#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:52 GMT TreeBASE (cc) 1994-2008 Study reference: Shi S., Wang X., & Bau T. 2018. Three new species of Lactarius (Russulaceae, Russulales) from Northeast China. Mycoscience, 59: 206-217. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21121] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=81; TAXLABELS Lactarius_AB922926_Japan_ECM Lactarius_Olympianus_EB_0070_18_USA_Mont Lactarius_Olympianus_ED_08_018_USA_KR364 Lactarius_Olympianus_HQ650733 Lactarius_Olympianus_JN2003_032_USA Lactarius_accerimus_EF493285 'