#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:20 GMT TreeBASE (cc) 1994-2008 Study reference: Valenzuela-lopez N., Cano-lira J.F., Guarro J., Sutton D., Wiederhold N.P., Crous P.W., & Stchigel A.M. 2018. Coelomycetous Dothideomycetes with emphasis on the families Cucurbitariaceae and Didymellaceae. Studies in Mycology, 90: 1-69. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21115] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=358; TAXLABELS 'Allocucurbitaria botulispora CBS_142453T' 'Allophoma coffeae arabicae_CBS_497.91' 'Allophoma cylindrispora CBS_142453T' 'Allophoma labilis CBS_124.93' 'Allophoma minor CBS_325.82T' 'Allophoma nicaraguensis CBS_506.91T' 'Allophoma oligotrophica CGMCC_3_18114T' 'Allophoma piperis CBS_268.93T' 'Allophoma tropica CBS_436.75T' 'Allophoma zantedeschiae CBS_131.93' 'Allophoma zantedeschiae CBS_229.32' 'Alternariaster bidentis CBS_134021' 'Alternariaster helianthi CBS_327.69' 'Ascochyta herbicola CBS_629.97' 'Ascochyta pisi CBS_126.54' 'Ascochyta rabiei CBS_206.30' 'Ascochyta versabilis CBS_876.97' 'Ascochyta viciae CBS_451.68' 'Boeremia exigua CBS_118.38' 'Boeremia exigua CBS_119.38' 'Boeremia lycopersici CBS_378.67' 'Briansuttonomyces eucalypti CBS_114879T' 'Briansuttonomyces eucalypti CBS_114887' 'Calophoma aquilegiicola CBS_107.96' 'Calophoma aquilegiicola CBS_108_96' 'Calophoma clematidina CBS_102.66' 'Calophoma clematidina CBS_108.79T' 'Calophoma clematidis rectae_CBS_507.63' 'Calophoma rosae CGMCC_3_18347T' 'Calophoma rosae LC_8119' 'Camarosporium aborescentis MFLUCC_14_0604' 'Camarosporium arezzoensis MFLUCC_140238' 'Camarosporium aureum MFLUCC_14_0620' 'Camarosporium clematidis MFLUCC_13_0336' 'Camarosporium quaternatum CPC_23216' 'Camarosporium quaternatum CPC_31081T' 'Camarosporium quaternatum CPC_31518' 'Camarosporium robiniicola MFLUCC_13_0527' 'Camarosporium spartii MFLUCC_13_0548' 'Camarosporomyces flavigenus CBS_314.80' 'Coniothyrium carteri CBS_105.91' 'Coniothyrium palmarum CBS_400.71' 'Coniothyrium palmarum CBS_758.73' 'Coniothyrium telephii CBS_188.71' 'Coniothyrium telephii CBS_856.97' 'Cucurbitaria berberidis CBS_130007T' 'Cucurbitaria berberidis MFLUCC_11_0387' 'Cucurbitaria elongata AFTOL_ID_1568' 'Cucurbitaria elongata MFLUCC_14_0260' 'Cumuliphoma indica CBS_654.77' 'Cumuliphoma indica CBS_991.95' 'Cumuliphoma omnivirens CBS_341.86T' 'Cumuliphoma pneumoniae CBS_142454' 'Curreya pityophila CBS_149.32' 'Didymella aeria CGMCC_3_18353T' 'Didymella aeria LC_8120' 'Didymella aliena CBS_379.93' 'Didymella americana CBS_185.85' 'Didymella anserina CBS_253.80' 'Didymella anserina UTHSC_DI16_255' 'Didymella aquatica CGMCC_3_18349T' 'Didymella aquatica LC_5555' 'Didymella arachidicola CBS_333.75' 'Didymella aurea CBS_269.93T' 'Didymella bellidis CBS_714.85' 'Didymella boeremae CBS_109942T' 'Didymella brunneospora CBS_115.58' 'Didymella chenopodii CBS_128.93' 'Didymella chloroguttulata CGMCC_3_18351T' 'Didymella chloroguttulata LC_8122' 'Didymella coffeae arabicae_CBS_123380T' 'Didymella curtisii PD_92_1460' 'Didymella ellipsoidea CGMCC_3_18350T' 'Didymella ellipsoidea LC_8123' 'Didymella eucalyptica CBS_377.91' 'Didymella exigua CBS_183.55T' 'Didymella gardeniae CBS_626.68T' 'Didymella gardeniae UTHSC_DI16_211' 'Didymella gardeniae UTHSC_DI16_226' 'Didymella gardeniae UTHSC_DI16_274' 'Didymella gardeniae UTHSC_DI16_295' 'Didymella glomerata CBS_528.66' 'Didymella glomerata UTHSC_DI16_205' 'Didymella heteroderae CBS_109.92T' 'Didymella heteroderae UTHSC_DI16_190' 'Didymella heteroderae UTHSC_DI16_224' 'Didymella heteroderae UTHSC_DI16_227' 'Didymella heteroderae UTHSC_DI16_231' 'Didymella heteroderae UTHSC_DI16_232' 'Didymella heteroderae UTHSC_DI16_234' 'Didymella heteroderae UTHSC_DI16_235' 'Didymella heteroderae UTHSC_DI16_305' 'Didymella ilicicola CGMCC_3_18355T' 'Didymella ilicicola LC_8127' 'Didymella infuscatispora CGMCC_3_18356T' 'Didymella infuscatispora LC_8129' 'Didymella keratinophila UTHSC_DI16_200T' 'Didymella keratinophila UTHSC_DI16_228' 'Didymella keratinophila UTHSC_DI16_282' 'Didymella lethalis CBS_103.25' 'Didymella macrophylla CGMCC_3_18357T' 'Didymella macrophylla LC_8132' 'Didymella macrostoma CBS_223.69' 'Didymella maydis CBS_588.69T' 'Didymella microchlamydospora CBS_105.95T' 'Didymella microchlamydospora UTHSC_DI16_199' 'Didymella microchlamydospora UTHSC_DI16_365' 'Didymella molleriana CBS_229.79' 'Didymella musae CBS_463.69' 'Didymella musae UTHSC_DI16_230' 'Didymella negriana CBS_358.71' 'Didymella negriana ICMP_10845' 'Didymella nigricans PD_77_919' 'Didymella ocimicola CGMCC_3_18358T' 'Didymella ocimicola LC_8138' 'Didymella pedeiae CBS_124517T' 'Didymella pinodella CBS_531.66' 'Didymella pinodes CBS_374.84' 'Didymella pinodes CBS_525.77T' 'Didymella pomorum CBS_285.76' 'Didymella protuberans CBS_381.96T' 'Didymella protuberans FMR_13795' 'Didymella protuberans UTHSC_DI16_302' 'Didymella pteridis CBS_379.96T' 'Didymella rhei CBS_109177' 'Didymella rumicicola CBS_179.97' 'Didymella rumicicola CBS_683.79T' 'Didymella sancta CBS_281.83T' 'Didymella sancta CBS_644.97' 'Didymella segeticola CGMCC_3_17489T' 'Didymella segeticola CGMCC_3_17498' 'Didymella segeticola LC_8141' 'Didymella sinensis LC_8142' 'Didymella sinensis LC_8143' 'Didymella subglomerata CBS_110.92' 'Didymella suiyangensis CGMCC_3_18352T' 'Didymella suiyangensis LC_8144' 'Didymella viburnicola CBS_523.73' 'Dothidotthia aspera CPC_12932' 'Dothidotthia symphoricarpi CPC_12929' 'Ectophoma multirostrata CBS_110.79' 'Ectophoma multirostrata CBS_274.60T' 'Ectophoma multirostrata CBS_368.65' 'Ectophoma pereupyrena CBS_267.92T' 'Epicoccum brasiliense CBS_120105T' 'Epicoccum camelliae CGMCC_3_18343T' 'Epicoccum camelliae LC_4862' 'Epicoccum camelliae UTHSC_DI16_201' 'Epicoccum camelliae UTHSC_DI16_202' 'Epicoccum camelliae UTHSC_DI16_206' 'Epicoccum camelliae UTHSC_DI16_280' 'Epicoccum camelliae UTHSC_DI16_338' 'Epicoccum camelliae UTHSC_DI16_345' 'Epicoccum catenisporum CBS_181.80T' 'Epicoccum dendrobii CGMCC_3_18359T' 'Epicoccum dendrobii LC_8146' 'Epicoccum draconis CBS_186.83' 'Epicoccum duchesneae CGMCC_3_18345T' 'Epicoccum duchesneae LC_8147' 'Epicoccum henningsii CBS_104.80' 'Epicoccum hordei CGMCC_3_18360T' 'Epicoccum hordei LC_8149' 'Epicoccum huancayense CBS_105.80T' 'Epicoccum italicum CGMCC_3_18361T' 'Epicoccum italicum LC_8151' 'Epicoccum keratinophilum CBS_142455T' 'Epicoccum keratinophilum UTHSC_DI16_244' 'Epicoccum keratinophilum UTHSC_DI16_258' 'Epicoccum keratinophilum UTHSC_DI16_272' 'Epicoccum keratinophilum UTHSC_DI16_299' 'Epicoccum latusicollum CGMCC_3_18346T' 'Epicoccum latusicollum LC_4859' 'Epicoccum latusicollum UTHSC_DI16_197' 'Epicoccum layuense CGMCC_3_18362T' 'Epicoccum layuense LC_8156' 'Epicoccum nigrum CBS_125.82' 'Epicoccum nigrum CBS_173.73T' 'Epicoccum ovisporum CBS_180.80T' 'Epicoccum pimprinum PD_77_1028' 'Epicoccum plurivorum CBS_558.81T' 'Epicoccum pneumoniae UTHSC_DI16_257' 'Epicoccum poae CGMCC_3_18363T' 'Epicoccum poae LC_8161' 'Epicoccum poae LC_8162' 'Epicoccum proteae CBS_114179T' 'Epicoccum sorghinum CBS_179.80' 'Epicoccum sorghinum CBS_627.68' 'Epicoccum sorghinum UTHSC_DI16_288' 'Epicoccum sorghinum UTHSC_DI16_301' 'Epicoccum viticis BRIP_29294' 'Epicoccum viticis CGMCC_3_18344T' 'Foliophoma fallens CBS_161.78' 'Foliophoma fallens CBS_284.70' 'Halojulella avicenniae BCC_18422' 'Halojulella avicenniae BCC_20173' 'Hazslinszkyomyces aloes CPC_21572' 'Hazslinszkyomyces aptrootii CBS_483.95' 'Hazslinszkyomyces lycii CPC_30998' 'Hazslinszkyomyces lycii CPC_31014' 'Heterophoma adonidis CBS_114309' 'Heterophoma nobilis CBS_507.91' 'Heterophoma verbascicola CGMCC_3_18364T' 'Heterophoma verbascicola LC_8164' 'Iuxtiphoma eupyrena CBS_374.91' 'Iuxtiphoma eupyrena CBS_527.66T' 'Leptosphaeria conoidea CBS_616.75' 'Leptosphaeria doliolum CBS_505.75T' 'Leptosphaerulina americana CBS_213.55' 'Leptosphaerulina australis CBS_317.83' 'Libertasomyces myopori CPC_27354' 'Libertasomyces platani CPC_29609' 'Libertasomyces quercus CBS_134.97' 'Macroventuria anomochaeta CBS_525.71T' 'Macroventuria wentii CBS_526.71T' 'Microsphaeropsis olivacea CBS_233.77' 'Microsphaeropsis proteae CBS_111319' 'Neoascochyta argentina CBS_112524T' 'Neoascochyta cylidrispora CBS_142456T' 'Neoascochyta cylidrispora UTHSC_DI16_352' 'Neoascochyta desmazieri CBS_297.69T' 'Neoascochyta desmazieri UTHSC_DI16_207' 'Neoascochyta desmazieri UTHSC_DI16_320' 'Neoascochyta desmazieri UTHSC_DI16_332' 'Neoascochyta desmazieri UTHSC_DI16_341' 'Neoascochyta europaea CBS_820.84T' 'Neoascochyta exitialis CBS_118.40' 'Neoascochyta exitialis CBS_389.86' 'Neoascochyta graminicola CBS_301.69' 'Neoascochyta graminicola CBS_816.84' 'Neoascochyta paspali CBS_560.81T' 'Neoascochyta soli CGMCC_3_18365T' 'Neoascochyta soli LC_8166' 'Neoascochyta tardicrebrescens CBS_689.97T' 'Neoascochyta tardicrebrescens UTHSC_DI16_291' 'Neoascochyta triticicola CBS_544.74T' 'Neocamarosporium betae CBS_109410' 'Neocamarosporium betae CBS_523.66' 'Neocamarosporium calvescens CBS_246.79' 'Neocamarosporium goegapense CPC_23676' 'Neocucurbitaria aquatica CBS_297.74T' 'Neocucurbitaria cava CBS_115979' 'Neocucurbitaria cava CBS_257.68T' 'Neocucurbitaria hakeae CPC_28920T' 'Neocucurbitaria irregularis CBS_142791T' 'Neocucurbitaria keratinophila CBS_121759T' 'Neocucurbitaria quercina CBS_115095T' 'Neocucurbitaria unguis hominis_CBS_111112' 'Neocucurbitaria unguis hominis_CBS_112.79' 'Neocucurbitaria unguis hominis_UTHSC_DI16_213' 'Neodidymelliopsis achlydis CBS_256_77T' 'Neodidymelliopsis cannabis CBS_234.37' 'Neodidymelliopsis longicolla CBS_382_96T' 'Neodidymelliopsis longicolla UTHSC_DI16_322' 'Neodidymelliopsis polemonii CBS_109181T' 'Neodidymelliopsis xanthina CBS_383.68' 'Neomicrosphaeropsis italica MFLUCC_15_0484' 'Neomicrosphaeropsis italica MFLUCC_15_0485' 'Neophaeosphaeria agaves CPC_21264' 'Neophaeosphaeria filamentosa CBS_102202' 'Neoplatysporoides aloicola CBS_139901' 'Neopyrenochaeta acicola CBS_812.95' 'Neopyrenochaeta fragariae CBS_101634' 'Neopyrenochaeta inflorescentiae CBS_119222T' 'Neopyrenochaeta telephoni CBS_139022T' 'Neopyrenochaetopsis hominis UTHSC_DI16_238T' 'Nothophoma anigozanthi CBS_381.91T' 'Nothophoma arachidis hypogaeae_CBS_125.93' 'Nothophoma gossypiicola CBS_377.67' 'Nothophoma gossypiicola UTHSC_DI16_294' 'Nothophoma infossa CBS_123395T' 'Nothophoma macrospora CBS_140674' 'Nothophoma quercina CBS_633.92' 'Nothophoma quercina UTHSC_DI16_270' 'Nothophoma variabilis CBS_142457T' 'Ochrocladosporium elatum CBS_146.33' 'Ochrocladosporium frigidarii CBS_103.81' 'Ophiosphaerella herpotricha AFTOL_ID_1569' 'Paraboeremia adianticola CBS_187.83' 'Paraboeremia camelliae CGMCC_3_18106T' 'Paraboeremia camelliae CGMCC_3_18107' 'Paraboeremia camelliae CGMCC_3_18108' 'Paraboeremia litseae CGMCC_3_18109T' 'Paraboeremia litseae CGMCC_3_18110' 'Paraboeremia oligotrophica CGMCC_3_18111T' 'Paraboeremia oligotrophica CGMCC_3_18112' 'Paraboeremia putaminum CBS_130.69' 'Paraboeremia selaginellae CBS_122.93' 'Paraconiothyrium estuarinum CBS_109850' 'Paracucurbitaria corni CBS_248.79T' 'Paracucurbitaria italica CBS_234.92T' 'Paraepicoccum amazonense MFLUCC_15_0491' 'Paraepicoccum amazonense MFLUCC_15_0493' 'Paraleptosphaeria dryadis CBS_643.86' 'Parapyrenochaeta acaciae CBS_141291T' 'Parapyrenochaeta protearum CBS_131315T' 'Parapyrenochaeta protearum CBS_137997' 'Phaeomycocentrospora cantuariensis CBS_132014' 'Phaeomycocentrospora cantuariensis CPC_10157' 'Phaeosphaeria oryzae CBS_110110' 'Phoma herbarum CBS_377.92' 'Phoma herbarum CBS_502.91' 'Phoma herbarum CBS_615.75' 'Phoma herbarum FMR_UTHSC_DI16_204' 'Phoma herbarum UTHSC_DI16_212' 'Phoma herbarum UTHSC_DI16_306' 'Phoma herbarum UTHSC_DI16_307' 'Phoma herbarum UTHSC_DI16_319' 'Phomatodes aubrietiae CBS_627.97T' 'Phomatodes nebulosa CBS_100191' 'Phomatodes nebulosa CBS_740.96' 'Pleiochaeta ghindensis CBS_552.92' 'Pleiochaeta setosa CBS_496.63' 'Pleospora herbarum CBS_191.86' 'Pleospora typhicola CBS_132.69' 'Preussia terricola AFTOL_ID_282' 'Pseudoascochyta novae zelandiae_CBS_141689T' 'Pseudoascochyta pradensis CBS_141688T' 'Pseudopyrenochaeta lycopersici CBS_306.65T' 'Pseudopyrenochaeta terrestris CBS_282.72T' 'Pyrenochaeta nobilis CBS_407.76T' 'Pyrenochaetopsis americana UTHSC_DI16_225T' 'Pyrenochaetopsis botulispora CBS_142458T' 'Pyrenochaetopsis botulispora UTHSC_DI16_289' 'Pyrenochaetopsis botulispora UTHSC_DI16_297' 'Pyrenochaetopsis confluens CBS_142459T' 'Pyrenochaetopsis decipiens CBS_343.85T' 'Pyrenochaetopsis globosa UTHSC_DI16_275T' 'Pyrenochaetopsis indica CBS_124454T' 'Pyrenochaetopsis leptospora CBS_101635T' 'Pyrenochaetopsis leptospora CBS_122787' 'Pyrenochaetopsis microspora CBS_102876T' 'Pyrenochaetopsis microspora UTHSC_DI16_198' 'Pyrenochaetopsis paucisetosa CBS_142460T' 'Pyrenochaetopsis poae CBS_136769T' 'Pyrenochaetopsis setosissima CBS_119739T' 'Pyrenochaetopsis tabarestanensis CBS_139506T' 'Pyrenochaetopsis uberiformis CBS_142461T' 'Remotididymella anthropophylica CBS_142462T' 'Remotididymella destructiva CBS_133.93' 'Remotididymella destructiva CBS_162.78' 'Remotididymella destructiva CBS_378.73T' 'Shiraia bambusicola NBRC_30753' 'Shiraia bambusicola NBRC_30754' 'Shiraia bambusicola NBRC_30771' 'Shiraia bambusicola NBRC_30772' 'Similiphoma crystallifera CBS_193.82T' 'Sporormiella minima CBS_524.50' 'Stagonosporopsis dorenboschii CBS_426.90T' 'Stagonosporopsis hortensis CBS_572.85' 'Vaciviphoma bulgarica CBS_357.84T' 'Vaciviphoma oculo hominis_UTHSC_DI16_308' 'Xenodidymella applanata CBS_115577' 'Xenodidymella applanata CBS_205.63' 'Xenodidymella asphodeli CBS_375.62T' 'Xenodidymella catariae CBS_102635' 'Xenodidymella humicola CBS_220.85' 'Xenodidymella saxea CBS_419.92T' 'Xenopyrenochaetopsis pratorum CBS_445.81' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M47110] TITLE 'Coelomycetous Dothideomycetes LSU, ITS, tub2 and rpb2 sequences'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1900; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Allocucurbitaria botulispora CBS_142453T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTG????TGTCTTTTTGAGTACTT-GTTGTTTCC--TCGGCGGCT-TAGCCCG--CCAGCAGGAC----ACTAT--AACACC-CCTTGTAA--TTGCAATCAGCG--------TCAG-AAAATAAAC---AAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTTTGTCCAGCCGAAACCCCCGAAGGGCAGGCCTGTGGTCTGGTCAAAAATCTCTCGTTGATGTGTTACGTTAGCGTTGGAAGTGACGCATCGCCCATTATCGATTTTATGACGCAACGAAACATGCAGCTCCTCGAGGAATACGACCAGAACCAGAATCCCGATGCTACCAAGGTTTTCGTCAACGGTGTCTGGGTCGGCGTACATTCCAATGCTCACCAGCTCGTCTCGGTCGTGCAAGAGCTTCGGCGAAACGGAACCCTTTCTTACGAGATGAGTCTAATCCGTGACATTCGCGACCGCGAGTTCAAAATCTTCACGGACGCTGGCCGTGTCATGAGGCCCCTGTTTGTCGTAGAAAATGATATCCGAAAGCCAAACCGCAATCAGCTCATTTTTACCAAGACAATTAGCCAGAAACTTCTCCTCGAGCAACAAAGCCACGAGCAACGAAGCGGGTGGAGTGAACAGGAAATCGAGGCCGCTACCTACGGCTGGAAAGGACTCATCCAAGACGGTGTCATCGAGTATCTCGACGCCGAGGAAGAAGAAACAGCAATGATCACCATGTCTCCTGAAGACCTGGATGAG 'Allophoma coffeae arabicae_CBS_497.91' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGGTTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-AC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTTTGGTCAAGAATCTATCTCTCATGTGTTACGTCAGTGTCGGTAGTGACGCTGGACCTATCTCGGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTATGATCAAAACCAGAATCCCGACGCCACCAAGGTATTTGTCAACGGTGTCTGGGTAGGTGTCCACTCCAACGCCCAACAACTTGTCGAGACTGTGCAGCAACTTCGTCGTAACGGAACTCTGTCGTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGACGTGTAATGAGGCCACTCTTCGTTGTGGACAGCGATATCAAGTCGGCAAACCGGAACCACCTCATCTTCAACCAGGAGCACTACAACAAGCTCGTCGAGGAACAGCAG-GCAATGGCTACAGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTGGCATATGGCTGGAAGGGTCTCATCCAAGACGGTGTCATCGAGTACCTTGACGCTGAGGAAGAGGAAACTGCCATGATCGTCATGTCGCCCGAAGATCTTGGCGAG 'Allophoma cylindrispora CBS_142453T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC-AAAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTTC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACATTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCTGGAACAATGGACGCCGTGCGCGCTGGAC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCCTTATGTGCTACGTCAGTGTTGGTAGTGATGCTGGGCCTATTTCGGAGTATATGAGCCAGAGGAACATGCAGCTGCTTGAGGAGTACGATCAGAATCAGAATCCCGATGCCACCAAGGTCTTTGTTAACGGGGTCTGGGTGGGTGTTCACTCCAACGCGCAACAACTTGTCGACACTGTGCAGAGACTGCGTCGCAATGGAACGCTATCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCACTTTTCGTTGTTAACAGCGACATCAAGTCACCAGACCGAAACCATCTCATCTTCGCTCAAACGCACTACAATAAGTTGGTTGAGGAACAACAG-GCAATGGCTACAGCAGGGGTGGG--CGAAGAGGAGAAGACCGAGCTGGCGTATGGTTGGAAGGGTCTCATCCAAGATGGTGTCATCGAGTACCTCGACGCCGAGGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGACCTTGGCGAG 'Allophoma labilis CBS_124.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAA-GC-TATCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCTGCTGAAACGCCTGAAGGTCAAGCTTGCGGTCTGGTCAAGAATCTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGATGCCGGGCCTATCTCCGAGTTCATGAGCCAGAGAAACATGCAGTTGCTCGAGGAGTACGACCAAAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTAGGTGTCCACTCCAACGCGCAACAGCTTGTCGAAACCGTGCAGCAACTGCGTCGTAACGGAACCCTGTCGTACGAGATGAGTTTGATTCGAGATATCCGTGATCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCACTCTTCGTTGTGGACAGCGACATCAAGTCGGCAAATCGAAACCACCTTATCTTCAACCAGGTGCACTACAACAAGCTGGTCGAGGAGCAACAG-GCAATGGCCACAGCAGGCGTTGG--CGAAGAAGAGAAGACTGAGCTGGCGTATGGTTGGAAGGGACTCATCCAGGACGGTGTTATTGAGTACCTCGACGCTGAAGAAGAGGAAACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Allophoma minor CBS_325.82T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGGTTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG-AAAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGAACAATGGACGCCGTCCGCGCTGGAC????GGGGTCTTGTCTGTCCTGCCGAGACCCCTGAAGGACAGGCTTGCGGTTTGGTCAAGAACCTGTCACTCATGTGCTATGTCAGTGTCGGCAGTGATGCTGGGCCCATCTCTGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTAGGTGTTCACTCCAACGCGCAACAGCTTGTCGAGACCGTACAGGCACTGCGACGTAATGGAACTCTATCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCACTCTTCGTTGTGGATAGCGACATCAAGTCAGCAAATCGAAATCATCTCATCTTCAACCAAGTGCATTACAACAAGCTGGTTGAGGAACAACAG-GCAATGGCAACAGCAGGTATAGG--CGAGGAGGAGAAGACCGAGTTGGCGTATGGTTGGAAGGGTCTCATCCAAGACGGTGTCATTGAGTACCTTGACGCTGAGGAAGAAGAAACCGCCATGATTGTCATGTCACCCGAAGACCTTGGCGAG 'Allophoma nicaraguensis CBS_506.91T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGGTTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-AC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTTTGGTCAAGAATCTATCTCTCATGTGTTACGTCAGTGTCGGTAGTGACGCTGGACCTATCTCGGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTATGATCAAAACCAGAATCCCGACGCCACCAAGGTATTCGTCAACGGTGTCTGGGTAGGTGTCCACTCCAATGCCCAACAACTTGTCGAGACTGTGCAGCAACTGCGTCGTAACGGAACTCTATCATACGAGATGAGTTTGATTCGAGATATCCGCGACCGAGAGTTCAAGATCTTTACAGATGCCGGACGTGTCATGAGGCCACTCTTCGTTGTAGACAGCGATATAAAGTCGGCAAACCGAAATCACCTCATCTTCAACCAGGAGCATTACAACAAGCTTGTCGAGGAACAACAG-GCAATGGCTACAGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTGGCATACGGCTGGAAGGGTCTCATCCAAGACGGTGTCATCGAGTACCTTGACGCTGAGGAAGAGGAAACTGCCATGATCGTCATGTCACCCGAAGATCTTGGCGAG 'Allophoma oligotrophica CGMCC_3_18114T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGGTTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTTTGGTCAAGAATCTATCTCTCATGTGTTACGTCAGTGTCGGTAGTGACGCTGGACCTATCTCGGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTATGATCAAAACCAGAATCCCGACGCCACCAAGGTATTTGTCAACGGTGTCTGGGTAGGTGTCCACTCCAACGCCCAACAACTTGTCGAGACTGTGCAGCAACTTCGTCGTAACGGAACTCTGTCGTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGACGTGTAATGAGGCCACTCTTCGTTGTGGACAGCGATATCAAGTCGGCAAACCGGAACCACCTCATCTTCAACCAGGAGCACTACAACAAGCTCGTCGAGGAACAGCAG-GCAATGGCTACAGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTGGCATATGGCTGGAAGGGTCTCATCCAAGACGGTGTCATCGAGTACCTTGACGCTGAGGAAGAGGAAACTGCCATGATCGTCATGTCGCCCGAAGATCTTGGCGAG 'Allophoma piperis CBS_268.93T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATCGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAAACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTGCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCCC----TTG-GAAG-------AAC---------TGCGAGTG-------CTGACCTGCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATCTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAAACACCTGAAGGACAGGCTTGCGGTTTGGTCAAGAATCTGTCACTCATGTGCTATGTCAGCGTCGGTAGTGATGCTGGGCCCATCTCCGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAAGAGTACGACCAGAATCAAAATCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTAGGTGTCCACTCCAATGCGCAACAGCTTGTCGAGACCGTTCAGGCACTGCGTCGTAATGGAACTCTATCATACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAAATCTTTACAGACGCTGGACGTGTCATGAGACCGCTCTTCGTTGTGGACAGCGACATTAAGTCGGCAAATCGAAATCACCTTATCTTCAACCAAATGCACTACAACAAGCTGGTTGAGGAACAACAG-GCAATGGCAACAGCAGGTATAGG--TGAGGAAGAGAAGACTGAGCTGGCGTATGGTTGGAAGGGTCTCATTCAAGATGGTGTCATCGAGTACCTTGACGCCGAGGAAGAGGAAACCGCCATGATTGTCATGTCGCCCGAAGACCTTGGCGAG 'Allophoma tropica CBS_436.75T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGGTTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT------TTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-AC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTTTGGTCAAGAATCTATCTCTCATGTGTTACGTCAGTGTCGGTAGTGACGCTGGACCTATCTCGGAGTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTATGATCAAAACCAGAATCCCGACGCCACCAAGGTATTCGTCAACGGTGTCTGGGTAGGTGTCCACTCCAACGCCCAACAACTTGTCGAGACTGTGCAGCAACTGCGTCGTAACGGAACTCTATCATACGAGATGAGTTTGATTCGAGATATCCGCGACCGAGAGTTCAAGATCTTTACAGATGCCGGACGTGTCATGAGGCCACTCTTCGTTGTAGACAGCGATATAAAGTCGGCAAACCGAAATCATCTCATCTTCAACCAGGAGCATTACAACAAGCTTGTCGAGGAACAACAG-GCAATGGCTACAGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTGGCATACGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAGTACCTTGATGCTGAGGAAGAGGAAACTGCCATGATCGTCATGTCGCCCGAAGATCTTGGCGAG 'Allophoma zantedeschiae CBS_131.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAA-GC-TATCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCGGGCC????GGGGTCTCGTCTGCCCTGCCGAAACGCCTGAAGGTCAGGCTTGCGGTCTGGTCAAGAATCTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGATGCCGGGCCTATCTCCGAGTTCATGAGCCAGAGAAACATGCAGTTGCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGTGTTTGGGTAGGTGTCCACTCCAACGCTCAACAGCTTGTCGAAACCGTGCAGCAACTGCGTCGTAACGGAACCCTGTCGTACGAGATGAGTTTGATCCGAGATATCCGTGATCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCGCTCTTCGTTGTGGACAGCGACATCAAGTCGGCAAATCGAAACCACCTTATCTTCAACCAGATGCACTACAACAAGCTGGTCGAGGAGCAACAG-GCAATGGCCACAGCAGGCGTCGG--CGAAGAAGAGAAGACTGAGCTGGCGTATGGCTGGAAGGGACTCATCCAAGACGGTGTTATCGAGTATCTCGACGCTGAAGAAGAGGAAACTGCCATGATTGTCATGTCGCCTGAGGATCTCGGCGAG 'Allophoma zantedeschiae CBS_229.32' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGCCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAA-GC-TATCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCGGGCC????GGGGTCTCGTCTGCCCTGCCGAAACGCCTGAAGGTCAGGCTTGCGGTCTGGTCAAGAATCTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGATGCCGGGCCTATCTCCGAGTTCATGAGCCAGAGAAACATGCAGTTGCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGTGTTTGGGTAGGTGTCCACTCCAACGCTCAACAGCTTGTCGAAACCGTGCAGCAACTGCGTCGTAACGGAACCCTGTCGTACGAGATGAGTTTGATCCGAGATATCCGTGATCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCGCTCTTCGTTGTGGACAGCGACATCAAGTCGGCAAATCGAAACCACCTTATCTTCAACCAGATGCACTACAACAAGCTGGTCGAGGAGCAACAG-GCAATGGCCACAGCAGGCGTCGG--CGAAGAAGAGAAGACTGAGCTGGCGTATGGCTGGAAGGGACTCATCCAAGACGGTGTTATCGAGTATCTCGACGCTGAAGAAGAGGAAACTGCCATGATTGTCATGTCGCCTGAGGATCTCGGCGAG 'Alternariaster bidentis CBS_134021' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCTCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGG--GCTTTT-GCCCAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTTCTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTACGCACCA-TCTGTTTCC--TTGGTGGGC-TTGCCTG--CCGATAGGAC---AATCCA--AA--ACCATTTGTAC--TTGCAGTCAGCG--------TCAG------TAACAATAAA-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGCCTTGTGTGTCCGGCTGAGACTCCTGAAGGGCAAGCTTGTGGTCTCGTCAAGAATTTGTCTCTGATGTGCTACGTGAGTGTCGGTAGCGATGCATCGCCGATCATCGACTTCATGACGCAGCGAAACATGCAACTTCTCGAAGAATACGACCAGAATCAAAGTCCCGAGGCCACCAAGATCTTTGTCAACGGTGTCTGGGTCGGTGTGCACTCGAATGCTCACCAGCTTGTCTCTGTCGTTCAGGAGCTCCGGAGAAACGGTACCTTGTCTTACGAGATGAGCTTGATTCGCGACATTCGTGATCGTGAATTCAAAATCTTTACAGATGCTGGTCGGGTTATGCGACCGCTATTCGTTATAGAAAACGACATTCGAAAGCCAAATAGGCATCAACTTATCTTCACAAAGGATATCAGTAGGAAGCTGATCTACGAGCAAGAGACGCAGGACCAGCGTCAAGGCTGGAGTGAGGAGGACATTGCAGCTGCAACGTACGGCTGGAAGGGACTCATTCAGGACGGTGTCATCGAGTACCTGGACGCGGAAGAAGAGGAGACCGCGATGATCACATTTTCGCCCGAAGATTTGTTCGCA 'Alternariaster helianthi CBS_327.69' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGG--GCTTTT-GCCCAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTACGCACTA-TCTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATTGGAC---AACCTA--AA--ACCATTTGTAC--TTGCAGTCAGCG--------TCAGTCATA-AAAT--TAAT--ATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGCCTTGTGTGTCCGGCTGAGACTCCTGAAGGGCAAGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTGAGTGTCGGTAGCGATGCATCGCCGATCATCGACTTCATGACGCAGCGAAACATGCAACTTCTCGAAGAATACGACCAGAACCAAAGTCCCGAGGCCACCAAGATCTTTGTCAACGGTGTCTGGGTCGGTGTGCACTCGAATGCTCACCAGCTTGTCTCTGTCGTTCAAGAGCTCCGGAGAAATGGTACCTTGTCTTACGAAATGAGCTTGATTCGCGACATTCGTGATCGTGAATTCAAAATCTTTACGGATGCTGGCCGGGTTATGCGACCGCTATTCGTTATAGAAAATGACATTCGAAAGCCAAATCGGCATCAACTTATTTTTACAAAGGATATCAGTAGGAAGCTGATTTACGAGCAAGAGACGCAGGACCAGCGTCAAGGCTGGAGTGAGGAGGACATTGCAGCTGCAACGTACGGCTGGAAGGGACTCATCCAGGACGGTGTCATCGAGTACCTGGATGCGGAAGAAGAAGAGACCGCAATGATCACATTTTCGCCCGAAGATCTATTTGCA 'Ascochyta herbicola CBS_629.97' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAAATTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGTGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTATC-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTCCGCGCTGGTC????GGGGTCTCGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGCGGCCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCAATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGACCAAAACCAGAACCCTGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTCCACTCAAACGCACAGCAGCTTGTATCAACCGTGCAGGAACTGCGACGAAACGGAACACTGTCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTCGAGAGCGACGTTCGCAAGCCCAACCGCAATCATCTTGTCTTCAGCCAGGACCACTACAACAAGCTAGTCGCAGAACAACAA-GCGCAAGCTGCGGCAGGTGTTGG--TGAGGAAGAGAAGACCGAGCTCACATACGGCTGGAAGGGGCTTATCCAAGACGGAGTCATCGAATATCTCGATGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ascochyta pisi CBS_126.54' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGATTGGAC--AAAATTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCTAC----TAG-GACG-------GAC---------TGCGAGTG-------CTGACCATTG-GC--AGGCTTCTGGTAACAAG-TTCGTCCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGTGCTGGTC????GGGGTCTTGTTTGCCCTGCTGAGACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACTTATCTTTGATGTGCTACGTCAGTGTTGGTAGTGACGCTGGGCCAATCTCCGACTTCATGAGCCAGAGGAATATGCAACTCCTCGAGGAGTACGACCAGAATCAGAACCCTGATGCAACCAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACACTGTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTTGAGAGCGACGTTCGCAAGCCCAACCGCAACCACCTTGTCTTCAGCCAGGAACACTACAACAAGCTGGTCGCAGAACAGCAA-GCGCAAGCCGCGGCAGGTGTCGG--TGAGGAGGAGAAGACCGAGCTCACCTACGGCTGGAAGGGGCTTATCCAAGACGGAGTCATCGAATACCTCGACGCTGAAGAAGAAGAGACCGCCATGATTGTCATGTCTCCCGAGGACCTCGGTGAG 'Ascochyta rabiei CBS_206.30' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAAATCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GACAC-GC-TTCAC----CAT-GACG-------GAC---------TTTGAGTG-------CTGACCTATC-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTAGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCGTGCGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCAATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAATCAGAACCCTGATGCTACCAAAGTCTTCGTTAACGGTGTGTGGGTCGGTGTCCACTCCAACGCACAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGGACACTGTCTTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTTGAGAGCGACGTTCGCAAGCCCAATCGCAATCACCTTGTCTTCAGCCAGAGCCACTACAACAAGCTGGTCGAAGAACAGCAA-GCGCAAGCTGCGGCAGGTGTTGG--TGAGGAAGAGAAGACCGAGCTCACGTACGGCTGGAAGGGGCTTATCCAGGACGGAGTCATTGAATATCTCGATGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ascochyta versabilis CBS_876.97' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAT-GC-TTTCT----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCAATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAATCAGAACCCTGATGCTACCAAAGTCTTCGTTAACGGTGTGTGGGTCGGTGTCCACTCCAACGCACAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGGACACTGTCTTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTTGAGAGCGACGTTCGCAAGCCCAATCGCAATCACCTTGTCTTCAGCCAGAGCCACTACAACAAGCTGGTCGAAGAACAGCAA-GCGCAAGCTGCGGCAGGTGTTGG--TGAGGAAGAGAAGACCGAGCTCACGTACGGCTGGAAGGGGCTTATCCAGGACGGAGTCATTGAATATCTCGATGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ascochyta viciae CBS_451.68' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGATTGGAC--AAATTTG--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTGGA--------AAT-------GACAC-GC-TCTAC----TAG-GACG-------GAC---------TGCGAGTG-------CTGACCATTG-GC--AGGCTTCTGGTAACAAG-TTCGTCCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGTGCTGGCC????GGGGTCTTGTTTGCCCTGCTGAGACACCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTATCTTTGATGTGCTACGTCAGTGTTGGTAGTGACGCTGGGCCAATCTCCGACTTCATGAGCCAGAGGAATATGCAACTCCTCGAGGAGTACGACCAGAATCAGAACCCTGATGCAACCAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACACTGTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTTGAGAGCGACGTTCGCAAGCCCAACCGCAACCACCTTGTCTTCAGCCAGGAACACTACAACAAGCTGGTCGCAGAACAGCAA-GCGCAAGCTGCGGCAGGTGTCGG--TGAGGAGGAGAAGACCGAGCTCACCTACGGCTGGAAGGGGCTTATCCAAGACGGAGTCATCGAATACCTCGACGCTGAAGAAGAAGAGACCGCCATGATTGTCATGTCTCCCGAGGACCTCGGTGAG 'Boeremia exigua CBS_118.38' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GA-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGCCTTGTCTGCCCTGCCGAGACCCCTGAAGGACAAGCCTGTGGTCTGGTCAAGAATCTATCGCTCATGTGCTACGTCAGTGTTGGTAGCGACGCTACACCTATCTCTGAATACATGAGCAAGAGGAACATGCAACTGCTTGAGGAGTACGATCAAAACCAGAATCCCGATGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCCACTGTGCAGCAGTTGCGTCGTGACGGTACCTTGTCGTACGAGATGAGTTTGATTCGAGATATTCGCGACCGAGAGTTCAAGATCTTTACTGATGCTGGACGTGTCATGAGGCCTCTTTTCGTTGTGGACAACGATGTTACCAGTAAGACTCGTAATCATCTCGTCTTCAACCAGGGGCACTACAATAAGCTGGTCGAAGAGCAACAG-GCATCGGCCACAGCAGGCATTGG--CGAAGAGGAGAAGGAAGAGCTTGCCTATGGCTGGAAGGGTCTCATTCAAGATGGTGTTATTGAATACCTTGACGCTGAAGAAGAGGAGACTGCCATGATCGTCTTTTCACCCGAGGATCTCGGTGAG 'Boeremia exigua CBS_119.38' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GA-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGCCTTGTCTGCCCTGCCGAGACCCCTGAAGGACAAGCCTGTGGTCTGGTCAAGAATCTATCGCTCATGTGCTACGTCAGTGTTGGTAGCGACGCTACACCTATCTCTGAATACATGAGCAAGAGGAACATGCAACTGCTTGAGGAGTACGATCAAAACCAGAATCCCGATGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCCACTGTGCAGCAGTTGCGTCGTGACGGTACCTTGTCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGAGAGTTCAAGATCTTTACTGATGCTGGACGTGTCATGAGGCCTCTTTTCGTTGTGGACAACGATGTTACCAGTAAGACTCGTAATCATCTCGTCTTCAACCAGGGGCACTACAATAAGCTGGTCGAAGAGCAACAG-GCATCGGCCACAGCAGGCATTGG--CGAAGAGGAGAAGGAAGAGCTTGCCTATGGCTGGAAGGGTCTCATTCAAGATGGTGTTATTGAATACCTTGACGCTGAAGAAGAGGAGACTGCCATGATCGTCTTTTCACCCGAGGATCTCGGTGAG 'Boeremia lycopersici CBS_378.67' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-AAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAATTTA--AA--CC-CTCTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGTAATAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGCCTTGTCTGCCCTGCCGAGACCCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTATCGCTCATGTGCTACGTCAGTGTTGGTAGTGACGCTACACCTATCTCTGAATACATGAGCAAGAGGAATATGCAACTTCTCGAGGAGTACGATCAGAACCAGAATCCCGATGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCCACCGTGCAGCAGTTGCGTCGTGACGGTACCTTGTCCTACGAGATGAGTTTGATTCGAGACATTCGCGACCGAGAGTTCAAGATCTTTACTGATGCTGGACGTGTCATGAGACCTCTTTTCGTTGTGGATAACGATGTTACCAGTAAGACTCGCAATCATCTCGTTTTCAACCAGGGGCACTACAATAAGCTGGTCGAGGAGCAACAG-GCATCGGCCGCAGCAGGCGTTGG--CGAAGAGGAGAGAGAAGAGCTCGCCTACGGCTGGAAGGGTCTCATTCAAGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAGGAGACTGCCATGATCGTTTTTTCACCCGAGGATCTCGGTGAG 'Briansuttonomyces eucalypti CBS_114879T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCCAC----TAC-GACA-------GAC---------CTCGAGTG-------CTGACCTATG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Briansuttonomyces eucalypti CBS_114887' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCCAC----TAC-GACA-------GAC---------CTCGAGTG-------CTGACCTATG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Calophoma aquilegiicola CBS_107.96' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAC-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AGT-------GACAC-GC-TTTCC----TAC-CAAG-------GAC---------TGCGAGTG-------CTGACCTGTT-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGTGCCGTTCTCGTCGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGTCCGGCTGAGACGCCTGAAGGACAGGCCTGCGGTTTGGTCAAGAACTTATCTCTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCTGATTTCATGAGCCAAAGGAATATGCAGCTTCTCGAGGAGTATGACCAGAATCAGAACCCTGACGCCACCAAGGTATTTGTCAACGGTGTGTGGGTTGGTGTCCACTCCAACGCGCAGCAGCTTGTCTCAACTGTGCAAGAGCTGCGACGAAACGGAACACTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGGCGTGTAATGAGGCCTCTGTTCGTAGTTGAGAGCGATGTTCGTAAGCCAAACCGCAATCATCTGGTCTTCAGCCAGGATCACTATAACAAGCTGGTTGCAGAGCAGCAA-GCACAGGCTGCGGCAGGTGTTGG--CGAAGAAGAGAAGACTGAGCTCACATACGGCTGGAAGGGACTCATCCAGGACGGTGTCATCGAGTACCTCGATGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTCGGCGAG 'Calophoma aquilegiicola CBS_108_96' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAC-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AGT-------GACAC-GC-TTTCC----TAC-CAAG-------GAC---------TGCGAGTG-------CTGACCTGTT-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGTGCCGTTCTCGTCGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Calophoma clematidina CBS_102.66' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGA--AGAC---AATCTATAAA--CC--TTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------ACT-------GACAC-TC-TTTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTATT-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCGGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCGCTGATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCTATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGTGTGTGGGTCGGTGTCCATTCCAACGCGCAACAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACGTTGTCTTACGAGATGAGTTTGATCCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTCGTTGAGAGCGATGTACGCAAGCCCAACCGCAACCATCTCGTTTTCAGCCAGGACCACTACAACAAGCTAGTCGCAGAGCAACAA-GCGCAGGCCGCAGCAGGTGTTGG--CGAGGAAGAAAAGACCGAACTCACATATGGCTGGAAGGGGCTCATTCAGGACGGTGTCATCGAGTACCTCGACGCGGAAGAAGAAGAGACAGCCATGATTGTCATGTCGCCAGAGGACCTTGGCGAG 'Calophoma clematidina CBS_108.79T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGA--AGAC---AATCTATAAA--CC--TTTGCAG--TTGCAATCAGCG--------TCTG-AAAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------ACT-------GACAC-TC-TTTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTATT-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCGGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCGCTGATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCTATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGTGTGTGGGTCGGTGTCCATTCCAACGCGCAACAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACGTTGTCTTACGAGATGAGTTTGATCCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTCGTTGAGAGCGATGTACGCAAGCCCAACCGCAACCATCTCGTTTTCAGCCAGGACCACTACAACAAGCTAGTCGCAGAGCAACAA-GCGCAGGCCGCAGCAGGTGTTGG--CGAGGAAGAAAAGACCGAACTCACATATGGCTGGAAGGGGCTCATTCAGGACGGTGTCATCGAGTACCTCGACGCGGAAGAAGAAGAGACAGCCATGATTGTCATGTCGCCAGAGGACCTTGGCGAG 'Calophoma clematidis rectae_CBS_507.63' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGACAAAAAATTA--AA--AC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCTGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GACAC-AC-TTTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTATT-GC--AGGCGTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCGGAAACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGCAGTGACGCCGGGCCTATCTCTGATTTCATGAGCCAAAGGAATATGCAACTTCTTGAGGAATACGATCAGAACCAGAACCCTGACGCTACAAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTTGTATCAACCGTACAAGAACTGCGACGAAACGGAACGCTGTCTTACGAAATGAGTTTGATCCGAGACATCCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCCCTGTTCGTCGTCGAGAGCGATGTCCGCAAACCCAACCGCAACCATCTCGTTTTTAGCCAGGACCACTACAACAAGCTGGTCGCAGAGCAACAA-GCGCAGGCTGCGGCAGGTGTTGG--CGAAGAAGAAAAGACCGAGCTCACATATGGCTGGAAGGGGCTTATCCAGGACGGTGTCATTGAGTATCTCGACGCGGAGGAAGAAGAGACGGCCATGATTGTCATGTCGCCAGAGGATCTTGGCGAA 'Calophoma rosae CGMCC_3_18347T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGAC---AATCTATAAA--AC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GACAC-GC-TTTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTATC-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCTGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCGGAGACACCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCCCTGATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCTATCTCTGATTTCATGAGCCAAAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTTGGTGTCCACTCCAACGCACAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTTTTCGTCGTCGAGAGTGATGTCCGCAAACCCAACCGCAACCATCTCGTTTTCAGCCAGGATCATTACAACAAGCTGGTCGCAGAGCAACAG-GCGCAGGCTGCAGCAGGTGTTGG--TGAGGAAGAGAAGACGGAGCTCACATATGGCTGGAAAGGGCTCATCCAGGACGGCGTCATTGAGTACCTCGACGCGGAGGAAGAAGAGACGGCCATGATTGTCATGTCGCCAGAGGATCTTGGCGAA 'Calophoma rosae LC_8119' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGATG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGAC---AATCTATAAA--AC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GACAC-GC-TTTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTATC-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCTGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCGGAGACACCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCCCTGATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCTATCTCTGATTTCATGAGCCAAAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTTGGTGTCCACTCCAACGCACAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTTTTCGTCGTCGAGAGTGATGTCCGCAAACCCAACCGCAACCATCTCGTTTTCAGCCAGGATCATTACAACAAGCTGGTCGCAGAGCAACAG-GCGCAGGCTGCAGCAGGTGTTGG--TGAGGAAGAGAAGACGGAGCTCACATATGGCTGGAAAGGGCTCATCCAGGACGGCGTCATTGAGTACCTCGACGCGGAGGAAGAAGAGACGGCCATGATTGTCATGTCGCCAGAGGATCTTGGCGAA 'Camarosporium aborescentis MFLUCC_14_0604' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCCG--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AATAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCACTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium arezzoensis MFLUCC_140238' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCTG--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AATAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium aureum MFLUCC_14_0620' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TTGGTGGGC-TTGCCCA--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AACAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium clematidis MFLUCC_13_0336' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCCG--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AA-TAATTATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium quaternatum CPC_23216' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGATG-TAATGTAGCC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGGT-TATTGCGTACTA-TTAGTTTCC--TCGGCGGGC-TTGCCTG--CCGATAGGAC---AACCAA--AA--CCCATTTGTAA--TTGCGGTCAGCG--------TCTGTAAAA-GTAA-TAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium quaternatum CPC_31081T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGATG-TAATGTAGCC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGGT-TATTGCGTACTA-TTAGTTTCC--TCGGCGGGC-TTGCCTG--CCGATAGGAC---AACCAA--AA--CCCATTTGTAA--TTGCGGTCAGCG--------TCTGTAAAA-GTAA-TAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium quaternatum CPC_31518' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGATG-TAATGTAGCC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGGT-TATTGCGTACTA-TTAGTTTCC--TCGGCGGGC-TTGCCTG--CCGATAGGAC---AACCAA--AA--CCCATTTGTAA--TTGCGGTCAGCG--------TCTGTAAAA-GTAA-TAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium robiniicola MFLUCC_13_0527' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TTGGTGGGC-TTGCCCA--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AACAAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium spartii MFLUCC_13_0548' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCCG--CCAATAGGAC---AACCTAAAAA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG---AA-TAATTATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporomyces flavigenus CBS_314.80' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTC-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCA-TTTGTTTCC--TTGGTGGGCTTTGCCTG--CCGATAGGAC-ACCCCAAAACAC--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AAAC-ACAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium carteri CBS_105.91' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????--------------------CGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGAC---ACTATA--AA-ACC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAAATAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGCGATTTAGA--------AAT-------------------------ATA---------------------------------------CTGAT-----------------------CAAG-----------------------------------------------------------------????GGGGTCTTGTTTGTCCCGCTGAAACCCCCGAAGGACAGGCTTGTGGCTTGGTCAAGAACCTGTCTCTTATGTGCTACGTCAGTGTGGGAAGCGATGCCACACCAATCACCGATTTCATGACGCAGCGAAACATGCAATTGCTCGAAGAGTACGATCAGAACCAGAACCCGGACGCTACGAAGGTTTTCGTCAACGGTGTTTGGGTTGGCGTACATACCAATGCTCAACAACTCGTATCGGTCGTGCAAGAGCTGCGGAGAAACGGCACGTTGTCCTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAATTCAAGATCTTTACGGATGCTGGCCGTGTAATGCGGCCCTTGTTCGTTGTTGAGAACGACATTCGAAAGCCAAACCGCAACCAGCTCATCTTCACCAAGGAGATCAGCAAGAAGCTCCTATACGAGCAACAAACTCAGGACCAGCGTTCAGGCTGGAGTGAAGCAGAGATAGAAGCTGCGACCTACGGCTGGAAAGGACTTATCCAAGATGGTGTTGTCGAGTACCTGGATGCTGAGGAAGAAGAGACCGCCATGATAACTTTCTCCCCTGAAGATCTGGACGAA 'Coniothyrium palmarum CBS_400.71' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGT-GTACCTCTCTTCGGGGA-GGCCGTATAGGG-GAGGCG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTTT-GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TATTGCGTACTA-CTTGTTTCC--TTGGTGGGC-TTGCCCG--CCAAAAGGAC-ACCTATAA--AA--CC-TCTTGTAA--TTGCAGTCAGCG--------TCAG---AA-AAAC-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAATCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACATCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTG-------------------CGC-------GACTC-CA-TTACT----ACTAGACG-----TGAAC-------AACACGAGAA-------CTGACCAATG-GC--AGGCCTCCAACAACAAG-TTTGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGCC????GGGGTCTGGTTTGCCCCGCAGAAACCCCTGAAGGCCAAGCCTGTGGCTTGGTCAAGAACT?GTCGTTGATGTGCTATGTCAGCGTTGGTAGCGAAGCCACACCTATCGT?GACTTCATGACCCAGCGGAACATGCAACTTCTGGAAGAGTATGACCAAAGCCAGAATCCGGAGGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTGCATTCCAACGCTCAACAACTGGTATCAGTCGTACAGGAGCTCCGGCGAAACGGCACTCTGTCTTACGAGATGAGCTTGATTCGAGATATTCGTGATCGGGAGTTCAAAATCTTCACGGATGCCGGTCGTGTTATGAGGCCCTTGTTCGTCGTCGAGAACGACGTTCGAAAACCCAACCGAAACCAGCTCATCTTCACAAAGGACATTAGTAGGAAGCTTCTCTATGAGCAACAAAGCCATGAACAACGTCAAGGCTGGAGTGAAGAGGAAATAGCAGCCGCCACCTATGGCTGGAAAGGCCTCATCCAAGATGGTGTGATCGAGTATCTTGACGCTGAGGAGGAGGAAACTGCAATGATAACCTTTGCCCCGGAAGATCTGGATGAA 'Coniothyrium palmarum CBS_758.73' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGT-GTACCTCTCTTCGGGGA-GGCCGTATAGGG-GAGGCG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium telephii CBS_188.71' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????--------------------TGTTTCC--TCGGTGGGC-TTGCCCG--CCGATAGGAC-ACTATAAA--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--TAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------------------CGC-GCTGATCA----TTCTGGCC-------GACCAGAAAAAGTTTAGGTG-------CTGACCAAAG-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGCGCTGTCCTCGTCGATCTTGAGCCCGGCACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTCGTGTGCCCAGCCGAGACTCCCGAAGGACAGGCCTGTGGTTTAGTCAAGAACTTGTCTCTCATGTGTTACGTCAGTGTCGGCAGTGATGCCACACCTATCACCGATTTCATGACCCAGCGAAACATGCAACTGCTCGAAGAGTACGATCAGAACCAGAACCCAGACGCAACGAAAGTTTTTGTCAATGGTGTTTGGGTTGGTGTACATACCAATGCGCAACAACTTGTGTCGGTCGTGCAAGAGCTTCGCAGAAACGGCACGTTGTCTTACGAGATGAGTTTGATTCGTGACATCCGTGATCGAGAGTTCAAGATCTTTACAGATGCTGGTCGCGTAATGCGACCCCTGTTCGTCGTTGAGAACGACATCCGAAAGCCGAATCGCGACAAGCTCATCTTCACCAAAGATATCAGCAAGAAGCTTCTGTACGAACAGCAGACACAAGACCAGCGTTCGGGCTGGAGTGAGGCGGAAATAGCGGCCGCGACCTACGGCTGGAAAGGACTCATCCAAGATGGTGTGGTCGAGTACCTCGATGCCGAGGAAGAAGAAACTGCAATGATCACATTCTCTCCTGAGGATTTGGACGAA 'Coniothyrium telephii CBS_856.97' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????--------------------TGTTTCC--TCGGTGGGC-TTGCCCG--CCGATAGGAC-ACTATAAA--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--TAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria berberidis CBS_130007T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAC-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCA-TTTGTTTCC--TCGGCGGGTTCTGCCTG--CCGATAGGAT-ACTATAAA--AA--CC-CTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-ACAT-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCGGGCGAGCATGGCCTCGAC-AGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCAGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CGTGA----------T-------GTCCC-TCTTTCTCCTGGTTA-GACG-------AAC---------AGTCGGTG-------CTGACCAATG-GC--AGGCGTCCGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATCTCGAGCCAGGCACCATGGACGCTGTCCGCGCTGGTC????GGGGCCTTGTCTGCCCAGCCGAAACCCCCGAAGGACAAGCCTGCGGACTGGTAAAGAATCTGTCTTTGATGTGCTACGTTAGCGTGGGAAGCGACGCGTCGCCCATCATTGACTTCATGACACAGCGAAACATGCAACTCCTCGAGGAATACGATCAGAATCAGAATCCGGATGCCACCAAGGTTTTTGTAAACGGTGTCTGGGTTGGTGTACATTCCAATGCCCACCAGCTTGTGTCGGTCGTGCAAGAGCTTCGGAGAAACGGAACGCTATCTTACGAGATGAGTCTGATTCTTGACATTCCTGACCGGGAGTTCAAGATTTTCACGGACGCCGGCCGTGTCATGAGACCATTGTTCGTTGTGGAGAACGACAT-CGAAAGCCGAACCGCAATCAGTTAATTTTCACCAAAGCCATCAGCCAAAAACTCTTAATGGAGCAACAAAGTCATGATCAACGCAGTGGGTGGAGTGAACAGGAAATCGAAGCCGGTACATATGGCTGGAAGGGTCTCATTCAAGACGGTGTTATCGAGTATCTTGATGCCGAGGAAGAAGAAACTGCAATGATCACCATGTCTCCTGAGGATTTGGATGAG 'Cucurbitaria berberidis MFLUCC_11_0387' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAC-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria elongata AFTOL_ID_1568' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTCGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGCGGCTTGGTAAAGAATCTGTCCCTCATGTGCTATGTCAGCGTTGGCAGCGACGCAACGCCCATCGTCGATTTCATGACACAACGAAATATGCAACTCCTTGAGGAATACGACCAAAACCAGAATCCGGATGCTACCAAGGTTTTCGTCAACGGTGTTTGGGTCGGTGTACATTCCAACGCGCAACAACTCGTCTCGGTCGTACAGGAGCTACGAAGAAACGGAACCTTGTCCTATGAGATGAGTTTGATCCGTGATATTCGAGACCGAGAGTTCAAGATCTTCACGGATGCCGGACGTGTCATGAGGCCTTTGTTCGTCGTTGAGAACGACATTCGAAAGCCCAACCGCAATCAGCTCATCTTCACGAAGGAGATTAGCAAGAAACTTCTGTTTGAGCAACAGAGCCAGGACTTGCGTCAAGGCTGGAGTGAAGAGGATATAGCAGCCGCTACTTACGGTTGGAAAGGACTCATCCAAGACGGTGTGATCGAGTATCTTGATGCCGAGGAAGAGGAAACTGCAATGATAACTTTCTCTCCCGAGGACCTGGACGAA 'Cucurbitaria elongata MFLUCC_14_0260' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cumuliphoma indica CBS_654.77' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-TCGCCCG--CCGGCTGGAC---AATTTA--AA--CC-CATTGCAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GCGTTCCC----ATC-GACG-------GAC---------TGCGAGTG-------CTGACCTATA-CT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCGGCTGAGACGCCCGAAGGACAGGCCTGCGGTCTGGTCAAGAACCTGTCGCTTATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAAGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCGACGGTCCAGGAGCTGCGCCGCAACGGAACCCTTTCCTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCTCTCTTCGTCGTCGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTTTTCAGCCAGGAGCACTACAACAAGCTGGTTGCAGAGCAGCAG-GCCATGGCTGCTGCAGGCGTCGG--CGAGGAGGAGAAGAACGAGCTGGCGTACGGCTGGAAGGGGCTCATCCAGGACGGTGTCATCGAGTACCTCGACGCCGAAGAAGAAGAGACCGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Cumuliphoma indica CBS_991.95' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-TCGCCCG--CCGGCTGGAC---AATTTA--AA--CC-CATTGCAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GCGTTCCC----ATC-GACG-------GAC---------TGCGAGTG-------CTGACCTATA-CT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCGGCTGAGACGCCCGAAGGACAGGCCTGCGGTCTTGTCAAGAACCTGTCGCTCATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAAGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTATCGACGGTCCAGGAGCTGCGCCGCAACGGAACCCTTTCCTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCTCTCTTCGTCGTCGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTTTTCAGCCAGGAGCACTACAACAAGCTGGTTGCAGAGCAGCAG-GCCATGGCTGCTGCAGGCGTCGG--CGAGGAAGAGAAGAACGAGCTGGCGTACGGCTGGAAGGGGCTCATCCAGGACGGTGTCATCGAGTACCTCGACGCCGAAGAAGAAGAGACCGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Cumuliphoma omnivirens CBS_341.86T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-TCGCCCG--CCGGCTGGAC---AATTTA--AA--CC-CATTGCAG--TTGCAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGTCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GCGTTCCC----ATC-GACG-------GAC---------TGCGAGTG-------CTGACCTATA-CT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCGGCTGAGACGCCCGAAGGACAGGCCTGCGGTCTGGTCAAGAACCTGTCGCTCATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCAATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCGACGGTCCAGGAGCTCCGCCGCAACGGAACCCTTTCCTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCTCTCTTCGTCGTCGAGAGCGATGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAACAAGCTGGTTGCAGAGCAGCAG-GCCATGGCTGCTGCAGGTGTCGG--CGAAGAGGAGAAAACGGAGCTGACGTACGGCTGGAAGGGGCTCATCCAGGACGGTGTCATCGAGTACCTCGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Cumuliphoma pneumoniae CBS_142454' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-TCGCCCG--CCGGCTGGAC---AATTTA--AA--CC-CATTGCAG--TTGCAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGGACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----ATT-GACG-------GAC---------TGCGAGTG-------CTGACCTATA-CT--AGGCTTCTGGCAACAAG-TTCGTCCCCCGTGCCGTTCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTCGTCTGCCCGGCTGAGACGCCCGAAGGACAGGCCTGCGGTCTGGTCAAGAACCTGTCGCTCATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCGACGGTGCAGGAGCTGCGCCGCAACGGAACGCTTTCCTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCTCTCTTCGTCGTCGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTTTTCAGCCAGGAGCACTACAACAAGCTGGTTGCAGAGCAGCAG-GCCATGGCTGCGGCAGGTGTCGG--CGAAGAGGAGAAGACGGAGCTGACGTACGGCTGGAAGGGGCTCATCCAGGACGGTGTCATCGAGTACCTCGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Curreya pityophila CBS_149.32' GGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAG--GCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAC-GTATCTCCCTTCGGGGT-GACCTTATAGGG-GAGGCG-CAATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TTTTTTTACGAGCACCT-TTCGTTCTCCTTCGGCGGGG-CAACCTG--CCGCTGGAAC------TTAACAAAACC-TTTT------TTGCATCTAGCATTACCTGTTCTG--ATACAAAC---AAT-CGTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TCTACACCCTC-AAGCTCTG------------CTTGGTGTT-GGGCG????GGTAACCAAATCGGTGCCGCCTTCTGGTGCGTCGATCACGAGAAAGCTCTGCCGATGCGACAGCAA------CTGACCGACCTACAGGCAGCAGATTTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT--GTAAGTAGCACTCATTTCAGAATACACGCTATATGCAGAAATGTCTGACTTTGACCAGCTACAATGGTACCTCTGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGCAGCGCCGA------------------TGAAC-GCCCGTCC--------GAAA-------GAA---------CACGAGT--------CTGACATTCC-GT--AGGCCACCGGCAATAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACGATGGACGCCGTCCGCGCTGGGC????GGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAAGCGTGTGGGCTCGTCAAGAACCTGTCGCTCATGTGCTACGTAAGTGTAGGTAGTGAAAGCGCGCCTATCATTGACTATATGTCGGGCCGTAACATGGAGCTCCTAGAGGAGTACGACCCGACAATGAATCCCAGCGCTACCAAGGTTTTCGTCAACGGTGTCTGGGTGGGAACACACAACAACCCACAACAACTTGTCACAAACGTTCAAGAACTTCGCCGAAACGGAACCCTGTCGTACGAAATGAGTTTGGTTCGAGACATTCGGGATCGCGAGTTCAAGATCTTCACGGATGCTGGTCGTGTCATGCGGCCGCTTTTTACCGTCGAAAACGACTCTAAGAAGCCGAACAAAGATCAATTGATCTTCAACAGGTACCATCTCGAGAAGCTTTTGCGAGATAAAGAA----GTGGACACATCTGGCATGAA--CGAAGAAGACACCGACGCTCACCAATATGGTTGGAAAGGTCTGCTTCACGACGGTTGCGTTGAGTATCTTGATGCCGAGGAAGAAGAGAGTGCTATGATTGTCATGTCGCCCGAAGATTTGACTGAT 'Didymella aeria CGMCC_3_18353T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGTG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCGGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAATACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTAGTAGCAGAGCAGCAG-GCGCAGGCTTCCGCAGGTGTCGG--CGAGGAGGAAAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella aeria LC_8120' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGTG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCGGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAATACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTAGTAGCAGAGCAGCAG-GCGCAGGCTTCCGCAGGTGTCGG--CGAGGAGGAAAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella aliena CBS_379.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTTGAGCGTATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGTAACAAG-TTCGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGTGCTGGCC????GGGGTCTCGTCTGTCCCGCCGAGACACCTGAGGGACAGGCTTGCGGTTTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCCATCTCTGACTTCATGAGTCAGAGGAACATGCAGCTTCTCGAGGAATATGATCAGAACCAGAATCCGGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCATTCCAACGCACAGCAGCTTGTATCGACCGTCCAGGAGCTGCGCCGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGACCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCGAACCGTAACCACCTCGTTTTCAACCAGGAGCACTATAACAAGTTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTTGG--CGAAGAGGAGAAGACCGAGCTTACATATGGCTGGAAGGGTCTCATCCAAGACGGTGTCATCGAATACCTCGACGCTGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAGGATCTTGGCGAA 'Didymella americana CBS_185.85' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TGTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGCTTGGTCAAGAACCTGTCTCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGTCCCATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAAGAGTACGACCAGAATCAAAACCCAGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCGAACGCCCAGCAGCTCGTATCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCATTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAATCGCAATCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCTGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCGCATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAGTACCTTGACGCCGAAGAAGAAGAGACTGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella anserina CBS_253.80' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTGGATTTGGAGCCTGGTACAATGGACGCAGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTTTAGTCAAGAATCTGTCTCTGATGTGTTACGTCAGTGTTGGTAGCGACGCCGGGCCCATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATATGACCAGAACCAGAATCCAGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTTGGCGTGCATTCCAACGCACAGCAGCTCGTATCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGCGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTATTCGTTGTCGAAAGCGATGTGCGCAAGCCGAACCGTAATCACCTCGTTTTCAATCAAGAGCATTACAATAAGCTGGTGGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--TGAGGAGGAAAAGACTGAGCTGACATACGGCTGGAAAGGTCTCATCCAGGACGGTGTCATCGAATACCTTGACGCGGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTGGGCGAA 'Didymella anserina UTHSC_DI16_255' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTGGATTTGGAGCCTGGTACAATGGACGCAGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTTTAGTCAAGAATCTGTCTCTGATGTGTTACGTCAGTGTTGGTAGCGACGCCGGGCCCATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATATGACCAGAACCAGAATCCAGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTTGGCGTGCATTCCAACGCACAGCAGCTCGTATCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGCGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTATTCGTTGTCGAAAGCGATGTGCGCAAGCCGAACCGTAATCACCTCGTTTTCAATCAAGAGCATTACAATAAGCTGGTGGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--TGAGGAGGAAAAGACTGAGCTGACATACGGCTGGAAAGGTCTCATCCAGGACGGTGTCATCGAATACCTTGACGCGGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTGGGCGAA 'Didymella aquatica CGMCC_3_18349T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TGTCT----TGG-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGACTTGTATGCCCTGCCGAGACGCCTGAAGGGCAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAATGCGCAGCAACTTGTATCAACCGTTCAGGAACTGCGTCGTAACGGAACACTCTCGTACGAGATGAGTTTGATTCGCGACATTCGTGATCGAGAGTTCAAGATCTTCACTGATGCTGGGCGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGACGTTCGCAAGCCGAATCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAA-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCTGAGGATCTTGGTGAA 'Didymella aquatica LC_5555' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TGTCT----TGG-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGACTTGTATGCCCTGCCGAGACGCCTGAAGGGCAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAATGCGCAGCAACTTGTATCAACCGTTCAGGAACTGCGTCGTAACGGAACACTCTCGTACGAGATGAGTTTGATTCGCGACATTCGTGATCGAGAGTTCAAGATCTTCACTGATGCTGGGCGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGACGTTCGCAAGCCGAATCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAA-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCTGAGGATCTTGGTGAA 'Didymella arachidicola CBS_333.75' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTTGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTGGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCTTGATGTGCTATGTCAGTGTGGGTAGCGACGCCGGGCCCATCTCTGACTTCATGAGCCAAAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAATCAAAACCCAGATGCCACGAAAGTCTTTGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTTTCTACTGTTCAGGAGCTCCGCCGTAACGGGACTCTGTCGTATGAGATGAGTTTGATTCGTGATATTCGAGACCGAGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTTGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--TGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTTATCGAATACCTTGACGCAGAAGAGGAAGAAACCGCCATGATTGTCATGTCCCCTGAGGATCTCGGCGAA 'Didymella aurea CBS_269.93T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAAA--------AAT-------GACAT-GC-TTTGC----TCA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTTGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGACCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCCACTAAAGTCTTCGTCAACGGTGTGTGGGTCGGTGTGCACTCCAATGCACAGCAGCTCGTCTCTACCGTCCAGGAGCTTCGTCGCAACGGCACTCTGTCCTATGAGATGAGCTTGATTCGTGATATTCGTGACCGAGAATTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCGAACCGCAATCATCTCGTTTTCAGCCAGGAGCATTACAGCAAGCTGGTGGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAGGAGGAGAAGACCGATCTCACATACGGTTGGAAAGGTCTCATTCAGGATGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAGACTGCTATGATCGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella bellidis CBS_714.85' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAC-GC-TATCC----TCA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTATCTCTCATGTGCTACGTCAGTGTTGGAAGTGACGCTGGTCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAGCTTGTATCAACTGTCCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGTGACATCCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAGCCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCCGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGACGCTGAAGAGGAGGAGACAGCCATGATTGTTATGTCACCCGAGGACCTTGGTGAA 'Didymella boeremae CBS_109942T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGGTGGATAAAAGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCGGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGTCTCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCTGATTTTATGAGCCAGAGGAACATGCAACTTCTCGAGGAGTACGACCAGAACCAAAACCCGGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGCGTGCACTCCAACGCTCAGCAGCTCGTTTCCACCGTCCAGGAGCTGCGCCGTAATGGAACTCTCTCTTACGAAATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAAATCTTCACTGATGCTGGACGTGTCATGAGACCGCTTTTCGTTGTCGAGAGTGACGTTCGCAAGCCGAATCGTAACCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGCGTTGG--CGAAGAGGAGAAGACCGAGCTTACCTATGGTTGGAAGGGTCTCATCCAAGACGGTGTCATCGAATACCTTGACGCTGAAGAGGAGGAGACTGCTATGATTGTCATGTCGCCCGAGGACCTCGGCGAG 'Didymella brunneospora CBS_115.58' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTTGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----CAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCTGCCGAGACACCGGAAGGACAGGCTTGTGGTCTGGTTAAGAATTTGTCCTTGATGTGTTATGTCAGTGTCGGTAGTGATGCTGGGCCTATCTCCGACTTCATGAGCCAGAGAAACATGCAGCTTCTTGAGGAGTACGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTTAATGGTGTGTGGGTTGGTGTGCACTCAAACGCACAACAGCTTGTATCGACTGTCCAGGAATTGCGACGCAACGGCACTCTGTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGCAACCACCTCGTCTTTAATCAGGAACACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTCGG--TGAAGAGGAGAAGAACGAGCTCACCTATGGCTGGAAAGGTCTCATCCAAGATGGTGTCATCGAGTACCTTGACGCTGAAGAAGAGGAGACTGCCATGATCGTCTTCTCGCCCGAGGATCTTGGTGAA 'Didymella chenopodii CBS_128.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACATCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------TTACA--------AAC-------TACAC-GC-TTTAC----GCA-GACG-------GAC---------TGCGAGTG-------CTGACCCCGT-CC--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCTGTCCTCGTCGATTTGGAGCCGGGCACAATGGATGCTGTTCGTGCTGGAC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTATCTCTCATGTGCTACGTCAGTGTTGGAAGTGACGCTGGTCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAGCTTGTATCAACTGTCCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGTGACATCCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAGCCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCCGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGACGCTGAAGAGGAGGAGACAGCCATGATTGTTATGTCACCCGAGGACCTTGGTGAA 'Didymella chloroguttulata CGMCC_3_18351T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCCC----AAA-AACG-------GAC---------TGCGAGTG-------CTGACCTCGT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCAGGTACAATGGACGCTGTCCGTGCTGGAC????GGGGTCTTGTCTGTCCTGCCGAGACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCCACCAAGGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCGACCGTCCAGGAGCTGCGCCGTAACGGAACTCTTTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGCTGTTCGTCGTCGAAAGCGACGTCCGCAAGCCAAATCGCAACCATCTCGTCTTTAGCCAAGAGCATTATAACAAGTTGGTGGCAGAGCAGCAG-GCGATGGCTTCTGCAGGTGTCGG--CGAAGAGGAGAAGACGGAGCTCACATATGGCTGGAAGGGCCTCATTCAAGATGGTGTCATCGAATACCTTGATGCGGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCAGAGGACCTCGGCGAA 'Didymella chloroguttulata LC_8122' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCCC----AAA-AACG-------GAC---------TGCGAGTG-------CTGACCTCGT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCAGGTACAATGGACGCTGTCCGTGCTGGAC????GGGGTCTTGTCTGTCCTGCCGAGACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCCACCAAGGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCGACCGTCCAGGAGCTGCGCCGTAACGGAACTCTTTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGCTGTTCGTCGTCGAAAGCGACGTCCGCAAGCCAAATCGCAACCATCTCGTCTTTAGCCAAGAGCATTATAACAAGTTGGTGGCAGAGCAGCAG-GCGATGGCTTCTGCAGGTGTCGG--CGAAGAGGAGAAGACGGAGCTCACATATGGCTGGAAGGGCCTCATTCAAGATGGTGTCATCGAATACCTTGATGCGGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCAGAGGACCTCGGCGAA 'Didymella coffeae arabicae_CBS_123380T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCT----TTA-GACG-------GCC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGATGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTAAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCTACTGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTGATCCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGACGTTCGCAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTATAACAAGCTGGTAGCAGAGCAGCAG-GCGCAGGCTGCCGCAGGTGTCGG--CGAGGAGGAGAAGACTGACCTCACATACGGTTGGAAGGGTCTCATCCAGGACGGTGTCATTGAATATCTTGACGCAGAAGAGGAAGAGACAGCCATGATCGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella curtisii PD_92_1460' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGTAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTTAGTGTCGGTAGCGACGCGGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCGGATGCTACTAAAGTCTTCGTCAATGGTGTATGGGTCGGTGTGCATTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAATTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAACCACCTCGTCTTCAACCAGGAGCATTACAACAAGCTGGTAGCTGAGCAGCAG-GCACAGGCTTCAGCAGGTGTCGG--TGAAGAGGAGAAGACCGACCTCACATACGGTTGGAAGGGTCTCATCCAGGACGGTGTCATCGAATACCTCGATGCAGAAGAGGAAGAGACTGCCATGATCGTCATGTCACCTGAGGACCTGGGCGAA 'Didymella ellipsoidea CGMCC_3_18350T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCCCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GGGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGTTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGCACGATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAAACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACCTTTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTTGAAGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTTAACGGCGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTGGTATCGACCGTCCAGGAATTGCGCCGTAATGGAACTCTTTCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTTGTTGAGAGCGATGTTCGCAAGCCGAATCGTAACCACCTCGTCTTCAGCCAGGACCACTACAATAAGTTGGTAGCAGAGCAACAG-GCGATGGCCGCTGCAGGTGTCGG--CGAAGAGGAAAAGAACGAGCTTACTTATGGCTGGAAGGGTCTCATTCAGGACGGTGTCATCGAGTACCTTGACGCCGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAAGATCTCGGCGAA 'Didymella ellipsoidea LC_8123' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCCCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GGGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGTTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGCACGATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAAACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACCTTTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTTGAAGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTTAACGGCGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTGGTATCGACCGTCCAGGAATTGCGCCGTAATGGAACTCTTTCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTTGTTGAGAGCGATGTTCGCAAGCCGAATCGTAACCACCTCGTCTTCAGCCAGGACCACTACAATAAGTTGGTAGCAGAGCAACAG-GCGATGGCCGCTGCAGGTGTCGG--CGAAGAGGAAAAGAACGAGCTTACTTATGGCTGGAAGGGTCTCATTCAGGACGGTGTCATCGAGTACCTTGACGCCGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAAGATCTCGGCGAA 'Didymella eucalyptica CBS_377.91' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGTACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------ATT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCACTT-AT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTTGTTAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACACTGTCCTATGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAATCATCTCGTTTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCTCAGGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGATCTCACATACGGCTGGAAGGGTCTTATCCAGGACGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAGACTGCCATGATCGTCATGTCACCTGAGGATCTGGGCGAA 'Didymella exigua CBS_183.55T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTTT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTA--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ATT-------GCCAC-GC-TTTCT----TAA-GACG-------GGC---------TGTGAGTG-------CTGACCTCTT-CT--AGGCGTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCCGCCGAGACACCCGAAGGACAGGCTTGTGGTTTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCCATCTCTGATTTCATGAGCCAGAGGAATATGCAACTTCTTGAGGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCGACCGTACAGGAGCTGCGCCGTAACGGAACTCTTTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCTGGACGTGTCATGAGGCCGCTGTTTGTTGTCGAGAGCGATGTCCGCAAGCCAGACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAGCAAACTGGTAGCGGAGCAGCAG-GCGATGGCTGCCGCAGGTGCCGG--TGAAGAGGAGAAGAGCGAGCTCACATATGGCTGGAAGGGACTCATCCAAGACGGTGTCATCGAGTATCTAGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAGGACCTCGGCGAA 'Didymella gardeniae CBS_626.68T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCAGTTGGAC----AACCATAAA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AACAAACTTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGACCTATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATACGACCAGAACCAGAACCCAGATGCCACCAAAGTCTTCGTCAATGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCTACCGTCCAGGAGCTCCGCCGGAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAATCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCACATATGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella gardeniae UTHSC_DI16_211' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC----AACCACAAA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AACAAACTTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGACCTATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATACGACCAGAACCAGAACCCAGATGCCACCAAAGTCTTCGTCAATGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCTACCGTCCAGGAGCTCCGTCGGAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCACATATGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGACGATCTGGGCGAA 'Didymella gardeniae UTHSC_DI16_226' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC----AACCACAAA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AACAAACTTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGACCTATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATACGACCAGAACCAGAACCCAGATGCCACCAAAGTCTTCGTCAATGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCTACCGTCCAGGAGCTCCGTCGGAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCACATATGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella gardeniae UTHSC_DI16_274' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC----AACCACAAA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AACAAACTTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGACCTATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATACGACCAGAACCAGAACCCAGATGCCACCAAAGTCTTCGTCAATGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCTACCGTCCAGGAGCTCCGTCGGAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCACATATGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella gardeniae UTHSC_DI16_295' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC----AACCACAAA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AACAAACTTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGACCTATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAATACGACCAGAACCAGAACCCAGATGCCACCAAAGTCTTCGTCAATGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCTACCGTCCAGGAGCTCCGTCGGAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCACATATGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella glomerata CBS_528.66' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTGGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAAA--------AAT-------GACAT-GC-TTTGC----TCA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAGACACCTGAAGGAC{AG}AGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGACCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGATGCCACTAAAGTCTTCGTCAACGGTGTGTGGGTCGGTGTGCACTCCAATGCACAGCAGCTCGTCTCTACCGTCCAGGAGCTTCGCCGCAACGGCACTCTGTCCTATGAGATGAGTTTGATCCGTGATATTCGTGACCGAGAATTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCATCTCGTTTTCAGCCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAGGAGGAGAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAG{AG}GGAAGAGACTGCTATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella glomerata UTHSC_DI16_205' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTGGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAAA--------AAT-------GACAT-GC-TTTGC----TCA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGACCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGATGCCACTAAAGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCCAATGCACAGCAGCTCGTCTCTACCGTCCAGGAGCTTCGCCGCAACGGCACTCTGTCCTATGAGATGAGTTTGATCCGTGATATTCGTGACCGAGAATTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCATCTCGTTTTCAGCCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAGGAGGAGAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCTATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella heteroderae CBS_109.92T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_190' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_224' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_227' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_231' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_232' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_234' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_235' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella heteroderae UTHSC_DI16_305' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTACGGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCGGACTTTATGAGCCAACGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACCGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCGTACGAGATGAGTTTAATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCACTGTTCGTTGTCGAGAGCGATGTTCGTAAACCAAACCGTAACCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--CGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCTGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTGGGCGAA 'Didymella ilicicola CGMCC_3_18355T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-GC-TTCAC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGTCCCGCTGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTCTCTCTGATGTGTTACGTCAGTGTTGGCAGCGATGCCGGGCCCATCTCCGATTTCATGAGCCAGAGAAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCGGATGCCACCAAGGTTTTCGTCAATGGTGTATGGGTCGGCGTGCATTCCAACGCACAGCAACTCGTATCCACTGTGCAGGAGCTGCGCCGTAACGGAACTCTCTCTTACGAAATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTATTCGTTGTCGAGAGCGATGTCCGTAAGCCAACTCGCAACCATCTTGTCTTCAGCCAGGACCATTACAGCAAGCTGGTAGCAGAGCAGCAG-GCAATGGCAGCGGCAGGTGTCGG--CGAGGAGGAGAAGACTGAGCTTACCTACGGCTGGAAGGGGCTCATCCAAGACGGTGTCATTGAATACCTTGACGCTGAAGAGGAAGAGACTGCTATGATTGTCATGTCACCCGAAGATCTCGGCGAA 'Didymella ilicicola LC_8127' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-GC-TTCAC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGTCCCGCTGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTCTCTCTGATGTGTTACGTCAGTGTTGGCAGCGATGCCGGGCCCATCTCCGATTTCATGAGCCAGAGAAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCGGATGCCACCAAGGTTTTCGTCAATGGTGTATGGGTCGGCGTGCATTCCAACGCACAGCAACTCGTATCCACTGTGCAGGAGCTGCGCCGTAACGGAACTCTCTCTTACGAAATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTATTCGTTGTCGAGAGCGATGTCCGTAAGCCAACTCGCAACCATCTTGTCTTCAGCCAGGACCATTACAGCAAGCTGGTAGCAGAGCAGCAG-GCAATGGCAGCGGCAGGTGTCGG--CGAGGAGGAGAAGACTGAGCTTACCTACGGCTGGAAGGGGCTCATCCAAGACGGTGTCATTGAATACCTTGACGCTGAAGAGGAAGAGACTGCTATGATTGTCATGTCACCCGAAGATCTCGGCGAA 'Didymella infuscatispora CGMCC_3_18356T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TAA-GACG-------AAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCTGAGACACCCGAAGGCCAGGCTTGCGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTTGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAGGTCTTCGTCAATGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAACAGCTTGTATCGACTGTCCAGGAACTGCGCCGTAACGGAACACTCTCCTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGACGCTGGGCGTGTCATGAGGCCACTGTTCGTCGTCGAGAGCGACGTCCGTAAGCCAAATCGCAACCACCTCGTCTTCAACCAGGAACACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCAGCAGCTGGTGTTGG--CGAAGAAGAGAAGACCGAGCTTGCATATGGTTGGAAGGGTCTCATTCAGGACGGTGTTATCGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCTGAGGATCTCGGTGAA 'Didymella infuscatispora LC_8129' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TAA-GACG-------AAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymella keratinophila UTHSC_DI16_200T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGGATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTGAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACCGTGCAGGAGCTCCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCACCTCGTCTTCAACCAGGATCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGCAAGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGATCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACCGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella keratinophila UTHSC_DI16_228' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGGATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTGAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACCGTGCAGGAGCTCCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCACCTCGTCTTCAACCAGGATCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGCAAGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGATCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACCGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella keratinophila UTHSC_DI16_282' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGGATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTGAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACCGTGCAGGAGCTCCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCACCTCGTCTTCAACCAGGATCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGCAAGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGATCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACCGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella lethalis CBS_103.25' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTTGTTGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTGGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCTTGATGTGTTATGTCAGTGTGGGTAGCGACGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAATCAGAACCCAGATGCTACCAAAGTTTTCGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTCTCTACTGTTCAGGAGCTCCGCCGTAACGGGACTCTGTCTTATGAGATGAGTTTGATTCGTGATATCCGAGACCGGGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--TGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAAACCGCCATGATTGTCATGTCCCCTGAGGATCTCGGCGAA 'Didymella macrophylla CGMCC_3_18357T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TGTCT----TAG-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGACTTGTATGCCCTGCTGAGACGCCTGAAGGGCAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAATGCGCAGCAACTTGTATCAACCGTTCAGGAACTGCGTCGTAACGGAACACTCTCGTACGAGATGAGTTTGATTCGCGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGGCGTGTTATGAGGCCACTGTTCGTTGTCGAGAGCGACGTTCGTAAGCCAAATCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAA-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCTGAGGATCTTGGTGAA 'Didymella macrophylla LC_8132' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TGTCT----TAG-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGACTTGTATGCCCTGCTGAGACGCCTGAAGGGCAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAATGCGCAGCAACTTGTATCAACCGTTCAGGAACTGCGTCGTAACGGAACACTCTCGTACGAGATGAGTTTGATTCGCGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGGCGTGTTATGAGGCCACTGTTCGTTGTCGAGAGCGACGTTCGTAAGCCAAATCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAA-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCTGAGGATCTTGGTGAA 'Didymella macrostoma CBS_223.69' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCATTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGTACCTCGGACCTTCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------TTC-------GATAC-GC-TTTGC----TGA-GACG-------GAC---------CACGAATG-------CTGACCTCGA-TT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCAGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTTGGCAGTGATGCTGGGCCTATCTCCGATTTCATGAGTCAGAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAATCCCGATGCCACCAAGGTTTTCGTAAACGGTGTTTGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTGTCGACCGTCCAGGAACTGCGACGTAACGGTACACTGTCTTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAAATCTTCACGGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTGGAGAGCGATGTCCGCAAGCCGAACCGCAACCACCTCGTCTTTAGCCAGGAACACTACAACAAACTAGTAGCAGAGCAACAA-GCGATGGCAGCTGCTGGTGTTGG--CGAGGAGGAGAAGACTGAGCTCACCTACGGCTGGAAGGGTCTAATCCAAGACGGTGTCATCGAGTACCTCGATGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAA 'Didymella maydis CBS_588.69T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCTG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------AACAC-GC-TATCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGAGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGCTTGGTCAAGAACCTGTCTCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGTCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAAGAGTACGACCAGAACCAAAACCCAGATGCCACTAAGGTTTTCGTCAATGGTGTATGGGTCGGTGTACACTCGAACGCCCAGCAGCTCGTATCTACCGTCCAGGAGCTCCGTCGTAACGGAACGCTGTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGACCATTGTTCGTTGTTGAGAGCGATGTTCGTAAGCCGAACCGTAATCATCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTCGG--AGAAGAGGAGAAGACCGAGCTCGCATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATTTGGGTGAA 'Didymella microchlamydospora CBS_105.95T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----CAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCTGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTTATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAACTTCTCGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAATGCACAGCAGCTGGTATCGACCGTCCAGGAACTGCGCCGTAACGGAACCCTTTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAACCACCTTGTCTTCAGCCAGGAGCACTACAACAAGCTGGTAGCAGAGCAACAG-GCGATGGCTGCTGCAGGTGTTGG--CGAAGAGGAGAAGACCGAGCTCACATATGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAAACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella microchlamydospora UTHSC_DI16_199' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----CAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCTGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTTATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAACTTCTCGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAATGCACAGCAGCTGGTATCGACCGTCCAGGAACTGCGCCGTAACGGAACCCTTTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAACCACCTTGTCTTCAGCCAGGAGCACTACAACAAGCTGGTAGCAGAGCAACAG-GCGATGGCTGCTGCAGGTGTTGG--CGAAGAGGAGAAGACCGAGCTCACATATGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAAACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella microchlamydospora UTHSC_DI16_365' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----CAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCTGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTTATGTGCTACGTCAGTGTTGGTAGTGATGCCGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAACTTCTCGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAATGCACAGCAGCTGGTATCGACCGTCCAGGAACTGCGCCGTAACGGAACCCTTTCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAACCACCTTGTCTTCAGCCAGGAGCACTACAACAAGCTGGTAGCAGAGCAACAG-GCGATGGCTGCTGCAGGTGTTGG--CGAAGAGGAGAAGACCGAGCTCACATATGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAAACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella molleriana CBS_229.79' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTCT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTTGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTTGA--------AAT-------GTCAC-TTCTTTTC----TGA-GACG-------GAC---------TCTGAGTG-------CTGACCTCTC-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCGGGTACAATGGACGCTGTCCGCGCGGGAC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTTGGTAGTGATGCTGGGCCCATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTTCTCGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCAAACGCGCAGCAGCTTGTATCGACCGTCCAGGAACTGCGCCGCAACGGAACACTTTCCTATGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCACTGTTCGTCGTCGAGAGCGATGTTCGTAAGCCAAATCGCAACCACCTTGTCTTCAGCCAGGAACACTACAACAAGCTGGTCGCAGAGCAGCAA-GCAATGGCAGCAGCTGGTGTTGG--CGAAGAAGAGAAGACCGAGCTTACGTATGGTTGGAAGGGTCTCATCCAGGACGGCGTGATCGAGTATCTTGACGCCGAAGAGGAGGAGACTGCCATGATTGTCATGTCACCCGAGGATCTTGGTGAA 'Didymella musae CBS_463.69' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTAGTCAAGAATCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCAACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCTTATGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTCGTTGAGAGCGATGTTCGCAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCTATGGCTGCCGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGACGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAGACTGCCATGATTGTTATGTCACCTGAGGATCTGGGCGAA 'Didymella musae UTHSC_DI16_230' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTAGTCAAGAATCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCAGATGCTACTAAAGTCTTCGTCAACGGTGTGTGGGTTGGTGTGCACTCCAACGCACAGCAGCTCGTATCAACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCTTATGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCGTTGTTCGTCGTTGAGAGCGATGTTCGCAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCTATGGCTGCCGCAGGTGTCGG--CGAGGAAGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGACGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAGACTGCCATGATTGTTATGTCACCTGAGGATCTGGGCGAA 'Didymella negriana CBS_358.71' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCTGTCCGTGCTGGAC????GGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTGGGCCTATCTCGGATTTCATGAGCCAAAGGAATATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGCGTGCACTCCAATGCACAGCAGCTTGTCTCAACCGTCCAGGAACTGCGACGTAACGGAACCCTTTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAAAGCGACGTCCGTAAGCCAAACCGCAATCACCTCGTCTTCAGTCAGGAGCACTACAACAAGCTGGTTGCAGAGCAGCAG-GCAATGGCCGCAGCAGGGGTTGG--CGAAGAAGAGAAGACCGAGCTTACATATGGCTGGAAGGGTCTCATCCAGGATGGTGTCATCGAGTACCTTGATGCTGAAGAAGAGGAGACTGCTATGATTGTCATGTCGCCCGAGGATCTTGGTGAG 'Didymella negriana ICMP_10845' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCTGTCCGTGCTGGAC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymella nigricans PD_77_919' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCCGCCGAAACACCTGAAGGACAAGCGTGTGGCTTGGTCAAGAACCTGTCCTTGATGTGCTATGTCAGTGTGGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCAGATGCTACTAAAGTCTTCGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCTACTGTCCAGGAGCTCCGCCGTAACGGGACTCTGTCCTATGAGATGAGTTTGATTCGTGATATTCGAGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCATTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCCGCAGCAGGTGTCGG--TGAGGAGGAGAAAACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTTATCGAATACCTTGACGCAGAGGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTCGGCGAG 'Didymella ocimicola CGMCC_3_18358T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTGAAAAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGAGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TCA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTTCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymella ocimicola LC_8138' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTGAAAAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGAGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCC----TCA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTTCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymella pedeiae CBS_124517T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTCAC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCTG-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGTCCCGCCGAGACACCTGAAGGACAAGCATGTGGTTTGGTCAAGAACCTGTCACTGATGTGTTACGTCAGTGTTGGCAGCGATGCCGGGCCCATCTCCGATTTCATGAGCCAGAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCGGATGCCACCAAGGTTTTCGTCAATGGTGTATGGGTCGGCGTGCATTCCAACGCACAGCAACTGGTATCCACTGTGCAGGAGCTGCGCCGTAACGGAACTCTCTCCTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTCAAGATTTTCACTGATGCCGGACGCGTCATGAGGCCGCTATTCGTTGTCGAGAGCGACATTCGTAAGCCAACTCGCAATCAACTCGTCTTCAGCCAGGAGCATTACAGCAAGCTAGTAGCAGAGCAGCAG-GCAATGGCAGCGGCAGGTGTCGG--CGAGGAGGAAAAGACTGAGCTTACTTACGGCTGGAAGGGCCTTATCCAAGACGGTGTCATCGAATACCTTGACGCTGAAGAGGAAGAGACTGCTATGATTGTCATGTCACCCGAAGATCTCGGCGAA 'Didymella pinodella CBS_531.66' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCACTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTTGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTGGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCTTGATGTGTTATGTCAGTGTGGGTAGCGACGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAATCAGAACCCAGATGCTACCAAAGTTTTCGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACTGTTCAGGAGCTCCGCCGTAACGGGACTCTGTCTTATGAGATGAGTTTGATTCGTGATATCCGAGACCGAGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTCGG--TGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTTATCGAATACCTTGACGCAGAAGAGGAAGAAACCGCCATGATTGTCATGTCCCCTGAGGATCTCGGCGAA 'Didymella pinodes CBS_374.84' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTTGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTGGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCTTGATGTGTTATGTCAGTGTGGGTAGCGACGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAATCAGAACCCAGATGCTACCAAAGTTTTCGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACTGTTCAGGAGCTCCGCCGTAACGGGACTCTGTCTTATGAGATGAGTTTGATTCGTGATATCCGAGACCGGGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTTGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTCGG--TGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAAACCGCCATGATTGTCATGTCCCCTGAGGATCTCGGCGAA 'Didymella pinodes CBS_525.77T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTTCTTGTCGATTTGGAGCCTGGAACAATGGACGCCTTCCGCGCTGGCC????GGGGTCTGGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCTTGATGTGTTATGTCAGTGTGGGTAGCGACGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAATCAGAACCCAGATGCTACCAAAGTTTTCGTTAATGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACTGTTCAGGAGCTCCGCCGTAACGGGACTCTGTCTTATGAGATGAGTTTGATTCGTGATATCCGAGACCGGGAGTTTAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAACCACCTTGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTCGG--TGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCAGAAGAGGAAGAAACCGCCATGATTGTCATGTCCCCTGAGGATCTCGGCGAA 'Didymella pomorum CBS_285.76' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGTTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-GC-TTTCC----TTA-GACG-------GGC---------TGCGAGTA-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTGGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAATACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAAGAGCTCCGTCGTAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTAGTGGCAGAACAGCAG-GCGCAGGCTTCCGCAGGTGTCGG--CGAGGAGGAGAAGACCGACCTCACATACGGCTGGAAGGGTCTCATCCAGGACGGCGTCATCGAATACCTTGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTGGGCGAA 'Didymella protuberans CBS_381.96T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-CC-TTTCT----TTG-GACG-------GAC---------CACGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAAACACCTGAAGGACAAGCGTGTGGCTTGGTCAAGAACCTGTCCTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAATGGTGTTTGGGTCGGCGTGCACTCCAACGCACAGCAGCTCGTCTCTACTGTTCAGGAGCTCCGCCGTAATGGAACTCTGTCCTATGAGATGAGTTTGATTCGTGATATTCGAGACCGAGAATTCAAGATCTTCACTGATGCTGGGCGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTGGG--CGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTTATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTCGGCGAA 'Didymella protuberans FMR_13795' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-CC-TTTCT----TTG-GACG-------GAC---------CACGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGAACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAAACACCTGAAGGACAAGCGTGTGGCTTGGTCAAGAACCTGTCCTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAATGGTGTTTGGGTCGGCGTGCACTCCAACGCACAGCAGCTCGTCTCTACTGTTCAGGAGCTCCGCCGTAATGGAACTCTGTCCTATGAGATGAGTTTGATTCGTGATATTCGAGACCGAGAATTCAAGATCTTCACTGATGCTGGGCGCGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCGAACCGCAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTGGTCGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTGGG--CGAGGAAGAGAAGACCGACCTCACGTACGGTTGGAAGGGTCTCATCCAGGATGGTGTTATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATCTCGGCGAA 'Didymella protuberans UTHSC_DI16_302' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymella pteridis CBS_379.96T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---ACTTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACTATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTTCAGCTCGAGCGCATGAATGTCTACTTTAATGAGGTG---------GG--------AGT-------GATAC-GC-TACAA----CAA-GACA-------GTT---------TGCGCGTG-------CTAATCTCTC-CT--AGGCGTCTGGCAACAAG-TTTGTCCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGGCAGGCTTGCGGTTTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTTATGAGCCAAAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAGGTCTTCGTCAATGGTGTGTGGGTCGGTGTGCACTCCAACGCGCAGCAGCTTGTATCGACTGTCCAGGAACTGCGCCGTAACGGAACACTCTCCTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCTGGGCGTGTCATGAGGCCACTGTTCGTTGTTGAGAGCGACGTCCGTAAGCCAAATCGCAACCACCTCGTCTTCAACCAGGAACATTACAGCAAGCTGGTCGCCGAGCAGCAG-GCAATGGCAGCAGCTGGCGTTGG--CGAAGAAGAGAAGACCGAGCTTGCATATGGTTGGAAGGGCCTCATACAGGACGGTGTCATCGAGTACCTAGATGCCGAAGAGGAGGAGACAGCCATGATTGTCATGTCACCCGAGGATCTTGGCGAA 'Didymella rhei CBS_109177' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------ATT-------GACAC-GC-TTTCC----TAC-CACG-------GAC---------TGCGGGTG-------CTGACCTCTT-CC--AGGCCTCCGGCAACAAA-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTTCGCGCGGGTC????GGGGCCTCGTCTGCCCCGCCGAGACACCAGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCCATTTCAGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAAAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTATCGACTGTCCAGGAACTGCGCCGCAATGGAACACTTTCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGAGTCATGAGACCGCTGTTCGTTGTCGAGAGTGACGTACGTAAGCCGAACCGCAATCATCTCGTCTTCAGCCAGGAGCACTACAACAAGTTGGTAGCAGAGCAGCAG-GCGATGGCCGCAGCAGGTGTTGG--CGAAGAGGAGAAGAGTGAGCTCGCATATGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAATACCTGGACGCAGAAGAGGAGGAAACAGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella rumicicola CBS_179.97' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTTT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGTGAGCATGGACTCGAC-GGCTCCGGTGT------------------------------------------------------------TTACAATGGCACTTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------ATT-------GTCTT-GC-TCTTG----GAA-GACG-------TAC---------TGTGTGTG-------CTGACCTCTT-GT--AGGCGTCTGGTAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCCGCCGAGACACCCGAAGGACAGGCCTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTATGTGAGCGTCGGTAGTGATGCCGGGCCCATCTCTGACTTCATGAGTCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAATGCACAGCAGCTTGTATCGACCGTCCAGGAACTGCGCCGTAATGGAACTCTTTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCCGGGCGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAAGAGCACTACAACAAACTCGTAGCGGAGCAGCAG-GCCATGGCTGCAGCAGGTGCCGG--CGAAGAGGAGAAGAGCGAGCTTACATATGGCTGGAAGGGACTTATCCAAGACGGTGTCATTGAGTACCTCGATGCTGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella rumicicola CBS_683.79T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GTTTTT-ACCTAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGTGAGCATGGACTCGAC-GGCTCCGGTGT------------------------------------------------------------TTACAATGGCACTTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------ATT-------GTCTT-GC-TCTTG----GAA-GACG-------TAC---------TGTGTGTG-------CTGACCTCTT-GT--AGGCGTCTGGTAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCCGCCGAGACACCCGAAGGACAGGCCTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTATGTGAGCGTCGGTAGTGATGCCGGGCCCATCTCTGACTTCATGAGTCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAATGCACAGCAGCTTGTATCGACCGTCCAGGAACTGCGCCGTAATGGAACTCTTTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCCGGGCGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAAGAGCACTACAACAAACTCGTAGCGGAGCAGCAG-GCCATGGCTGCAGCAGGTGCCGG--CGAAGAGGAGAAGAGCGAGCTTACATATGGCTGGAAGGGACTTATCCAAGACGGTGTCATTGAGTACCTCGATGCTGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAGGATCTCGGCGAA 'Didymella sancta CBS_281.83T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TTA-GGCG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCTGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTATTCGTAAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTGCAGGAGCTCCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCTCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCGAACCGTAATCATCTCGTCTTCAACCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGCAGGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGACCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATTGAATACCTCGACGCAGAAGAGGAAGAGACCGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella sancta CBS_644.97' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCAGATGCTACCAAAGTCTTCGTAAATGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTGCAGGAGCTCCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAATCATCTCGTCTTCAACCAGGAGCATTACAACAAGCTGGTAGCAGAGCAGCAG-GCGCAGGCTGCCGCAGGTGTCGG--TGAGGAGGAGAAGACCGACCTCACATACGGTTGGAAGGGTCTCATCCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACCGCCATGATCGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella segeticola CGMCC_3_17489T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAC-GC-TATCC----TTA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCCGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTATCTCTCATGTGCTACGTCAGTGTTGGAAGTGACGCTGGTCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAGCTTGTATCAACTGTCCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAACCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCCGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCTGAAGAGGAGGAGACAGCTATGATAGTTATGTCACCCGAGGATCTTGGTGAA 'Didymella segeticola CGMCC_3_17498' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAC-GC-TATCC----TTA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCCGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTATCTCTCATGTGCTACGTCAGTGTTGGAAGTGACGCTGGTCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAATCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAGCTTGTATCAACTGTCCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGTGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAACCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCCGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCTGAAGAGGAGGAGACAGCTATGATAGTTATGTCACCCGAGGATCTTGGTGAA 'Didymella segeticola LC_8141' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAC-GC-TATCC----TTA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCCGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTTGGAAGTGACGCTGGTCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAGCTTGTATCAACTGTCCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGTGTCATGAGGCCACTGTTTGTGGTCGAGAGCGACGTTCGTAAGCCAAATCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCTGAAGAGGAGGAGACAGCTATGATTGTTATGTCACCCGAGGATCTTGGTGAA 'Didymella sinensis LC_8142' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AACTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------AACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGGC????GGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAATACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTAGTAGCAGAGCAGCAG-GCGCAGGCTTCCGCAGGTGTCGG--CGAGGAGGAAAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella sinensis LC_8143' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AACTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------AACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGGC????GGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCATGTGGTTTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAATACGACCAGAACCAGAACCCAGATGCTACTAAAGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTCTCTACCGTTCAGGAGCTCCGCCGTAACGGAACTCTGTCCTACGAGATGAGTTTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACTGATGCTGGACGCGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGTAATCACCTCGTTTTCAACCAGGAGCATTACAACAAGCTAGTAGCAGAGCAGCAG-GCGCAGGCTTCCGCAGGTGTCGG--CGAGGAGGAAAAGACCGACCTCACATACGGTTGGAAGGGTCTCATTCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAGGAAGAGACTGCCATGATTGTCATGTCACCTGAGGATTTGGGCGAA 'Didymella subglomerata CBS_110.92' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCCGGCGAGCATGGCCTTGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAT-AC-CGTCC----TTA-GACG-------GAC---------TGCGAGTG-------CTGACTGCTT-CT--AGGCCTCCGGCAACAAA-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGAACGATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAAGCTTGTGGTTTAGTCAAGAACCTGTCTCTGATGTGTTACGTCAGTGTTGGTAGCGACGCCGGTCCGATTTCTGACTTCATGAGCCAGAGGAACATGCAGCTGCTTGAGGAATACGACCAGAATCAGAATCCAGATGCCACTAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAACGCACAGCAGCTTGTGTCCACTGTCCAGGAGCTCCGCCGTAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCATTGTTCGTTGTCGAGAGCGATGTTCGTAAGCCGAACCGCAATCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAGCAG-GCAATGGCTGCCGCAGGTGTTGG--AGAAGAGGAGAAGACCGAGCTCACATACGGTTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATTTGGGCGAA 'Didymella suiyangensis CGMCC_3_18352T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAT-GC-TATCC----TAA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTCGGAAGTGACGCTGGGCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAACTTGTATCAACTGTTCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGCGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGGGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAGCCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCTGAAGAGGAGGAGACAGCCATGATTGTTATGTCACCCGAGGATCTTGGTGAA 'Didymella suiyangensis LC_8144' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAG--GTTTCT-ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGACTGGAC---AATTTA--AA--CC-ACTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACAT-GC-TATCC----TAA-GACG-------GGC---------TGCGAGTG-------CTGACCTCTT-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCTGTTCGCGCTGGCC????GGGGTCTTGTATGCCCGGCCGAGACGCCCGAAGGGCAGGCTTGCGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTCGGAAGTGACGCTGGGCCCATCTCCGATTTCATGAGCCAGAGGAATATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGATGCTACCAAAGTTTTCGTCAATGGTGTTTGGGTTGGTGTGCACTCCAACGCGCAACAACTTGTATCAACTGTTCAGGAACTGCGTCGTAACGGAACACTCTCCTACGAGATGAGCTTGATTCGCGACATTCGTGATCGAGAGTTCAAGATCTTTACAGATGCCGGGCGGGTCATGAGGCCACTGTTCGTGGTCGAGAGCGACGTTCGTAAGCCAAACCGAAACCACCTCGTCTTCAGCCAAGAGCACTACAGCAAGCTGGTCGCAGAGCAGCAG-GCAATGGCAGCAGCAGGTGTCGG--CGAAGAAGAGAAAAACGAGCTTGCATATGGTTGGAAGGGTCTCATACAGGACGGTGTTATTGAGTACCTCGATGCTGAAGAGGAGGAGACAGCCATGATTGTTATGTCACCCGAGGATCTTGGTGAA 'Didymella viburnicola CBS_523.73' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGTTCCGGTGT------------------------------------------------------------TTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA---------GG--------ACC-------GACGC-GC-TTTCA----CGA-GAAC-------GAC---------CGCGCGTG-------CTGATCTCCC-CCTTAGGCATCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGCC????GGGGTCTCGTCTGCCCCGCCGAGACACCAGAAGGACAGGCTTGTGGACTCGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCTGGGCCCATCTCCGACTTCATGAGCCAGAGAAACATGCAGCTTCTTGAAGAGTACGATCAGAACCAGAATCCTGACGCCACCAAAGTTTTCGTCAATGGTGTGTGGGTCGGTGTGCACTCCAACGCGCAACAACTTGTCTCGACTGTGCAGGAACTGCGACGTAACGGTACCCTGTCCTACGAGATGAGTTTGATTCGTGACATTCGTGATCGGGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTTCGCAAGCCGAACCGTAATCACCTCGTCTTCAACCAGGAGCACTACAACAAGCTGGTAGCAGAGCAACAG-GCGATGGCCGCTGCCGGCGTCGG--TGAAGAGGAGAAGACTGAGCTCACCTATGGCTGGAAAGGTCTCATCCAAGATGGTGTCATCGAGTACCTCGACGCCGAAGAAGAGGAAACCGCCATGATTGTTATGTCGCCTGAGGACCTTGGCGAA 'Dothidotthia aspera CPC_12932' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGACTTATAGGG-GAGGCG-ACATGCAACC-AGCCCCGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia symphoricarpi CPC_12929' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCAGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Ectophoma multirostrata CBS_110.79' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTACTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCCCTTATGTGCTACGTCAGCGTCGGTAGTGATGCCGGACCTATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCAACCGTGCAAGAACTACGTCGCAACGGAACCCTCTCATACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAATTCAAGATTTTCACAGATGCTGGACGTGTTATGAGACCTCTCTTCGTTGTGGAGAGCGACGTCCGTAAGCCGAACCGAAATCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTCGCAGAGCAACAG-GCAATGGCTGCAGCAGGCGTGGG--TGAAGAAGAGAAGACAGAGCTCACATATGGCTGGAAAGGTCTCATCCAAGACGGTGTTATCGAGTACCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ectophoma multirostrata CBS_274.60T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTACTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCCCTTATGTGCTACGTCAGCGTCGGTAGTGATGCCGGACCTATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTATGATCAAAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCAACCGTGCAAGAACTACGTCGCAACGGAACCCTATCATACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAATTCAAGATTTTCACAGATGCTGGACGTGTTATGAGACCTCTCTTCGTTGTGGAGAGCGACGTCCGTAAGCCGAACCGAAATCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTCGCAGAGCAACAG-GCAATGGCTGCAGCAGGCGTGGG--TGAAGAAGAGAAGACAGAGCTCACATATGGCTGGAAAGGTCTCATCCAAGACGGTGTTATCGAGTACCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ectophoma multirostrata CBS_368.65' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTACTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCCCTTATGTGCTACGTCAGCGTCGGTAGTGATGCCGGACCTATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCAACCGTGCAAGAACTACGTCGCAACGGAACCCTCTCATACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAATTCAAGATTTTCACAGATGCTGGACGTGTTATGAGACCTCTCTTCGTTGTGGAGAGCGACGTCCGTAAGCCGAACCGAAATCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTCGCAGAGCAACAG-GCAATGGCTGCAGCAGGCGTGGG--TGAAGAAGAGAAGACAGAGCTCACATATGGCTGGAAAGGTCTCATCCAAGACGGTGTTATCGAGTACCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Ectophoma pereupyrena CBS_267.92T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-ACATTTAA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACTATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCCCTTATGTGCTACGTCAGTGTCGGTAGTGATGCCGGACCTATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTCGTCTCGACCGTGCAGGAATTACGTCGCAACGGAACCCTATCATACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAATTCAAGATTTTCACAGATGCTGGACGTGTTATGAGACCTCTCTTCGTCGTGGAGAGCGATGTCCGTAAGCCGAACCGAAATCACCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTTGCAGAGCAACAG-GCAATGGCTGCAGCGGGCGTGGG--TGAAGAAGAGAAGACGGAGCTCACATATGGCTGGAAAGGCCTCATCCAAGACGGTGTTATCGAGTACCTTGACGCTGAAGAGGAGGAGACTGCCATGATTGTTATGTCGCCCGAGGATCTCGGCGAG 'Epicoccum brasiliense CBS_120105T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTCA-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAACCTGTCTTTGATGTGTTACGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCCGATGCTACCAAGGTTTTCGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCGCAACAGCTCGTGTCCACAGTGCAGGAACTGCGTCGTAACGGTACCCTCTCTTACGAGATGAGTTTGATCCGAGACATTCGTGATCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTTGAGAGCGACGTCCGTAAGCCAAACCGCAACCATCTGGTGTTCAACCAAGAGCACTACAACAAGCTGGTGGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTCGG--AGAGGAGGAGAAGACAGAGCTCACGTACGGCTGGAAGGGTCTCATTCAGGACGGTGTCATTGAATACCTCGACGCCGAAGAAGAGGAAACCGCCATGATTGTCATGTCGCCCGAAGATCTCGGCGAG 'Epicoccum camelliae CGMCC_3_18343T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae LC_4862' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTTGTGAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_201' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCT----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTTGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_202' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCT----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_206' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_280' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCT----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_338' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCT----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTTGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTTGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum camelliae UTHSC_DI16_345' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCT----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGCCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGAGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Epicoccum catenisporum CBS_181.80T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AGA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGCCTCGTGTGCCCCGCTGAGACACCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCCCTAATGTGCTACGTCAGTGTCGGTAGTGATGCTGGGCCCATTTCTGACTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAACCAGAATCCCGATGCTACCAAGGTTTTTGTCAACGGTGTATGGGTCGGTGTGCATTCCAATGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGCCGTAATGGAACACTGTCCTACGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAAATCTTCACGGACGCTGGGCGTGTCATGAGACCTCTTTTCGTAGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAACCAAGATCACTACAACAAGCTGGTTCAAGAGCAACAG-GCAATGGCTCAAGCAGGCATCGG--CGAGGAGGAGAAGACGGAATTCACATATGGCTGGAAAGGTCTCATTCAGGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACCGCCATGATTGTCATGTCACCCGAAGACCTCGGCGAG 'Epicoccum dendrobii CGMCC_3_18359T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum dendrobii LC_8146' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum draconis CBS_186.83' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AATACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCGTCA-CT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGTC????GGGGTCTCGTGTGCCCTGCCGAAACGCCAGAAGGACAGGCTTGCGGTCTTGTCAAGAACCTATCTCTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTCCTTGAGGAGTACGATCAGAACCAGAACCCTGACGCCACCAAGGTTTTCGTCAACGGTGTGTGGGTGGGTGTCCACTCCAACGCGCAGCAGCTCGTGTCCACAGTGCAGGAACTGCGTCGTAACGGCACACTCTCTTACGAGATGAGTTTGATTCGTGATATCCGTGATCGGGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGTGACGTTCGTAAGCCAAACCGCAACCACCTGGTATTTAACCAGGAGCACTACAATAAGCTGGCGGCGGAGCAGCAA-GCAAACAATGCGGCAGGTGTTCG--AGAAGAGGAGAGGCTAGAGCTCAAGTACGGCTGGAAGGGCCTCATCCAGGACGGCGTTATTGAGTACCTCGACGCCGAAGAGGAAGAGACCGCTATGATTGTCATGTCGCCCGAAGACCTTGGCGAG 'Epicoccum duchesneae CGMCC_3_18345T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GAAG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum duchesneae LC_8147' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GAAG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum henningsii CBS_104.80' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGT--TTTATAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAT-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCAGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GT-TCCCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTCAAGAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGACCCATCTCTGACTTCATGAGCCAGCGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGATGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCCAACGCACAGCAGCTCGTGTCCACAGTGCAGGAACTGCGTCGCAACGGAACCCTGTCCTACGAGATGAGTTTGATCCGAGATATTCGTGACCGAGAGTTCAAGATCTTTACAGACGCTGGACGTGTCATGCGACCTCTGTTCGTTGTAGAGAGTGACGTACGTAAGCCAAACCGCAACCATTTGGTATTCAACCAGGACCACTACAACAAGCTGGTAGCGGAGCAGCAA-GCAATGGCCTCGGCGGGTGTTGG--AGAGGAAGAGAAGACAGATCTCACTTATGGCTGGAAGGGTCTCATCCAGGATGGTGTCATCGAATATCTTGACGCTGAAGAAGAGGAGACTGCCATGATCGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum hordei CGMCC_3_18360T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTGCCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-AC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTTGATTTGGAGCCTGGTACAATGGACGCTGTCCGTGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum hordei LC_8149' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTGCCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-AC--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTTGATTTGGAGCCTGGTACAATGGACGCTGTCCGTGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum huancayense CBS_105.80T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------GAC-------GTCGC-TC-TTGTC----ATG-AAGG-------GAC---------TGCGAGTG-------CTGACCCTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCTGCCGAAACACCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTCGAAGAGTACGACCAAAACCAGAACCCTGACGCCACAAAGGTCTTTGTCAACGGAGTCTGGGTTGGCGTGCACAACAATGCACAGCAACTCGTTTCCACAGTGCAGGAACTGCGCCGCAACGGAACTCTATCCTACGAAATGAGTTTGATCCGAGACATTCGTGACCGCGAGTTCAAAATCTTCACAGATGCTGGACGTGTCATGAGACCTCTCTTCGTTGTCGAGAGTGACGTACGCAAATTGAACCGCAACCACCTCGTTTTCAATCAGGAGCACTACAACAAGCTGGTCGCAGAGCAACAA-GCAATGGCTGCTGCAGGAGTCGG--CGAGGAAGAGAAGACTGGACTTGCTTATGGTTGGAAGGGTCTCATCCAAGACGGTGTCATCGAGTACCTCGATGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum italicum CGMCC_3_18361T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCCTTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGCC????GGGGTCTTGTATGCCCCGCCGAGACACCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCGCTGATGTGCTACGTCAGTGTTGGTAGCGATGCCGGGCCCATATCCGAGTTCATGAAGCAGCGAAACATGCAGGTCCTTGAAGAATATGATCAAGCCCAAAATCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTTCACTCCAACGCGCAGCAGCTCGTCTCCACAGTGCAGGAGCTTCGCCGCAATGGAACCCTATCCTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTTACAGATGCTGGACGTGTTATGAGGCCTCTTTTCGTAGTGGAGAACGACGTGCGCAAGCCGAATAGGAATCACCTCGTCTACAACCAAGAACACTACAACAAACTAGCCCAAGAGCAAATG-GCAATGACTCAGGCAGGCGTCGG--CGAGGAAGAGAAGC------AGCCTTATGGTTGGAAGGGCCTGATCCAAGATGGTATCATCGAATACCTTGACGCTGAAGAGGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum italicum LC_8151' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCCTTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGCC????GGGGTCTTGTATGCCCCGCCGAGACACCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCGCTGATGTGCTACGTCAGTGTTGGTAGCGATGCCGGGCCCATATCCGAGTTCATGAAGCAGCGAAACATGCAGGTCCTTGAAGAATATGATCAAGCCCAAAATCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTTCACTCCAACGCGCAGCAGCTCGTCTCCACAGTGCAGGAGCTTCGCCGCAATGGAACCCTATCCTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTTACAGATGCTGGACGTGTTATGAGGCCTCTTTTCGTAGTGGAGAACGACGTGCGCAAGCCGAATAGGAATCACCTCGTCTACAACCAAGAACACTACAACAAACTAGCCCAAGAGCAAATG-GCAATGACTCAGGCAGGCGTCGG--CGAGGAAGAGAAGC------AGCCTTATGGTTGGAAGGGCCTGATCCAAGATGGTATCATCGAATACCTTGACGCTGAAGAGGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum keratinophilum CBS_142455T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ATATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCTACAGTGCAGGAACTGCGCCGCAACGGAACCCTCTCTTACGAGATGAGTTTGATCCGAGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTGGTATTCAACCAGGAGCACTACAACAAGCTGGTCGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCACGTATGGCTGGAAGGGACTCATCCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum keratinophilum UTHSC_DI16_244' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ATATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCTACAGTGCAGGAACTGCGCCGCAACGGAACCCTCTCTTACGAGATGAGTTTGATCCGAGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTGGTATTCAACCAGGAGCACTACAACAAGCTGGTCGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCACGTATGGCTGGAAGGGACTCATCCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum keratinophilum UTHSC_DI16_258' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ATATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCTACAGTGCAGGAACTGCGCCGCAACGGAACCCTCTCTTACGAGATGAGTTTGATCCGAGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTGGTATTCAACCAGGAGCACTACAACAAGCTGGTCGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCACGTATGGCTGGAAGGGACTCATCCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum keratinophilum UTHSC_DI16_272' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ATATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCCTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCTACAGTGCAGGAACTGCGCCGCAACGGAACCCTCTCTTACGAGATGAGTTTGATCCGAGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTGGTATTCAACCAGGAGCACTACAACAAGCTGGTCGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCACGTATGGCTGGAAGGGACTCATCCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum keratinophilum UTHSC_DI16_299' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--ATATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGTTACGTCAGTGTTGGTAGCGATGCCGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCGGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCTACAGTGCAGGAACTGCGCCGCAACGGAACCCTCTCTTACGAGATGAGTTTGATCCGAGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTGGTATTCAACCAGGAGCACTACAACAAGCTGGTCGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCACGTATGGCTGGAAGGGACTCATCCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAAGAGGAGACGGCCATGATTGTCATGTCGCCCGAAGACCTCGGCGAG 'Epicoccum latusicollum CGMCC_3_18346T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAAGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTACGATCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAATTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGCAG-GCGATGGCACAAGCAGGCATAGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTAATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAGGACCTCGGTGAG 'Epicoccum latusicollum LC_4859' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAAGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTACGATCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAATTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGCAG-GCGATGGCACAAGCAGGCATAGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTAATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAGGACCTCGGTGAG 'Epicoccum latusicollum UTHSC_DI16_197' GCGTCCGAGTTGTAATTTGCACAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAAGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTACGATCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAATTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGCAG-GCGATGGCACAAGCAGGCATAGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTAATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAGGACCTCGGTGAG 'Epicoccum layuense CGMCC_3_18362T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TAA-CACG-------GAC---------TGCGAGTG-------CTGACCTTTC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum layuense LC_8156' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TAA-CACG-------GAC---------TGCGAGTG-------CTGACCTTTC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum nigrum CBS_125.82' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGCGCCGGCC????GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCATGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCCATATCCGACTTCATGAGCCAGCGAAACATGCTGGTGCTCGAAGAATATGATCAAAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACAGTGCAAGAGCTTCGCCGTAATGGAACCCTCTCCTACGAGATGAGTCTGATTCGAGACATCCGTGATCGAGAATTCAAGATCTTTACAGATGCTGGACGTGTCATGAGGCCTCTCTTCGTGGTGGAGAACGACGTGCGCAAGCCCAATAGGAACCACCTCGTCTACAACCAGGATCACTACGGCAAGCTCGCTCGAGAGCAACAA-GCAATGACCCAGGCAGGCGTCGG--TGAGGAAGAGGGGCTGCCAGAAACTTATGGCTGGAAGGGCCTTATCCAAGATGGTGTTATTGAATACCTGGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum nigrum CBS_173.73T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGCGCCGGCC????GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCATGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCCATATCCGACTTCATGAGCCAGCGAAACATGCTGGTGCTCGAAGAATATGATCAAAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACGGTGCAGGAGCTTCGCCGTAATGGAACCCTCTCTTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTTATGAGGCCTCTCTTCGTGGTGGAGAATGACGTGCGCAAGCCTAACAGGAATCACCTCGTCTATAACCAAGAGCACTACGGCAAGCTGGCCCGAGAGCAACAG-GCAATGACCCAGGCAGGCATCGG--CGAGGAAGAGGGGCTGCCAGAAACTTATGGCTGGAAGGGCCTTATTCAAGATGGTGTTATTGAATACCTGGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGTGAG 'Epicoccum ovisporum CBS_180.80T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-AT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTGCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGTCCCGCCGAAACACCTGAAGGGCAGGCCTGTGGTCTCGTCAAGAACCTGTCCCTGATGTGCTACGTCAGTGTCGGTAGTGACGCGGGGCCCATTTCTGACTTTATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAGAACCAGAACCCCGATGCTACAAAGGTTTTCGTCAACGGTGTATGGGTCGGTGTGCACTCTAATGCACAGCAGCTTGTCTCTACAGTGCAAGAGTTGCGCCGTAATGGAACACTATCCTACGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAATTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCTCTTTTCGTGGTGGAGAGCGATGTGCGCAAGCCAAACCGCAACCACCTCGTCTTCAACCAGGAACACTACAACAAGCTAGTTCAAGAGCAACAG-GCAATGGCTCAAGCAGGCGTCGG--CGAAGAGGAGAAGACACAGTTCACTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCGGAAGAAGAGGAGACCGCCATGATTGTCATGTCACCCGAAGACCTTGGCGAG 'Epicoccum pimprinum PD_77_1028' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG---GTATT-ATCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GATCTTATAGGG-GAGACG-CAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTTGTTTCC--TCGGCGGGT-CCGCCCG--CCGA--AGACACCAATTCA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ACAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-GC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCCGCCGAAACACCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACCTGTCCCTGATGTGCTACGTGAGTGTCGGTAGCGATGCCGGGCCCATTTCCGACTTTATGAGCCAGCGAAATATGCAACTCCTTGAAGAGTATGATCAAAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTTTGGGTTGGCGTGCATTCCAATGCACAGCAGCTTGTCTCAACAGTGCAGGAACTTCGCCGGAACGGAACCTTGTCCTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTTATGAGACCTCTTTTCGTGGTGGAGAGCGATGTGCGCAAGCCGAATAAGAACCATCTAGTCTTCAACCAAGACCACTACAACAAGCTAGTCGCAGAGCAACAG-GCAATGGCTCAAGCAGGCATCGG--CGAGGAAGAGAAGACAGAGTATACTTATGGTTGGAAAGGGCTCATCCAAGACGGTGTCATCGAATATCTTGATGCTGAAGAAGAAGAGACCGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAA 'Epicoccum plurivorum CBS_558.81T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTACAGTACC--TTCGTTTCC--TCGGCGGGT-TCGCCCG--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GGCG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTCAAGAACCTTTCTTTGATGTGTTACGTCAGTGTCGGTAGCGATGCCGGGCCCATCTCTGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGATGCTACCAAGGTTTTTGTCAACGGTGTGTGGGTCGGTGTGCATTCCAATGCACAGCAGCTTGTATCTACTGTGCAGGAACTGCGTCGCAACGGAACCTTATCCTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGCGACCTCTCTTCGTCGTAGAGAGTGACGTTCGTAAGCCAAACCGCAACCACCTGGTGTTCAACCAGGAGCACTATAACAAGCTGGTGGCGGAGCAGCAA-GCAATGGCTTCGGCAGGTGTTGG--AGAGGAAGAGAAGACGGAGCTCGCTTATGGCTGGAAGGGTCTCATCCAGGATGTTGTGATTGAGTACCTCGACGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGACCTTGGCGAG 'Epicoccum pneumoniae UTHSC_DI16_257' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGT-GGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGTTA-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTCGTATGCCCCGCTGAGACGCCTGAAGGACAGGCCTGTGGTCTCGTTAAGAACTTGTCTCTGATGTGCTACGTCAGCGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGATCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGCAG-GCGATGGCTCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGCCTCATTCAAGACGGTGTCATTGAATATCTCGACGCCGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAGGACCTCGGCGAG 'Epicoccum poae CGMCC_3_18363T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCATGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCCATATCCGACTTCATGAGCCAGCGAAACATGCTGGTGCTTGAAGAATATGATCAAAACCAGAACCCCGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACAGTGCAGGAGCTTCGCCGTAATGGAACCCTCTCTTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTTATGAGGCCTCTCTTCGTGGTGGAGAACGACGTGCGCAAGCCTAATAGGAACCACCTCGTCTACAACCAAGATCACTACGGCAAGCTGGCCCGAGAGCAACAG-GCAATGACTCAAGCAGGCGTCGG--CGAGGAAGAGAGGCCGACGGATTCTTATGGCTGGAAGGGCCTTATTCAAGATGGTGTTATTGAATACCTGGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum poae LC_8161' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCATGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCCATATCCGACTTCATGAGCCAGCGAAACATGCTGGTGCTTGAAGAATATGATCAAAACCAGAACCCCGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACAGTGCAGGAGCTTCGCCGTAATGGAACCCTCTCTTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTTATGAGGCCTCTCTTCGTGGTGGAGAACGACGTGCGCAAGCCTAATAGGAACCACCTCGTCTACAACCAAGATCACTACGGCAAGCTGGCCCGAGAGCAACAG-GCAATGACTCAAGCAGGCGTCGG--CGAGGAAGAGAGGCCGACGGATTCTTATGGCTGGAAGGGCCTTATTCAAGATGGTGTTATTGAATACCTGGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum poae LC_8162' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AACATTCA--AA--CC-CTTTGCAG--TTGGAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GACAC-GC-TTTCC----TGA-GACG-------GAC---------TGCGAGTG-------CTGACCTCCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCATGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCCATATCCGACTTCATGAGCCAGCGAAACATGCTGGTGCTTGAAGAATATGATCAAAACCAGAACCCCGATGCTACCAAGGTTTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAACAGCTCGTCTCTACAGTGCAGGAGCTTCGCCGTAATGGAACCCTCTCTTACGAGATGAGTCTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTTATGAGGCCTCTCTTCGTAGTGGAGAACGACGTGCGCAAGCCTAATAGGAACCACCTCGTCTACAACCAAGATCACTACGGCAAGCTGGCCCGAGAGCAACAG-GCAATGACTCAAGCAGGCGTCGG--CGAGGAAGAGAGGCCGACGGATTCTTATGGCTGGAAGGGCCTTATTCAAGATGGTGTTATTGAATACCTGGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Epicoccum proteae CBS_114179T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------GAC-------GTCGC-TC-TTGTC----ATG-AACG-------GAC---------TGCGAGTG-------CTGACCCTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCTGCCGAAACACCTGAAGGACAGGCCTGCGGTCTCGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTGGGCCCATCTCCGACTTCATGAGCCAGCGAAACATGCAGCTTCTTGAGGAGTACGACCAAAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGAGTCTGGGTTGGCGTGCACAACAATGCACAGCAGCTCGTTTCCACAGTCCAGGAACTGCGCCGCAACGGAACTCTATCCTACGAAATGAGTTTGATCCGAGACATTCGTGACCGAGAGTTCAAGATCTTTACAGACGCTGGACGTGTCATGAGACCTCTCTTTGTTGTAGAGAGTGATGTACGCAAATTGAACCGCAACCACCTCGTGTTCAATCAGGAGCATTACAACAAGCTGGTCGCAGAGCAACAG-GCAATGGCTGCTGCAGGAGTCGG--CGAGGAAGAGAAGACTGGACTTGCCTATGGTTGGAAGGGTCTCATTCAAGATGGTGTCATCGAGTACCTTGACGCTGAGGAAGAGGAGACCGCCATGATTGTCATGTCACCTGAAGACCTTGGCGAG 'Epicoccum sorghinum CBS_179.80' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTACAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCTCAAGCAGGCATCGG--TGAGGAGGAGAAGACAGAACTCGCTTACGGTTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCTCCCGAGGACCTTGGTGAG 'Epicoccum sorghinum CBS_627.68' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC----TTTCC--CCTTA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTACAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCTCAAGCAGGCATCGG--TGAGGAGGAGAAGACAGAACTCGCTTACGGTTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCTCCCGAGGACCTTGGTGAG 'Epicoccum sorghinum UTHSC_DI16_288' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCCGCCGAGACGCCTGAAGGGCAGGCCTGCGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAACGGTGTTTGGGTTGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCTCAAGCAGGCATCGG--TGAGGAGGAGAAGACAGAACTCGCTTATGGTTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCTCCCGAGGACCTTGGTGAG 'Epicoccum sorghinum UTHSC_DI16_301' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCCATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTACAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCACTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCTCAAGCAGGCATCGG--TGAGGAGGAGAAGACAGAACTCGCTTACGGTTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCTCCCGAGGACCTTGGTGAG 'Epicoccum viticis BRIP_29294' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Epicoccum viticis CGMCC_3_18344T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC--AAACTTA--AA--CC-CTTTGCAG--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ATA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTCGTGTGCCCCGCTGAGACGCCTGAAGGGCAGGCCTGTGGTCTCGTGAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGCAGTGATGCCGGGCCAATTTCTGATTTCATGAGCCAGCGAAACATGCAGCTACTCGAGGAGTATGACCAAAATCAGAATCCCGATGCTACCAAGGTTTTCGTCAATGGTGTTTGGGTCGGTGTGCATTCCAACGCACAGCAGCTTGTCTCCACAGTGCAGGAACTGCGTCGTAATGGAACACTGTCCTATGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACGGACGCTGGACGTGTCATGAGACCACTTTTCGTGGTGGAGAGCGATGTTCGCAAGCCAAACCGCAACCATCTCGTCTTCAGCCAAGAGCATTACAACAAGCTGGTTGAAGAGCAGGCG-GCGATGGCCCAAGCAGGCATCGG--CGAGGAGGAGAAGACAGAACTCTCTTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATTGAATATCTTGACGCCGAAGAGGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTCGGTGAG 'Foliophoma fallens CBS_161.78' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGCT-TTTTGCGTACTA-TTCGTTTCC--TCGGCGGGC-TTGCCCG--CCAGTAGGAC-ACCATA-A--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Foliophoma fallens CBS_284.70' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGCGTACTA-TTCGTTTCC--TCGGCGGGC-TTGCCCG--CCAGTAGGAC-ACCATA-A--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Halojulella avicenniae BCC_18422' GGGTCTAAGTTGTAATTTGCAGAGAGTGCTTTAGTGTTAGTAAGAGCCTAAGTTCCTTAGAATAGGGCGTTATAGAGGGTAAGAATCCTGTATATAGTTGCTATTCTTTACTGTGTAAAGCCCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTAG--GCTTTT-GCCCGGTGCACTCTTCTATAGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGTG-AAATACAGCC-AGCCTGGACTGAGGTTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTCGTGTGCCCCGCTGAAACCCCAGAAGGACAAGCGTGTGGTCTAGTCAAGAACCTATCTCTTATGTGCTACGTTAGTGTAGGTAGTGACGCCACCCCTATAACCGATTTCATGAGTCAGCGAGGTATGGATTTGCTGGAAGAGCACGATCCTGTCTTGAACCCAGCTACTACCAAGGTGTTCGTCAATGGTGTTTGGGTCGGGGTTCACAATAATGCTGCACAACTCTTCACCACAGTTCAAGAGCTTCGACGGAACGGAACTCTCTCATACGAGATGAGTCTTGTACGAGAAATTCGTGACAGAGAGTTCAAGATATTCACGGACGCCGGCCGTGTCATGAGGCCGTTGTTCATTGTAGAAAATGATCCCCGCCAACCGAACCGTCATCATCTCATGTATACCAAGGCTCATGCCAACAAGCCTGCTCGAGGAGAAGAG----ATGGACGTGTCGGGCTTGAG--TGACGACGAGATTTCTCATGCCAGGTACGGGTGGAGAGGTCTTATTCAAGATGGTATAATTGAGTATCTCGACGCCGAAGAAGAGGAAGCTGCCATGATTGTCATGTCGCCTGATGACCTTGACGAA 'Halojulella avicenniae BCC_20173' GGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGGAGCCTAAGTTCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGTTGCTATCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTGG--GCTTTT-GCCCGGTGCACTCTTCTATAGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGTG-AAATACAGCC-AGCCTGGACTGAGGTTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTCGTGTGCCCCGCTGAAACCCCAGAAGGACAAGCGTGTGGTCTAGTCAAGAACCTATCTCTTATGTGCTACGTTAGTGTAGGTAGTGACGCCACCCCTATAACCGATTTCATGAGTCAGCGAGGTATGGATTTGCTGGAAGAGCACGATCCTGTCTTGAACCCAGCTACTACCAAGGTGTTCGTCAATGGTGTTTGGGTCGGGGTTCACAATAATGCTGCACAACTCTTCACCACAGTTCAAGAGCTTCGACGGAACGGAACTCTCTCATACGAGATGAGTCTTGTACGAGAAATTCGTGACAGAGAGTTCAAGATATTCACGGACGCCGGCCGTGTCATGAGGCCGTTGTTCATTGTAGAAAATGATCCCCGCCAACCGAACCGTCATCATCTCATGTATACCAAGGCTCATGCCAACAAGCTGCTCGAGGAGAAAGAG----ATGGACGTGTCGGGCTTGAG--TGACGACGAGATTTCTCATGCCAGGTACGGGTGGAGAGGTCTTATTCAAGATGGTATAATTGAGTATCTCGACGCCGAAGAAGAGGAAGCTGCCATGATTGTCATGTCGCCTGATGACCTTGACGAA 'Hazslinszkyomyces aloes CPC_21572' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TCGGTGGGC-TTGCCTG--CCGATCGGAC----ACTATAAAA--CC-TTTTGTAA--TAGCAGTCAGCG--------TCAG--AAA-CAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces aptrootii CBS_483.95' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TCGGTGGGC-TTGCCTG--CCGATTGGAC----ACCATAAAA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-TAAT-TTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces lycii CPC_30998' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-CCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTTTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGACTGGAC---ACCATA--AACACC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-TCAT-TGAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces lycii CPC_31014' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-CCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTTTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGACTGGAC---ACCATA--AACACC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-TCAT-TGAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Heterophoma adonidis CBS_114309' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGGCCGGAC-AACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGCGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------TACAC-GC-GTTTC----TTT-GACG-------GAC---------TGCGAGTG-------CTGACCTACG-GC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCCGAGACCCATGAAGGACAGGCCTGCGGTCTGGTAAAGAACTTGTCTCTCATGTGCTACGTGAGTGTCGGTAGTGACGCCGGGCCTATCTCCGAGTTCATGAGCCAGAGAAACATGCAGCTGCTCGAGGAGTACGATCAGAATCAAAACCCTGACGCCACCAAGGTTTTCGTCAACGGTGTCTGGGTGGGTGTACACTCCAATGCGCAACAGCTTGTCTCGACTGTGCAGGAGCTGCGCCGTAACGGAACTCTCTCGTACGAGATGAGTTTGATCCGAGATATCCGTGATCGAGAGTTCAAAATCTTCACGGATGCCGGACGTGTCATGAGGCCTCTCTTCGTTGTACAGAACGATGTCACGAAAGGAGATCGAAACCACCTTATATTCAACCAGAACCACTACAACAAGCTTGTTGCGGAGCAACAG-GCAATGGCCACAGCAGGTGTGGG--CGAAGAAGAGAAGACCGAGCTGACATATGGTTGGAAGGGTCTCATCCAAGACGGTGTCATTGAGTACCTTGACGCTGAAGAAGAGGAGACTTCCATGATTGTCATGTCGCCTGAGGATCTTGGCGAG 'Heterophoma nobilis CBS_507.91' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGAATGGAC-AAAACTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AACAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTCCA----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCATCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATCTGGAGCCCGGCACAATGGACGCTGTCCGCGCAGGCC????GGGGTCTTGTGTGTCCTGCCGAAACACCCGAAGGACAAGCTTGCGGTTTGGTCAAGAACCTGTCCCTTATGTGCTACGTCAGTGTCGGCAGTGACGCCGGGCCTATCTCTGAGTTCATGAGCCAGAGAAACATGCAGCTGCTTGAGGAATACGATCAGAACCAGAACCCGGATGCCACCAAGGTTTTCGTCAATGGTGTCTGGGTCGGTGTACACTCCAACGCGCAACAGCTTGTTTCGACCGTGCAGGAACTGCGCCGTAACGGAACCCTCTCGTACGAGATGAGTTTGATCCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCACTCTTCGTTGTGCAGAACGATGTCACGAAGACAGACCGAAATCACCTTATCTTCAACCAGCACCACTATAACAAGCTGGTCGCTGAGCAACAG-GCAATGGCCACGGCAGGTGTGGG--TGAGGAAGAGAAGACCGAGCTGACATATGGTTGGAAGGGCCTCATTCAAGATGGTGTCATTGAGTACCTTGACGCTGAAGAGGAAGAGACGTCCATGATTGTCATGTCCCCGGAGGATCTTGGCGAG 'Heterophoma verbascicola CGMCC_3_18364T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC-AACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AATAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCATTC-GC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGTCCTGCTGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGATGCCGGGCCCATCTCGGAGTTCATGAGCCAGAGAAACATGCAGCTGCTTGAGGAATACGACCAGAACCAGAATCCCGATGCCACCAAGGTTTTCGTCAATGGTGTCTGGGTGGGTGTACACTCCAACGCGCAACAGCTTGTTTCGACTGTGCAGGAACTGCGCCGTAACGGAACCCTCTCGTACGAGATGAGTCTGATTCGAGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGGCCACTCTTCGTTGTGCAGAACGATGTCACGAAGGCAGACCGAAATCACCTCATCTTTAACCAGCACCACTACAACAAGCTGGTTGCGGAGCAACAG-GCCATGGCCACAGCAGGTGTGGG--TGAGGAAGAGAAGACCGAGCTAACCTATGGTTGGAAGGGCCTCATCCAGGACGGTGTCATTGAGTACCTTGACGCTGAAGAGGAAGAGACTTCCATGATTGTCATGTCGCCCGAGGATCTTGGCGAG 'Heterophoma verbascicola LC_8164' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGGTTGGAC-AACATTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG---AATAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCATTC-GC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGTCCTGCTGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGATGCCGGGCCCATCTCGGAGTTCATGAGCCAGAGAAACATGCAGCTGCTTGAGGAATACGACCAGAACCAGAATCCCGATGCCACCAAGGTTTTCGTCAATGGTGTCTGGGTGGGTGTACACTCCAACGCGCAACAGCTTGTTTCGACTGTGCAGGAACTGCGCCGTAACGGAACCCTCTCGTACGAGATGAGTCTGATTCGAGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGGCCACTCTTCGTTGTGCAGAACGATGTCACGAAGGCAGACCGAAATCACCTCATCTTTAACCAGCACCACTACAACAAGCTGGTTGCGGAGCAACAG-GCCATGGCCACAGCAGGTGTGGG--TGAGGAAGAGAAGACCGAGCTAACCTATGGTTGGAAGGGCCTCATCCAGGACGGTGTCATTGAGTACCTTGACGCTGAAGAGGAAGAGACTTCCATGATTGTCATGTCGCCCGAGGATCTTGGCGAG 'Iuxtiphoma eupyrena CBS_374.91' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAA-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TGC-GACG-------GAC---------TGCGAGTG-------CTGACCAATA-AT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTTGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTTGGTAGCGATGCCGGGCCCATTTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAAGAGTACGACCAGAACCAGAACCCTGATGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTGGGTGTCCACTCCAACGCACAACAGCTCGTTTCGACTGTGCAGGAGCTGCGCCGAAACGGAACCTTGTCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCATTGTTCGTCGTGGAAAGCGATGTGCGTAAGCCGAATCGTAACCACCTTGTTTTCAGCCAGGAACATTACAACAGGCTGGTTGCAGAGCAGCAG-GCGATTGCTGCTGCAGGTGTCGG--CGAAGAGGAGAAGAACGAGCTTGCTTACGGCTGGAAGGGGCTCATTCAAGACGGTGTCATCGAGTACCTTGATGCAGAGGAAGAAGAGACTGCCATGATCGTCATGTCACCCGAGGATCTCGGCGAG 'Iuxtiphoma eupyrena CBS_527.66T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAA-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-GTTCC----TGC-GACG-------GAC---------TGCGAGTG-------CTGACCAATA-AT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTTGACTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTTGGTAGCGATGCCGGGCCCATTTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAAGAGTACGACCAGAACCAGAATCCTGATGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTGGGTGTCCACTCCAACGCACAACAGCTTGTTTCGACTGTGCAGGAGCTGCGCCGAAACGGAACCTTGTCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGGCGTGTCATGAGGCCATTGTTCGTCGTGGAAAGCGATGTGCGTAAGCCGAATCGTAACCACCTTGTTTTCAGCCAGGAACATTACAACAGGCTGGTTGCAGAGCAGCAG-GCGATTGCAGCTGCAGGTGTCGG--CGAAGAGGAGAAGAATGAGCTTGCTTATGGCTGGAAGGGGCTCATTCAAGACGGTGTCATCGAGTACCTTGATGCAGAGGAAGAAGAGACTGCCATGATCGTCATGTCGCCCGAGGATCTCGGTGAG 'Leptosphaeria conoidea CBS_616.75' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAG--GCTTTT-GCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGCCTTTTTGCGTACAG-TTTGTTTTC--CCAGCAGGGCTTTACGGCCCCTACGGGATATCAATCCA------CC-CATTGTAT--TTGCAGTCAATG--------TCTG--AAA-AATA-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTG-----------------------------CGCAT----TTTCT---GGCGCGACCATCATGTGAC--------CTGTGAATG-------CTAACAAGCG-AC--AGGCGTCCGGCAACAAG-TTCGTGCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTC????GGGGCCTTGTCTGCCCTGCCGAGACACCAGAAGGCCAGGCTTGTGGCTTAGTCAAGAATTTATCTCTCATGTGCTACGTCAGTGTTGGTAGCGACGCAGAACCCATCACTGACTTTATGCAACAACGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAATCCGGACGCGACGAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTACACTCCAACGCACAACAACTTGTCTCAGTTGTACAAGAGCTCCGCAGAAACGGCACTCTGTCCTACGAGATGAGCTTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACGGATGCTGGGCGTGTCATGAGGCCTTTGTTTGTCGTCGAGACCGCCTCAAGCAAACCTAACCGCAACCAGCTCATTTTCACCAAGGAGATCAGCAAAAAGCTACATGCCGAGCAACAGAATCAGGATTCTCGTCAAGGGTGGAGCGATCAGGAAGTAGCGGACGCCACATATGGGTGGAAGGGGCTCATTCAAGACGGTGTGATCGAGTACCTTGATGCTGAGGAAGAAGAGACAGCCATGATCACATTTTCACCCGAAGATCTGGACGAA 'Leptosphaeria doliolum CBS_505.75T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAG--GCTTTT-GCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGCCTTTTTGCGTACAG-TTTGTTTTC--CCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCA------CC--CATGTAT--TTGCAGTCAATG--------TCTG---AA-AATT-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAAACCATCTCAGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTG-----------------------------CGCAT-TC-TTTTT----CGCCAGTGTCATGTGACC---------CGTGAATG-------CTAACAAGCG-AT--AGGCGTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCCGAGACACCAGAAGGACAGGCCTGTGGCCTCGTCAAGAACTTGTCTCTTATGTGTTACGTCAGTGTTGGTAGCGACGCTGAGCCCATCACCGACTTCATGCAACAACGAAACATGCAACTTCTCGAAGAGTACGATCAGAACCAAAATCCCGACGCTACGAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTTCACTCCAACGCACAACAGCTTGTCTCAGTTGTACAAGAGCTCCGGAGAAACGGCACTCTGTCCTACGAGATGAGCTTAATTCGTGACATTCGTGATCGAGAGTTCAAGATTTTCACGGATGCTGGGCGTGTCATGAGGCCATTGTTTGTTGTCGAAACCAACTCCAGTAAGCCAAACCGGAACCAGCTCATCTTTACCAAAGAGATCAGCAAAAAGCTACACTCCGAACAACAGAACCAGGACTCTCGTCAAGGGTGGAGTGATCAGCAAGTAGCCGACGCCACATATGGGTGGAAGGGACTCATTCAAGACGGTGTGATCGAGTATCTTGATGCTGAGGAAGAAGAGACCGCCATGATCACATTTTCACCCGAAGATCTGGACGAA 'Leptosphaerulina americana CBS_213.55' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCTAC----TAC-GACG-------GAC---------TACGAGTG-------CTGACCTATG-GT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCTGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCCTAATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCGATTTCTGACTTCATGAGCCAAAGAAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAATCCCGATGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCGCAGCAGCTTGTGTCAACCGTACAAGAACTGCGACGAAATGGAACATTGTCCTACGAAATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTGTTCGTCGTGGAGAGCGATGTCCGCAAGCCCAACCGCAACCACCTTGTTTTCAGCCAAGAACACTATAACAAGCTCGTTGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTATTGG--TGAAGAAGAGAAGACTGAGCTCACTTATGGCTGGAAGGGACTCATCCAAGACGGTGTCATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTCATGTCACCCGAAGATCTTGGTGAG 'Leptosphaerulina australis CBS_317.83' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTAC----TAA-GACG-------GAC---------TACGAGTG-------CTGACCTATC-GT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCGGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCACTAATGTGCTATGTCAGTGTTGGTAGCGATGCTGGCCCAATTTCTGATTTCATGAGTCAAAGGAATATGCTTTTTCTTGAGGAGTACGACCAGAACCAGAATCCCGATGCTACCAAAGTCTTCGTCAACGGTGTATGGGTTGGTGTGCATTCCAACGCACAGCAGCTTGTGTCAACTGTACAAGAACTGCGACGAAACGGAACGCTGTCATACGAAATGAGTTTGATTCGAGACATTCGTGACCGTGAGTTCAAGATTTTCACAGATGCTGGACGTGTTATGAGGCCTTTATTCGTCGTGGAAAGCGATGTCCGCAAGCCCAACCGCAACCATCTCGTTTTCAGTCAAGAACACTACAACAAGCTCGTTGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTATCGG--CGAAGAAGAGAAGACCGAACTCACTTATGGCTGGAAGGGGCTCATCCAGGACGGTGTTATCGAGTACCTCGACGCAGAAGAGGAAGAGACTGCTATGATTGTCATGTCGCCCGAAGATCTTGGCGAG 'Libertasomyces myopori CPC_27354' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCGACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACTTCCTCTCGGGGA-AGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAAGGGCTGTATGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CTTGTTTCC--TCGGTGGGT-TCGCCCA--CCAGCAGGAC----ATTTCAAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-CAAC-ACAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG-AGCGTCA-TTTGAAC-TTC-AAGCATTG------------CTTGGTGAT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Libertasomyces platani CPC_29609' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCGTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACTTCCTCTCGGGGA-AGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTTTGCTAGGATGCTGGCGTAAAGGCTGTATGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TCTGTTTCC--TCGGTGGGT-TCGCCCA--CCAGCAGGAC----ATTACTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG-AGCGTCA-TTTGAACCCTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGATCTGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA-------------------GCC-------GACTT-GC-TCCCC----ACTGCCCAGGTGATCGAA---------CGCTTATA-------CTGACGGATG-AC--AGGCCTCCAACAACAAG-TTCGTTCCCCGCGCTGTCCTCGTCGATCTCGAGCCTGGTACTATGGATGCCGTCCGCGCTGGGC????GGGGTCTTGTATGCCCCGCTGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTCTCCCTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCACCCATCATTGATTTCATGACACAACGAAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCAGATGCGACAAAAGTCTTTGTCAACGGTGTTTGGGTGGGCGTACACTCCAATGCTCAGCAGCTCGTCTCAGTCGTACAGGAACTGCGGCGAAATGGTACACTCTCTTATGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATCTTCACAGACGCGGGTCGTGTCATGAGACCGCTTTTTGTTGTGGAGAATGACATTCGGAAGCCAAACAAAAACCAACTTATCTTCACAAAGGCCATTAGCAGAAAACTTATGCAAGAACAACAGGATAGTCAGCAACGTCAAGGATGGAGTGAAGAGGAAGTTGCAGAGGCCACCTACGGTTGGAAAGGCCTCATTCAAGACGGTGTGGTTGAGTATCTCGATGCCGAAGAGGAGGAAACTGCGATGATAACGTTCTCCCCTGAGGACTTGGAAGAA 'Libertasomyces quercus CBS_134.97' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCGTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACTTCCTCTCGGGGA-AGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAAAGGCTGTATGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CTTGTTTCC--TCGGTGGGC-CTGCCCA--CCAGCAGGAC--ATAATTA--AA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG-AGCGTCA-TTTGAACCCTC-AAGCCTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Macroventuria anomochaeta CBS_525.71T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGCGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTTTACTTCAACGAGGTA------CTAGA--------AAT-------GACAT-GC-TTTCC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTACC-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTCGTTTGCCCTGCCGAAACACCTGAAGGCCAAGCCTGTGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCTTCTTCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTGGGTGTGCACTCCAACGCACAGCAGCTCGTATCGACTGTGCAGGAACTGCGTCGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTCGTGGAGAGCGACGCCCGCAAGCCAAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGATCGCAGAGCAGCAG-GCAATGGCTGCCGCCGGTGTCGG--TGAAGAAGAGAAGACTGAGCTCACATACGGCTGGAAGGGTCTCATTCAAGATGGTGTCATCGAGTACCTCGACGCCGAGGAAGAGGAGACTGCCATGATTGTCATGTCGCCGGAGGATCTCGGTGAG 'Macroventuria wentii CBS_526.71T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGCGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-AC-TTTTC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTACC-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTGGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTCGTTTGCCCTGCCGAAACACCTGAAGGACAAGCCTGCGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGCGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTGGGCGTGCACTCCAACGCACAGCAGCTCGTATCGACTGTGCAGGAACTGCGTCGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTCGTGGAGAGCGACGCCCGCAAGCCGAACCGCAACCACCTGGTCTTCAGCCAGGAACACTACAACAAGCTGATCGCAGAGCAGCAG-GCAATGGCTGCCGCTGGTGTCGG--TGAAGAAGAGAAGACTGAGCTCACATACGGCTGGAAGGGTCTCATTCAAGATGGTGTCATCGAGTACCTCGACGCAGAGGAAGAGGAGACTGCCATGATCGTCATGTCGCCGGAGGATCTCGGTGAG 'Microsphaeropsis olivacea CBS_233.77' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTTGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTGTATTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TGC-GACG-------GAC---------TGCGAGTG-------CTGACCTATA-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGGGTGGTCTGCCCTGCCGAAACTCCTGAAGGTCAAGCTTGTGGTCTGGTGAAGAACTTGTCCTTGATGTGTTATGTTAGTGTTGGTAGCGACGCAACACCCATCATCGACTTCATGACACAACGGAACATGCAACTACTTGAAGAGTACGACCAGAACCAGAATCCAGACGCCACGAAGGTGTTCGTGAACGGTGTATGGGTCGGCGTGCATTCTAATGCCCAACAACTTGTCTCAGTCGTACAAGAGCTCCGCAGAAACGGCACTTTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACAGAGAATTCAAGATCTTCACGGATGCTGGACGTGTCATGAGGCCTTTGTTCGTGGTTGAAAATGACATCCGGAAACCAAATCGAAATCAGTTGATTTTCACGAAAGAGATCAGTAAAAAGCTGTTGTTTGAGCAGCAGAATCAGGACTCTCGGCAAGGGTGGAGCGACGAAGACATCGCATCTGCTACATATGGCTGGAAGGGTCTCATTCAAGATGGTGTGATCGAGTACCTTGATGCTGAGGAAGAGGAAACAGCTATGATCACATTCTCGCCTGAGGACCTCGACGAG 'Microsphaeropsis proteae CBS_111319' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAATGTGTACTTCAACGAGGTA------CTAAA--------AAT-------GACAC-GC-TTTCC----TGC-GACA-------GAC---------TGTGAGTG-------CTGACCTATA-AC--AGGCCTCTGGCAACAAG-TTCGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neoascochyta argentina CBS_112524T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGCTAGGAC----AAAATTAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCCC-GT-TCCCC---AATT-GGCA-------GAC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGCACAATGGACGCTGTCCGCGCCGGCC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neoascochyta cylidrispora CBS_142456T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-CTTAC--ACTATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCTGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATCTCGGACTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTGCACTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTCGTTGAGAGCGACGTGCGTAAGCCTACACGCAACCACCTTGTTTTCAACAAGGACCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAGGCCGCAGCGGGCATTGG--TGAGGAGGAGAAGACAGCAATGACATACGGATGGAAGGGTCTTATCCAAGATGGTGTCATTGAATACCTAGACGCCGAGGAAGAAGAAACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta cylidrispora UTHSC_DI16_352' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-CTTAC--ACTATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCTGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATCTCGGACTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTGCACTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTCGTTGAGAGCGACGTGCGTAAGCCTACACGCAACCACCTTGTTTTCAACAAGGACCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAGGCCGCAGCGGGCATTGG--TGAGGAGGAGAAGACAGCAATGACATACGGATGGAAGGGTCTTATCCAAGATGGTGTCATTGAATACCTAGACGCCGAGGAAGAAGAAACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta desmazieri CBS_297.69T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC--T-TACAC----TATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCCGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCGGATTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGTAAGCCTACACGCAACCACCTCGTCTTCAACAAGGATCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAAGCCGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCAATGACGTACGGATGGAAGGGTCTTATCCAAGATGGTGTCATCGAATACCTGGACGCTGAGGAAGAAGAGACCGCCATGATTGTCATGTCACCTGAGGACCTTGGCGAG 'Neoascochyta desmazieri UTHSC_DI16_207' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC--T-TACAC----TATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCCGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCGGATTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGTAAGCCTACACGCAACCACCTCGTCTTCAACAAGGATCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAAGCCGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCAATGACGTACGGATGGAAGGGTCTTATCCAAGATGGTGTCATCGAATACCTGGACGCTGAGGAAGAAGAGACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta desmazieri UTHSC_DI16_320' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC--T-TACAC----TATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCCGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCGGATTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGTAAGCCTACACGCAACCACCTCGTCTTCAACAAGGATCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAAGCCGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCAATGACGTACGGATGGAAGGGTCTTATCCAAGATGGTGTCATCGAATACCTGGACGCTGAGGAAGAAGAGACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta desmazieri UTHSC_DI16_332' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC--T-TACAC----TATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCCGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCGGATTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGTAAGCCTACACGCAACCACCTCGTCTTCAACAAGGATCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAAGCCGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCAATGACGTACGGATGGAAGGGTCTTATCCAAGATGGTGTCATCGAATACCTGGACGCTGAGGAAGAAGAGACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta desmazieri UTHSC_DI16_341' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTCT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-AACGTTTCC--TCGGCAGGT-CCGCCTG--CCG-TAGGAC----AATTATAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAACATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC--T-TACAC----TATCGGCA-------GGC---------CACGAGTG-------CTGACCGCTT-GC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGACTCGTCTGCCCCGCCGAAACCCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACTTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATTTCGGATTTCATGACCCAGAGGAACATGCAACTTCTTGAGGAGTACGACCAAACCCAGAATCCGGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCGTACGAGATGAGTTTGATTCGAGATATTCGTGACCGTGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCGTTGTTCGTTGTCGAGAGCGATGTGCGTAAGCCTACACGCAACCACCTCGTCTTCAACAAGGATCACATGAACAAGCTCGTCTGGGAGCAACAA-GAGCAAGCCGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCAATGACGTACGGATGGAAGGGTCTTATCCAAGATGGTGTCATCGAATACCTGGACGCTGAGGAAGAAGAGACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Neoascochyta europaea CBS_820.84T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTTGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC--CCCATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG----A-AAAATTTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AACA------GCCACAGCATCCCC--------AACC-------GAC---------CACGAGTG-------CTGACCGTCT-GC--AGGCCTCCGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGACTTGTTTGCCCTGCCGAAACCCCCGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTGTCGCTGATGTGCTACGTCAGTGTTGGCAGCGACGCCGGGCCTATTTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAAACCCAGAATCCAGAAGCAACTAAAGTCTTTGTCAATGGCGTCTGGGTCGGTGTGCACTCTAACGCTCAACAGCTGGTCTCGACCGTGCAAGAGCTGCGACGAAACGGAACGCTGTCCTACGAGATGAGTTTGATTCGAGATATTCGCGACCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCGCTGTTCGTTGTTGAAAGCGACGTGCGCAAGCCTACGCGCAACCATCTTGTCTTCAACAAGGACCACATGAATAAGCTCGTGTGGGAGCAGCAA-GAGCAAGCCGCAGCGGGCGTTGG--CGAGGAGGAGAAGACGGCAATGACCTATGGCTGGAAAGGTCTTATCCAGGATGGTGTCATCGAATACCTGGATGCCGAAGAGGAAGAAACCGCCATGATTGTCATGTCACCTGAAGATCTCGGTGAG 