATGTAAATGGGATA-----C--------------CC---------CG-------------TTAAAAAAAGGGTTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTTGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGACGTAAGTGCAGAAGGGGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGGGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGAGTAGAACCGCTGAATGCCTTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCAGTAACCTTCACAGGGTTTCAAGCACTAGAGTATATTGAAGCACCCTTTACCATTTCAGATGGGGCATTCGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGAACCATTTTTATAACAGTAGCACTAGCTCGAATTATTAGTTATCAA{CG}TAACAGATCATC-- Puccinia_psidii CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTT---------AGAGTCCGAGTTGTAATTTGAAGAGCTGTTTTCTGTGCTACCCCATTTATAAGTCTGTTGGAAAACAGCATCATTGAGGGTGATAATCCCGTTTATGGAATGGA------TAAGT-AGTAC-TA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACATTTGAAGTTAGACTTGTTA-TTGTTAGTTCAACTTTTTT-------AAAGGTGTATTCTAATGA-TTAACAGACCAACATCAATCTTTGAATGTTGGAGAA-GG-TTTTTGGAGATGTTACAG-----TTTAGGCTGTGTTA---TA--A-T-CC----TTAA-ATTTGA--TACAATGT-TTAAGATTGAGGA-----TCGCAATAAGCCATTTATT----------TGGTAAAACAA-ATT---A-ATGTTT-TTCTTATTGAGGAT-GTTGGTATAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG--TTAAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------AA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCAGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAGACTCAC----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGGTTTAGGGATGTAAGTGCCGAAGGGGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCATATTTTCATTCAGCTCTAAGTCCAACGGTAGAACTAGGATCTCAATGGCCAGCACCGGGAGTAGAACCGCTGAATGCATTCGAGATTCCACTTCTAAATACAATCCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAGAAGGAAATCATGCCTGATAGGTTTTCTAGTAACTCTAGCGCTGGCAGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCATTTACAATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTAATAATTGGAACCCTTTTCCTAACAGTAGCACTAGCTCGAATTATTAGTTACCAACTAACAGATCATC-- Puccinia_purpurea CTAACCAGGATTCCCTTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTCA---------GGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTGTGATATGGA-----GCTACC-AGTGC-AA----TATGATACAGATTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGGGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTCTTT------AAGGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTCTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACTGTAAAAAA-------GTGTGGGACCA-ACT-A---AGGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGATGA-TTGAAATCCTGATGCGTAATGAAAGTGAATGTAAATGGGAAC-----CTGG---------TAAA---------AA----------------------AGGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_rhagodiae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCTGTTTATGATATGGA------CTACC-AGTGC-AC----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATCAGTTCAACCTTTTTTTTTT-AAGAGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACAC----ATATGT----GTGTGGAACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGGAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_rhaphidophorae CTAACAAGGATTCCCTTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGAGT---CTTTC---------AGAGTCAGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATACAAGTCTGTTGAAAAGCAGCATCATGGAGGGTGATAATCCTGTTTATGATATGGA------CTACCAAGTGC-TT----TATGATACAGTTTCTAAGAGTCAAGTTGTTTGGGAATGCAGCTTAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTATGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTGTTAGTTCAAC----TTG-----AAAGGGTGTATTCTAACCA-TTAACAGACCAACATCAGTTTTTGAGTGTTGGAGAAGGG-CTGATGTAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-TA----TTGG-CTTTGATTTACAATGC-TTAAGACTGAGGA-----ATGCAGTAAGCTACTTTATTGT-------GGTTGAAACAA-ATT-C---ATGTTT-TTCTTACTGAAGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGT{CT}TAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTGATGCATAATGAAAGTAAATGTAAATGGGAAC-----TTTTTTTTTTTTTTATT---------GG----------------------AAAGTGCACCATTGACCAGTCCTGATTATTTATATGATGGTACTGAGTAAGAGCAAATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTTGTAGCAGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_saccardoi CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC-----TTATTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_scleriae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AG----TATGATACAGCCTCTAAGAGTCAAGTTGTTTGGGAATGCAGCTCCAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTCATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTATGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TCATTAGTTCAACCTTTTCT------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C--TTGAG-CTTTGA--TACAATGC-TCAAGATTGAGGG-----ATGCAGTAAGCC----------TTTTTG-AGGTGGGACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCACAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------TC-----------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACG{CT}TCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGTTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGCGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGAATTATGAGTTACCAATTAACAGATCATC-- Puccinia_sparganioidis CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTCATGATATGGA------CCCCC-AGTAT-GT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGTAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTG-TCATTAGCTCAGCCTCTTA------TAGGGGTGTATTCTAATGATTTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCCCTGACTGTGTTA---TA--G-T-CCT---AGAA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC-----CTTT--------GGGTGGGACCA-ATT-A---TGGTCT-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGA-TTGAAACCCTTATGCGGAATGAAAGTAAATGTAAATGAGAAC-----CTCT-----------TC---------TG----------------------GGGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_striiformis CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTCT-----AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_stylidii CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGAATTGTTA-TTGTTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC--TTTTTTTTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_tetragoniae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGATAAGCCCAAATTTGTAATCTGGCT---CTCTT-------TGAGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGCAAT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTCTTG--AAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTTTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCAGC---{CT}CTGCT----GTGTGGAACTA-ATTA----AAGTTC-TTCTTACTGAGGAT-GATGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTATAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCACGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATCTCAGATGGGGCATTTGGTAGTACTTTTTTTTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGGACAATTTTTATAAC---------------------------------------------- Puccinia_unica CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTAAAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTC-----AAAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTCTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTTTGGCTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TGCAAGGC-TTAAGATTGAGGA-----AGGCAGTAAGCACTT--TATT--------GTGTGGAACCC-ATT---A-TGGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCAAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAAGGGGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTTAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCTGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATCCCACTTCTAAATACAATTCTGCTTCTTACATCAGCTAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATCGGTTTTATAGTAACTCTAGCACTGGCAGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATTGAGGCACCCTTCACAATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACCCTTTTTCTAACAGTAGCACTAGCTCGAATTATTAGTTACCAACTAACAGATCATC-- Puccinia_ursiniae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTA---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTTCTGAAAAGAAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTAATAGTTCAACCTTTTTCTTC---AAAGGAGTATTCTATTGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TTTTTGACTGTGTTA---TA--T-T-C-CTTTTGAG-CTTTGA--TACAATGC-CTAAGATTGAGGA-----ATGCAGTAAGCC-----------CATTT-GGGTAGGATAA-ATTA----ATATTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGATTTGAAACCCTTATGCATAATGAAAGTGAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCTAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCAGCACAGGGGGTAGAACCTCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACC--------------------------------------------------------- Puccinia_xanthii CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTG-TTGTTAGTTCAACCTTTT--TT----AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTGAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CCT---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCCT--TTT------TTAA-AGGTGGAACAA-ATTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-ATTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puccinia_xanthosiae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGAGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC-------TTTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGC{AG}AATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sphaerophragmium_acaciae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGTCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCTGTGCTGTTCCATCTATAAGTCTGTTGAAAAGCAGCATCATGGAGGGTGATAATCCCGTATATGAGATGGA-----TTTAAC-AGTGC-TC----TATGATACAGTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACATTTGAAGTTAGACTTGTTA-TTGTTAGTTCAACTCTTTT-------TAGGGTGTATTCTAATA--TTAACAGACCAACATCAATTTTTGAATATTGGA-AAAGG-TTCATGGAAATGTAGCAG-----TCTAGGCTGTGTTA---TA--G-T-CC----AAGA-AATTGA--TACAATGT-TTAAGATTGAGGA-----TCACAGTAAGCCTTA--------------TGGTGGAGCAA-ATT---A-TTGCTC-TTCTTACTGAGGAT-GTTGGTATAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGA--TGAAACCCTGATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGACGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCAGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAGACTCAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGACGTAAGTGCCGAGGGTGCGCTAGGAGGGCATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTCTTTGTGTCAATTTTTTGAGCTTATTTTCATTCAGCTCTAAGTCCTACGGTAGAGCTAGGATCTCAATGGCCAGCACCGGGGGTAGAGCCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATCCTGCTTCTAACCTCAGCGAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAGTAGGAAATCATGCCTGATAGGTTTTCTAGTAACTCTGGCACTGGCAGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATTGAAGCACCATTTACAATTTCAGATGGGGCATTTGGTAGTACCTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTAATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTCGGATTATTAGTTACCAACTAACAGATCA---- Uromyces_appendiculatis CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAATTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTAATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGAGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTGTCAGTTCAACCTTTTTTTTA---AAGGGAGTATTCTGATGA-TTAACAGACCAACATCAACTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGATTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGGTTGAGGA-----TTGCAGTAAGCC-----TCTTTTTTTTG-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGAGAACTCT--T--------------TT---------T------------------------GAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGCTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATTGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCGACGGTAGAGCTAGGGTCTCAATGGCCTGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTATAACAGTAGCACTAGCTCGAATTATGAGTTACCAACTAACAGATCATC-- Uromyces_appendiculatis_crassitunicatus CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAATTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGAGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT---T----TAGGGAGTATTCTAATGA-TTAACAGACCAACATCAACTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGATTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGGTTGAGGA-----TTGCAGTAAGCCT--TCA-----------AGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGAGAAC-TC--T--------------TT---------T------------------------GAGTGCACCATTGACCAGTCCAGATTATTTATATGACGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_bidenticola CTAACAAGGATTCCCCCAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAATTGTAATTTTAAGAACTGTTTTCATTTCTGGACCATGCATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGGGA-AA----TACGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATTGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TT{AG}TTAGTTCAGCCTTGTAAT-----TGAGGTGTATTCTGACTT-TTAACAGACCAACATCAGTTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCT{AT}TGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-CTAAGATTGAGGA-----ATGCAGTAAGCCT--TTA---------T-TGGTGGAACAC-TCTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGAAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-ATTGAAACCCTTATGCAGAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_geranii CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAAATTGTAATCTGGCT---CTTTC---------AGAGTCAGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTAATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGCTCAACCTTTT--CT----AAGGGTGTATTCTAATGA-TTAACAGACCAACATCAGTTTTTGGGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAGTGC-TTAAGATTGAGGA-----ATGCAGTAAGCCT--TTA---------T-TGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_lomandracearum CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTATTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATATAGTCTCCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTAAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTCTTA----AAGGGAGTATTCTAATGA-TTAACAGACCAGCATCAATTTTTGAGTGTTGGAGAAGGG-TTCAAGGAAAAGTAGCTG----TCTTTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAAATTGAGGA-----AGGCAGTAAGCACAAC----TTGTT----GTGTGGGACAA-ATCA----TTGTTCTTTTTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTTCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTTGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGGTATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCAATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTA----------------------------------------------------------------------------------------------- Uromyces_orientalis CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGGGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTT-----GAGGGAGTATTCTAATAA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C--ATGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCC-------CTTTTTTAA-GGGTGGAACAG-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC--T--T--------------TT---------G------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGTTTTATAAGTGTGGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCGACGGTAGAGCTAGGGTCTCAATGGCCTGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTCTAACAGTAGCACTAGCTAGAATTATGAGTTACCAACTAACAGATCATC-- Uromyces_pisi_sativi CTAACAAGGATTCCCCTAGTCATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGACT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATCAGTTCAACCTTTTTTTA----AAGGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCCC--TTT-----TATTA-GGGTAGGACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC{AG}AAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_salsolae CTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-AT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGAGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTTTTA-AAAGGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCACT------TTATT----GTGTGGAACTA-ATCA----CAGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----A--------------AT---------CA----------------------AATGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTCGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGGGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTTACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTCTAACAGTAGCACTATCTCGAATTATAAGTTACCAA{CT}TAACAGATCATC-- Uromyces_scaevolae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTC--------AAAGGAGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGATAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGCAAGCC--TTTTTTTTTTTTTA-AGGTGGAACAA-ATTA----TTGTTC-TTCTTGCTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGATC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTCTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAATGGCCGGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATAAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_setariae_italicae CTAACAAGGATTCCCCTATAAACGGCAGGTGAAAGGGGAAAAGCCCAAATTTGTAATCTAACT---CCTTC----AACCAAGAGTTAGAGTTGTAATTTTGAGAGCTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTGC-CC----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTA{CT}GTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTCTTTTTTGTTAAGGGGAGTATTCTAATGA-TTAACAGACCGACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGGAATGTAGCAGCCATTTTATGACTGTGTTA---TA--GAC-TT----TGAA-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAACCAAATTCATTTT------TGGAGGGATAA-ATTATTA-TCCTTT-CTTTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGATTTGAAACCCTTATGCGTAATGAAAGTAAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCTTGATTATTTATATGAAGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATTGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTCATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGAGATGTAAGTGCAGAAGGGGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGAGTAGTACTATTTATTGTAAGCGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGAGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCAGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATTGAAGCACCCTTTACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGCACAGGTTTTCATGGGATTCACGTCATTATCGGAACCCTTTTCCTAACAGTAGCACTAGCTCGAATTATTAGTTACCAACTAACAGATCATC-- Uromyces_striatus_Medicago CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGACT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATCAGTTCACCCCTT-----------AGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTGGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCCC--TGT-----GAAAA-GGGAGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC--T--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_tenuicutis CTAACCAGGATTCCCTTAGTAACGGCGAGTGAAGAGGGAAAAGCCCAAATTTGTAATCAGGCT---CTTTC---------AGAGTCTGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATTGAGGGTGATAATCCCGTTTATGATATGGA------CTACC-AGTAT-GT----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATAGGTGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTGCGTGAAATTGTTAAAAGGGAAACACTTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTCTA-----AAGGGGGTATTCTAATGA-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTCAAGGAAAAGTAGCAG----TCTCTGGCTGTGTTA---TA--A-T-CC----TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----AGGCAGTAAGCGCATT----TTTGT----GTGTGGAACAA-ACTA----ATGTTC-TTCTTACTGAGGAT-GTTGGTGTAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGC-TTGAAACCCTTATGCGTAATGAAAGTGAATGTAAATGGGATC-----T--------------GT---------CA----------------------AAAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGTGTAATAAGTCTATGATTTAGGGATGTAAGTGCAGAGGGAGCGCTAGGAGGATATCATACGTTTGATGTACAACGTTCTCTAAATATAGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCTACGGTAGAACTAGGGTCTCAATGGCCAGCACCGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACAATTCTGCTTCTAACATCAGCAAGTTCACTGACCTATGCACATCATGCTCTAATTAATGGGAATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTGGCACTAGCGGTAACTTTCACAGGGTTTCAGGCACTAGAGTATATAGAAGCCCCTTTCACCATTTCAGATGGGGCATTTGGTAGTACTTTTTTCTTTAGTACAGGTTTTCATGGGATTCACGTCATTATCGGGACGATTTTTATAACAGTAGCACTAGCTCGAATTATAAGTTACCAACTAACAGATCATC-- Uromyces_trifoli CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTA-----AAGGGAGTATTCTAATGG-TTAACAGACCAACATCAATTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCC---------CTTTTTT-GGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGTTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGATGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCGACGGTAGAGCTAGGATCTCAATGGCCTGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCGAGCTCACTGACCTATGCACATCATGCCCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCGTAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACCATTTTTATAACAGTGGCACTAGCTCGAATTATGAGTTACCA---------------- Uromyces_viciae_fabae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAGTTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACT-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATCAGTTCAACCTTTTC-------AAGGGAGTATTCTGATGA-TTAACAGACCAACATCAATTTTTGGGTGTTGGAGAAGGG-TTCAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGGG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----TTGCAGTAAGCCC--ATT-----TTTTT-GGGTGGAACTA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAACTTT--T--------------TT---------T------------------------AAGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTAT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_vignae CTAACAAGGATTCCCCTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCTGGCT---CTTTC---------AGAGTCCGAATTGTAATTTTGAGAACTGTTTTCAGTGCTGGACCATATATAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGAGGGTGGTAAATTCCATCTAAGGCTAAATATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTT---T----TAGGGAGTATTCTAATGA-TTAACAGACCAACATCAACTTTTGAGTGTTGGAGAAGGG-CTTAAGGAAATGTAGCAG----TCTCTGATTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TATAATGC-TTAAGGTTGAGGA-----TTGCAGTAAGCCT--TTA-----------AGGTGGAACAA-ATTA----TTGTTC-TTCTTACTGAGGAT-GTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTG-TTTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGAGAAC-TC--T--------------TT---------T------------------------GAGTGCACCATTGACCAGTCCAGATTATTTATATGACGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Uromyces_wedeliae CTAACAAGGATTCCCTTAGTAATGGCGAATGAAGAGGGAAAAGCCCAAATTTGTAATCAGGTTTTCTTTTT---------GAAATCTGAGTTGTAATTTTAAGAACTGTTTTCAGTGCTGGACCATGTACAAGTCTGTTGAAAAGCAGCATCATAGAAGGTGATAATCCTGTTCATGATATGGA------CTACC-AGTGC-AA----TATGATACAGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAGGCTAAACATTGATGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTAAAAGGGAAACAATTGAAGTTAGACTTGTTA-TTATTAGTTCAACCTTTTTTTTT--AAAGGGAGTATTCTAATGG-TTAACAGACCAAGATCAGTTTTTGAGTGTTGGAGAAGGG-TTTAAGGAAATGTAGCAG----TCTCTGACTGTGTTA---TA--G-T-C-C---TGAG-CTTTGA--TACAATGC-TTAAGATTGAGGA-----ATGCAGTAAGCC----GAATATTTTGTT-TGGTGGAACTA-AATG----AAGTTC-TTCTTACTGAGGAT-TTTGGTGCAATAGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTTTGCAAGTATTTGGGTG-ATTGAAACCCTTATGCATAATGAAAGTAAATGTAAATGGGAAC-TT--T--------------TTATTTTTTGGG------------------------AGGTGCACCATTGACCAGTCCAGATTATTTATATGATGGTACTGAGTAAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAAAGACTTGT----ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGGGTTTATAAGTGTAGTAGGAGTAATAAGTCTATGATTTAGGGACGTAAGTGCGGAGGGTGCGCTAGGGGGGTATCATACGTTTGATGTACAACGTTCACTAAATATGGGGGTAGTACTATTTATTGTAAGTGAGATCTTTTTTTTTGTATCCATTTTTTGAGCTTACTTTCATTCAGCTCTAAGTCCAACGGTAGAGCTAGGGTCTCAGTGGCCTGCACAGGGGGTAGAACCGCTGAATGCATTTGAGATTCCACTTCTAAATACCGTTCTGCTTCTAACATCAGCAAGCTCACTGACCTATGCACATCACGCCCTAATTAATGGGGATAGGAAGTCATGCCTGATTGGTTTTATAGTAACTCTAGCACTGGCCATAACTTTCACAGGGTTTCAAGCACTAGAGTATATAGAAGCACCCTTTACCATTTCAGATGGGGTATTTGGTAGTACTTTTTACTTTAGTACAGGTTTTCATGGGATTCACGTCATTATTGGAACAATTTTTATAACAGTAGCACTAGCTCGAATTATGAGTTACCAACTAACAGATCA---- ; END; BEGIN TREES; TITLE Pucciniaceae_28S_CO3_SIM; LINK TAXA = Taxa1; TRANSLATE 1 Aecidium_nymphoidis, 2 Ceratocoma_jacksoniae, 3 Puccinia_convolvuli, 4 Puccinia_menthae, 5 Puccinia_chrysanthemi, 6 Puccinia_striiformis, 7 Puccinia_magnusiana, 8 Puccinia_melanocephala, 9 Puccinia_nakanishikii, 10 Puccinia_sparganioidis, 11 Puccinia_polysora, 12 Puccinia_horiana, 13 Puccinia_acroptili, 14 Miyagia_pseudosphaeria, 15 Puccinia_abrupta, 16 Puccinia_arthrocnemi, 17 Puccinia_aucta, 18 Puccinia_bassiae, 19 Puccinia_boroniae, 20 Puccinia_brachypodii, 21 Puccinia_canaliculata, 22 Puccinia_carduorum, 23 Puccinia_caricina, 24 Puccinia_carissae, 25 Puccinia_cnici, 26 Puccinia_cynodontis, 27 Puccinia_dampierae, 28 Puccinia_dichondrae, 29 Puccinia_duthiae, 30 Puccinia_flavascentis, 31 Puccinia_gastrolobii, 32 Puccinia_gilgiana, 33 Puccinia_gnaphaliicola, 34 Puccinia_graminis, 35 Puccinia_grevillieae, 36 Puccinia_haemodori, 37 Puccinia_hemerocallidis, 38 Puccinia_heterospora, 39 Puccinia_hypochaeridis, 40 Puccinia_iridis, 41 Puccinia_kuehnii, 42 Puccinia_lagenophorae, 43 Puccinia_levis_trichloaene, 44 Puccinia_liberta, 45 Puccinia_loranthicola, 46 Puccinia_ludwigii, 47 Puccinia_malvacearum, 48 Puccinia_muehlenbeckiae, 49 Puccinia_myrsiphylli, 50 Puccinia_paululla, 51 Puccinia_pelargoni_zonalis, 52 Puccinia_pritzeliana, 53 Puccinia_psidii, 54 Puccinia_purpurea, 55 Puccinia_rhaphidophorae, 56 Puccinia_saccardoi, 57 Puccinia_scleriae, 58 Puccinia_stylidii, 59 Puccinia_tetragoniae, 60 Puccinia_unica, 61 Puccinia_ursiniae, 62 Puccinia_xanthii, 63 Puccinia_xanthosiae, 64 Sphaerophragmium_acaciae, 65 Puccinia_geitonoplesii, 66 Puccinia_operculinae, 67 Puccinia_rhagodiae, 68 Uromyces_appendiculatis_crassitunicatus, 69 Uromyces_appendiculatis, 70 Uromyces_bidenticola, 71 Uromyces_geranii, 72 Uromyces_lomandracearum, 73 Uromyces_orientalis, 74 Uromyces_pisi_sativi, 75 Uromyces_salsolae, 76 Uromyces_scaevolae, 77 Uromyces_setariae_italicae, 78 Uromyces_striatus_Medicago, 79 Uromyces_tenuicutis, 80 Uromyces_trifoli, 81 Uromyces_viciae_fabae, 82 Uromyces_vignae, 83 Uromyces_wedeliae; TREE 'PAUP_1' = [&R] (64:0.0275185,(53:0.060137,((45:0.123512,(50:0.002499,55:0.00357):0.065819):0.019768,((52:0.052615,(41:0.058768,(11:0.035692,77:0.029596):0.021214):0.017649):2.28785E-7,((47:0.020962,(7:0.027318,(((8:0.015045,9:0.01481):0.017818,(60:0.018924,(29:0.009152,54:0.049511):0.018151):0.003997):0.007567,(((20:0.005452,28:0.020742):0.002332,(34:0.00383,49:0.012572):0.003601):0.001199,(((16:0.030869,17:0.026794):0.005471,(30:0.016827,(2:0.028021,(79:0.024295,(19:0.011749,72:0.023986):0.001001):0.0):3.60014E-7):0.003499):0.002469,((18:0.010798,67:0.010098):0.01558,((12:0.007959,26:0.008596):0.008195,(59:0.018764,(6:0.005019,75:0.015151):1.15374E-7):0.002285):0.002365):1.46493E-7):0.004337):0.01633):3.34154E-7):0.010866):1.39172E-7,((38:0.043021,(43:0.059652,(10:0.016791,24:0.023503):0.006282):0.021198):0.021721,(35:0.042859,(70:0.068383,((4:0.012313,(31:0.013985,(15:0.009377,71:0.009645):0.002398):0.004988):0.004915,(((40:0.01318,(37:0.002026,65:0.001104):0.010836):0.008764,(62:0.011095,((51:0.019623,(44:0.006067,(21:0.002854,66:0.005812):0.001797):0.00112):0.006419,((1:0.008367,57:0.012833):0.005289,(23:0.007693,((32:0.0,(42:0.001151,56:0.0):0.0):0.001156,(36:0.0,(63:0.001167,(58:0.003414,(27:0.001068,76:0.0):0.0):0.0):0.0):0.0):0.003396):0.001207):0.0):0.0):0.007582):0.003649,(((3:0.017382,(73:0.01336,83:0.044737):0.001206):0.003384,(80:0.005456,((69:0.006438,(68:0.001115,82:0.003561):0.011059):0.014261,(81:0.012423,(74:0.006777,78:0.018197):0.005274):7.31056E-8):0.003704):0.0):0.007498,(((33:0.01141,46:0.009337):0.004469,(48:0.010794,(5:0.021885,61:0.008271):0.020402):2.63E-4):0.001477,(25:0.022176,((13:0.00596,22:0.003527):0.003728,(14:0.006444,39:0.048866):0.008361):0.010169):0.001582):7.31058E-8):1.34018E-7):6.47337E-7):0.004248):0.039572):0.004288):0.008967):2.93625E-7):0.004546):0.05938):0.0275185); END;