'Neoascochyta exitialis CBS_118.40' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTTGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC--CCCATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATAGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GATCC--T-TGCAC----CCCCAAAA-------GAC---------CACGAGTG-------CTGACCGCCT-GC--AGGCCTCCGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGACTTGTCTGCCCTGCCGAAACCCCCGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTGTCGCTCATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCTATCTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTCGAGGAGTATGACCAAACCCAGAACCCAGAAGCAACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAGCTGGTCTCGACCGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGCGAATTCAAGATCTTCACGGATGCTGGGCGTGTCATGAGACCGCTGTTCGTCGTTGAAAGTGACGTGCGCAAGCCTACACGCAACCATCTTGTCTTCAACAAGGACCACATGAATAAGCTCGTGTGGGAGCAGCAG-GAGCAAGCCGCAGCGGGCGTTGG--CGAAGAGGAGAAGACAGCGATGACCTATGGCTGGAAAGGCCTCATCCAGGATGGTGTCATCGAATACCTGGACGCCGAAGAAGAAGAAACCGCCATGATTGTCATGTCACCTGAAGATCTTGGCGAG 'Neoascochyta exitialis CBS_389.86' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTTGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC--CCCATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATAGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGG--------AAT-------GATCC--T-TGCAC----CCCCAAAA-------GAC---------CACGAGTG-------CTGACCGCCT-GC--AGGCCTCCGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGACTTGTCTGCCCTGCCGAAACCCCCGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTGTCGCTCATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCTATCTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTCGAGGAGTATGACCAAACCCAGAACCCAGAAGCAACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAGCTGGTCTCGACCGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGCGAATTCAAGATCTTCACGGATGCTGGGCGTGTCATGAGACCGCTGTTCGTCGTTGAAAGTGACGTGCGCAAGCCTACACGCAACCATCTTGTCTTCAACAAGGACCACATGAATAAGCTCGTGTGGGAGCAGCAG-GAGCAAGCCGCAGCGGGCGTTGG--CGAAGAGGAGAAGACAGCGATGACCTATGGCTGGAAAGGCCTCATCCAGGATGGTGTCATCGAATACCTGGACGCCGAAGAAGAAGAAACCGCCATGATTGTCATGTCACCTGAAGATCTTGGCGAG 'Neoascochyta graminicola CBS_301.69' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTTGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC--CACATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGTTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-ATTGCACCCTCA--ACG-------GAC---------CACGAGTG-------CTGACCGCCT-GC--AGGCCTCCGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGACTTGTCTGCCCTGCCGAAACCCCCGAAGGACAAGCTTGTGGCCTGGTCAAGAACCTGTCGCTGATGTGCTACGTCAGTGTTGGCAGCGACGCTGGGCCTATCTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAAACTCAGAATCCAGAAGCAACTAAAGTCTTTGTTAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAGCTGGTGTCGACCGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGCGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCGTTGTTCGTCGTTGAAAGCGACGTGCGCAAGCCTACGCGTAATCATCTTGTCTTCAACAAGGACCACATGAATAAGCTCGTGTGGGAGCAACAG-GAGCAAGCTGCAGCGGGCGTTGG--CGAGGAGGAGAAGACAGCGATGACCTACGGCTGGAAAGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCCGAAGAAGAAGAGACCGCGATGATTGTCATGTCACCTGAAGATCTCGGCGAG 'Neoascochyta graminicola CBS_816.84' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTTGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC--CACATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGTTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-ATTGCACCCTCA--ACG-------GAC---------CACGAGTG-------CTGACCGCCT-GC--AGGCCTCCGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGTACAATGGACGCTGTCCGCGCTGGTC????GGGGACTTGTCTGCCCTGCCGAAACCCCCGAAGGACAAGCTTGTGGCCTGGTCAAGAACCTGTCGCTGATGTGCTACGTCAGTGTTGGCAGCGACGCTGGGCCTATCTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAAACTCAGAATCCAGAAGCAACTAAAGTCTTTGTTAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAGCTGGTGTCGACCGTGCAAGAGCTGCGACGAAACGGAACGCTGTCTTACGAGATGAGTTTGATTCGAGATATTCGCGACCGCGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCGTTGTTCGTCGTTGAAAGCGACGTGCGCAAGCCTACGCGTAATCATCTTGTCTTCAACAAGGACCACATGAATAAGCTCGTGTGGGAGCAACAG-GAGCAAGCTGCAGCGGGCGTTGG--CGAGGAGGAGAAGACAGCGATGACCTACGGCTGGAAAGGTCTCATCCAGGATGGTGTCATCGAATACCTCGACGCCGAAGAAGAAGAGACCGCGATGATTGTCATGTCACCTGAAGATCTCGGCGAG 'Neoascochyta paspali CBS_560.81T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCTGG--ACTTTT-GTCCAGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-CTTCC--ACTGATGTCG-------GAT---------CGTGAGTG-------CTGACCTTTCCGC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTTCTCGTCGATTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGTC????GGGGACTCGTCTGCCCCGCTGAAACACCCGAAGGCCAAGCCTGTGGTCTGGTGAAGAACTTGTCCCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGACCCAGAGGAACATGCAGCTTCTCGAAGAGTACGACCAGACACAGAACCCGGATGCCACCAAGGTCTTCGTTAACGGTGTTTGGGTTGGTGTACACTCCAATGCTCAGCAGCTTGTCTCGACAGTGCAGGAACTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGCGAGTTCAAGATCTTCACGGATGCTGGACGTGTCATGAGGCCGCTGTTCGTTGTCGAGAGCGATGTGCGCAAGCCCACTCGCAACCACCTTGTTTTCAACAAGGACCACATGAACAAGCTTGTCTGGGAGCAACAG-GAGCAGGCCTCCGCTGGTCTGGG--CGACGAGGAGAAGGGAGCGATGACCTACGGATGGAAGGGTCTCATCCAGGACGGTGTCATCGAGTACCTGGACGCCGAGGAAGAGGAAACTGCTATGATTGTCATGTCGCCCGAGGACCTCGGCGAG 'Neoascochyta soli CGMCC_3_18365T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCTGG--ACTTTT-GTCCGGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-CTTCC--ACTGATGTCG-------GAT---------CGTGAGTA-------CTGACCTTTTCGC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTTCTCGTCGATTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neoascochyta soli LC_8166' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAA-GCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCTGG--ACTTTT-GTCCGGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA------------------AACGA-GC-CTTCC--ACTGATGTCG-------GAT---------CGTGAGTA-------CTGACCTTTTCGC--AGGCCTCTGGCAACAAG-TTTGTGCCCCGTGCTGTTCTCGTCGATTTGGAGCCGGGTACAATGGACGCCGTCCGCGCCGGTC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neoascochyta tardicrebrescens CBS_689.97T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGCTAGGAC--AAAATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCCC-GT-TCCCC----ATT-GGCA-------GAC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGCACAATGGACGCTGTCCGCGCCGGCC????GGGGACTTGTTTGCCCTGCCGAAACTCCTGAAGGACAGGCCTGTGGACTGGTCAAGAACCTTTCGTTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCCATCTCCGATTTCATGACCCAGAGGAACATGCAGCTGCTTGAAGAGTACGACCAAACGCAGGACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTGTGGGTTGGTGTACACTCCAACGCCCAACAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTATCATACGAGATGAGTTTGATTCGAGACATTCGCGACCGCGAGTTCAAGATCTTCACCGATGCTGGACGTGTCATGAGGCCACTGTTCGTCGTTGAGAGTGATGTGCGCAAGCCTACACGCAATCACCTTGTCTTCAACAAGGACCACATGAACAAACTCGTCTGGGAGCAGCAA-GAGCAGGCTGCGGCGGGTGTTGG--CGAGGAAGAGAAGACAGCAATGACCTATGGGTGGAAGGGTCTCATCCAAGACGGTGTCATCGAATACCTCGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCGGAAGATCTCGGCGAG 'Neoascochyta tardicrebrescens UTHSC_DI16_291' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CACGTTTCC--TCGGCAGGT-CCGCCTG--CCGCTAGGAC--AAAATTA--AA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCCC-GT-TCCCC----CATTGGCA-------GAC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGCACAATGGACGCTGTCCGCGCCGGCC????GGGGACTTGTTTGCCCTGCCGAAACTCCTGAAGGACAGGCCTGTGGACTGGTCAAGAACCTTTCGTTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCCATCTCCGATTTCATGACCCAGAGGAACATGCAGCTGCTTGAAGAGTACGACCAAACGCAGGACCCTGATGCCACTAAGGTCTTCGTCAACGGTGTGTGGGTTGGTGTACACTCCAACGCCCAACAGCTTGTTTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTATCATACGAGATGAGTTTGATTCGAGACATTCGCGACCGCGAGTTCAAGATCTTCACCGATGCTGGACGTGTCATGAGGCCACTGTTCGTCGTTGAGAGTGATGTGCGCAAGCCTACACGCAATCACCTTGTCTTCAACAAGGACCACATGAACAAACTCGTCTGGGAGCAGCAA-GAGCAGGCTGCGGCGGGTGTTGG--CGAGGAAGAGAAGACAGCAATGACCTATGGGTGGAAGGGTCTCATCCAAGACGGTGTCATCGAATACCTCGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCGGAAGATCTCGGCGAG 'Neoascochyta triticicola CBS_544.74T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TACGTTTCC--TCGGCAGGT-CCGCCTG--CCGTTAGGAC----AAACTTAAA--CC-ATTTGCAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAGATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC-CT-TCCCC---AATT-GACA-------GAC---------CACGAGTG-------CTGACCGCTT-GC--AGGCTTCTGGCAACAAG-TTTGTGCCCCGTGCTGTCCTTGTCGACTTGGAGCCGGGCACAATGGACGCTGTCCGCGCCGGCC????GGGGACTTGTTTGCCCTGCGGAAACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTTTCGTTGATGTGCTATGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGACCCAAAGGAACATGCAACTTCTTGAAGAATACGACCAAACCCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCCCAGCAGCTTGTCTCGACTGTGCAAGAGCTGCGACGAAACGGAACGCTGTCATATGAGATGAGTTTGATCCGAGATATTCGCGACCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCACTGTTCGTCGTTGAAAGCGACGTGCGCAAGCCTACACGCAATCACCTCGTCTTTAACAAAGACCACATGAACAAGCTCGTCTGGGAACAGCAA-GAGCAGGCTGCAGCGGGCATTGG--CGAGGAGGAGAAGACAGCGATGACATATGGATGGAAGGGTCTCATCCAAGATGGTGTCATTGAATATCTGGACGCCGAGGAAGAAGAGACCGCCATGATCGTCATGTCGCCAGAAGACCTCGGCGAA 'Neocamarosporium betae CBS_109410' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCA-TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCC-ATTGTTTCC--TTGGCGGGC-TTGCCCG--CCAATAGGAC----ATTGTTAAA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-TAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTCTGCCCTGCCGAGACCCCCGAAGGTCAGGCCTGTGGTTTGGTCAAGAATCTCTCCCTCATGTGCTACGTCAGTGTCGGTAGTGATGCATCACCCATCATCGATTTCATGACGCAGCGAAACATGCAACTTCTCGAGGAATACGACCAGACTCAGAACCCAGAAGCAACTAAGGTCTTTGTAAACGGTGTCTGGGTCGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCAGTTGTACAGGAATTGCGACGAAACGGAACGTTGTCCTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCCTTGTTCGTCGTTGAGAACGACATCCGAAAGCCGAACAAGGACCATCTCATCTTTACCAAGGATACTAGCCGAAGGTTGTTAGCCGAACAGCAACTGGCTCAACAGCGCCAAGGCTGGAGCGACGAGGAGATTGCCGAAAACACCTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTCGAGTACCTTGATGCTGAGGAAGAGGAGACGGCTATGATCACTTTCTCTCCGGAAGACTTGGAAGAG 'Neocamarosporium betae CBS_523.66' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCA-TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCC-ATTGTTTCC--TTGGCGGGC-TTGCCCG--CCAATAGGAC----ATTGTTAAA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--AAA-TAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTGTACTTCAACGAGGTA-----GCCGCT--------TAT-------GCTCC-GTCCCACC----AAGTGAA--------AAG---------TGCTTATA-------CTGACAAATG-AC--AGGCTTCCGGCAACAAG-TTCGTCCCCCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTCTGCCCTGCCGAGACCCCCGAAGGTCAGGCCTGTGGTTTGGTCAAGAATCTCTCCCTCATGTGCTACGTCAGTGTCGGTAGTGATGCATCACCCATCATCGATTTCATGACGCAGCGAAACATGCAACTTCTCGAGGAATACGACCAGACTCAGAACCCAGAAGCAACTAAGGTCTTTGTAAACGGTGTCTGGGTCGGTGTGCATTCCAACGCCCAGCAGCTTGTTTCAGTTGTACAGGAATTGCGACGAAACGGAACGTTGTCCTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCCTTGTTCGTCGTTGAGAACGACATCCGAAAGCCGAACAAGGACCATCTCATCTTTACCAAGGATACTAGCCGAAGGTTGTTAGCCGAACAGCAACTGGCTCAACAGCGCCAAGGCTGGAGCGACGAGGAGATTGCCGAAAACACCTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTCGAGTACCTTGATGCTGAGGAAGAGGAGACGGCTATGATCACTTTCTCTCCGGAAGACTTGGAAGAG 'Neocamarosporium calvescens CBS_246.79' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCA-TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTCGTCTGCCCTGCCGAGACACCTGAAGGTCAGGCTTGTGGTTTGGTCAAGAACCTCTCCCTCATGTGCTACGTCAGTGTCGGTAGCGATGCATCCCCCATCATCGATTTCATGACACAGCGAAACATGCAACTTCTCGAGGAATACGACCAGAACCAGAACCCAGAGGCGACCAAGGTCTTCGTCAATGGTGTCTGGGTCGGTGTACATTCCAATGCCCAGCAACTGGTTTCAGTCGTACAGGAACTGCGACGAAACGGAACTCTCTCCTACGAGATGAGTTTGATCCGTGACATCCGTGACCGAGAATTCAAGATTTTCACAGATGCTGGTCGTGTTATGAGACCCTTATTCGTCGTCGAGAACGACATCCGAAAGCCGAACAAAGACCACCTCATCTTCACCAAGGAGACTAGCCGAAGGTTAGCGGCCGAACAACAGCTGAACCAACAGCGCCAGGGCTGGAGTGAGGAAGAGATTGCTGAAAACACTTACGGCTGGAGGGGTCTCATTCAAGATGGTGTGGTTGAGTACCTTGATGCTGAGGAAGAGGAGACTGCGATGATAACCTTTTCTCCGGAAGACTTGGAAGAA 'Neocamarosporium goegapense CPC_23676' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCA-TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCCA--CCAATAGGAC----ATTATTAAA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocucurbitaria aquatica CBS_297.74T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGACAACCATTAA--AA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACGATCTCTGGCGAGCATGGTCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGA---------------------------TTTCCTCCCTCACAGTGTCGGATGAAC---------AGCGAATC-------CTGACCAATG-GC--AGGCTTCGAACAACAAG-TTTGTTCCACGCGCCGTTCTCGTTGATCTCGAGCCCGGCACGATGGATGCTGTCCGCGCCGGTC????GGGGACTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTAGTCAAGAATTTGTCGTTGATGTGCTACGTTAGTGTTGGAAGCGACGCATCGCCCATCATCGATTTCATGACGCAGCGGAACATGCAATTGCTTGAGGAATATGACCAGAACCAAAATCCGGACGCCACCAAGGTTTTCGTCAACGGCGTCTGGGTCGGTGTGCATTCCAATGCCCATCAACTGGTCTCCGTCGTGCAAGAGCTTCGGAGGAATGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGTGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCCTTGTTCGTTGTAGAGAACGATATTCGGAAGCCGAATCGCAATCAACTTATTTTTACAAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGAAGTGGGTGGAGCGAACAGGAAATCGAAGCCGCTACATACGGCTGGAAAGGACTCATCCAAGACGGTGTTATCGAATACCTCGATGCGGAGGAAGAAGAAACTGCCATGATCACGATGTCACCTGAAGACCTCGATGAG 'Neocucurbitaria cava CBS_115979' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GCTCTTTGCCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCA-TTTGTTTCC--TTGGTAGGCTTTGCCTA--CCAATAGGAC-ACCACTT---AA--CC-TCTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTATCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------GATTC----CTCGC----TCACAGCGTCGGATGAAC---------TGTGAATG-------CTAACCAATG-GC--AGGCTTCCAACAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGCACAATGGACGCCGTCCGCGCCGGTC????GGGGTCTTGTGTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTAAAGAATCTGTCCTTGATGTGCTATGTCAGTGTCGGAAGCGACGCATCGCCGATCATCGACTTCATGACGCAGCGAAATATGCAACTCCTCGAAGAATATGACCAGAACCAAAATCCTGACGCCACCAAAGTCTTTGTCAACGGCGTGTGGGTCGGTGTGCATTCCAACGCCCACCAGCTCGTCTCCATTGTGCAAGAGCTTCGCAGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGCGATAGAGAGTTCAAGATTTTCACAGACGCTGGTCGTGTGATGAGGCCCTTATTCGTCGTAGAGAACGACATCCGAAAGCCAAACCGAAATCAGCTTATTTTCACCAAGGCAATCAGCACAAAACTCTTGATGGAGCAGCAGAGTCACGACCAACGAAATGGGTGGAGCGAACAGGAGATCGAAGCTGCTACTTATGGCTGGAAAGGGCTCATCCAAGACGGTGTCATTGAGTATCTCGATGCGGAGGAGGAAGAGACTGCTATGATTACCATGTCCCCTGAAGACCTGGATGAG 'Neocucurbitaria cava CBS_257.68T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAG--GCTCTTTGCCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCA-TTTGTTTCC--TTGGTAGGCTTTGCCTA--CCATTAGGAC-ACCACTT---AA--CC-TCTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTATCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------GATTC----CTCGC----TCACAGCGTCGGATGAAC---------TGTGAATG-------CTAACCAGTG-GC--AGGCTTCCAACAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGCACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTTGTGTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTAAAGAATCTGTCCTTGATGTGCTATGTCAGTGTCGGAAGCGACGCATCGCCGATCATCGACTTCATGACGCATCGAAATATGCAACTCCTCGAAGAATATGACCAGAACCAAAATCCTGACGCCACCAAAGTCTTTGTCAACGGCGTGTGGGTCGGTGTGCATTCCAATGCCCATCAGCTTGTCTCCATTGTGCAAGAGCTTCGGAGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGCGATAGAGAGTTCAAGATTTTCACAGACGCTGGTCGTGTTATGAGGCCCTTATTCGTCGTAGAGAACGACATCCGAAAGCCAAACCGAAATCAGCTTATTTTCACCAAGGCAATCAGCACAAAACTCTTGATGGAGCAGCAGAGTCACGACCAACGAAATGGGTGGAGCGAACAGGAGATCGAAGCTGCTACTTATGGCTGGAAAGGGCTCATCCAAGACGGTGTCATTGAGTATCTCGATGCGGAGGAGGAAGAGACTGCTATGATTACCATGTCCCCTGAAGACCTGGATGAG 'Neocucurbitaria hakeae CPC_28920T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCACTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAATGGCCTCTGTCAC-GTACCTCCCTTCGGGGTTGGCCTTATAGGG-GAGGCG-TAGTGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCA-TTTGTTTCC--TTGGTGGGCTTTGCCTG--CCAACAGGAC-ACCATTTA--AA--CC-TCTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCGGGCGAGCATGGTCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------GATGC-GCGATTCCTCTCTCACAGCGTCGGATGAAC---------AGCGGATG-------CTAACCAATG-GC--AGGCTTCTAACAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGCACAATGGACGCCGTCCGCGCTGGTC????GGGGCCTTGTGTGCCCAGCCGAAACCCCAGAAGGACAGGCTTGTGGGCTGGTCAAGAATCTGTCATTGATGTGTTATGTCAGTGTTGGAAGCGACGCATCGCCAATCATCGACTTCATGACTCAGCGAAATATGCAACTGCTCGAGGAATATGACCAAAATCAGAACCCAGACGCCACCAAAGTTTTTGTCAATGGCGTGTGGGTCGGTGTGCATTCCAATGCCCACCAGCTCGTCTCCATCGTGCAAGAGCTTCGGAGGAATGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGTGATAGAGAGTTCAAGATTTTCACAGACGCTGGTCGTGTCATGAGACCTTTGTTTGTGGTAGAGAATGACATTCGCAAGCCAAATCGAAATCAGCTTATCTTCACCAAGCAAATCAGCACAAAACTCCTCATGGAGCAGCAGAGTCACGACCAACGAAACGGGTGGAGCGAACAGGAGATTGAAGCCGCTACGTATGGCTGGAAAGGGCTCATCCAAGACGGTGTTATTGAATACCTCGATGCGGAAGAAGAAGAAACCGCTATGATCACCATGTCCCCCGAAGACCTTGATGAG 'Neocucurbitaria irregularis CBS_142791T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGAC---AACCATTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGAGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------GATGT-TCATACATCAGTGTCGGATG-------AAC---------AGTGCATT-------CTGACCAATG-GC--AGGCTTCTAACAACAAG-TTTGTTCCCCGCGCCGTTCTCGTCGATCTCGAGCCTGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGGCTTGTTTGCCCAGCCGAGACCCCTGAAGGACAGGCTTGTGGATTGGTCAAGAACTTGTCGTTGATGTGTTACGTTAGTGTCGGAAGCGATGCATCGCCCATTATCGATTTTATGACGCAGCGGAACATGCAACTCCTTGAAGAATATGACCAGAACCAAAATCCGGACGCCACCAAGGTTTTTGTCAACGGCGTCTGGGTCGGTGTGCATTCCAACGCCCACCAACTGGTCTCCGTCGTGCAAGAGCTTCGGAGGAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGCGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCCCTGTTCGTTGTAGAGAACGATATTCGTAAGCCGAATCGCAATCAGCTTATTTTTACCAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGGAGTGGGTGGAGTGAACAAGAAATCGAAGCCGCTACGTACGGCTGGAAAGGACTCATCCAAGACGGTGTCATTGAATACCTCGATGCGGAAGAAGAAGAAACTGCCATGATCACGATGTCCCCTGAAGACCTCGATGAG 'Neocucurbitaria keratinophila CBS_121759T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCTG--CCGATAGGAC---AACCATTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGTCTCGAT-GGATCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGA--------TTT-----------T-GC-TCCCTCAGTGTCGGATG-------AAC---------AGTGAATC-------CTGACCAATG-GC--AGGCTTCTAACAACAAG-TTTGTTCCCCGCGCCGTTCTCGTCGATCTCGAGCCTGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGGCTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTCAAGAATTTGTCGTTGATGTGCTACGTTAGTGTCGGAAGCGATGCATCGCCCATCATCGATTTCATGACGCAGCGGAACATGCAACTCCTTGAAGAATATGACCAGAACCAAAACCCGGACGCCACCAAGGTTTTTGTTAATGGCGTCTGGGTCGGTGTGCATTCTAATGCCCACCAACTGGTCTCTGTCGTTCAAGAGCTTCGGAGGAACGGGACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGCGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCTTTGTTCGTTGTAGAGAACGATATTCGGAAGCCAAATCGCAACCAGCTTATTTTTACCAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGGAGTGGGTGGAGCGAACAGGAAATCGAAGCCGCTACATACGGCTGGAAAGGACTCATCCAAGACGGTGTCATTGAATACCTCGATGCGGAGGAAGAAGAGACTGCCATGATCACGATGTCCCCTGAAGACCTCGATGAG 'Neocucurbitaria quercina CBS_115095T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGCTTTGCCTG--CCAATAGGAC----ACTATCAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------GATTT----CCCTC----TCACAGTATCGGGTGAGC---------AGTAAATG-------CTGACCAATG-GC--AGGCTTCTGGCAACAAG-TTCGTCCCCCGCGCCGTTCTCGTCGATCTGGAGCCTGGCACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTAAAGAATCTGTCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCATCGCCCATCATCGATTTCATGACGCAGCGAAACATGCAGCTCCTCGAAGAATATGACCAGAATCAAAATCCCGACGCTACGAAGGTTTTTGTTAACGGTGTCTGGGTTGGTGTGCATTCCAATGCCCACCAGCTCGTCTCTGTCGTGCAAGAGCTTCGGAGGAACGGGACTCTCTCTTACGAGATGAGTTTGATCCGTGACATTCGTGATAGAGAGTTTAAGATTTTCACAGACGCTGGCCGTGTTATGAGGCCCTTGTTCGTTGTAGAGAACGATATTCGGAAGCCGAACCGCAATCAGCTCATTTTTACCAAGGCCATCAGCCAGAAACTCCTTATGGAGCAACAGAGTCACGAGCAGCGGAGTGGGTGGAGCGAACAGGAAATTGAAGCCGCTACGTACGGCTGGAAAGGACTCATCCAAGACGGTGTCATTGAGTACCTCGATGCGGAGGAAGAAGAAACTGCCATGATCACCATGTCCCCTGAAGATCTAGATGAG 'Neocucurbitaria unguis hominis_CBS_111112' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGAC---AACCATTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGCGCCGCCTTCT-------------------------------------------------------------GGCAGACGATCTCTGGCGAGCATGGTCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTAA---------------------------TTTCCTCCCTCACAATGTCGAATGAAC---------AGCGAATC-------CTGACCAATG-GC--AGGCTTCGAACAACAAG-TTTGTTCCACGCGCCGTTCTCGTCGATCTCGAGCCCGGCACGATGGATGCTGTCCGCGCCGGTC????GGGGACTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTCAAGAATTTGTCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCATCGCCCATCATCGATTTCATGACGCAGCGGAACATGCAACTGCTTGAGGAATATGACCAGAACCAAAATCCGGACGCCACCAAGGTTTTCGTCAACGGCGTCTGGGTCGGTGTGCATTCCAATGCCCATCAACTGGTCTCCGTCGTGCAAGAGCTTCGGAGGAATGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGTGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCCTTGTTCGTTGTAGAGAACGATATTCGGAAGCCGAATCGCAATCAACTTATTTTTACAAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGAAGTGGGTGGAGCGAACAGGAAATCGAAGCCGCTACATATGGCTGGAAAGGACTTATCCAAGACGGTGTTATCGAATACCTCGATGCGGAGGAAGAAGAAACTGCCATGATCACGATGTCACCTGAAGACCTCGATGAG 'Neocucurbitaria unguis hominis_CBS_112.79' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGAC---AACCATTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGCGCCGCCTTCT-------------------------------------------------------------GGCAGACGATCTCTGGCGAGCATGGTCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTAA---------------------------TTTCCTCCCTCACAATGTCGAATGAAC---------AGCGAATC-------CTGACCAATG-GC--AGGCTTCGAACAACAAG-TTTGTTCCACGCGCCGTTCTCGTCGATCTCGAGCCCGGCACGATGGATGCTGTCCGCGCCGGTC????GGGGACTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTCAAGAATTTGTCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCATCGCCCATCATCGATTTCATGACGCAGCGGAACATGCAACTGCTTGAGGAATATGACCAGAACCAAAATCCGGACGCCACCAAGGTTTTCGTCAACGGCGTCTGGGTCGGTGTGCATTCCAATGCCCATCAACTGGTCTCCGTCGTGCAAGAGCTTCGGAGGAATGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGTGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCCTTGTTCGTTGTAGAGAACGATATTCGGAAGCCGAATCGCAATCAACTTATTTTTACAAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGAAGTGGGTGGAGCGAACAGGAAATCGAAGCCGCTACATATGGCTGGAAAGGACTTATCCAAGACGGTGTTATCGAATACCTCGATGCGGAGGAAGAAGAAACTGCCATGATCACGATGTCACCTGAAGACCTCGATGAG 'Neocucurbitaria unguis hominis_UTHSC_DI16_213' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGGGGAGGCG-TAATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TCGGTGGGC-TTGCCTG--CCGATAGGAC---AACCATTAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCTTCAAAGCTCTT----------GCTTGGGTGTTGGGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACGATCTCTGGCGAGCATGGTCTCGAT-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTAA---------------------------TTTCCTCCCTCACAGTGTCGAATGAAC---------AGCGAATC-------CTGACCAATG-GC--AGGCTTCGAACAACAAG-TTTGTTCCACGCGCCGTTCTCGTCGATCTCGAGCCCGGCACGATGGATGCTGTCCGCGCCGGTC????GGGGACTTGTTTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGACTGGTCAAGAATTTGTCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCATCGCCCATCATCGATTTCATGACGCAGCGGAACATGCAACTGCTTGAGGAATATGACCAGAACCAAAATCCGGACGCCACCAAGGTTTTCGTCAACGGCGTCTGGGTCGGTGTGCATTCCAATGCCCATCAACTGGTCTCCGTCGTGCAAGAGCTTCGGAGGAATGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGATATTCGTGATAGAGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGAGGCCCTTGTTCGTTGTAGAGAACGATATTCGGAAGCCGAATCGCAATCAACTTATTTTTACAAAGGCTATTAGCCAGAAGCTGCTCATGGAGCAACAGAGCCACGAGCAACGAAGTGGGTGGAGCGAACAGGAAATCGAAGCCGCTACATATGGCTGGAAAGGACTTATCCAAGACGGTGTTATCGAATACCTCGATGCGGAGGAAGAAGAAACTGCCATGATCACGATGTCACCTGAAGACCTCGATGAG 'Neodidymelliopsis achlydis CBS_256_77T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCGGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---CACTTA--AA--CC-CATTGCAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GATTC-GT-CGAAC----GTA-AACG-------GAC---------TGCGAGTG-------CTGACCATCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neodidymelliopsis cannabis CBS_234.37' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ATCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC---CACTTA--AA--CC-CTTTGTAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACC-------GACCC-GT-CAATG----GAC-AACG-------GAC---------TGCGAGTG-------CTGACCATCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGTGCCGGCC????GGGGTCTTGTTTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCCATTTCCGACTTCATGTCCCAGCGTAACATGCAGCTCCTTGAAGAGTACGATCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTCGGTGTTCACTCCAACGCACAGCAACTTGTTTCGACCGTGCAAGAACTACGACGAAACGGCACTTTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCTCTGTTCGTCGTTGAGAGCGACATTCGCAAGCCAAACCGCAACCATCTCGTTTTCAACCAAGACCACTACAGCAAGCTAGTGGCAGAGCAGCAG-GCGCAGGCCGCGGCAGGTGTGGG--TGAAGAGGAGAAGACTGAGCTTACATACGGCTGGAAGGGCCTCATCCAAGACGGTGTCATCGAATATCTCGATGCAGAAGAAGAGGAGACTGCCATGATCGTCATGTCACCCGAAGATCTCGGCGAA 'Neodidymelliopsis longicolla CBS_382_96T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTATGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC---CACTTA--AA--CC-CTTTGCAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACTC-GT-CGAAC----GTC-AACG-------GAC---------TGCGAGTG-------CTGACCGTCT-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neodidymelliopsis longicolla UTHSC_DI16_322' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTATGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC---CACTTA--AA--CC-CTTTGCAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACTC-GT-CGAAC----GTC-AACG-------GAC---------TGCGAGTG-------CTGACCGTCT-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAGAACCTCTCTCTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGGCCTATCTCTGACTTCATGTCCCAGCGGAACATGCAGCTCCTTGAAGAGTACGACCAGAACCAAAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTATGGGTTGGTGTCCATTCCAACGCACAACAGCTTGTCTCGACTGTGCAAGAACTACGACGAAACGGTACCTTGTCCTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTGTTCGTCGTCGAGAGCGATGTTCGTAAGCCTAACCGCAACCACCTCGTCTTCAGCCAGGATCACTACAACAAGCTCGTCGCAGAGCAGCAG-GCGCAGGCCGCAGCAGGTGTAGG--TGAAGAGGAAAAGACCGAGCTCACATACGGCTGGAAGGGGCTCATCCAAGACGGTGTCATCGAATACCTGGATGCAGAGGAAGAGGAAACGGCCATGATTGTCATGTCACCCGAAGACCTTGGCGAG 'Neodidymelliopsis polemonii CBS_109181T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCGGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---CACTTA--AA--CC-CATTGCAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAC-------GATTC-GT-CGAAA----GTC-AACG-------GAC---------TGCGAGTG-------CTGACCACCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCTGTTCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTCTAATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCCATCTCCGACTTCATGTCTCAGCGGAACATGCAGCTCCTCGAAGAGTACGATCAAAACCAGAACCCCGATGCTACAAAGGTTTTCGTCAACGGTGTATGGGTTGGTGTCCACTCCAACGCACAACAACTTGTCTCGACCGTGCAAGAACTACGACGAAACGGCACATTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTGTTCGTCGTCGAGAGTGATGTCCGTAAACCCAACCGCAACCACCTCGTCTTCAGCCAGGACCACTACAACAAGCTCGTCGCAGAACAGCAG-GCGCAGGCTGCGGCAGGTGTGGG--TGAAGAGGAGAAGACCGAGCTTACATATGGCTGGAAGGGACTCATCCAAGACGGTGTCATCGAATACCTGGATGCTGAAGAAGAGGAAACCGCCATGATTGTCATGTCACCCGAAGACCTTGGCGAA 'Neodidymelliopsis xanthina CBS_383.68' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCGGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTTGAGCACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---CACTTA--AA--CC-CATTGCAGTTTTGTAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAACGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAC-------GATTT-AG-CGAAT----GTC-AACG-------GAC---------TGCGAGTG-------CTGACTATCC-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTTTGCCCTGCCGAGACGCCCGAAGGACAGGCCTGTGGTTTAGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCCATCTCCGACTTCATGTCTCAGCGGAACATGCAGCTCCTCGAAGAGTACGATCAAAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTCCACTCCAACGCACAACAACTTGTCTCGACCGTGCAAGAACTACGACGAAACGGCACATTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGCGTCATGAGGCCTCTGTTCGTCGTCGAGAGTGATGTCCGTAAGCCCAACCGCAACCACCTCGTCTTCAGCCAAGACCACTACAACAAGCTCGTCGCAGAGCAGCAG-GCGCAGGCCGCAGCAGGTGTGGG--TGAAGAGGAAAAGACCGAGCTTACGTATGGCTGGAAGGGGCTCATCCAAGACGGTGTCATCGAATACCTGGATGCTGAAGAAGAGGAAACCGCCATGATTGTCATGTCACCCGAAGACCTTGGCGAA 'Neomicrosphaeropsis italica MFLUCC_15_0484' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTAACTCTCTTCGGAGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCTT----TTACGACG-------GAC---------TGCGAGTG-------CTGACCTCTG-AC--AGGCCTCTGGTAACAAG-TTTGTTCCCCGTGCCGTCCTCGTTGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTGAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTCGTATCAACTGTGCAAGAACTGCGACGAAACGGAACACTATCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTTACCGACGCTGGACGTGTCATGAGACCTTTGTTCGTTGTTGAGAGCGATGTTCGCAAGCCCAACCGCAACCACCTCGTTTTCAGCCAAGAACACTACAACAAGCTGGTGGCTGAGCAGCAG-GCGCAGGCTGCGGCGGGTGTTGG--TGAAGAGGAGAAGACTGAGCTCACATACGGATGGAAGGGGCTCATCCAAGACGGTGTCATCGAGTATCTCGATGCAGAGGAAGAAGAGACTGCCATGATTGTCATGTCACCAGAGGATCTCGGCGAA 'Neomicrosphaeropsis italica MFLUCC_15_0485' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTAACTCTCTTCGGAGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTGAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTCGTATCAACTGTGCAAGAACTGCGACGAAACGGAACACTATCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTTACCGACGCTGGACGTGTCATGAGACCTTTGTTCGTTGTTGAGAGCGATGTTCGCAAGCCCAACCGCAACCACCTCGTTTTCAGCCAAGAACACTACAACAAGCTGGTGGCTGAGCAGCAG-GCGCAGGCTGCGGCGGGTGTTGG--TGAAGAGGAGAAGACTGAGCTCACATACGGATGGAAGGGGCTCATCCAAGACGGTGTCATCGAGTATCTCGATGCAGAGGAAGAAGAGACTGCCATGATTGTCATGTCACCAGAGGATCTCGGCGAG 'Neophaeosphaeria agaves CPC_21264' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCAC-GTACCCCTCTTCGGGGG-GGCCTTATAGGG-GAAACG-ACATGCAACC-AGCCCAGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTCTATTTGCGTACCG-TTTGTTTCC--TTGGTGGGC-TCGCCCG--CCAAAAGGAC----ACCCATAAA--ACCTTTTGTAA--TTGCAATCAGCG--------TCAGTAAAA-ACAA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeosphaeria filamentosa CBS_102202' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCAC-GTACCCCTCTTCGGGGG-GGCCTTATAGGG-GGAACG-ACATGCAACC-AGCCCAGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTCTATTTGCGTACCG-TTTGTTTCC--TTGGTGGGC-TCGCCTG--CCAAAAGGAC----ACCTATAAA--AC-TCTTGTAA--TTGCAATCAGCG--------TCAGTTAAA-ACAA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTCGTTTGTCCGGCTGAGACGCCTGAAGGTCAGGCTTGTGGCTTGGTCAAGAACTTGTCATTGATGTGCTACGTCAGCGTTGGTAGCGATGCATCGCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTCGAGGAGTACGACCAGAACCAAAACCCGGATGCTACCAAAGTTTTCGTCA{AG}CGGTGTTTGGGTCGGTGTGCATTCCAATGCTCAACAACTTGTCTCTGTTGTCCAGGAGCTTCGGAGGAACGGCACTCTGTCTTACGAGATGAGTCTGATTCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACGGATGCAGGACGTGTTATGAGGCCGTTATTTGTCATTG{AG}GAACGACATCAGAAAACCAAACCGCAACCAACTCATTTTCACCAAGGAAATTAGCAGGAAGCTTCTTTATGAGCAACAGAGTCAGGACCAACGCCAAGGTTGGAGCGAAGAGGAAATAGCAGCTTCTACGTATGGCTGGAAGGGTCTCATTCAAGACGGTGTGATTGAGTATCTTGACGCTGAAGAAGAGGAGACTGCAATGATAACGTTTTCTCCTGAAGACCTAGACGAA 'Neoplatysporoides aloicola CBS_139901' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTACCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTCCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTATGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-CTTGTTTCC--TTGGTGGGT-TCGCCCA--CCAGCAGGAC----ACTCATAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ACAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG-AGCGTCA-TTTGAACCCTC-AAGCCTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neopyrenochaeta acicola CBS_812.95' GGGTCCGAGTTGTAATTTGCAGAGGGAGCTTTCGAGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCAGGCCTTCTCGAGGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTG-TATGTTTCC--TCGGCGGGT-TCGCCCG--CCGATAGGAC----ACTTCAAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAACTATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTTGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGT--------TTT-------TGCTC-AC-TCT----------AACGCCGCCCTGGA---------TGCAGCCA-------CTGACCATCT-GT--AGGCTTCCGGAAACAAG-TTCGTTCCCCGCGCCGTTCTCGTTGATCTCGAGCCCGGCACAATGGATGCCGTCCGCGCTGGAC????GGGGTCTCGTTTGTCCTGCCGAAACTCCCGAAGGACAGGCTTGTGGTTTAGTCAAGAATCTCTCCTTGATGTGCTATGTTAGCGTTGGTAGCGACGCATCGCCCATTATCGACTTCATGACTCAACGAAACATGCAGCTTTTGGAAGAATACGACCAAAACCAGAACCCAGATGCCACCAAGGTTTTTGTCAACGGTGTCTGGGTTGGTGTACATTCCAATGCCCATCAGCTTGTTTCGGTCGTGCAGGAGCTCCGAAGAAACGGCACATTGTCATACGAAATGAGCTTGATCCGTGACATTCGTGACCGGGAATTCAAAATCTTCACAGATGCCGGCCGTGTGATGAGGCCATTGTTCGTTGTTGAGAATGACATCCGAAAGCCGAATCGCAATCAGCTCATCTTTACCAAAGATATCAGTAAGAAGCTTCTACTCGAGCAGGAGAGCCACGATGAGCGCAATGGGTGGAGTGAAGAGGAGATTGCAGCTGCCACATACGGATGGAAAGGTCTCATTCAAGATGGTGTAATTGAATACCTCGATGCGGAAGAAGAAGAAACTGCCATGATTACCTTCTCTCCTGAAGACCTGGATGAG 'Neopyrenochaeta fragariae CBS_101634' GGGTCCGAGTTGTAATTTGCAGAGGGAGCTTTCGAGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCAGGCCTTCTCGAGGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTG-TATGTTTCC--TCGGCGGGT-TCGCCCG--CCGATAGGAC----ACTTCAAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-AACT-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGT--------TTT-------TGTTC-CC-TCT----------AACGCCGCCCTGGA---------CGCAGCCA-------CTGACCACCT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGCGCTGTTCTCGTCGATCTCGAGCCCGGCACAATGGATGCCGTCCGCGCTGGAC????GGGGTCTTGTTTGTCCTGCCGAAACTCCCGAAGGACAGGCTTGTGGTTTAGTCAAGAATCTCTCCTTGATGTGCTATGTTAGCGTCGGTAGCGACGCATCGCCCATTATCGACTTCATGACTCAACGAAACATGCAGCTTTTGGAAGAATACGACCAAAACCAGAACCCAGATGCCACCAAAGTTTTTGTCAACGGTGTCTGGGTTGGTGTGCATTCCAATGCCCATCAGCTTGTTTCGGTCGTGCAGGAGCTCCGAAGGAACGGCACATTGTCATACGAAATGAGCTTGATCCGTGACATTCGTGACCGGGAATTCAAAATCTTCACAGACGCCGGCCGTGTGATGAGGCCATTGTTCGTTGTTGAGAATGACATCCGAAAGCCGAACCGCAATCAGCTCATCTTTACCAAAGATATCAGTAAGAAGCTTCTACTCGAGCAGGAGAGCCACGATGAGCGCAATGGGTGGAGTGAAGAGGAGATTGCGGCTGCCACATACGGATGGAAAGGTCTCATTCAAGATGGTGTAATTGAATACCTCGATGCTGAAGAAGAAGAAACTGCCATGATTACCTTCTCTCCTGAAGACCTGGATGAG 'Neopyrenochaeta inflorescentiae CBS_119222T' GGGTCCGAGTTGTAATTTGCAGAGGGAGCTTTCGAGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCAGGCCTTCTCGAGGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTG-TATGTTTCC--TCGGCGGGC-TCGCCCG--CCGATAGGAC----ACTTCAAAA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-AAACTATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTGCTTTTTCAGCATCTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGT--------TTT-------TGCTC-CC-TCT----------AACGTCGCCCTGGA---------CGCAGCCA-------CTGACGACCT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGCGCTGTTCTCGTCGATCTCGAGCCCGGCACAATGGATGCCGTCCGCGCTGGAC????GGGGTCTCGTTTGCCCTGCCGAAACTCCCGAAGGACAGGCTTGTGGTTTAGTTAAGAATCTCTCCTTGATGTGCTATGTTAGCGTCGGTAGCGACGCATCGCCTATCATCGACTTCATGACTCAACGAAACATGCAGCTCTTGGAAGAATACGACCAAAATCAGAACCCAGATGCCACCAAGGTTTTTGTCAACGGTGTCTGGGTTGGTGTACATTCCAATGCCCATCAGCTTGTTTCGGTCGTGCAGGAGCTCCGAAGAAACGGCACATTGTCATACGAAATGAGCCTGATTCGTGACATTCGTGACCGGGAATTCAAAATCTTCACAGATGCCGGCCGTGTGATGAGGCCATTGTTCGTTGTTGAGAATGACATCCGAAAGCCGAACCGCAATCAGCTCATCTTTACCAAGGATATCAGTAAGAAGCTTCTACTCGAGCAGGAGAGCCACGATGAGCGCAACGGGTGGAGCGAAGAGGAGATTGCAGCTGCCACATACGGATGGAAAGGTCTCATTCAAGATGGTGTCATCGAGTACCTCGACGCAGAAGAAGAAGAAACTGCCATGATTACCTTCTCTCCTGAAGACCTGGATGAG 'Neopyrenochaeta telephoni CBS_139022T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCACCGAGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGATATTGTTGAAAGGGAAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTG-TATGTTTCC--TCGGCGGGT-TCGCCCG--CCGATAGGAC----ATTCATAAA--CC-CTTCGTAG--TTGCAATCAGCG--------TCAG--AAA-AAACTATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTTAACGAGGTA------CGTGA------------------------TC-TCTCC----TTTCGACGATATCTTGGA---------CGCGAATG-------TTGACCTTTG-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGCGCTGTCCTTGTCGATCTCGAGCCCGGCACAATGGATGCTGTTCGCGCTGGAC????GGGGTCTCGTTTGCCCTGCCGAAACCCCTGAAGGACAGGCCTGTGGGCTAGTCAAGAATCTTTCTTTGATGTGCTATGTCAGCGTCGGCACTGATGCCTCGCCTATTATCGACTTCATGACACAGCGAAACATGCAACTCTTGGAAGAATATGACCAAAATCAGAATCCCGATGCTACCAAGGTCTTCGTCAATGGTGTTTGGGTTGGTGTACATTCCAATGCCCACCAGCTCGTCTCAGTCGTGCAGGAGCTCCGAAGGAATGGTACTCTATCCTACGAAATGAGCTTGATTCGTGACATTCGAGACCGCGAATTCAAGATCTTCACAGATGCCGGTCGTGTGATGCGGCCCTTGTTTGTTGTAGAAAATGATATTCGAAAGCCAAATCGCAACCAGCTCATTTTTACCAAGGATATCAGCAAGAAGCTTCTGTTAGAGCAACAGAGCCACGATGAACGCAACGGGTGGAGTCAAGACGAGATTGCAGCCGCCACTTACGGCTGGAGAGGACTTATTCAAGATGGTGTGATTGAGTATCTCGATGCAGAAGAAGAGGAAAGCGCCATGATTACCTTCTCTCCTGAAGACTTAGACGAA 'Neopyrenochaetopsis hominis UTHSC_DI16_238T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCCTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TTGGTGGGC-TTGCCTG--CCAAAAGGAC-ACTATAA---AA--CC-ACTTGTAA--TAGCAATCAGCG--------TCAG---AT-AACT-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACTCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAGATTGGTGCTGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGCTATGGTGT------------------------------------------------------------CTACAACGGCACCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGG--------TTCGT--------AAT-------GCCAAAGC-TGTCT--------GA---------GAC--------TTTTCCATG-------CTAATTGATG-GC--AGGCCTCCAACAACAAG-TATGTTCCCCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACGATGGACGCTGTCCGCGCCGGTC????GGGGTTTGGTCTGTCCTGCAGAGACTCCGGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCAGTGTTGGCAGCGACGCGTCGCCTATTATTGACTTCATGTCACAGCGCAATATGCAATTGCTGGAAGAGTATGATGCGGTGCAGAACCCAGAAGCCACCAAGGTCTTTGTTAATGGTGTGTGGGTTGGTGTGCATTCCAACGCTCAGCAGCTTGTCTCCACTGTTCAGGAACTTCGCCGGAATGGTACCCTCTCATATGAGATGAGTTTGATCCGTGACATCCGTGATCGCGAATTCAAGATCTTCACTGATGCCGGTCGCGTCATGAGACCATTGTTCGTTGTCGAAAATGACCCCCGTAAACCCAACCGCAACCAGTTGATCTTCACAAAAGATATCAGCAGGAAGCTGCTTATGGAACAGCAGACTAACGATTCGCGTGATGGCTGGAGCGAAGAAGAGATTGCGGCAACCACTTACGGTTGGAAGGGCCTGATCCAGGATGGTGTCATCGAGTACCTCGATGCCGAAGAGGAAGAGACGGCCATGATCACTTTCTCGCCTGAAGATCTGGACGAA 'Nothophoma anigozanthi CBS_381.91T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTCTGTCCCGCCGAAACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAAAACCCTGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTGCACTCTAACGCACAGCAGCTTGTATCGACCGTGCAGGAGCTTCGCCGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCATTGTTCGTCGTGGAGAGCGACGTCCGAAAGCCAAACCGCAATCATCTTGTCTTCAGCCAGGAACACTACAATAAGCTGGTTGCCGAACAACAG-GCTCAGGCTGCGGCAGGCGTTGG--CGAGGAGGAGAAGACCGAGCTCACATACGGCTGGAAAGGTCTCATCCAGGATGGTGTTATCGAATACCTTGATGCCGAAGAAGAGGAGACCGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Nothophoma arachidis hypogaeae_CBS_125.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACCC-GC-GTTCC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTATCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAATACGACCAGAACCAAAACCCTGACGCCACCAAGGTTTTCGTCAATGGTGTTTGGGTCGGTGTCCATTCCAACGCACAGCAACTTGTATCGACCGTGCAGGAGCTGCGCCGAAACGGAACCCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTCTTCGTTGTCGAGAGCGATGTCCGGAAGCCCAACCGTAACCATCTCGTCTTCAGCCAAGAACACTACAACAAGCTGGTTGCCGAACAGCAG-GCGCAAGCTGCCGCAGGTGTTGG--TGAAGAAGAAAAGACCGAGCTTACATATGGCTGGAAGGGTTTGATTCAAGATGGTGTCATCGAATACCTTGACGCCGAAGAGGAGGAAACTGCTATGATCGTCATGTCACCTGAGGACCTTGGCGAG 'Nothophoma gossypiicola CBS_377.67' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---ACTTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTACA-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAGGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCTGACGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTTGTATCGACCGTGCAGGAGCTTCGCCGAAACGGAACTCTGTCTTATGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCTCTTTTCGTTGTCGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTTGTCTTCAGTCAGGACCACTACAACAAGCTGGTCGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--CGAAGAAGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTTATTGAATACCTCGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAG 'Nothophoma gossypiicola UTHSC_DI16_294' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---ACTTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTTAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTACA-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAGGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCTGACGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTTGTATCGACCGTGCAGGAGCTTCGCCGAAACGGAACTCTGTCTTATGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCTCTTTTCGTTGTCGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTTGTCTTCAGTCAGGACCACTACAACAAGCTGGTCGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--CGAAGAAGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTTATTGAATACCTCGACGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAG 'Nothophoma infossa CBS_123395T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-AATTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC-GC-GTTCC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTATCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAAAACCCTGACGCCACCAAGGTCTTTGTCAATGGTGTTTGGGTCGGTGTCCATTCCAACGCACAGCAACTTGTATCGACCGTGCAGGAGCTGCGCCGAAACGGAACCCTGTCTTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTCTTCGTTGTCGAGAGCGATGTCCGTAAGCCCAACCGTAACCATCTCGTCTTCAGCCAAGAACACTACAACAAGCTGGTTGCCGAGCAGCAG-GCGCAAGCTGCCGCAGGCGTTGG--TGAGGAAGAAAAGACCGAGCTTACATATGGCTGGAAGGGTTTGATTCAAGATGGTGTCATCGAATACCTCGACGCCGAAGAAGAGGAAACTGCCATGATCGTCATGTCACCTGAGGACCTTGGTGAG 'Nothophoma macrospora CBS_140674' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---ACTTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-TC-TTCCC----ACA-GACG-------GAC---------TGCGAGTG-------CTGACCTTCC-AC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAGGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCCGGGCCTATCTCCGACTTCATGAGCCAGAGAAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCTGACGCCACCAAGGTTTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAACGCGCAGCAGCTTGTATCGACTGTGCAGGAGCTTCGCCGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCTCTGTTCGTTGTTGAGAGCGACGTTCGTAAGCCAAACCGCAACCATCTTGTCTTCAACCAGGAGCACTACAACAAGCTGGTCGCAGAACAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--TGAAGAAGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTTATTGAATACCTCGATGCCGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCCGAGGATCTCGGCGAG 'Nothophoma quercina CBS_633.92' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-AATTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTTGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------TAT-------GACAC-GC-TTTAC----TGC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCACTGATGTGCTACGTCAGCGTCGGTAGTGATGCCGGGCCAATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGACGCCACTAAGGTCTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAACGCACAACAGCTTGTATCAACCGTGCAGGAGCTGCGCCGGAACGGAACTTTGTCTTACGAGATGAGTTTGATCCGAGATATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCATTGTTCGTTGTCGAGAGCGACGTCCGAAAGCCCAACCGCAATCACCTTGTCTTCAGCCAGGAGCATTACAACAAGTTGGTCGCCGAGCAGCAG-GCGCAGGCCGCAGCAGGCGTTGG--TGAAGAAGAGAAGACCGAGCTCACATATGGCTGGAAGGGGCTTATTCAGGATGGTGTTATCGAATACCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTTATGTCACCTGAAGACCTTGGCGAG 'Nothophoma quercina UTHSC_DI16_270' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTAAGTACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------TAT-------GACAC-GC-TTTAC----TGC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCACTGATGTGCTACGTCAGCGTCGGTAGTGATGCCGGGCCAATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTTCTTGAGGAGTACGACCAGAACCAGAACCCTGACGCCACTAAGGTCTTCGTCAACGGTGTTTGGGTTGGTGTGCACTCCAACGCACAACAGCTTGTATCAACCGTGCAGGAGCTGCGCCGGAACGGAACTTTGTCTTACGAGATGAGTTTGATCCGAGATATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCATTGTTCGTTGTCGAGAGCGACGTCCGAAAGCCCAACCGCAATCACCTTGTCTTCAGCCAGGAGCACTACAACAAGTTGGTCGCCGAGCAGCAG-GCGCAGGCCGCAGCAGGCGTTGG--TGAAGAAGAGAAGACCGAGCTCACATATGGCTGGAAGGGGCTTATTCAGGATGGTGTTATCGAATACCTTGACGCCGAAGAAGAGGAGACTGCCATGATTGTTATGTCACCCGAAGACCTTGGCGAG 'Nothophoma variabilis CBS_142457T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTGGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGCACCT-TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAAAAAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTTCG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGAACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCGGAAACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTGGGCCCATCTCTGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAAAACCCTGACGCCACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTGCACTCCAACGCACAACAGCTTGTATCGACCGTGCAGGAGCTTCGTCGAAACGGAACTCTGTCTTATGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGACGTGTCATGAGGCCATTGTTCGTCGTTGAGAGCGACGTCCGAAAGCCCAACCGTAATCATCTCGTCTTCAGCCAGGAGCACTACAACAAGCTGGTCGCCGAGCAGCAG-GCTCAGGCCGCAGCAGGCGTTGG--TGAAGAAGAGAAGACTGAGCTCACATACGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTATCTCGATGCCGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCTGAGGATCTCGGCGAG 'Ochrocladosporium elatum CBS_146.33' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTATCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGATG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTCTTTTTGCGTACTA-TTTGTTTCC--TCGGTAGGC-TTGCCTG--CCGATAGGAC-ACTATAAA--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--TAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Ochrocladosporium frigidarii CBS_103.81' CAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTATCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGATG-TCATACAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTCTTTTTGCGTACTA-TTTGTTTCC--TCGGTAGGC-TTGCCTG--CCGATAGGAC-ACTATAAA--AA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG--TAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Ophiosphaerella herpotricha AFTOL_ID_1569' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGG--ACTTTT-GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTATCAC-GTACCTCCCTTCGGGGTTGGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGAACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGCACT--CATGTTTCC--TCGGCGGGC-TTGCCCG--CCGACTGGAC--AAACTTAT-AA--CC-TTTTTAAT--TTTCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGGCTCGTGTGCCCTGCCGAAACCCCGGAAGGACAGGCTTGCGGTTTAGTCAAGAACTTATCTCTGATGTGCTACGTCAGCGTTGGAAGTGACGCTTCTCCTATTGTCGACTTCATGTCGCAACGGAACATGCAGCTTCTCGAAGAGTACGACCAGAACCAAAATCCGGAGGCTACCAAAATTTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCCAGGCGCAACAGCTTGTCTCGGTTGTCCAGGAGCTGAGGAGAAACGGAACGCTATCGTACGAGATGAGTCTGATTCGTGATATTCGTGATCGGGAGTTCAAGATCTTCACAGATGCCGGTCGCGTCATGCGCCCTCTCTTCGTTGTTGAGAACAGACCCTCAAAACCGAACAGAAACATGCTCGTGTTTGACAGGGAGATCAGTAACAAACTTGTGCGTGAGCAGCAGGACTCTGATGCTCGCGTTGGATGGAGTGAAGAAGACATTGCCGAGCACACCTACGGATGGAAGGGCCTTATCCAAAATGGCGTGATCGAATATCTCGATGCTGAAGAGGAGGAGACTGCAATGATAACGTTCTCTCCGGAGGATCTCGATGAA 'Paraboeremia adianticola CBS_187.83' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCTTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTTTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTCTTGTCAAGAACCTGTCTCTTATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTGCTCGAGGAGTACGACCAGAACCAGAATCCTGACGCAACAAAGGTCTTCGTCAACGGTGTATGGGTGGGTGTGCACTCCAACGCACAGCAGCTCGTGTCGACTGTGCAGGAGTTGCGCCGAAACGGAACTCTCTCCTACGAGATGAGTTTGATTCGAGATATTCGAGACCGAGAGTTTAAGATCTTCACCGACGCTGGACGTGTCATGAGGCCTCTGTTCGTCGTGGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAGCACTACAACAAGCTGGTCGCCGAGCAGCAG-GCGATGGCGGCCGCAGGTATTGG--CGAAGAGGAGAAGAACGAGCTCACATACGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGACGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCTCCCGAGGATCTCGGCGAG 'Paraboeremia camelliae CGMCC_3_18106T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGTAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCATC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTTTGCCCTGCCGAGACACCTGAAGGACAAGCCTGCGGTCTTGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAACAGCTCGTTTCGACCGTGCAGGAACTGCGTCGGAACGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCTCTGTTCGTTGTGGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGACTGATTCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia camelliae CGMCC_3_18107' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGTAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCATC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTTTGCCCTGCCGAGACACCTGAAGGACAAGCCTGCGGTCTTGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAACAGCTCGTTTCGACCGTGCAGGAACTGCGTCGGAACGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCTCTGTTCGTTGTGGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGACTGATTCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia camelliae CGMCC_3_18108' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGTAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCATC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTTGTTTGCCCTGCCGAGACACCTGAAGGACAAGCCTGCGGTCTTGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCCATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAACAGCTCGTTTCGACCGTGCAGGAACTGCGTCGGAACGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCTCTGTTCGTTGTGGAGAGCGACGTCCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCTGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGACTGATTCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia litseae CGMCC_3_18109T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ATT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGTCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTTGTCAACGGTGTATGGGTTGGTGTGCACTCCAACGCGCAACAGCTCGTTTCGACTGTGCAGGAACTGCGTCGAAACGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGTGAGTTCAAGATCTTCACAGACGCTGGTCGCGTCATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia litseae CGMCC_3_18110' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGTCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCCAACGCGCAACAGCTCGTTTCGACTGTGCAGGAACTGCGTCGAAACGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGTGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia oligotrophica CGMCC_3_18111T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AACTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------AACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGGC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGATGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTGCGTCGAAATGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTAATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCAGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAGGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia oligotrophica CGMCC_3_18112' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AACTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------AACAC-GC-TTTCC----TTG-GACG-------GAC---------TGCGAGTG-------CTGACCGCTT-CT--AGGCCTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGCACAATGGACGCCGTCCGCGCTGGGC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGATGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTGCGTCGAAATGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTAATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCAGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAGGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia putaminum CBS_130.69' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCA--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGACCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCCGATGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTACACTCCAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTGCGTCGAAATGGAACCCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTAATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAGGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraboeremia selaginellae CBS_122.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGC-TCGCCCG--CCGGTTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCAGCTCCGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TCTTC----TAC-GACG-------GAC---------TACGAGCG-------CTGACCGTCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCCGGTC????GGGGTCTCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGTCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCTAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTTCGTCGAAACGGAACTCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGTGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGCAGAGCAGCAG-GCGATGGCTGCCGCAGGTGTTGG--CGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACTGCCATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Paraconiothyrium estuarinum CBS_109850' GGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAG--GCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGACAAAGGCCTCTGTCAA-GTATCTCCCTTCGGGGT-GACCTTATAGGG-GAGGCG-TAATGCGACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TTTTTTTACGAGCACCT-TTCGTTCTCCTTCGGTGGGG-CAACCTG--CCGCTGGAAC------TTATCAAAACC-TTTT------TTGCATCTAGCATTACCTGTTCAG--ATACAAAC---AAT-CGTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TCTACACCCTC-AAGCTCTG------------CTTGGTGTT-GGGCG????GGTAACCAAATCGGTGCTGCTTTCT-------GTGCGTCGATCTACAGAAAGCTCTGCCGATGCGACGACGACTGACTGGCATACAGGCAGCAGATTTCCGGCGAGCACGGCCTCGAC-GGCTCCGGTGTGTAAGTAGCTGTTCCTGGAAACTTTGCTTTTTGTTTGCAGAGATGGCTGACTTGGACTAGCTACAATGGTACCTCGGATCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGTA-------------------CGT-------AGCAC-TC----------AAA-GACGCCC----GAT---------GGCAAAAGCACGTCTCTGACAAGGC-TC--AGGCCACCGGTAACAAG-TTTGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCTGGAACCATGGACGCTGTCCGCGCTGGAC????GGGGTCTTGTCTGTCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTCTTGTCAAGAACTTATCACTCATGTGCTACGTCAGTGTAGGCAGCGAAAGCGCACCCATTATAGACTACATGACGGGACGTAACATGGAGCTCCTCGAGGAATACGACCCGATGATGAACCCGAGTGCTACTAAGGTTTTCGTCAATGGTGTCTGGGTAGGAACGCACAACAACCCGCAACAGCTGGTTTCAAACGTACAAGAACTTCGCCGCAACGGAACGCTGTCTTATGAAATGAGTTTGATTCGAGATATTCGGGATCGCGAATTTAAAATCTTCACGGATGCAGGTCGCGTCATGCGACCGCTCTTTACTATCGAGAACGATACCAAGAAGCCGAACAAGGACCACTTGATCTTTAACCGGACCCATCTTGATAAGCTTCTACGCGACAAAGAG----ATAGATACATCTGGCTACAA--TGATGAAGACACGGACAATATGAAATATGGTTGGAAAGGTCTCCTTCACGATGGTTGCGTAGAATACCTCGATGCCGAGGAAGAAGAGAGTGCCATGATTGTCATGTCACCCGAGGATTTGACTGAA 'Paracucurbitaria corni CBS_248.79T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-CCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-GTTGTTTCC--TCGGTAGGC-TTGCCTG--CCGGTTGGAC-AGTAAAAA--AA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGACTCGAC-GGATCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTCA--------TCT-------ATCTC-TC-TCCTT----GTCAGACG-------AAG---------GGTAAATA-------CTGACTAATG-GC--AGGCTTCCGGTAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACGATGGACGCTGTCCGCGCTGGTC????----------TTGCCCTGCTGAA-CTCCCGAAGGACAGGCCTGTGGACTGGTTGAGAATTTATCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCGGCGCCCATCATCGATTTCATGACGCAACGAAACATGCAATTGCTTGAGGAATATGACCAGAACCGGAATCCGGATGCTACTAAAGTCTTCGTCAACGGCGTCTGGGTTGGTGGGCATTCCAACGCTCACCAGCTCGTCTCGGTCGTACAAGAGCTTCGGAGAAACGGAACTCTTTCTTACGAGATGAGTTTGATCCGTGACATTCGCGACCGAGAGTTCAAGATTTTCACGGACGCTGGCCGCGTCATGAGGCCCTTGTTCGTTGTGGAAAACGATATTCGAAAGCCAAACCGCAACCAACTCATCTTTACGAAGGCCATCAGTCAAAAACTCCTCATGGAGCAACAGAGTCACGAGCAACGTAACGGGTGGAGCGAACAGGAAATTGAAGCCGCCACCTACGGCTGGAAAGGACTGATCCAGGATGGTGTCATTGAATATCTGGATGCTGAGGAAGAAGAAACTGCAATGATCACCATGTCTCCTGAAGACCTGGATGAG 'Paracucurbitaria italica CBS_234.92T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-CCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-GTTGTTTCC--TCGGCAGGC-TTGCCTG--CCGGTTGGAC-AGTAAAAA--AA--CC-TTTTGTAA--TTGCAATCAGCG--------TCAG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGACTCGAC-GGATCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGA--------TCT-------ATCTC-AC-TCCTT----ATCAGACG-------AAG---------GGTAAATA-------CTGACTACTG-GC--AGGCTTCCGGTAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACGATGGACGCTGTCCGCGCTGGTC????GGGGGCTTGTTTGCCCTGCTGAAACTCCCGAAGGACAGGCCTGTGGACTGGTTAAGAATCTATCGTTGATGTGCTACGTTAGTGTCGGAAGCGACGCGTCGCCCATCATCGATTTCATGACGCAGCGAAACATGCAACTGCTTGAGGAATATGACCAGAACCAGAATCCGGATGCTACTAAAGTTTTCGTCAACGGCGTCTGGGTTGGTGTGCATTCCAACGCTCACCAACTCGTCTCGGTCGTACAAGAGCTTCGGAGAAACGGAACTCTTTCTTACGAGATGAGTTTGATCCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACCGACGCCGGCCGCGTCATGAGACCCTTGTTCGTCGTGGAAAACGATATTCGAAAGCCAAACCGCAACCAACTCATCTTTACGAAGGCCATCAGTCAAAAACTCCTCATGGAGCAACAGAGCCACGAGCAACGTAACGGGTGGAGCGAACAGGAAATTGAAGCCGCTACCTACGGCTGGAAAGGACTGATCCAAGATGGTGTCATTGAATATCTGGATGCTGAGGAAGAAGAAACTGCAATGATCACCATGTCTCCTGAAGACCTGGATGAG 'Paraepicoccum amazonense MFLUCC_15_0491' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTATCAA-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TAATGCAGCC-AGCTTGAACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TTGGTGGGC-TTGCCCG--CCAATAGGAC---AATCTTATAA--CC-CTTTGTAA--TAGCAGTCAGCG--------TCAG---AA-TTATAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTCTGCCCTGCCGAAACCCCTGAAGGACAAGCTTGTGGATTGGTCAAGAACTTGTCGTTAATGTGCTATGTCAGTGTCGGCAGCGACGCAACGCCCATTGTCGATTTCATGACCCAGCGAAATATGCAACTTCTAGAGGAATACGACCAGACCCAGAATCCGGAAGCTACTAAAGTCTTCGTTAATGGTGTCTGGGTTGGTGTACACTCGAATGCCCAACAGCTCGTTTCGGTTGTACAGGAGCTCCGGAGAAACGGAACCTTGTCCTATGAGATGAGTTTGATCCGTGACGTTCGTGACCGAGAGTTCAAGATCTTCACGGATGCCGGCCGTGTTATGAGGCCCTTGTTCGTCGTCGAGAACGATATCCGGAAGCCAAACCGCAACCAGCTTATCTTTACAAAGGATATCAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paraepicoccum amazonense MFLUCC_15_0493' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTATCAA-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TAATGCAGCC-AGCTTGAACTGAGG-TCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTCGTTTCC--TTGGTGGGC-TTGCCCG--CCAATAGGAC---AATCTTATAA--CC-CTTTGTAA--TAGCAGTCAGCG--------TCAG---AA-TTATAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTCTGCCCTGCCGAAACCCCTGAAGGACAAGCTTGTGGATTGGTCAAGAACTTGTCGTTAATGTGCTATGTCAGTGTCGGCAGCGACGCAACGCCCATTGTCGATTTCATGACCCAGCGAAATATGCAACTTCTAGAGGAATACGACCAGACCCAGAATCCGGAAGCTACTAAAGTCTTCGTTAATGGTGTCTGGGTTGGTGTACACTCGAATGCCCAACAGCTCGTTTCGGTTGTACAGGAGCTCCGGAGAAACGGAACCTTGTCCTATGAGATGAGTTTGATCCGTGACGTTCGTGACCGAGAGTTCAAGATCTTCACGGATGCCGGCCGTGTTATGAGGCCCTTGTTCGTCGTCGAGAACGATATCCGGAAGCCAAACCGCAACCAGCTTATCTTTACAAAGGATATCAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paraleptosphaeria dryadis CBS_643.86' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--ACTTTT-GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTA-TTTGTTTCC--TTGGTGGGC-TTGCCTG--CCGATAGGAC----ATTATTAAA--CC-TTTTGTAA--TTGCAGTCAGCG--------TCAG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGCCTTGTTTGTCCCGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGCTACGTCAGTGTCGGCAGCGACGCCACACCCATTGTTGACTTCATGACGCAGCGCAATATGCAGCTGCTTGAAGAATACGATCAGAACCAGAACCCTGATGCTACAAAGGTCTTCGTTAACGGCGTCTGGGTCGGCGTCCATTCCAACGCTCAACAGCTTGTCTCGGTTGTGCAAGAGCTTCGGAGGAACGGAACCTTGTCGTATGAGATGAGTTTGATCCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCATTGTTCGTGGTTGAAAATGATATTCGCAAGCCAAATCGCAAT?AGCTCATCTTCACCAAAGAGATCAGTAAGAAACTTTTGTACGAGCAACAGAGCCAGGATCAACGGCAAGGCTGGAGCGAAGAGGAGATTGCAGCTGCGACGTACGGTTGGAAGGGCCTTATCCAGGACGGTGTGATTGAGTATCTTGATGCTGAGGAAGAAGAGACAGCGATGATAACCTTCTCTCCTGAGGACCTCGACGAA 'Parapyrenochaeta acaciae CBS_141291T' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGACTCTGTCAC-GTACCTCCTCTCGGGGA-GGCCTTATAGGG-GAGTCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-TTCGTTTCC--TTGGTGGGC-TTGCCTG--CCAATAGGACAACCAATTA--AA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTGAAAAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAATCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGACTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGGATCTGCTCAAA-------GAAAA----GTTTT--------GACG-------AAA---------AGTAAGTG-------CTGACCAATG-GT--AGGCATCCGGCAACAAG-TTCGTTCCCCGCGCCGTTCTCGTCGATCTCGAGCCTGGTACAATGGATGCTGTCCGCGCTGGAC????GGGGTCTCGTTTGCCCAGCCGAAACCCCCGAAGGTCAGGCATGTGGTTTGGTCAAGAACTTATCCTTGATGTGCTATGTTAGCGTTGGCAGTGACGCTACGCCCATCATTGATTTCATGACACAGCGTAACATGCAGGTTCTAGAGGAGTACGATCAGAACCAGAATCCGGAGGCTACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGCGTACATTCCAACGCGCAACAACTCGTCTCAGTCGTACAAGAACTTCGAAGAAACGGAACTTTGTCCTATGAGATGAGTTTGATCCGTGATATTCGAGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGTTGTTCGTAATCGAAAACGACATTCGTAAGCCCAACCGCAACCAGCTCATCTTCACAAAGGATATCAGTAAGAAATTGCTGTTTGAGCAACAGAGCCAGGACCAACGTCAGGGCTGGAGTGAAGACGAAATAGCCGCTGCCACCTATGGCTGGAAAGGACTCATCCAGGATGGTGTGATCGAATATCTTGATGCCGAGGAAGAGGAGACCGCCATGATTACCTTTTCGCCTGAGGACTTGGATGAG 'Parapyrenochaeta protearum CBS_131315T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGACTCTGTCAC-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGTCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-TTCGTTTCC--TTGGTGGGC-TTGCCTG--CCAATAGGACAACCAATTA--AA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG-AAAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCACCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAAGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGACTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGGGTCTTCCCAAA-------GAAAA----AGTCT--------GACA-------AAA---------AGCAAGTG-------CTGACCAACG-AC--AGGCATCCGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCTGGTACAATGGATGCTGTCCGCGCTGGAC????GGGGTCTCGTGTGCCCAGCCGAAACTCCTGAAGGTCAAGCGTGTGGTTTGGTGAAGAATTTATCCTTGATGTGCTATGTTAGCGTTGGCAGTGACGCTACACCCATCACTGATTTCATGACGCAGCGTAACATGCAGGTTCTAGAGGAGTACGACCAGAACCAGAATCCGGATGCTACCAAAGTCTTTGTCAACGGCGTTTGGGTCGGCGTACACTCAAATGCGCAGCAACTCGTCTCAGTCGTACAAGAACTTCGAAGAAATGGAACCTTGTCCTATGAGATGAGTTTGATCCGTGATATTCGAGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGTTGTTCGTTATCGAAAACGACATCCGTAAGCCCAACCGCAACCAGCTCATCTTTACAAAGGAGATCAGTAAGAAATTGCTGTTTGAGCAACAGAGCCAGGACCAACGCCAGGGCTGGAGTGAAGAGGAAATAGCCGCCGCCACTTATGGCTGGAAAGGACTGATCCAGGATGGTGTGATCGAATATCTCGATGCTGAGGAAGAGGAAACCGCCATGATAACCTTCTCCCCTGAGGACTTGGATGAA 'Parapyrenochaeta protearum CBS_137997' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGACTCTGTCAC-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGTCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTT-TTCGTTTCC--TTGGTGGGC-TTGCCTG--CCAATAGGACAACCAATTA--AA--CCTTTTTGTAA--TTGCAATCAGCG--------TCTG-AAAA-AACT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGACTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGGATCTTCCCAAA-------GAAAA----AGTCT--------GACA-------AAA---------AGCAAGTG-------CTGACCAACG-AC--AGGCATCCGGCAACAAG-TTCGTTCCCCGCGCCGTCCTCGTCGATCTCGAGCCTGGTACAATGGATGCTGTCCGCGCTGGAC????GGGGTCTCGTGTGCCCAGCCGAAACTCCTGAAGGTCAAGCGTGTGGTTTGGTGAAGAATTTATCCTTGATGTGCTATGTTAGCGTTGGCAGTGACGCTACACCCATCACTGATTTCATGACGCAGCGTAACATGCAGGTTCTAGAGGAGTACGACCAGAACCAGAATCCGGATGCTACCAAAGTCTTTGTCAACGGTGTTTGGGTCGGCGTACACTCAAATGCGCAGCAACTCGTCTCAGTCGTACAAGAACTTCGAAGAAATGGAACCTTGTCCTATGAGATGAGTTTGATCCGTGATATTCGAGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGTTGTTCGTTATCGAAAACGACATCCGTAAGCCCAACCGCAACCAGCTCATCTTTACAAAGGAGATCAGTAAGAAATTGCTGTTTGAGCAACAGAGCCAGGACCAACGCCAGGGCTGGAGTGAAGAGGAAATAGCCGCCGCCACTTATGGCTGGAAAGGACTGATCCAGGATGGTGTGATCGAATATCTCGATGCTGAGGAAGAGGAAACCGCCATGATAACCTTCTCCCCTGAGGACTTGGATGAA 'Phaeomycocentrospora cantuariensis CBS_132014' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGAGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTTGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCAGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTCCACGTACC--AAAGTTTCC--TCGGCGGCT-CTGCCCG--CCGATTGGAC-TCCATTCA--AA--CC--AATGTAG--TTGCAGTCAGCG--------TCTG---AA-AAAT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCTCTCGGTATTCCGGGAGGTATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Phaeomycocentrospora cantuariensis CPC_10157' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGAGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTTGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCAGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTCCACGTACC--AAAGTTTCC--TCGGCGGCT-CTGCCCG--CCGATTGGAC-TCCATTCA--AA--CC--AATGTAG--TTGCAGTCAGCG--------TCTG---AA-AAAT-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCTCTCGGTATTCCGGGAGGTATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Phaeosphaeria oryzae CBS_110110' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGG--ACTTTT-GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????-GTTTTTTTGCGTACCT-ATCGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC---AACTTTATAA--CCTTTTTAAAT--CTTCAATCAGCG--------TCTG---AACAATATACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTC-----AGTAGTCAGCAATTAAT----------------TCTCG----TGATGGCG-------TAC---------TGACAACA------------------GC--AGGCCTCAGGCAACAA------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Phoma herbarum CBS_377.92' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAATCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum CBS_502.91' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAATGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAATCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum CBS_615.75' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum FMR_UTHSC_DI16_204' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTC-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum UTHSC_DI16_212' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAATGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAATCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum UTHSC_DI16_306' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum UTHSC_DI16_307' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CGAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTATGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAATCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phoma herbarum UTHSC_DI16_319' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCAGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-AC-TCTAC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCCGAAGGGCAGGCTTGTGGGCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGCAGCGACGCTGGGCCGATCTCCGATTTCATGAGCCAAAGAAACATGCAGCTTCTCGAGGAGTACGATCAGAACCAGAACCCTGACGCTACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCGCAGCAACTTGTGTCGACGGTGCAAGAATTGCGACGAAACGGAACATTGTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAAATCTTCACAGACGCTGGACGCGTCATGAGGCCCTTGTTCGTCGTTGAGAGCGATGTCCGCAAGCCCAATCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTAGTTGCTGAGCAGCAG-GCGCAGGCTGCTGCAGGTGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAAGGTCTGATTCAAGACGGTGTTATCGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGATTGTTATGTCACCCGAGGATCTCGGCGAG 'Phomatodes aubrietiae CBS_627.97T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CCATA--------ACT-------ATCAC-GC-TCGAC----TAT-GACG-------GAC---------TGCGAGTG-------CTGACCTATG-GC--AGGCTTCCGGCAACAAG-TTCGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGCTTGGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCCTGTGGTTTGGTCAAGAACCTATCTTTGATGTGCTACGTCAGTGTTGGTAGCGACGCCGGGCCGATCTCCGATTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAATCCTGATGCTACCAAGGTTTTTGTCAACGGTGTATGGGTCGGTGTTCACTCCAACGCGCAGCAGCTTGTATCTACCGTGCAAGAACTGCGACGGAACGGAACCTTGTCTTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCCGGACGTGTCATGAGACCTTTGTTCGTCGTTGAGAGCAACGTTCGCAAACCCAATCGTAACCACCTTATCTTCAGCCAGGAACACTACAACAAGCTCGTCGCAGAGCAGCAG-GCGCAAGCTGCGGCCGGCGTTGG--CGAAGAAGAGAAGACCGAGCTCACCTACGGCTGGAAGGGACTTATTCAAGACGGTGTCATCGAGTATCTTGATGCGGAAGAAGAGGAGACTGCCATGATTGTCATGTCACCCGAGGACCTCGGCGAG 'Phomatodes nebulosa CBS_100191' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CTAGA--------ACT-------GACAC-GC-TCGAC----TAT-GACG-------GAC---------TGCGAGTG-------CTGACCTATG-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTAGTTTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTATCTTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCGATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAATCCTGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAATGCGCAGCAACTTGTGTCCACCGTGCAAGAACTGCGACGGAACGGAACCTTGTCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCCGGACGTGTCATGAGACCTTTGTTCGTCGTTGAGAGCAACGTTCGCAAGCCCAACCGCAACCACCTTATCTTCAGCCAGGAACACTACAACAAGCTCGTCGCAGAGCAGCAG-GCACAAGCTGCGGCCGGCGTTGG--CGAAGAAGAGAAGACCGAGCTTACCTACGGCTGGAAGGGACTCATTCAAGACGGTGTCATCGAGTATCTTGACGCAGAAGAAGAGGAAACTGCTATGATTGTCATGTCACCTGAGGATCTCGGCGAG 'Phomatodes nebulosa CBS_740.96' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CTAGA--------ACT-------GACAC-GC-TCGAC----TAT-GACG-------GAC---------TGCGAGTG-------CTGACCTATG-GC--AGGCTTCCGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATCTGGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTAGTTTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTATCTTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCGATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAATCCTGATGCTACCAAAGTTTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAATGCGCAGCAACTTGTGTCCACCGTGCAAGAACTGCGACGGAACGGAACCTTGTCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGACGCCGGACGTGTCATGAGACCTTTGTTCGTCGTTGAGAGCAACGTTCGCAAGCCCAACCGCAACCACCTTATCTTCAGCCAGGAACACTACAACAAGCTCGTCGCAGAGCAGCAG-GCACAAGCTGCGGCCGGCGTTGG--CGAAGAAGAGAAGACCGAGCTTACCTACGGCTGGAAGGGACTCATTCAAGACGGTGTCATCGAGTATCTTGACGCAGAAGAAGAGGAAACTGCTATGATTGTCATGTCACCTGAGGATCTCGGCGAG 'Pleiochaeta ghindensis CBS_552.92' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGAGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGACTTATAGGG-GAGGCG-ACATGCAACC-AGCTCAGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTT-TTTACAGTACCA-AAAGTTTCC--TCGGCGGCT-CTGCCCG--CCGGTTGGAC-TCTATTCA--AA--CC-CTTTGTAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCTCTCGGTATTCCGGGAGGTATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleiochaeta setosa CBS_496.63' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGAGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGACTTATAGGG-GAGGCG-ACATGCAACC-AGCTCAGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGT--TTTTTAGTACCA-AAAGTTTCC--TCGGCGGCT-CTGCCCG--CCGGTCGGAC-TCCATTCA--AA--CC-CTTTGTAG--TTGCAGTCAGCG--------TCTG---AA-AAAC-TTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCTCTCGGTATTCCGGGAGGTATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleospora herbarum CBS_191.86' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATACCACC-AGCCTAGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGCACTT-CTTGTTTCC--TGGGCGGGT-TCGCCCG--CCACCAGGACCAAACCATA--AA--CCTTTTTGTAA--TTGCAATCAGCG--------TCAG-TAAA-CAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTTTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCCTGCGGCCTGGTCAAGAACTTGTCTCTCATGTGCTACGTTAGTGTCGGTAGCGACGCATCGCCCATTATCGACTTTATGACCCAACGAAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGCCGGAACGGCACCCTATCCTACGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATTTTCACAGATGCGGGCCGTGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTCTTCACAAAGGCGATTAGTAACAAACTCAAGGCTGAACAGCAAGAGACCAGCACACGTCAAGGCTGGAGTCAGGAGGAGGTCGAGAATGCCACCTACGGCTGGCGAGGCCTTATCCAAGACGGTGTTGTTGAATACCTCGATGCCGAGGAAGAGGAGACTGCTATGATAACCTTCTCTCCCGAGGACCTGGAAGAA 'Pleospora typhicola CBS_132.69' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTAGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATACAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATTTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAACGGCACCTCGGATCTGCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CGTGA--------TTT-------GGAAT-GT-CATCG----CAC------------GAG---------TCCAAGGA-------CTGATAGCTA-GC--AGGCGTCCAACAACAAG-TTCGTTCCTCGCGCCGTCCTGGTCGATCTCGAGCCCGGTACGATGGATGCCGTCCGCGCTGGAC????GGGGTCTCGTCTGCCCTGCTGAAACGCCCGAAGGACAGGCATGCGGTCTCGTCAAGAACCTGTCCCTAATGTGCTATGTCAGTGTCGGTAGTGATGCGTCACCCATTATTGATTTCATGTCGCAGCGAAACATGCAGCTTCTCGAGGAGTATGATCAAAATCAAAATCCAGATGCTACTAAAGTATTCGTTAACGGTGTCTGGGTTGGCGTACATTCGAATGCTCAACAACTCGTCACAGTTGTACAGGAGCTACGACGAAACGGCACTCTGTCCTACGAGATGAGCTTAATTCGAGACATTCGCGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGCGGCCGCTATTTGTTGTCGAGAACGATGTTCGAAAGCCAAATAAGAATCATCTTGTCTTTACCAAGGCGATCAGTAACAAACTCAAGGACGAACAACAAGACGGGCCCCTGCGACAGGGCTGGAGTCAGGAAGAAATCGCAGAGGCTACCTACGGTTGGAGAGGCCTGATTCAGGATGGTGTTGTCGAATACCTTGATGCCGAGGAGGAGGAGACGGCTATGATAACCTTCTCCCCTGAAGATTTGGAGGAA 'Preussia terricola AFTOL_ID_282' GGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCAAAGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAACCCGCGCTATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCGG--GCTCTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCTTGGCGGTCGGATAAATGCGTGCTAAAC-GTACCTCTCTTCGGGGA-GGACTTATAGGG-CACGCG-GCATACGACC-AGCCGGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGCCTTTTTGAGTACC--TTCGTTTCC--TCGGCAGGC-TCGCCTG--CCAATGGGGA---CCCCAATAAA--CC-CTTTGTAA--TACCTGTAATCG--------TCTGACAAA-ACAA-ACAAA-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCGTAGGGCATGCCTGTTCG-AGCGTCA-TTCAAACCTTC-AAGCTCTG------------CTTGGTGTT-GGGCG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTGGTTTGCCCTGCCGAAACACCTGAAGGGCAAGCTTGCGGCTTGGTGAAAAATCTCTCATTGATGTGTTATGTCAGCGTTGGTAGCGAGAGCGAACCAATTACAGATTTCATGAGTCAACGAAACATGGAACTTCTGGAAGAATACGACGCAGTCCAGAATCCTACAGCCACGAAAGTTTTCGTCAACGGGGTTTGGGTTGGTGTGCACTCCAATCCCTCGCAGTTGTATAATGTCGTGCAGGAGCTCCGACGTAATGGAACTCTCTCATATGAGATGAGTCTCATTCGCGACATCCGAGACCGAGAACTCAAGATCTTTACAGATGCGGGTCGTGTTATGCGACCGCTGTTCGTTGTCGAAACAAGTTACAATAAGCCAAATCGGGGCAATCTGGTCCTCACTAAGGCACATGTCACCAAGCTTAACCTCGACAAGGAA----ATCGATACCTCGGGCTATAA--TGAGGAGGATACCGATGCTATGAAGTATGGCTGGAAGGGGCTTATCCAAGACGGCGTGGTCGAGTATCTGGATGCCGAAGAAGAGGAATCAGCTATGATTATCATGTCGCCCGAAGACCTCGAGGAA 'Pseudoascochyta novae zelandiae_CBS_141689T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------TTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCCAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTATG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGTGCTGGCC????GGGGTCTCGTCTGCCCTGCCGAGACACCTGAAGGACAGGCCTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGGCCTATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCTACCAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAATGCGCAGCAGCTTGTATCAACCGTGCAGGAGCTGCGACGAAACGGAACGTTGTCTTATGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCTTGTTCGTTGTCGAAAGCGATGTTCGCAAGCCCAACCGTAACCACCTTGTCTTCAGCCAAGAACACTACAACAAGCTGGTCCAAGAGCAACAG-GCTCAAGCTGCGGCCGGTGTTGG--CGAGGAGGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTTATCCAAGACGGTGTTATCGAGTATCTCGACGCTGAGGAAGAAGAGACTGCCATGATTGTCATGTCACCTGAGGACCTCGGCGAG 'Pseudoascochyta pradensis CBS_141688T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-ATTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------TTACAATGGCACCTCAGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-CCCAC----TAC-GACG-------GAC---------TGCGAGTG-------CTGACCTATG-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGTCTCGTCTGCCCTGCCGAGACACCTGAAGGACAGGCCTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGCGATGCTGGGCCTATCTCTGACTTTATGAGCCAGAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTTGTATCGACCGTGCAGGAGCTGCGACGAAACGGAACGTTGTCTTACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCCTTGTTCGTTGTCGAAAGCGATGTTCGCAAGCCCAACCGTAACCACCTTGTCTTCAGCCAAGAACACTACAACAAGCTGGTTCAAGAGCAGCAG-GCTCAAGCTGCGGCCGGTGTTGG--AGAGGAGGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTTATCCAAGACGGTGTCATCGAGTATCTCGACGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCGCCTGAGGACCTCGGCGAG 'Pseudopyrenochaeta lycopersici CBS_306.65T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTAGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTTTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCAC-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCC-ATTGTTTCC--TCGGCGGGT-TTGCCCG--TCGATTGGAC----ACTAC--AA--CC-CTTTGTAA--TTGCAATCAGCG--------TCAG----A-AAACTATAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCATTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGAGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGA---------------------------TTTGCCTCTGTGCTAGG-------AAT---------TGCAAATC-------CTGACCAATG-AC--AGGCTTCCAACAACAAG-TTTGTTCCCCGCGCCGTTCTTGTCGATCTCGAGCCCGGCACCATGGACGCTGTCCGCGCTGGCC????GGGGCCTTGTGTGTCCTGCCGAAACTCCGGAAGGACAGGCCTGTGGTTTAGTCAAGAATCTGTCCCTGATGTGTTACGTTAGCGTTGGAAGTGACGCCTCGCCTATTATTGATTTCATGACACAACGAAACATGCAGCTACTGGAGGAGTACGATCAAAATCAGAATCCGGATGCTACCAAGGTTTTTGTCAACGGCGTTTGGGTCGGCGTGCATTCCAATGCCCATCAGCTCGTCTCAGTTGTGCAAGAACTTCGAAGAAACGGTACTCTCTCCTACGAGATGAGTTTGATCCGTGATATTCGTGACCGAGAATTTAAAATCTTTACGGACGCTGGCCGTGTCATGAGGCCCTTGTTCGTGGTCGAGAATGACATTCGAAAACCGAACCGAAACCAGCTCATCTTCACAAAGACCATCAGCCAGAAACTCCTCATGGAACAGCAAAGTCTTGACCAACGTGATGGCTGGAGTGAAGAAGAAATAGCGGCTGCTACGTATGGTTGGAAAGGTCTCATTCAAGATGGTGTGGTTGAATATTTGGATGCAGAGGAAGAGGAGACTGCCATGATTACCATGTCTCCCGAAGATCTGGACGAG 'Pseudopyrenochaeta terrestris CBS_282.72T' GGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTAGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTTTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCA-ATTGTTTCC--TCGGTAGGC-TTGCCTG--CCGGCCGGAC-ACCATAA---AA--CC-TTTTGTGA--TTGCAGTCAGCG--------TCAG---AA-AACT-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGAGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTG-------------------CGT-------GATTT-GCCTTTGT--------GACATG-----AAT---------TGCATATC-------CTGACCAATG-AC--AGGCCTCCAACAACAAG-TTTGTTCCCCGCGCCGTTCTCGTCGATCTTGAGCCCGGTACGATGGACGCTGTCCGCGCTGGAC????GGGGCCTTGTGTGTCCTGCCGAAACTCCGGAAGGACAGGCCTGTGGATTGGTCAAGAACTTGTCCCTGATGTGTTATGTTAGTGTTGGAAGTGACGCCTCGCCTATTATTGATTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGATCAAAATCAGAATCCGGATGCTACCAAGGTGTTTGTGAACGGCGTTTGGGTTGGTGTGCATTCCAATGCCCACCAGCTCGTCTCGGTTGTGCAAGAGCTCCGGAGAAACGGTACCCTCTCCTACGAGATGAGTTTGATCCGTGATATTCGTGACCGAGAGTTCAAGATCTTTACGGATGCTGGCCGTGTCATGAGACCCTTGTTCGTCGTCGAGAATGACATTCGAAAGCCAAACCGCAACCAACTCATCTTCACCAAAACCATCAGCCAGAAACTCCTCATGGAGCAACAAAGCCTTGACCAACGTGATGGCTGGAGTGAAGAAGAAATAGCGGCTGCTACATACGGTTGGAAAGGCCTCATTCAAGATGGTGTGGTCGAGTACCTGGACGCAGAGGAAGAAGAGACTGCCATGATTACTATGTCGCCCGAAGATCTGGACGAG 'Pyrenochaeta nobilis CBS_407.76T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAT-GTACCTCCTTTCGGGGA-GGCCTTATAGGG-GAGGCG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACTATTTTGTTTCC--TTGGTAGGC-TTGCCTG--CCAAAAGGAC---CACATC--AA--CCCTTTTGTAA--TTGCAATCAGCG--------TCAG--AAA-AACT-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCACGGCCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA-------------------CGT-------GTTTC-GCCTCCTC----CTACAATG---CATAGAG---------TGCGAGGA-------CTGACCAATG-GC--AGGCTTCGGGTAACAAG-TTCGTTCCCCGCGCTGTCCTCGTCGATCTCGAGCCCGGCACAATGGATGCTGTCCGCGCTGGTC????GGGGTCTTGTTTGCCCGGCTGAAACCCCTGAAGGACAGGCCTGCGGATTGGTCAAGAATCTCTCATTGATGTGTTACGTTAGCGTTGGCAGCGACGCCTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTCGAGGAATACGACCAGAATCAAAATCCAGATGCCACCAAAGTCTTCGTCAACGGTGTTTGGGTTGGTGTACATTCCAATGCTCACCAGCTCGTCTCAGTCGTGCAAGAGCTTCGACGAAACGGAACTTTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACGGATGCTGGCCGTGTCATGAGGCCGCTTTTCGTCGTCGAGAATGATATTCGGAAACCGAACCGTAACCAGCTCATTTTTACTAAAGACATCAGCAAAAAGCTGCTCATGGAACAGCAGAGCCACGACCAACGTAACGGTTGGAGCGAGGAGGAAATAGCTGCCGCCACTTACGGCTGGAAAGGACTCATTCAGGATGGTGTCATCGAATATCTTGATGCTGAGGAAGAAGAAACTGCCATGATTACCATGTCTCCTGAAGACTTGGACGAA 'Pyrenochaetopsis americana UTHSC_DI16_225T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG-AAAATAAAC---AAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAT-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG------CGTGT----------T-------GATAA----CCACC----AAAAAATT-------CAG---------CGCGGAAA-------TTGACAATA--GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGATTGGTCTGCCCTGCGGAGACTCCGGAAGGTCAGGCCTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTTTGTCAGTGTAGGCAGCGATGCTTCACCCATCATTGACTATATGACTCAGCGGAACATGCAACTTCTAGAAGAGTACGACCAAGGTCAGAACCCAGAGGCTACCAAAGTCTTTGTCAATGGTGTCTGGGTCGGAGTTCATTTCAACGCTCATCAGCTTGTATCTACGGTGCAGGAGCTGCGCAGAAACGGCACTTTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAGTTCAAGATTTTTACGGATGCTGGCCGTGTTATGCGACCGCTATTCGTCGTCGAGAACGATGTGCGCAAGGCCAATCGCAATCAACTTCGTTTTACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAACGCAGCGGCTGGAGTGATGCCGAGATCGCGTCGGCTACCTATGGATGGACTGGGCTCATTCACGATGGTGTGGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACCTTCTCACCCGAAGACTTGGATGAA 'Pyrenochaetopsis botulispora CBS_142458T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AATA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAGAATATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT-TGTGTTCATA--------AAC-------AACAA-AAATTTT--------------------GGC----------GCGGAAA-------CTGACCGATA-CC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTGTGCCCTGCTGAGACTCCCGAGGGTCAGGCTTGTGGTCTGGTCAAGAATCTTTCTTTGATGTGCTTTGTCAGTGTCGGCAGCGATGCTTCACCCATCATTGACTACATGACTCAGCGAAACATGCAACTTTTGGAAGAGTATGACCAAGGTCAGAACCCAGATGCTACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGAGTGTCTTTCAATGCTCATCAACTTGTATCTACAGTGCAGGACTTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATCCGAGACATCCGAGACCGTGAGTTCAGGATTTTCACGGATGCTGGTCGTGTTATGCGACCGCTATTCGTTGTCGAGAATGATGTGCGCAAGGCGAATCGGAACCACCTTCGATTCACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAAACACTGTTGATGAGCGGAGCGGTTGGAGCGATGCAGAGATCGTATCGGCCACGTATGGATGGACTGGGCTCATCCATGATGGTGTAGTAGAATATCTCGATGCCGAAGAGGAGGAGACGGCCATGATAACCTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis botulispora UTHSC_DI16_289' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG----A-AAATAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAGAATATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT-TGTGTTCATA--------AAC-------AACAA-AAATTTT--------------------GGC----------GCGGAAA-------CTGACCGATA-CC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTGTGCCCTGCTGAGACTCCCGAGGGTCAGGCTTGTGGTCTGGTCAAGAATCTTTCTTTGATGTGCTTTGTCAGTGTCGGCAGCGATGCTTCACCCATCATTGACTACATGACTCAGCGAAACATGCAACTTTTGGAAGAGTATGACCAAGGTCAGAACCCAGATGCTACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGAGTGTCTTTCAATGCTCATCAACTTGTATCTACAGTGCAGGACTTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATCCGAGACATCCGAGACCGTGAGTTCAGGATTTTCACGGATGCTGGTCGTGTTATGCGACCGCTATTCGTTGTCGAGAATGATGTGCGCAAGGCGAATCGGAACCACCTTCGATTCACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAAACACTGTTGATGAGCGGAGCGGTTGGAGCGATGCAGAGATCGTATCGGCCACGTATGGATGGACTGGGCTCATCCATGATGGTGTAGTAGAATATCTCGATGCCGAAGAGGAGGAGACGGCCATGATAACCTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis botulispora UTHSC_DI16_297' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AATA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAGAATATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT-TGTGTTCATA--------AAC-------AACAA-AAATTTT--------------------GGC----------GCGGAAA-------CTGACCGATA-CC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTGTGCCCTGCTGAGACTCCCGAGGGTCAGGCTTGTGGTCTGGTCAAGAATCTTTCTTTGATGTGCTTTGTCAGTGTCGGCAGCGATGCTTCACCCATCATTGACTACATGACTCAGCGAAACATGCAACTTTTGGAAGAGTATGACCAAGGTCAGAACCCAGATGCTACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGAGTGTCTTTCAATGCTCATCAACTTGTATCTACAGTGCAGGACTTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATCCGAGACATCCGAGACCGTGAGTTCAGGATTTTCACGGATGCTGGTCGTGTTATGCGACCGCTATTCGTTGTCGAGAATGATGTGCGCAAGGCGAATCGGAACCACCTTCGATTCACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAAACACTGTTGATGAGCGGAGCGGTTGGAGCGATGCAGAGATCGTATCGGCCACGTATGGATGGACTGGGCTCATCCATGATGGTGTAGTAGAATATCTCGATGCCGAAGAGGAGGAGACGGCCATGATAACCTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis confluens CBS_142459T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCGTATCGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC-ACTATTA---AA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAA-AATC-ATAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACAATC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCATGGCCTTGAC-GGCTATGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CGTGT--------CAATGAGCGGGACAA-AA-TTTTT-------------------GAG---------CTTTCATA-------CTAACCCCCA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCATCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGAC????GGGGGTTGGTGTGTCCAGCCGAGACTCCCGAAGGTCAGGCCTGTGGTCTGGTCAAGAATTTGTCTTTGATGTGCTTCGTCAGCGTTGGGAGCGACGCAACCCCTATCATTGACTACATGACGCAGCGTAACATGAATCTTTTGGAGGAGTACGATCAGAACCAGAATCCAGATGCCACTAAAGTTTTCGTCAATGGAGTATGGGTTGGTGTTCACACCAACGCTCACCAGCTCGTAACCACGGTACAAGAGTTGCGCAGGAACGGTACACTTTCTTTCGAGATGAGTCTGATTCGTGATATTCGGGATCGTGAGTTCAAAATCTTCACAGACGCTGGCCGTGTCATGCGTCCATTGTTCGTTGTAGAGAACGATCCCCGGAAGCCGAACAAAAATCAGTTACGATTTACCAAGGACCATGCCAGAAAGTTAATGCAAGAACAGACTTCCGCCGATGAGCGCAGCGGCTGGAGCGATTATGAAATCGACCAGGCCACGTACGGCTGGAAGGGACTTATTCACGACGGTGTTGTTGAGTATCTCGATGCGGAGGAGGAAGAGACAGCTATGATCACGTTTTCACCTGAGGATTTGGATGAG 'Pyrenochaetopsis decipiens CBS_343.85T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGTTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAACAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGCACCGTATTGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTAT--AAACCCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAATAATC-ATAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCTGGCGAGCACGGTCTCGAC-GGCTATGGTGT------------------------------------------------------------CTACAACGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTA------CGTGT-------CAAC-------GATAG-------------CAGCGACA-------AAT---------TTTGAACA-TCCAAATTGACCGATG-AC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCTGGAC????GGGGCCTTGTTTGCCCTGCCGAGACCCCCGAAGGTCAGGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGCTTCGTCAGTGTGGGAAGTGACGCCACACCGATTATCGACTACATGACTCAACGCAGTATGGTTCTCCTGGAGGAGTACGAATCGACGAATCACCCCGACGCTACCAAGATCTTCGTGAACGGAGTGTGGGTCGGGGTCCACCACAACCCTCATCAACTTGTTTCCACGGTGCAGGAACTGCGTAGGAACGGCACTTTGTCTTTCGAAATGAGTTTGATTCGTGATATCCGAGACCGTGAATTCAAGATCTTCACGGATGCCGGTCGTGTCATGCGACCACTTTTCGTCGTCGAGAATGATGTGCGCAAGCCTAATCGGAATCAACTGCGATTTACCAAGGAGCATGCCAAAAAACTGATGCAGGAACAACTCACTGCCGACGAGCGCAGCGGCTGGAGTGATGCTGAGGTGGCGTCGGCCACATATGGCTGGACCGGACTCATCCATGACGGTGTGGTGGAGTATCTTGATGCTGAAGAGGAGGAAACAGCCATGATTACCTTCTCGCCTGAAGATCTGGACGAG 'Pyrenochaetopsis globosa UTHSC_DI16_275T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAA-ACAA-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GGCAC-GC-TTCAC----TAA-GACG-------GAC---------TGCGAGTG-------CTGACCTACG-GC--AGGCCTCTGGCAACAAG-TTTGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGACTGGTTTGCCCTGCTGAGACTCCGGAAGGTCAGGCTTGTGGTTTGGTCAAGAACTTGTCTCTGATGTGCTTCGTCAGTGTGGGCAGCGATGCTTCACCTATCATTGACTACATGACTCAGCGGAACATGCAACTTCTGGAAGAGTACGACCAAGGTCAGAATCCAGAGGCTACTAAAGTCTTTGTCAACGGTGTCTGGGTTGGAGTTCATTTCAATGCTCATCAGCTTGTATCTACGGTGCAGGAGCTGCGCAGAAACGGAACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAGTTCAAGATCTTTACAGATGCTGGCCGTGTTATGCGACCGCTATTCGTCGTCGAGAACGATGTGCGCAAGGCGAATCGCAACCAACTTCGATTTACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAGCGCAGCGGCTGGAGTGATGCCGAGATCGCATCAGCTACCTATGGTTGGACTGGACTCATTCACGATGGTGTAGTAGAATATCTCGATGCTGAAGAAGAGGAGACAGCCATGATCACCTTCTCGCCGGAAGACTTGGACGAA 'Pyrenochaetopsis indica CBS_124454T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGAGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACTCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGTTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCATTCTTCTGCGAACAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGCACCGTATTGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATCATAAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AAACAATAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAAAACATCTCTGGCGAGCACGGTCTCGAC-GGCTATGGTGT------------------------------------------------------------CTACAATGGCACTTCCGACCTCCAGCTCGAACGCATGAACGTCTACTTCAACGAGGTG--CGTACCAAC--------AAA-------AGCACCGT--------------GAAATGTTGGAGCT---------CTCAAG---------CTGATTTACA-AT--AGGCATCCAACAACAAG-TATGTTCCTCGTGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCTGGAC????GGGGCTTAGTATGTCCGGCTGAGACACCTGAAGGGCAGGCCTGTGGTTTGGTCAAGAACCTGTCTTTGATGTGCTTCGTCAGTGTCGGAACCGACGCTACACCTATCATTGACTACATGACTCAGCGTAGTATGACACTCTTGGAAGAGTATGACCATACCAATCACCCAGACGCCACTAAAGTCTTTGTCAACGGAGTCTGGGTGGGAGTTCATCATAACTCTCATCAGCTCGTGTCTACGGTGCAGGAATTGCGTAGAAACGGTACACTGTCATTCGAAATGAGTCTTATTCGTGACATTCGTGACCGCGAGTTCAAAATCTTCACCGACGCTGGTCGTGTGATGCGACCGTTGTTCGTTGTTGAGAACGATGTACGCAAGCCGAATCGAAACCAACTACGGTTCACCAAAGACCACGCCAAGAAGTTGATGCAAGAGCAACTTACTGCCGATGAGCGCGGCGGTTGGAGTGACGCTGAGATTGCACAAGCTACCTATGGATGGAGAGGACTCATTCAGGATGGTGTCGTAGAGTATCTCGACGCGGAGGAGGAGGAAACGGCTATGATCACGTTCTCGCCAGAAGACTTGGACGAA 'Pyrenochaetopsis leptospora CBS_101635T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC---AATATC-AAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AACAAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGCTACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG-----CGTGTA--------GAT-------AACAA-GG--------------GAAA-------AAT-----CCGGCGCGGAAA-------CTGACCCTCA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGGGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACCCCAGAAGGTCAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTGATGTGCTTCGTCAGCGTGGGTAGCGATGCTTCGCCCATCATTGACTACATGACTCAGCGTAACATGCAACTTTTGGAAGAGTATGATCAAGGCCAGAACCCAGAGGCCACTAAAGTTTTCGTCAACGGTGTGTGGGTGGGTGTTCATTTCAATGCTCATCAGCTCGTGTCTACGGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAATTCAAGATCTTTACAGACGCTGGTCGTGTCATGCGGCCGCTATTCGTTGTCGAGAATGACGTTCGCAAGGCCAATCGCAACCAACTACGATTCACCAAGGACCATGCCAGGAAGTTGATGCAAGAGCAAACGACCGCTGACGAGCGCAGCGGCTGGAGTGATGCTGAGATCGCATCAGCCACCTATGGATGGACCGGGCTTATCCACGATGGTGTCGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACGTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis leptospora CBS_122787' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC---AATATC-AAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AACAAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGCTACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG-----CGTGTA--------GAT-------AACAA-GG--------------GAAA-------AAT-----CCGGCGCGGAAA-------CTGACCCTCA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGGGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACCCCAGAAGGTCAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTGATGTGCTTCGTCAGCGTGGGTAGCGATGCTTCGCCCATCATTGACTACATGACTCAGCGTAACATGCAACTTTTGGAAGAGTATGATCAAGGCCAGAACCCAGAGGCCACTAAAGTTTTCGTCAACGGTGTGTGGGTGGGTGTTCATTTCAATGCTCATCAGCTCGTGTCTACGGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAATTCAAGATCTTTACAGACGCTGGTCGTGTCATGCGGCCGCTATTCGTTGTCGAGAATGACGTTCGCAAGGCCAATCGCAACCAACTACGATTCACCAAGGACCATGCCAGGAAGTTGATGCAAGAGCAAACGACCGCTGACGAGCGCAGCGGCTGGAGTGATGCTGAGATCGCATCAGCCACCTATGGATGGACCGGGCTTATCCACGATGGTGTCGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACGTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis microspora CBS_102876T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG-AAAATAAAC---AAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG------CGTGT--------TATC------AACACTGA--------------GAAA-------AAT------CAGCGCGGAAA-------CTGACCCATA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACCCCAGAAGGTCAAGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTTTGTCAGTGTAGGCAGCGATGCGTCACCCATCATTGACTACATGACTCAGCGGAACATGCAACTTTTGGAAGAGTACGACCAAGGTCAGAATCCAGAGGCCACTAAGGTTTTTGTCAACGGTGTCTGGGTCGGAGTTCATTTCAATGCTCATCAGCTTGTATCTACGGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAGTTCAAGATCTTTACGGATGCTGGCCGTGTTATGCGACCGCTTTTCGTTGTCGAGAACGATGTGCGTAAGGCAAATCGCAACCAACTTCGATTTACCAAAGAACATGCCAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAGCGCAGCGGCTGGAGTGATGCCGAGATCGCATCAGCCACCTATGGATGGACTGGGCTCATTCACGATGGTGTCGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACCTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis microspora UTHSC_DI16_198' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAA-ATAA-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG------CGTGT--------TATC------AACACTGA--------------GAAA-------AAT------CAGCGCGGAAA-------CTGACCCATA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACCCCAGAAGGTCAAGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTTTGTCAGTGTAGGCAGCGATGCGTCACCCATCATTGACTACATGACTCAGCGGAACATGCAACTTTTGGAAGAGTACGACCAAGGTCAGAATCCAGAGGCCACTAAGGTTTTTGTCAACGGTGTCTGGGTCGGAGTTCATTTCAATGCTCATCAGCTTGTATCTACGGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAGTTCAAGATCTTTACGGATGCTGGCCGTGTCATGCGACCGCTTTTCGTTGTCGAGAACGATGTGCGTAAGGCAAATCGCAACCAACTTCGATTTACCAAAGAACATGCCAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAGCGCAGCGGCTGGAGTGATGCCGAGATCGCATCAGCCACCTATGGATGGACTGGGCTCATTCACGATGGTGTCGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACCTTCTCGCCTGAAGACTTGGACGAA 'Pyrenochaetopsis paucisetosa CBS_142460T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCACCGTACCTTCTCTCGGGAA-GGCCTTATAGGGGGAGGCGGTCATGCAACCCAGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AATA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATCGGTGCCGCCTTTT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCATGGTCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAACTCGAGCGCATGAACGTCTATTTCAACGAGGTT-------------------TGTGTTGATGAACACCAAAACTTT-------------------GGC----------GCGGAAA-------TTGACCGATA-CT--AGGCATCCAACAACAAG-TATGTCCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTCTGCCCTGCTGAGACTCCCGAGGGTCAGGCTTGTGGTCTGGTCAAGAACCTTTCTTTGATGTGCTTTGTCAGTGTCGGCAACGATGCTTCACCCATCGTTGACTACATGACTCAGCGAAACATGCAACTTTTGGAAGAATATGACCAAAGTCAGAATCCAGATGCTACTAAGGTCTTCGTCAATGGTGTCTGGGTCGGAGTGCATTTCAACGCTCATCAACTTGTGTCTACAGTCCAGGAGTTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATCCGAGACATCCGAGACCGTGAATTCAAGATCTTCACGGATGCTGGTCGTGTTATGCGACCGCTGTTCGTTGTGGAGAATGATGTGCGCAAGGCGAATCGGAACCAACTTCGATTCACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAGACCACTGCTCATGAGCGGAGTGGTTGGAGCGATGCGGAGATCGCATCGGCCACCTATGGATGGACTGGGCTCATTCATGATGGTGTAGTAGAATATCTCGACGCCGAAGAGGAGGAGACGGCCATGATAACCTTCTCGCCTGAAGACCTAGACGAA 'Pyrenochaetopsis poae CBS_136769T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC---AATATC-AAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AACAAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGCTACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG-----CGTGTA--------GAT-------GACAA-----------------GGAAAAAATCCGGC----------GCGGAAA-------CTGACCCTCA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTTTGCCCCGCTGAGACTCCGGAAGGTCAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTGATGTGCTTCGTCAGTGTGGGTAGCGATGCTTCACCCATCATTGACTACATGACTCAGCGTAACATGCAACTTTTGGAAGAGTATGATCAAGGCCAAAATCCAGAGGCCACTAAAGTCTTCGTCAACGGCGTGTGGGTGGGTGTTCATTTCAATGCTCACCAGCTCGTGTCTACGGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAATTCAAGATCTTCACAGACGCTGGTCGTGTGATGCGACCGCTATTCGTTGTCGAGAATGACGTTCGCAAGGCCAATCGCAACCAGCTACGATTCACCAAGGACCATGCAAGGAAGTTGATGCAAGAGCAAACGACTGCTGACGAGCGCAGCGGCTGGAGTGATGCTGAGATTGCATCAGCTACTTACGGATGGACCGGGCTCATCCACGATGGTGTTGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACGTTCTCACCTGAGGACTTGGACGAA 'Pyrenochaetopsis setosissima CBS_119739T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAA-ATAA-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG-----CGTATA-----TCTAAC-------GACAA-GAAAATCC-------------------GTC----------GCAGAAA-------CTGACCCGCA-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACTCCGGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTTTGTCAGTGTGGGCAGCGATGCTTCACCCATCATTGACTACATGACTCAGCGGAACATGCAACTTCTGGAAGAGTACGACCAAGGTCAGAACCCAGAGGCTACTAAAGTCTTTGTCAATGGTGTCTGGGTCGGAGTTCATTTCAATGCTCATCAGCTTGTATCTACGGTGCAGGAGCTGCGCAGAAACGGCACTTTGTCGTTTGAAATGAGTCTCATTCGAGACATTCGAGACCGTGAGTTCAAGATCTTTACAGATGCTGGTCGTGTTATGCGACCGCTATTTGTCGTCGAGAACGATGTGCGCAAGGCGAATCGCAATCAACTTCGATTTACCAAAGAGCATGCTAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAGCGCAGCGGCTGGAGTGATGCCGAGATCGCATCCGCTACCTACGGATGGACTGGGCTCATTCACGATGGTGTAGTAGAATATCTCGATGCTGAAGAGGAGGAGACAGCCATGATCACATTCTCACCAGAAGACTTGGACGAA 'Pyrenochaetopsis tabarestanensis CBS_139506T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCT-G????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AATA-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAGAATATCTCCGGCGAGCACGGCCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT-TGTGTTCATA--------AAC-------AACAA-AAATTTT--------------------GGC----------GCGGAAA-------CTGACCGATA-CC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pyrenochaetopsis uberiformis CBS_142461T' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGCG-TCATGCAACC-AGTCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCG-TATGTTTCC--TCGGCGGGC-TTGCCTG--CCGGTTGGAC----ATTATCAAA--CCTTTTTGTAG--TTGCAATCAGCG--------TCAG--AAA-ACAA-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCATTTTGTACCCTC-AAGCACTG------------CTTGGTGTT-GGGCG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGAACATCTCCGGCGAGCACGGTCTCGAC-GGATACGGTGT------------------------------------------------------------CTACAATGGCACTTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTG------CGTGT----------T-------GATGT----CCACC-------------------GAAAAAAATCGGCGCAGAAA-------CTGACAGATC-GC--AGGCATCCAACAACAAG-TATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGAACCATGGACGCCGTCCGTGCTGGAC????GGGGACTGGTTTGCCCTGCTGAGACTCCGGAAGGTCAGGCTTGTGGTTTGGTCAAGAACCTGTCTCTGATGTGCTTCGTCAGTGTGGGCAGCGATGCTTCACCTATCATTGACTACATGACTCAGCGGAACATGCAACTTCTGGAGGAGTACGACCAAGGTCAGAATCCAGAGGCTACTAAAGTCTTTGTCAACGGTGTCTGGGTTGGAGTTCATTTCAATGCTCATCAGCTTGTATCTACCGTGCAGGAGCTGCGCAGAAACGGCACTCTGTCGTTTGAGATGAGTCTGATTCGAGACATTCGAGACCGTGAGTTCAAGATCTTTACGGATGCTGGCCGTGTTATGCGACCGCTATTTGTCGTCGAGAACGATGTGCGCAAGGCGAATCGCAACCAACTTCGATTTACCAAGGAACATGCCAGGAAGTTGATGCAAGAGCAAACCACTGCTGATGAGCGCAGCGGCTGGAGTGATGCCGAGATCGCATCAGCTACCTATGGTTGGACTGGGCTCATTCACGATGGTGTAGTAGAATATCTCGATGCTGAAGAAGAGGAGACAGCCATGATCACCTTCTCGCCGGAAGACTTGGACGAA 'Remotididymella anthropophylica CBS_142462T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACCT-TACGTTTCC--TCGGTGGGT-TCGCCCG--CCGGCTGGAC-AAAACTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-AC--AGGCTTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGCGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGACGCTGGGCCAATCTCTGAATATATGAGTCAGAGGAACATGCAGTTACTTGAAGAGTACGATCAAAACCAGAACCCTGATGCCACCAAGGTCTTCGTTAACGGTGTCTGGGTGGGTGTGCACTCCAATGCGCAGCAGCTCGTTTCGACTGTACAGGAGTTGCGCCGTAACGGAACTCTCTCGTACGAAATGAGTTTGATCCGAGACATTCGAGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCTCTTTTCGTTGTTGAGAGCGATGCCTGGAAGCCGAACCGCAACCACCTCATCTTCAACCAGGCGCACTACAACAAGCTGGTCACAGAGCAACAG-GCAATGGCTTCCGCTGGCGTTGG--CGAAGAAGAGAAGACCGAACTCACGTATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATTGTCATGTCACCTGAAGATCTTGGCGAA 'Remotididymella destructiva CBS_133.93' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG-ACAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC-GC-TTTCT----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCGTTC-AC--AGGCTTCCGGCAACAAG-TTTGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTTCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAATTTGTCTCTTATGTGCTATGTCAGTGTCGGAAGTGACGCTGGGCCTATCTCTGAATACATGAGCCAAAGGAACATGCAGCTGCTTGAGGAGTATGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAATGCGCAGCAGCTCGTCTCGACGGTCCAAACATTGCGTCGCAATGGAACTCTGTCTTACGAAATGAGTTTGATTCGAGATATCCGCGATCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTTGTTGAGAGCGATGCCTGGAAGCCGAATCGCAACCACCTCATCTTTAACCAGGTGCACTACAACAAGCTGGTAACGGAGCAACAG-GCAATGGCTGCTGCAGGCGTAGG--CGAAGAGGAGAAGACTGAGCTCGCGTATGGCTGGAAGGGCCTTATCCAGGACGGTGTCATCGAGTACCTCGATGCTGAAGAGGAGGAGACTGCCATGATTGTCATGTCTCCTGAAGACCTTGGCGAG 'Remotididymella destructiva CBS_162.78' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG-ACAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC-GC-TTTCT----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCGTTC-AC--AGGCTTCCGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTTCGCGCTGGTC????GGGGCCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAATTTGTCTCTTATGTGCTATGTCAGTGTCGGAAGTGACGCTGGGCCTATCTCTGAATACATGAGCCAAAGGAACATGCAGCTGCTTGAGGAGTATGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAATGCGCAGCAGCTCGTCTCGACGGTGCAAACATTGCGTCGCAATGGAACTCTGTCTTACGAAATGAGTTTGATTCGAGATATTCGCGATCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTTGTTGAGAGCGATGCCTGGAAGCCGAATCGCAACCACCTCATCTTTAACCAGGTGCACTACAACAAGCTGGTAACGGAGCAACAG-GCAATGGCTGCTGCAGGCGTAGG--CGAAGAGGAGAAGACTGAGCTCGCGTATGGCTGGAAGGGTCTTATCCAGGACGGTGTCATCGAGTACCTCGATGCTGAAGAGGAGGAGACTGCCATGATTGTCATGTCTCCTGAAGACCTTGGCGAG 'Remotididymella destructiva CBS_378.73T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTCTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCTG-ACAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACCC-GC-TTTCT----TTC-GACG-------GAC---------TGCGAGTG-------CTGACCGTTC-AC--AGGCTTCCGGCAACAAG-TTTGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCTGTTCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAATTTGTCTCTTATGTGCTATGTCAGTGTCGGAAGTGACGCTGGGCCTATCTCTGAATACATGAGCCAAAGGAACATGCAGCTGCTTGAGGAGTATGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTGGGTGTGCACTCCAATGCGCAGCAGCTCGTCTCGACGGTCCAAACATTGCGTCGCAATGGAACTCTGTCTTACGAAATGAGTTTGATTCGAGATATCCGCGATCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGGCCCCTGTTCGTTGTTGAGAGCGATGCCTGGAAGCCGAATCGCAACCACCTCATCTTTAACCAGGTGCACTACAACAAGCTGGTAACGGAGCAACAG-GCAATGGCTGCTGCAGGCGTAGG--CGAAGAGGAGAAGACTGAGCTCGCGTATGGCTGGAAGGGCCTTATCCAGGACGGTGTCATCGAGTACCTCGATGCTGAAGAGGAGGAGACTGCCATGATTGTCATGTCTCCTGAAGACCTTGGCGAG 'Shiraia bambusicola NBRC_30753' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGG--ACTTTT-GTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCG-CTTG????TGTC-TTTTGCGTACTA-AATGTTTCC--TCGGCAGGC-CTGCCTG--CCGGTTGGAC--ACGCTTA--TA--CT-CTTTGTAA--TTGCAATCAGCG--------TCTG--AACCAACT-ATAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGAAAACTC-AAGCTTTG------------CTTGGTATT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCACGGTCTCGAC-GGTGCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA-------------------------------CGT-GT-TTTCCTGCCTTTTGGC--------AAC---ATGCTTTTTGAAAATCACGCACTGATCCATTGGC--AGGCATCAGGCAACAAG-TTTGTGCCCCGCGCTGTTCTTGTTGATCTTGAGCCCGGCACCATGGACGCTGTCCGCGCTGGGC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30754' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGG--ACTTTT-GTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTGG????TGTC-TTTTGCGTACTA-AATGTTTCC--TCGGCAGGC-CTGCCTG--CCGGTTGGAC--ACGCTTA--TA--CT-CTTTGTAA--TTGCAATCAGCG--------TCTG--AACCAACT-ATAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGAAAACTC-AAGCTTTG------------CTTGGTATT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCACGGTCTCGAC-GGTGCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA-------------------------------CGT-GT-TTTCCTGCCTTTTGGC--------AAC---ATGCTTTTTGAAAATCACGCACTGATCCATTGGC--AGGCATCAGGCAACAAGCTTTGTGCCCCGCGCTGTTCTTGTTGATCTTGAGCCCGGCACCATGGACGCTGTCCGCGCTGGGC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30771' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGG--ACTTTT-GTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCG-CTGG????TGTC-TTTTGCGTCACTAAATGTTTCC--TCGGCAGGC-CTGCCTG--CCGGTTGGAC--ACGCTTA--TA--CT-CTTTGTAA--TTGCAATCAGCG--------TCTG---AACCAACTATAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGAAAACTC-AAGCTTTG------------CTTGGTATT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCACGGTCTCGAC-GGTGCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA-------------------------------CGT-GT-TTTCCTGCCTTTTGGC--------AAC---ATGCTTTTTGAAAATCACGCACTGATCCATTGGC--AGGCATCAGGCAACAAG-TTTGTGCCCCGCGCTGTTCTTGTTGATCTTGAGCCCGGCACCATGGACGCTGTCCGCGCTGGGC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30772' GAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGG--ACTTTT-GTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCAC-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTGG????TGTC-TTTTGCGTACTA-AATGTTTCC--TCGGCAGGC-CTGCCTG--CCGGTTGGAC--ACGCTTA--TA--CT-CTTTGTAA--TTGCAATCAGCG--------TCTG--AACCAACT-ATAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGAAAACTC-AAGCTTTG------------CTTGGTATT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCAGGCGAGCACGGTCTCGACTGGTGCTGGTGT------------------------------------------------------------CTACAATGGCACCTCTGACCTTCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA-------------------------------CGT-GT-TTTCCTGCCTTTTGGC--------AAC---ATGCTTTTTGAAAATCACGCACTGATCCATTGGC--AGGCATCAGGCAACAAG-TTTGTGCCCCGCGCTGTTCTTGTTGATCTTGAGCCCGGCACCATGGACGCTGTCCGCGCTGGGC????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Similiphoma crystallifera CBS_193.82T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCCTTCT-------------------------------------------------------------GGCAGAACATCTCTGGCGAGCATGGCCTTGAT-GGCTCCGGCGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-GC-TTTCT----TG--GACG-------GAC---------TGCGAGTG-------CTGACCTTTT-GT--AGGCCTCTGGCAACAAG-TTCGTCCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGATGCCGTCCGCGCTGGCC????GGGGTCTTGTGTGCCCTGCCGAGACACCTGAAGGGCAGGCCTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCCATTTCTGACTTCATGAGCCAGAGGAATATGCAACTTCTCGAAGAGTATGATCAGAACCAGAACCCTGACGCCACCAAAGTATTTGTCAACGGTGTGTGGGTAGGCGTGCACTCCAACGCGCAGCAGCTTGTCTCGACTGTGCAGGAACTACGTCGTAACGGAACTCTCTCTTATGAGATGAGTTTGATTCGAGATATCCGTGACCGTGAGTTCAAGATTTTTACGGATGCAGGACGTGTTATGAGACCTCTCTTCGTTGTGGAGAGCGATGTTCGTAAGCCGAACCGCAACCACCTCGTCTTCAACCAGGAGCATTATAACAAGCTGGTCGCTGAGCAGCAG-GCGATGGCTGCTGCAGGCGTCGG--CGAAGAAGAGAAGACCGAGCTCACATACGGCTGGAAGGGGCTCATTCAAGATGGTGTCATCGAGTACCTTGATGCTGAAGAGGAGGAGACTGCCATGATTGTCATGTCACCCGAAGACCTAGGCGAG 'Sporormiella minima CBS_524.50' GGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGT?GGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCAGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCCCAGCGGTTGGATAAATGTCTGTTGAAC-GTACCTCTCTTCGGGGA-GGACTTATAGCTTCAGGCG-GCATACAACC-AGCCGGGATTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGCCTTTTTGAGTACCTTTTCGTTTCC--TCGGCAGGC-TCGCCTG--CCAACGGGGA--CCCTTCA--AA--ACGCTTTGTAG--TACCTGTAACTG--------TCTGATACA-ACAA-GCAAA-AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCG-AGCGTCA-TTTAAACCTTC-AAGCTCAG------------CTTGGTGAT-GGGTG????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????GGGGTCTTGTGTGTCCCGCCGAAACAC?TGAAGGTCAGGCATGTGGTCTGGTGAAGAATCTCTCTTTGATGTG?TACGTCAGCGTTGGAACGGAGAGCGGCCCCATCACCGAATACATGCTTACGCGTGGCATGGACATACTGGAAGAATACGACCCGGTCCAGACGCCGACAGCCACCAAAGTCTTCGTCAATGGCGTCTGGGTCGGTGTCCACTCGAACCCAA?TCAGCTGTTTGGAGATGTCCAGAGACTTCGCCGCAGTGGAACACTCTCGTACGAGATGAGTTTGATCCGGGACATTCGTGATCGAGAGTTCAAGATCTTCACTGATGCGGGTCGAGTCATGCGGCCGTTGTTCGTTGTAGATACCGACTACAACAGTCCCAACCGTGGAAATCTGGTCCTTACCAAGGAGCACATTGCGAGGCTCCTGGAAGACAAAGAA----AAAGACACATCCGGGCTCAA--CGATGAGGATACCGATAAACAGAAGTATGGATGGAAGGGTCTCATCCATGACGGTATCGTGGAATATCTGGACGCTGAGGAAGAGGAAAGTGCTATGATCATCATGACTCCTGAGGACCTGAGCGAG 'Stagonosporopsis dorenboschii CBS_426.90T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCCTTTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC-AAAACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCACGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCT----CCA-GACG-------GAC---------TGCGAGTG-------CTGACCCTTC-A---AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGTC????GGGGTCTTGTCTGTCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTTATGTGCTACGTTAGTGTCGGCAGTGATGCTGGGCCTATCGCTGAGTACATGAGCCAGAGGAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCTGATGCTACCAAGATTTTTGTCAACGGTGTTTGGGTGGGTGTACACAACAACGCCCAGCAGCTCGTTGCAACTGTGCAGGAACTGCGTCGTAACGGCACCCTGTCATACGAGATGAGCTTGATTCGAGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCACTATTCGTTGTGCAGAACGATGTCACCAAGCCGGATCGAAACCACCTCGTGTTCAGCCAGCAGCATTACAACAAGCTGGTTGCAGAGCAGCAG-GCAATGGCAACAGCAGGTTATGG--CGAAGAGGAGAAGACTGGTCTTACATATGGCTGGAAGGGTCTCATTCAAGACGGTGTCATCGAATATCTGGACGCTGAAGAGGAGGAAACCGCCATGATAGTCATGTCACCCGAAGATCTTGGCGAG 'Stagonosporopsis hortensis CBS_572.85' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGACAT-GTACCTCCTTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGTAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACC--TTCGTTTCC--TCGGTGGGT-TCGCCCG--CCGATTGGAC-AACACTTA--AA--CC-CTTTGTAA--TTGAAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TTC-GAAT-------GAC---------TGCGAGTG-------CTGACCTCTG-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGCACAATGGACGCTGTCCGCGCTGGTC????GGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTCGGCAGCGATGCTACGCCTATCGCCGATTTCATGGGCAAGAGAAACATGCAGCTTCTTGAGGAGTACGATCAGAACCAAAATCCCGATGCCACCAAGGTGTTTGTCAACGGTGTTTGGGTGGGTGTACACAACAACGCGCAGCAGCTCGTTTCGACCGTGCAGGAACTTCGTCGTAACGGAACCCTGTCATACGAGATGAGTTTGATTCGAGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGGCCACTCTTCGTCGTGCAAAACGACGTTACTAAGGACGATCGAAACCACCTTGTATTCAATCAGGACCATTACAATAAGCTGGTTCAAGAGCAGCAG-ACAATGGCTACAGCAGGTGTTGG--CGAAGAAGAGAAGACTGCGCTCACATACGGCTGGAAGGGTCTCATTCAAGATGGTGTTATCGAGTATCTCGACGCCGAAGAAGAGGAGACCGCCATGATTGTCATGTCACCCGAGGATCTTGGAGAA 'Vaciviphoma bulgarica CBS_357.84T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAAATTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTATG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTTCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTTCC----TAC-GACG-------AAC---------TGCGAGTG-------CTGACCAAAT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGACGCTGTTCGCGCTGGCC????GGGGTCTTGTCTGCCCTGCTGAGACGCCTGAAGGACAAGCTTGCGGTCTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGCAGCGATGCCGGGCCTATTTCCGATTTCATGAGCCAAAGGAACATGCAGCTTCTTGAGGAATACGACCAAAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAATGGTGTATGGGTTGGTGTCCACTCCAACGCACAGCAGCTTGTGTCAACCGTGCAGGAACTGCGCCGAAACGGAACTCTTTCTTACGAGATGAGTTTGATTCGAGATATCCGTGACCGGGAGTTCAAGATCTTCACAGACGCTGGACGTGTCATGAGGCCACTCTTCGTTGTGGAGAGCGATGTTCGCAAGCCGAACCGCAACCACCTCGTTTTCAGCCAGGAACACTACAATAAGCTTGTCGCAGAGCAGCAA-GCCCAGGCTGCTGCGGGTGTTGG--AGAAGAAGAGAAAACTGAACTCACATACGGCTGGAAGGGGCTCATCCAGGACGGTGTCATCGAATACCTCGACGCAGAAGAAGAGGAGACTGCTATGATTGTCATGTCGCCCGAGGATCTCGGTGAG 'Vaciviphoma oculo hominis_UTHSC_DI16_308' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--AAAATTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCTGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TTCAC----AAT-GACG-------GAC---------TGCGAGTG-------CTGACCATAT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTTGATTTGGAGCCTGGTACAATGGACGCTGTCCGTGCTGGCC????GGGGTCTTGTCTGCCCTGCCGAGACGCCAGAAGGACAAGCTTGCGGTCTTGTGAAGAATTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGACCTATTTCCGATTTCATGAGCCAAAGGAACATGCAGCTTCTAGAGGAATACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTGAACGGTGTGTGGGTGGGCGTTCACTCCAACGCACAGCAACTCGTATCGACCGTGCAGGAACTTCGCCGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGGCGTGTCATGAGGCCGCTCTTCGTCGTGGAGAGCGATGTCCGTAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTTGTCGCAGAGCAACAG-GCGCAAGCTGCTGCGGGTGTTGG--TGAAGAAGAGAAGACTGAACTCACATACGGCTGGAAGGGACTCATCCAGGACGGTGTCATCGAGTACCTTGACGCAGAAGAAGAGGAGACTGCTATGATTGTCATGTCGCCCGAGGATCTCGGCGAG 'Xenodidymella applanata CBS_115577' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC----AATAACAAA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGTCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------TTAGA--------ACT-------GACAC-GC-TCAAC----ATC-AACG-------GAC---------TGCGAGTG-------CTGACTGTCT-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGGCTTGTCTGCCCTGCTGAGACCCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAATCTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGACCTATTAGCGACTTCATGAGCCAGAGAAACATGCAGCTCCTCGAGGAGTATGACCAGAATCAGAACCCTGATGCTACCAAGGTCTTTGTAAACGGTGTGTGGGTTGGTGTACATTCCAACGCACAGCAACTCGTCTCGACCGTACAAGAGTTGCGACGAAATGGAACCTTGTCCTACGAGATGAGTTTGATTCGAGACATTCGTGATCGAGAATTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCTCTTTTCGTTGTCGAAAGCGATGTCCGAAAGCCTAATCGCAACCACCTCGTCTTCAGTCAGGAACATTATAACAAGCTTGTCGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--CGAAGAAGAGAAGACCGAGCTCACGTATGGCTGGAAGGGTCTCATCCAGGACGGTGTTATCGAGTACTTGGATGCGGAAGAAGAGGAGACTGCCATGATTGTAATGTCCCCCGAGGATCTGGGCGAG 'Xenodidymella applanata CBS_205.63' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-TCGCCCA--CCGATTGGAC----AATAACAAA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCTTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGTCTCGAT-GGCTCCGGTGT------------------------------------------------------------CTACAACGGCACCTCGGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTA------TTAGA--------ACT-------GACAC-GC-TCAAC----ATC-AACG-------GAC---------TGCGAGTG-------CTGACTGTCT-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCTGGCC????GGGGGCTTGTCTGCCCTGCTGAGACCCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAATCTGTCGTTGATGTGCTACGTCAGTGTCGGTAGCGATGCTGGACCTATTAGCGACTTCATGAGCCAGAGAAACATGCAGCTCCTCGAGGAGTATGACCAGAATCAGAACCCTGATGCTACCAAGGTCTTTGTAAACGGTGTGTGGGTTGGTGTACATTCCAACGCACAGCAACTCGTCTCGACCGTACAAGAGTTGCGACGAAATGGAACCTTGTCCTACGAGATGAGTTTGATTCGAGACATTCGTGATCGAGAATTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCTCTTTTCGTTGTCGAAAGCGATGTCCGAAAGCCTAATCGCAACCACCTCGTCTTCAGTCAGGAACATTATAACAAGCTTGTCGCAGAGCAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--CGAAGAAGAGAAGACCGAGCTCACGTATGGCTGGAAGGGTCTCATCCAGGACGGTGTTATCGAGTACTTGGATGCGGAAGAAGAGGAGACTGCCATGATTGTAATGTCCCCCGAGGATCTGGGCGAG 'Xenodidymella asphodeli CBS_375.62T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GATCTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC--CAATAAC--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAACTTTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCCTC-AAGCCTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCTGCTTTCT-------------------------------------------------------------GGCAGACCATCTCTGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCCAC----ACT--GCG-------GAC---------TGCGAGTG-------CTGACCAACT-GT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTAGTCGATTTAGAGCCCGGTACAATGGACGCTGTCCGCGCTGGCC????GGGGACTTGTCTGCCCCGCCGAGACCCCTGAAGGACAAGCTTGTGGTCTAGTCAAAAACCTGTCGTTGATGTGCTATGTTAGTGTTGGTAGCGACGCTGGTCCCATCTCCGACTTCATGAGCCAGAGGAATATGCAGCTTCTTGAGGAGTACGATCAGAACCAGAATCCTGATGCCACAAAGGTCTTTGTAAACGGTGTATGGGTTGGTGTCCATTCCAACGCACAACAGCTCGTCTCGACTGTACAGGAACTGCGACGAAACGGAACTTTGTCTTACGAGATGAGTTTGATTCGAGACATTCGCGACCGAGAGTTCAAAATATTCACAGATGCTGGACGTGTCATGAGGCCTCTCTTCGTTGTCGAAAGCGATGTCCGTAAGCCCAACCGTAACCACCTTGTCTTTAGCCAGGAGCACTACAACAAGCTTATCGCGGAGCAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--CGAAGAAGAGAAAACTGAGCTTACATATGGCTGGAAGGGCCTTATTCAAGACGGTGTCATCGAGTACTTAGACGCAGAAGAAGAAGAAACCGCCATGATTGTCATGTCACCCGAGGACCTCGGCGAG 'Xenodidymella catariae CBS_102635' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTCT-ACCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGTGGGT-CCGCCCG--CCGATTGGAC---AATACA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGTCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCGGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTA------CTAGA--------ACT-------GACAC-AC-TCGAC----ATC-AACG-------GAC---------TGCGAGTG-------CTGACCGCCT-GC--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTTGTCGATTTGGAGCCCGGTACGATGGATGCCGTCCGCGCTGGCC????GGGGACTCGTATGTCCTGCCGAGACCCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAATCTTTCGTTGATGTGCTACGTCAGTGTTGGTAGCGACGCTGGACCTATTAGCGACTTTATGAGCCAGAGGAACATGCAACTCCTCGAAGAGTACGATCAGAATCAGAACCCTGATGCCACCAAGGTCTTCGTGAATGGTGTCTGGGTTGGTGTGCATTCCAACGCACAGCAGCTCGTCTCGACTGTTCAAGAACTGCGACGAAACGGAACGTTGTCTTACGAGATGAGTTTGATCCGAGACATTCGTGATCGAGAATTCAAAATCTTCACAGATGCTGGACGTGTCATGAGGCCTCTCTTCGTCGTCGAAAGCGATGTCCGGAAGCCGAACCGCAACCACCTCGTTTTTAGTCAAGATCACTACAACAAACTTGTCGCGGAACAGCAG-GCGCAGGCTGCAGCAGGTGTTGG--TGAAGAAGAGAAGACCGAGCTGACATATGGCTGGAAGGGGCTCATTCAGGACGGTGTCATTGAATATTTGGATGCAGAAGAAGAAGAAACCGCCATGATTGTCATGTCCCCCGAAGATCTCGGCGAG 'Xenodidymella humicola CBS_220.85' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GAACTTATAGGG-GAGACG-ACATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG---AA-AAAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTTTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACCATCTCCGGCGAGCATGGCCTCGAC-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACTTCGGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------CTAGA--------AAT-------GACAC-GC-TCTCT----AAGCAACG-------GAC---------TGCGAGTG-------CTGACCAACATGT--AGGCCTCTGGCAACAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCTGGTACAATGGATGCCGTCCGCGCTGGCC????GGGGGCTTGTCTGCCCTGCCGAGACCCCTGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTAGCGACGCCGGGCCTATCTCCGACTTCATGAGCCAAAGGAACATGCAGCTCCTCGAGGAGTACGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAATGGTGTATGGGTTGGTGTTCACTCCAATGCGCAGCAGCTTGTCTCGACGGTACAAGAACTGCGACGAAACGGAACGTTGTCTTACGAGATGAGTTTGATTCGAGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGACCTCTGTTCGTTGTCGAGAGCGACGTCCGTAAGCCCAACCGCAACCACCTCGTCTTCAGCCAGGATCACTACAACAAGCTTGTCGCGGAGCAGCAG-GCGCAAGCCGCAGCAGGTGTTGG--TGAGGAAGAGAAGACTGAGCTCACATATGGCTGGAAGGGGCTCATTCAAGATGGTGTCATCGAATACTTAGATGCAGAAGAAGAAGAAACTGCCATGATTGTCATGTCACCCGAGGATCTTGGCGAG 'Xenodidymella saxea CBS_419.92T' GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GTTTTT-ACCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCAT-GTACCTCTCTTCGGGGA-GGCCTTATAGGG-GAGGCG-CAATGCAACC-AGCCCGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGAGTACT--TACGTTTCC--TCGGCGGGT-CCGCCCG--CCGATTGGAC---AATTTA--AA--CC-CTTTGCAG--TTGCAATCAGCG--------TCTG--AAA-AAAC-TTAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCTCTG------------CTTGGTGTT-GGGTG????GGTAACCAAATCGGTGCCGCCTTCT-------------------------------------------------------------GGCAGACGATCTCTGGCGAGCACGGCCTTGAT-GGCTCCGGTGT------------------------------------------------------------CTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA------ATAGA--------GAT-------AACAT-GC-TCTGC----AAACAACG-------GAC---------TGCGAGTG-------CTGACCAACT-GC--AGGCCTCTGGCAATAAG-TTCGTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACAATGGACGCCGTCCGCGCCGGCC????GGGGCCTTGTATGCCCCGCCGAGACTCCCGAAGGACAGGCTTGTGGACTGGTCAAGAACCTTTCGCTGATGTGCTACGTCAGTGTTGGTAGCGATGCTGGGCCGATCTCCGACTTCATGACCCAAAGGAACATGCAGCTGCTCGAGGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTGAACGGTGTCTGGGTCGGTGTCCACTCGAACGCACAGCAACTCGTTTCAACTGTCCAAGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTTTGATCCGAGACATTCGTGATCGAGAGTTCAAGATCTTCACAGACGCTGGCCGTGTCATGCGACCTCTATTCGTTGTCGAGAGCGATATTCGCAAGTCCACCCGCAACCACCTAGTGTTCAATCAAGAGCACTACAGCAAGCTCGTCGCAGAGCAGCAA-GCGCAAGCCGCAGCAGGTGTTGG--AGAAGAGGAGAAGACAGAGCTCACATATGGCTGGAAAGGTCTCATTCAGGATGGTGTCATCGAATACCTGGATGCTGAAGAAGAAGAAACTGCCATGATTGTCATGTCACCAGAGGATCTTGGTGAG 'Xenopyrenochaetopsis pratorum CBS_445.81' GGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTAACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAA-GCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGG--GCTTTT-GCCCGGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGACCTCTGTCAC-GTACCTTCTCTCGGGAA-GGCCTTATAGGG-GAGGTG-TCATGCAACC-AGCCTGGACTGAGG-TCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTG????TGTC-TTTTGCGTACCA-CTTGTTTCC--TCGGCGGGC-TTGCCTG--CCGATAGGAC--AAACACA--AA--CC-CTTTGTAG--TTGCAATCAGCG--------TCAG---AA-AAAA-ACAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG-AGCGTCA-TTTGTACCTTC-AAGCAATG------------CTTGGTGTT-GGGTG????GGTAACCAAATTGGTGCCGCCTTTT-------------------------------------------------------------GGCAAAACATCTCTGGCGAGCATGGCCTCGAC-GGAGACGGTGT------------------------------------------------------------CTACAACGGCACCTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTT------CGTGATC----------------GCCGCAGC-------------------------ATC---------CGAGCTTGTCAGAATCTGACTACTC-CC--AGGCAGCCAACAACAAG-TATGTTCCCCGTGCGGTTCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCTGGAC????GGGGTCTGGTCTGCCCCGCTGAGACTCCGGAAGGTCAGGCCTGTGGTTTGGTCAAGAACTTGTCGCTGATGTGCTACGTGTCTGTCGGAAGCGATGCTTCGCCAATCATTGACTTCATGTCCCAACGTAACATGCAGCTACTCGAGGAGTTCGACCAAAGCCAGAACCCTGATGCCACTAAGGTCTTCGTTAACGGTGTATGGGTTGGTGTTCATTTCAACGCCCACCAGCTCGTGTCAGTTGTCCAGGAGCTCCGCCGAAATGGAACTTTGTCCTTCGAGATGAGTTTGATTCGTGACATTCGAGACCGTGAATTCAAGATTTTCACAGATGCCGGTCGTGTCATGCGACCACTCTTCGTCGTCGAGAATGACGTTCGCAAGCCGAACCGCAACCAGCTGATCTTTACCAAGGACCATGCTAAGAAGCTTCTCCAAGAGCAGACCAGCCTCGACGAACGCAACGGCTGGAGCGATGAAGAGATCAGCAAATCCACTTATGGTTGGAGAGGCCTGATTCAAGATGGTGTCGTAGAATATCTTGATGCTGAGGAAGAAGAGACTGCGATGATCACCTTCTCACCCGAAGACCTGGACGAG ; END; BEGIN TREES; TITLE Coelomycetous_Dothideomycetes; LINK TAXA = Taxa1; TRANSLATE 1 'Preussia terricola AFTOL_ID_282', 2 'Sporormiella minima CBS_524.50', 3 'Allocucurbitaria botulispora CBS_142453T', 4 'Allophoma coffeae arabicae_CBS_497.91', 5 'Allophoma cylindrispora CBS_142453T', 6 'Allophoma labilis CBS_124.93', 7 'Allophoma minor CBS_325.82T', 8 'Allophoma nicaraguensis CBS_506.91T', 9 'Allophoma oligotrophica CGMCC_3_18114T', 10 'Allophoma piperis CBS_268.93T', 11 'Allophoma tropica CBS_436.75T', 12 'Allophoma zantedeschiae CBS_131.93', 13 'Allophoma zantedeschiae CBS_229.32', 14 'Alternariaster bidentis CBS_134021', 15 'Alternariaster helianthi CBS_327.69', 16 'Ascochyta herbicola CBS_629.97', 17 'Ascochyta pisi CBS_126.54', 18 'Ascochyta rabiei CBS_206.30', 19 'Ascochyta versabilis CBS_876.97', 20 'Ascochyta viciae CBS_451.68', 21 'Boeremia exigua CBS_118.38', 22 'Boeremia exigua CBS_119.38', 23 'Boeremia lycopersici CBS_378.67', 24 'Briansuttonomyces eucalypti CBS_114879T', 25 'Briansuttonomyces eucalypti CBS_114887', 26 'Calophoma aquilegiicola CBS_107.96', 27 'Calophoma aquilegiicola CBS_108_96', 28 'Calophoma clematidina CBS_102.66', 29 'Calophoma clematidina CBS_108.79T', 30 'Calophoma clematidis rectae_CBS_507.63', 31 'Calophoma rosae CGMCC_3_18347T', 32 'Calophoma rosae LC_8119', 33 'Camarosporium aborescentis MFLUCC_14_0604', 34 'Camarosporium arezzoensis MFLUCC_140238', 35 'Camarosporium aureum MFLUCC_14_0620', 36 'Camarosporium clematidis MFLUCC_13_0336', 37 'Camarosporium quaternatum CPC_23216', 38 'Camarosporium quaternatum CPC_31081T', 39 'Camarosporium quaternatum CPC_31518', 40 'Camarosporium robiniicola MFLUCC_13_0527', 41 'Camarosporium spartii MFLUCC_13_0548', 42 'Camarosporomyces flavigenus CBS_314.80', 43 'Coniothyrium carteri CBS_105.91', 44 'Coniothyrium palmarum CBS_400.71', 45 'Coniothyrium palmarum CBS_758.73', 46 'Coniothyrium telephii CBS_188.71', 47 'Coniothyrium telephii CBS_856.97', 48 'Cucurbitaria berberidis CBS_130007T', 49 'Cucurbitaria berberidis MFLUCC_11_0387', 50 'Cucurbitaria elongata AFTOL_ID_1568', 51 'Cucurbitaria elongata MFLUCC_14_0260', 52 'Cumuliphoma indica CBS_654.77', 53 'Cumuliphoma indica CBS_991.95', 54 'Cumuliphoma omnivirens CBS_341.86T', 55 'Cumuliphoma pneumoniae CBS_142454', 56 'Curreya pityophila CBS_149.32', 57 'Didymella aeria CGMCC_3_18353T', 58 'Didymella aeria LC_8120', 59 'Didymella aliena CBS_379.93', 60 'Didymella americana CBS_185.85', 61 'Didymella anserina CBS_253.80', 62 'Didymella anserina UTHSC_DI16_255', 63 'Didymella aquatica CGMCC_3_18349T', 64 'Didymella aquatica LC_5555', 65 'Didymella arachidicola CBS_333.75', 66 'Didymella aurea CBS_269.93T', 67 'Didymella bellidis CBS_714.85', 68 'Didymella boeremae CBS_109942T', 69 'Didymella brunneospora CBS_115.58', 70 'Didymella chenopodii CBS_128.93', 71 'Didymella chloroguttulata CGMCC_3_18351T', 72 'Didymella chloroguttulata LC_8122', 73 'Didymella coffeae arabicae_CBS_123380T', 74 'Didymella curtisii PD_92_1460', 75 'Didymella ellipsoidea CGMCC_3_18350T', 76 'Didymella ellipsoidea LC_8123', 77 'Didymella eucalyptica CBS_377.91', 78 'Didymella exigua CBS_183.55T', 79 'Didymella gardeniae CBS_626.68T', 80 'Didymella gardeniae UTHSC_DI16_211', 81 'Didymella gardeniae UTHSC_DI16_226', 82 'Didymella gardeniae UTHSC_DI16_274', 83 'Didymella gardeniae UTHSC_DI16_295', 84 'Didymella glomerata CBS_528.66', 85 'Didymella glomerata UTHSC_DI16_205', 86 'Didymella heteroderae CBS_109.92T', 87 'Didymella heteroderae UTHSC_DI16_190', 88 'Didymella heteroderae UTHSC_DI16_224', 89 'Didymella heteroderae UTHSC_DI16_227', 90 'Didymella heteroderae UTHSC_DI16_231', 91 'Didymella heteroderae UTHSC_DI16_232', 92 'Didymella heteroderae UTHSC_DI16_234', 93 'Didymella heteroderae UTHSC_DI16_235', 94 'Didymella heteroderae UTHSC_DI16_305', 95 'Didymella ilicicola CGMCC_3_18355T', 96 'Didymella ilicicola LC_8127', 97 'Didymella infuscatispora CGMCC_3_18356T', 98 'Didymella infuscatispora LC_8129', 99 'Didymella keratinophila UTHSC_DI16_200T', 100 'Didymella keratinophila UTHSC_DI16_228', 101 'Didymella keratinophila UTHSC_DI16_282', 102 'Didymella lethalis CBS_103.25', 103 'Didymella macrophylla CGMCC_3_18357T', 104 'Didymella macrophylla LC_8132', 105 'Didymella macrostoma CBS_223.69', 106 'Didymella maydis CBS_588.69T', 107 'Didymella microchlamydospora CBS_105.95T', 108 'Didymella microchlamydospora UTHSC_DI16_199', 109 'Didymella microchlamydospora UTHSC_DI16_365', 110 'Didymella molleriana CBS_229.79', 111 'Didymella musae CBS_463.69', 112 'Didymella musae UTHSC_DI16_230', 113 'Didymella negriana CBS_358.71', 114 'Didymella negriana ICMP_10845', 115 'Didymella nigricans PD_77_919', 116 'Didymella ocimicola CGMCC_3_18358T', 117 'Didymella ocimicola LC_8138', 118 'Didymella pedeiae CBS_124517T', 119 'Didymella pinodella CBS_531.66', 120 'Didymella pinodes CBS_374.84', 121 'Didymella pinodes CBS_525.77T', 122 'Didymella pomorum CBS_285.76', 123 'Didymella protuberans CBS_381.96T', 124 'Didymella protuberans FMR_13795', 125 'Didymella pteridis CBS_379.96T', 126 'Didymella rhei CBS_109177', 127 'Didymella rumicicola CBS_179.97', 128 'Didymella rumicicola CBS_683.79T', 129 'Didymella sancta CBS_281.83T', 130 'Didymella sancta CBS_644.97', 131 'Didymella segeticola CGMCC_3_17489T', 132 'Didymella segeticola CGMCC_3_17498', 133 'Didymella segeticola LC_8141', 134 'Didymella sinensis LC_8142', 135 'Didymella sinensis LC_8143', 136 'Didymella subglomerata CBS_110.92', 137 'Didymella suiyangensis CGMCC_3_18352T', 138 'Didymella suiyangensis LC_8144', 139 'Didymella viburnicola CBS_523.73', 140 'Dothidotthia aspera CPC_12932', 141 'Dothidotthia symphoricarpi CPC_12929', 142 'Ectophoma multirostrata CBS_110.79', 143 'Ectophoma multirostrata CBS_274.60T', 144 'Ectophoma multirostrata CBS_368.65', 145 'Ectophoma pereupyrena CBS_267.92T', 146 'Epicoccum brasiliense CBS_120105T', 147 'Epicoccum camelliae CGMCC_3_18343T', 148 'Epicoccum camelliae LC_4862', 149 'Epicoccum camelliae UTHSC_DI16_201', 150 'Epicoccum camelliae UTHSC_DI16_202', 151 'Epicoccum camelliae UTHSC_DI16_206', 152 'Epicoccum camelliae UTHSC_DI16_280', 153 'Epicoccum camelliae UTHSC_DI16_338', 154 'Epicoccum camelliae UTHSC_DI16_345', 155 'Epicoccum catenisporum CBS_181.80T', 156 'Epicoccum dendrobii CGMCC_3_18359T', 157 'Epicoccum dendrobii LC_8146', 158 'Epicoccum draconis CBS_186.83', 159 'Epicoccum duchesneae CGMCC_3_18345T', 160 'Epicoccum duchesneae LC_8147', 161 'Epicoccum henningsii CBS_104.80', 162 'Epicoccum hordei CGMCC_3_18360T', 163 'Epicoccum hordei LC_8149', 164 'Epicoccum huancayense CBS_105.80T', 165 'Epicoccum italicum CGMCC_3_18361T', 166 'Epicoccum italicum LC_8151', 167 'Epicoccum keratinophilum CBS_142455T', 168 'Epicoccum keratinophilum UTHSC_DI16_244', 169 'Epicoccum keratinophilum UTHSC_DI16_258', 170 'Epicoccum keratinophilum UTHSC_DI16_272', 171 'Epicoccum keratinophilum UTHSC_DI16_299', 172 'Epicoccum latusicollum CGMCC_3_18346T', 173 'Epicoccum latusicollum LC_4859', 174 'Epicoccum latusicollum UTHSC_DI16_197', 175 'Epicoccum layuense CGMCC_3_18362T', 176 'Epicoccum layuense LC_8156', 177 'Epicoccum nigrum CBS_125.82', 178 'Epicoccum nigrum CBS_173.73T', 179 'Epicoccum ovisporum CBS_180.80T', 180 'Epicoccum pimprinum PD_77_1028', 181 'Epicoccum plurivorum CBS_558.81T', 182 'Epicoccum pneumoniae UTHSC_DI16_257', 183 'Epicoccum poae CGMCC_3_18363T', 184 'Epicoccum poae LC_8161', 185 'Epicoccum poae LC_8162', 186 'Epicoccum proteae CBS_114179T', 187 'Epicoccum sorghinum CBS_179.80', 188 'Epicoccum sorghinum CBS_627.68', 189 'Epicoccum sorghinum UTHSC_DI16_288', 190 'Epicoccum sorghinum UTHSC_DI16_301', 191 'Epicoccum viticis BRIP_29294', 192 'Epicoccum viticis CGMCC_3_18344T', 193 'Foliophoma fallens CBS_161.78', 194 'Foliophoma fallens CBS_284.70', 195 'Halojulella avicenniae BCC_18422', 196 'Halojulella avicenniae BCC_20173', 197 'Hazslinszkyomyces aloes CPC_21572', 198 'Hazslinszkyomyces aptrootii CBS_483.95', 199 'Hazslinszkyomyces lycii CPC_30998', 200 'Hazslinszkyomyces lycii CPC_31014', 201 'Heterophoma adonidis CBS_114309', 202 'Heterophoma nobilis CBS_507.91', 203 'Heterophoma verbascicola CGMCC_3_18364T', 204 'Heterophoma verbascicola LC_8164', 205 'Iuxtiphoma eupyrena CBS_374.91', 206 'Iuxtiphoma eupyrena CBS_527.66T', 207 'Leptosphaeria conoidea CBS_616.75', 208 'Leptosphaeria doliolum CBS_505.75T', 209 'Leptosphaerulina americana CBS_213.55', 210 'Leptosphaerulina australis CBS_317.83', 211 'Libertasomyces myopori CPC_27354', 212 'Libertasomyces platani CPC_29609', 213 'Libertasomyces quercus CBS_134.97', 214 'Macroventuria anomochaeta CBS_525.71T', 215 'Macroventuria wentii CBS_526.71T', 216 'Microsphaeropsis olivacea CBS_233.77', 217 'Microsphaeropsis proteae CBS_111319', 218 'Neoascochyta argentina CBS_112524T', 219 'Neoascochyta cylidrispora CBS_142456T', 220 'Neoascochyta cylidrispora UTHSC_DI16_352', 221 'Neoascochyta desmazieri CBS_297.69T', 222 'Neoascochyta desmazieri UTHSC_DI16_207', 223 'Neoascochyta desmazieri UTHSC_DI16_320', 224 'Neoascochyta desmazieri UTHSC_DI16_332', 225 'Neoascochyta desmazieri UTHSC_DI16_341', 226 'Neoascochyta europaea CBS_820.84T', 227 'Neoascochyta exitialis CBS_118.40', 228 'Neoascochyta exitialis CBS_389.86', 229 'Neoascochyta graminicola CBS_301.69', 230 'Neoascochyta graminicola CBS_816.84', 231 'Neoascochyta paspali CBS_560.81T', 232 'Neoascochyta soli CGMCC_3_18365T', 233 'Neoascochyta soli LC_8166', 234 'Neoascochyta tardicrebrescens CBS_689.97T', 235 'Neoascochyta tardicrebrescens UTHSC_DI16_291', 236 'Neoascochyta triticicola CBS_544.74T', 237 'Neocamarosporium betae CBS_109410', 238 'Neocamarosporium betae CBS_523.66', 239 'Neocamarosporium calvescens CBS_246.79', 240 'Neocamarosporium goegapense CPC_23676', 241 'Neocucurbitaria aquatica CBS_297.74T', 242 'Neocucurbitaria cava CBS_115979', 243 'Neocucurbitaria cava CBS_257.68T', 244 'Neocucurbitaria hakeae CPC_28920T', 245 'Neocucurbitaria irregularis CBS_142791T', 246 'Neocucurbitaria keratinophila CBS_121759T', 247 'Neocucurbitaria quercina CBS_115095T', 248 'Neocucurbitaria unguis hominis_CBS_111112', 249 'Neocucurbitaria unguis hominis_CBS_112.79', 250 'Neocucurbitaria unguis hominis_UTHSC_DI16_213', 251 'Neodidymelliopsis achlydis CBS_256_77T', 252 'Neodidymelliopsis cannabis CBS_234.37', 253 'Neodidymelliopsis longicolla CBS_382_96T', 254 'Neodidymelliopsis longicolla UTHSC_DI16_322', 255 'Neodidymelliopsis polemonii CBS_109181T', 256 'Neodidymelliopsis xanthina CBS_383.68', 257 'Neomicrosphaeropsis italica MFLUCC_15_0484', 258 'Neomicrosphaeropsis italica MFLUCC_15_0485', 259 'Neophaeosphaeria agaves CPC_21264', 260 'Neophaeosphaeria filamentosa CBS_102202', 261 'Neoplatysporoides aloicola CBS_139901', 262 'Neopyrenochaeta acicola CBS_812.95', 263 'Neopyrenochaeta fragariae CBS_101634', 264 'Neopyrenochaeta inflorescentiae CBS_119222T', 265 'Neopyrenochaeta telephoni CBS_139022T', 266 'Neopyrenochaetopsis hominis UTHSC_DI16_238T', 267 'Nothophoma anigozanthi CBS_381.91T', 268 'Nothophoma arachidis hypogaeae_CBS_125.93', 269 'Nothophoma gossypiicola CBS_377.67', 270 'Nothophoma gossypiicola UTHSC_DI16_294', 271 'Nothophoma infossa CBS_123395T', 272 'Nothophoma macrospora CBS_140674', 273 'Nothophoma quercina CBS_633.92', 274 'Nothophoma quercina UTHSC_DI16_270', 275 'Nothophoma variabilis CBS_142457T', 276 'Ochrocladosporium elatum CBS_146.33', 277 'Ochrocladosporium frigidarii CBS_103.81', 278 'Ophiosphaerella herpotricha AFTOL_ID_1569', 279 'Paraboeremia adianticola CBS_187.83', 280 'Paraboeremia camelliae CGMCC_3_18106T', 281 'Paraboeremia camelliae CGMCC_3_18107', 282 'Paraboeremia camelliae CGMCC_3_18108', 283 'Paraboeremia litseae CGMCC_3_18109T', 284 'Paraboeremia litseae CGMCC_3_18110', 285 'Paraboeremia oligotrophica CGMCC_3_18111T', 286 'Paraboeremia oligotrophica CGMCC_3_18112', 287 'Paraboeremia putaminum CBS_130.69', 288 'Paraboeremia selaginellae CBS_122.93', 289 'Paraconiothyrium estuarinum CBS_109850', 290 'Paracucurbitaria corni CBS_248.79T', 291 'Paracucurbitaria italica CBS_234.92T', 292 'Paraepicoccum amazonense MFLUCC_15_0491', 293 'Paraepicoccum amazonense MFLUCC_15_0493', 294 'Paraleptosphaeria dryadis CBS_643.86', 295 'Parapyrenochaeta acaciae CBS_141291T', 296 'Parapyrenochaeta protearum CBS_131315T', 297 'Parapyrenochaeta protearum CBS_137997', 298 'Phaeomycocentrospora cantuariensis CBS_132014', 299 'Phaeomycocentrospora cantuariensis CPC_10157', 300 'Phaeosphaeria oryzae CBS_110110', 301 'Phoma herbarum CBS_377.92', 302 'Phoma herbarum CBS_502.91', 303 'Phoma herbarum CBS_615.75', 304 'Phoma herbarum FMR_UTHSC_DI16_204', 305 'Phoma herbarum UTHSC_DI16_212', 306 'Phoma herbarum UTHSC_DI16_306', 307 'Phoma herbarum UTHSC_DI16_307', 308 'Phoma herbarum UTHSC_DI16_319', 309 'Phomatodes aubrietiae CBS_627.97T', 310 'Phomatodes nebulosa CBS_100191', 311 'Phomatodes nebulosa CBS_740.96', 312 'Pleiochaeta ghindensis CBS_552.92', 313 'Pleiochaeta setosa CBS_496.63', 314 'Pleospora herbarum CBS_191.86', 315 'Pleospora typhicola CBS_132.69', 316 'Pseudoascochyta novae zelandiae_CBS_141689T', 317 'Pseudoascochyta pradensis CBS_141688T', 318 'Pseudopyrenochaeta lycopersici CBS_306.65T', 319 'Pseudopyrenochaeta terrestris CBS_282.72T', 320 'Pyrenochaeta nobilis CBS_407.76T', 321 'Pyrenochaetopsis americana UTHSC_DI16_225T', 322 'Pyrenochaetopsis botulispora CBS_142458T', 323 'Pyrenochaetopsis botulispora UTHSC_DI16_289', 324 'Pyrenochaetopsis botulispora UTHSC_DI16_297', 325 'Pyrenochaetopsis confluens CBS_142459T', 326 'Pyrenochaetopsis decipiens CBS_343.85T', 327 'Pyrenochaetopsis globosa UTHSC_DI16_275T', 328 'Pyrenochaetopsis indica CBS_124454T', 329 'Pyrenochaetopsis leptospora CBS_101635T', 330 'Pyrenochaetopsis leptospora CBS_122787', 331 'Pyrenochaetopsis microspora CBS_102876T', 332 'Pyrenochaetopsis microspora UTHSC_DI16_198', 333 'Pyrenochaetopsis paucisetosa CBS_142460T', 334 'Pyrenochaetopsis poae CBS_136769T', 335 'Pyrenochaetopsis setosissima CBS_119739T', 336 'Pyrenochaetopsis tabarestanensis CBS_139506T', 337 'Pyrenochaetopsis uberiformis CBS_142461T', 338 'Remotididymella anthropophylica CBS_142462T', 339 'Remotididymella destructiva CBS_133.93', 340 'Remotididymella destructiva CBS_162.78', 341 'Remotididymella destructiva CBS_378.73T', 342 'Shiraia bambusicola NBRC_30753', 343 'Shiraia bambusicola NBRC_30754', 344 'Shiraia bambusicola NBRC_30771', 345 'Shiraia bambusicola NBRC_30772', 346 'Similiphoma crystallifera CBS_193.82T', 347 'Stagonosporopsis dorenboschii CBS_426.90T', 348 'Stagonosporopsis hortensis CBS_572.85', 349 'Vaciviphoma bulgarica CBS_357.84T', 350 'Vaciviphoma oculo hominis_UTHSC_DI16_308', 351 'Xenodidymella applanata CBS_115577', 352 'Xenodidymella applanata CBS_205.63', 353 'Xenodidymella asphodeli CBS_375.62T', 354 'Xenodidymella catariae CBS_102635', 355 'Xenodidymella humicola CBS_220.85', 356 'Xenodidymella saxea CBS_419.92T', 357 'Xenopyrenochaetopsis pratorum CBS_445.81', 358 'Didymella protuberans UTHSC_DI16_302'; TREE Fig._1 = [&R] ((((((((((((((((((((((((((((((101:1.00000000002876E-6,99:1.00000000002876E-6):1.00000000002876E-6,100:1.00000000002876E-6):0.007604999999999973,(129:0.0066230000000000455,130:1.00000000002876E-6):0.0024060000000000192):0.00903900000000002,73:0.012369999999999992):0.004777999999999949,((((57:1.00000000002876E-6,58:1.00000000002876E-6):0.024680000000000035,(134:1.00000000002876E-6,135:1.00000000002876E-6):0.002597999999999989):0.010399000000000047,122:0.014449000000000045):0.003997999999999946,74:0.01736700000000002):0.002139000000000002):0.002342999999999984,77:0.015270000000000006):0.002882999999999969,((85:8.070000000000022E-4,84:1.00000000002876E-6):0.0046479999999999855,66:0.013186999999999949):0.021347000000000005):9.369999999999656E-4,((((((121:8.120000000000349E-4,120:1.00000000002876E-6):0.0017570000000000086,102:0.002346999999999988):0.0016420000000000323,119:9.439999999999449E-4):0.004487000000000019,65:0.008418999999999954):0.01450499999999999,115:0.011527999999999983):0.004800999999999944,(358:1.00000000002876E-6,123:1.00000000002876E-6):0.014382000000000006):0.01823600000000003):0.004414000000000029,(111:1.00000000002876E-6,112:0.004913999999999974):0.008333000000000035):0.007109000000000032,(61:1.00000000002876E-6,62:1.00000000002876E-6):0.031416):0.0046040000000000525,(((((((89:1.00000000002876E-6,88:1.00000000002876E-6):1.00000000002876E-6,(87:1.00000000002876E-6,91:1.00000000002876E-6):1.00000000002876E-6):1.00000000002876E-6,(94:1.00000000002876E-6,93:1.00000000002876E-6):1.00000000002876E-6):1.00000000002876E-6,92:1.00000000002876E-6):1.00000000002876E-6,86:1.00000000002876E-6):1.00000000002876E-6,90:1.00000000002876E-6):0.018874999999999975,(((((83:1.00000000002876E-6,81:1.00000000002876E-6):1.00000000002876E-6,82:8.070000000000022E-4):1.00000000002876E-6,80:8.089999999999486E-4):0.0021489999999999565,79:0.0010970000000000146):0.018396999999999997,((60:0.005614000000000008,106:0.018535999999999997):0.007896000000000014,136:0.023302000000000045):0.008664000000000005):0.005396999999999985):0.0035800000000000276):0.011946000000000012,((95:1.00000000002876E-6,96:1.00000000002876E-6):0.011718000000000006,118:0.01410100000000003):0.03887499999999999):0.0047800000000000065,68:0.03682799999999997):0.0067749999999999755,59:0.03222499999999995):0.004997000000000029,(71:1.00000000002876E-6,72:1.00000000002876E-6):0.039256999999999986):0.0015380000000000393,((108:1.00000000002876E-6,107:1.00000000002876E-6):1.00000000002876E-6,109:1.00000000002876E-6):0.01714199999999999):0.0022459999999999702,((((((((((67:1.00000000002876E-6,70:0.030730999999999953):0.004692999999999947,(131:1.00000000002876E-6,132:1.00000000002876E-6):0.0026720000000000077):0.0017399999999999638,133:0.0017490000000000006):0.0061909999999999465,(137:1.00000000002876E-6,138:1.00000000002876E-6):0.0037089999999999623):0.02842,((103:1.00000000002876E-6,104:1.00000000002876E-6):0.0041240000000000165,(64:1.00000000002876E-6,63:1.00000000002876E-6):0.003302999999999945):0.011116000000000015):0.023981999999999948,(((116:1.00000000002876E-6,117:1.00000000002876E-6):0.010905999999999971,125:0.04237599999999997):0.007904000000000022,(98:1.00000000002876E-6,97:1.00000000002876E-6):0.013101999999999947):0.002635000000000054):0.01597000000000004,110:0.02915000000000001):0.021936999999999984,((139:0.06616100000000003,69:0.030187999999999993):0.008838000000000013,105:0.05860299999999996):0.009009000000000045):0.006952999999999987,((128:1.00000000002876E-6,127:1.00000000002876E-6):0.04584200000000005,78:0.02310000000000001):0.018375999999999948):0.0030489999999999684,((75:1.00000000002876E-6,76:1.00000000002876E-6):0.04910700000000001,126:0.05163300000000004):0.0024999999999999467):0.0010559999999999459):0.0045279999999999765,(114:1.00000000002876E-6,113:1.00000000002876E-6):0.04112499999999997):0.01121799999999995,(((((((((((((((((150:1.00000000002876E-6,154:1.00000000002876E-6):1.00000000002876E-6,152:1.00000000002876E-6):1.00000000002876E-6,(149:1.00000000002876E-6,153:8.059999999999734E-4):8.070000000000022E-4):8.059999999999734E-4,((147:1.00000000002876E-6,151:1.00000000002876E-6):1.00000000002876E-6,148:0.0016169999999999796):8.110000000000062E-4):0.0024410000000000265,191:1.00000000002876E-6):1.00000000002876E-6,192:0.0024640000000000217):0.005631000000000053,(((190:1.00000000002876E-6,187:1.00000000002876E-6):8.540000000000214E-4,188:0.004056999999999977):0.0024359999999999937,189:0.0025020000000000042):0.007669999999999955):0.0025039999999999507,((174:0.0016169999999999796,172:1.00000000002876E-6):8.070000000000022E-4,173:1.00000000002876E-6):0.0062429999999999986):0.0015490000000000226,182:0.02060899999999999):0.017548000000000008,155:0.01617500000000005):0.010232000000000019,179:0.02822199999999997):0.026175999999999977,((((((((183:1.00000000002876E-6,184:1.00000000002876E-6):1.00000000002876E-6,185:0.002434999999999965):9.879999999999889E-4,(178:0.006761000000000017,177:0.01195999999999997):0.009318000000000048):0.02018299999999995,(165:1.00000000002876E-6,166:1.00000000002876E-6):0.033962999999999965):0.004960999999999993,(176:1.00000000002876E-6,175:1.00000000002876E-6):0.012040999999999968):0.005570999999999993,(157:1.00000000002876E-6,156:1.00000000002876E-6):1.00000000002876E-6):0.02119700000000002,180:0.05320800000000003):0.017695000000000016,(163:1.00000000002876E-6,162:1.00000000002876E-6):0.02359599999999995):0.004707000000000017):0.024421000000000026,(((((168:1.00000000002876E-6,167:1.00000000002876E-6):1.00000000002876E-6,171:1.00000000002876E-6):1.00000000002876E-6,(170:0.0016490000000000116,169:0.0033199999999999896):0.0016519999999999868):0.014206000000000052,(146:0.012380999999999975,158:0.05558399999999997):0.00942299999999996):0.008024000000000031,(161:0.029788000000000037,181:0.023653000000000035):0.008341000000000043):0.036970999999999976):0.0043999999999999595,(186:0.014352000000000031,164:0.016461999999999977):0.04686400000000002):0.00411499999999998,(159:1.00000000002876E-6,160:1.00000000002876E-6):0.013441000000000036):0.016398000000000024,(((((((((11:0.00418099999999999,8:0.0015450000000000186):0.007333000000000034,(4:0.0018759999999999888,9:5.629999999999802E-4):0.005021000000000053):0.031050000000000022,((10:0.035717,7:0.024641000000000024):0.011372999999999966,5:0.05798099999999995):0.01064200000000004):0.008014999999999994,((13:8.129999999999526E-4,12:1.00000000002876E-6):0.011557999999999957,6:0.010047000000000028):0.02571699999999999):0.021321999999999952,(((204:1.00000000002876E-6,203:1.00000000002876E-6):0.02189399999999997,202:0.036775):0.02052900000000002,201:0.04233100000000001):0.016661999999999955):0.013669000000000042,(348:0.05841600000000002,347:0.046640000000000015):0.01832199999999995):0.006140000000000034,((21:8.029999999999982E-4,22:1.00000000002876E-6):0.012812999999999963,23:0.01559900000000003):0.07669000000000004):0.011186999999999947,(((142:1.00000000002876E-6,144:1.00000000002876E-6):8.249999999999647E-4,143:7.899999999999574E-4):0.008604000000000056,145:0.013203999999999994):0.024649000000000032):0.005963000000000052,(((341:1.00000000002876E-6,339:8.059999999999734E-4):0.003446999999999978,340:6.410000000000027E-4):0.047043999999999975,338:0.03408800000000001):0.026487999999999956):0.006852999999999998):0.006144000000000038,346:0.06015199999999998):0.010013999999999967):0.010221999999999953,((((((((281:1.00000000002876E-6,280:1.00000000002876E-6):1.00000000002876E-6,282:1.00000000002876E-6):0.009866000000000041,279:0.02783100000000005):0.004846000000000017,((284:1.00000000002876E-6,283:0.002450999999999981):0.0015979999999999883,288:0.002511000000000041):0.00305500000000003):0.0031039999999999957,287:0.0013619999999999743):0.015000000000000013,(285:1.00000000002876E-6,286:1.00000000002876E-6):0.014634999999999954):0.026886999999999994,(214:0.008059999999999956,215:0.007296999999999998):0.022287999999999974):0.009593999999999991,(((55:0.009637000000000007,54:0.005751999999999979):0.004753000000000007,(53:0.002595000000000014,52:7.019999999999804E-4):0.007897000000000043):0.04413800000000001,(205:1.00000000002876E-6,206:0.008369999999999989):0.040776000000000034):0.012159000000000031):1.00000000002876E-6):0.006719999999999948,(350:0.03045399999999998,349:0.025726000000000027):0.024075999999999986):0.005152999999999963,((((273:0.0026530000000000165,274:0.0031409999999999494):0.03309200000000001,(267:0.028217000000000048,275:0.01558499999999996):0.006398000000000015):0.005657000000000023,(271:0.005570999999999993,268:0.007835999999999954):0.030132999999999965):0.010618000000000016,((269:1.00000000002876E-6,270:1.00000000002876E-6):0.007410999999999945,272:0.01951400000000003):0.01774500000000001):0.018742000000000036):0.003481999999999985,(((((((((19:0.01715599999999995,18:0.009661999999999948):0.010437999999999947,16:0.013600999999999974):0.010238999999999998,(20:0.0020649999999999835,17:0.002929999999999988):0.028278000000000025):0.008538999999999963,((310:1.00000000002876E-6,311:1.00000000002876E-6):0.013036999999999965,309:0.021838000000000024):0.03372300000000006):0.00440700000000005,((25:1.00000000002876E-6,24:1.00000000002876E-6):0.010873000000000022,(317:0.0061989999999999545,316:0.007360999999999951):0.01836099999999996):0.018305000000000016):0.004614000000000007,(257:0.0011679999999999469,258:9.970000000000256E-4):0.03832000000000002):0.00819000000000003,((((302:1.00000000002876E-6,305:1.00000000002876E-6):8.129999999999526E-4,(301:1.00000000002876E-6,307:8.129999999999526E-4):1.00000000002876E-6):8.129999999999526E-4,(304:8.129999999999526E-4,306:1.00000000002876E-6):1.00000000002876E-6):9.500000000000064E-4,(308:1.00000000002876E-6,303:1.00000000002876E-6):6.789999999999852E-4):0.05024200000000001):0.005279000000000034,((((32:1.00000000002876E-6,31:1.00000000002876E-6):0.01872600000000002,30:0.02944100000000005):0.009738000000000024,(29:1.00000000002876E-6,28:1.00000000002876E-6):0.02742100000000003):0.01869900000000002,(27:1.00000000002876E-6,26:0.0031480000000000397):0.054007999999999945):0.01168199999999997):0.003854000000000024,(209:0.017450999999999994,210:0.041642999999999986):0.036645999999999956):0.003450999999999982):0.00969500000000001,((((((351:1.00000000002876E-6,352:1.00000000002876E-6):0.04595400000000005,354:0.04605499999999996):0.023316000000000003,353:0.05030199999999996):0.009414999999999951,355:0.026822000000000012):0.008515999999999968,356:0.08447400000000005):0.010382000000000002,((((251:0.0027930000000000454,256:0.011353999999999975):0.0013079999999999758,255:0.014759999999999995):0.013159000000000032,252:0.047787000000000024):0.005661000000000027,(254:1.00000000002876E-6,253:1.00000000002876E-6):0.024811000000000027):0.04224099999999997):0.005595000000000017):0.035911000000000026,((((((((223:1.00000000002876E-6,224:1.00000000002876E-6):1.00000000002876E-6,222:1.00000000002876E-6):1.00000000002876E-6,225:8.249999999999647E-4):1.00000000002876E-6,221:8.249999999999647E-4):0.017481999999999998,(219:1.00000000002876E-6,220:1.00000000002876E-6):0.007298999999999944):0.024147999999999947,(((234:1.00000000002876E-6,235:0.002487000000000017):0.008160000000000056,218:0.003383000000000025):0.025872000000000006,236:0.020195999999999992):0.03982399999999997):0.003538000000000041,(((228:1.00000000002876E-6,227:1.00000000002876E-6):0.022042000000000006,226:0.020518999999999954):6.890000000000507E-4,(230:1.00000000002876E-6,229:1.00000000002876E-6):0.02254299999999998):0.04178099999999996):0.018904000000000032,((232:1.00000000002876E-6,233:1.00000000002876E-6):0.002642999999999951,231:0.006897000000000042):0.071075):0.06849099999999997):0.026088,((((313:0.011319999999999997,312:0.0325899999999999):0.06067800000000001,140:0.06422700000000003):0.02332500000000004,(299:9.9999999991773E-7,298:9.9999999991773E-7):0.08597300000000008):0.043876000000000026,141:1.00000000002876E-6):0.21433000000000002):0.022379999999999955,(((((((((((((((((248:9.9999999991773E-7,249:9.9999999991773E-7):0.0015220000000000233,250:0.0024360000000001047):0.0033689999999999554,241:0.008037000000000072):0.021389000000000102,(245:0.02072699999999994,246:0.01404099999999997):0.01307400000000003):0.0263469999999999,247:0.03254200000000007):0.010186999999999946,((242:0.0042159999999999975,243:0.004669999999999952):0.029638000000000053,244:0.055498999999999965):0.04381900000000005):0.03398699999999999,((290:0.01690400000000003,291:0.005365000000000064):0.06219599999999992,3:0.10607100000000003):0.007433000000000023):0.007032000000000038,(49:9.9999999991773E-7,48:9.9999999991773E-7):0.1049270000000001):0.021275000000000044,(318:0.056766000000000094,319:0.042526000000000064):0.09326699999999999):0.015610000000000013,320:0.07858200000000004):0.014846000000000026,(((263:0.008154999999999912,262:0.007911999999999919):0.0072069999999999634,264:0.009918000000000093):0.09113100000000007,265:0.067218):0.06742300000000001):0.010472999999999955,(((((((((((324:9.9999999991773E-7,322:9.9999999991773E-7):9.9999999991773E-7,323:0.0016359999999999708):0.0029490000000000904,336:9.9999999991773E-7):0.015414999999999957,333:0.029649000000000036):0.045579000000000036,((330:9.9999999991773E-7,329:9.9999999991773E-7):0.012758000000000047,334:0.014626000000000028):0.040669999999999984):0.00862099999999999,335:0.021163000000000043):0.004694999999999894,((321:0.03385199999999999,337:0.016061000000000103):0.005190000000000028,(332:0.001651000000000069,331:8.179999999999854E-4):0.02075500000000008):0.00460600000000011):0.012026000000000092,327:0.03211600000000003):0.045646000000000075,((326:0.11092299999999988,328:0.11477599999999999):0.037952999999999903,325:0.14390199999999997):0.03558400000000006):0.10623399999999994,357:0.15169900000000003):0.10828699999999991,266:0.23964299999999994):0.038058000000000036):0.03165200000000001,((((((213:0.038397000000000014,212:0.028437000000000046):0.02222400000000002,211:0.0932090000000001):0.04776399999999992,261:0.0700670000000001):0.0331800000000001,(315:0.12592000000000003,314:0.132193):0.06503399999999993):0.05076999999999998,(((237:9.9999999991773E-7,238:9.9999999991773E-7):0.07201600000000008,240:9.9999999991773E-7):9.9999999991773E-7,239:0.03424000000000005):0.08528400000000003):0.04672200000000004,((((344:0.01876499999999992,345:9.9999999991773E-7):0.0022409999999999375,343:9.9999999991773E-7):0.0022409999999999375,342:9.9999999991773E-7):0.284995,(300:0.1297759999999999,278:0.12751):0.05866899999999997):0.11566500000000002):0.024388999999999994):0.0038240000000000496,(((((((((276:9.9999999991773E-7,277:0.0069909999999999695):0.051935000000000064,(47:9.9999999991773E-7,46:9.9999999991773E-7):9.9999999991773E-7):0.05031899999999989,(194:9.9999999991773E-7,193:0.007152999999999965):0.07727699999999993):0.033862999999999976,(((200:9.9999999991773E-7,199:0.0066230000000000455):0.0742259999999999,43:0.03938799999999998):0.010885999999999951,198:0.02133600000000002):0.012468999999999952):0.01002599999999998,((38:9.9999999991773E-7,39:9.9999999991773E-7):9.9999999991773E-7,37:9.9999999991773E-7):0.28522500000000006):0.01993800000000001,197:0.047978999999999994):0.01989799999999997,294:0.10344500000000001):0.005520999999999998,42:0.12266199999999994):0.014681999999999973,((((((((36:1.00000000002876E-6,41:1.00000000002876E-6):1.00000000002876E-6,50:1.00000000002876E-6):1.00000000002876E-6,51:1.00000000002876E-6):0.01388199999999995,(35:1.00000000002876E-6,40:1.00000000002876E-6):0.017737000000000003):0.009298999999999946,33:0.006584000000000034):0.007619000000000042,34:0.00569200000000003):0.011884000000000006,((297:9.9999999991773E-7,296:0.0024020000000000152):0.024652999999999925,295:0.02413399999999999):0.09197500000000003):0.016158000000000006,((292:1.00000000002876E-6,293:1.00000000002876E-6):0.09306800000000004,(44:9.9999999991773E-7,45:9.9999999991773E-7):0.130343):0.019125999999999976):0.017715999999999954):0.008942000000000005):0.016888000000000014,((14:0.028083999999999998,15:0.008680999999999939):0.18699899999999992,(259:0.012591000000000019,260:0.02123799999999998):0.08036900000000002):0.024329999999999963):0.017487999999999948,(208:0.04331799999999997,207:0.0403929999999999):0.167238):0.03651899999999997,(217:0.017264000000000057,216:0.021340999999999943):0.08946500000000002):0.07413899999999995):0.10790100000000002,(195:0.037946000000000035,196:9.9999999991773E-7):0.5290619999999999):0.069388,(56:0.08427999999999991,289:0.1910860000000001):0.453546):0.1983764999999999,(2:0.3522719999999999,1:0.25113600000000025):0.1983765); END;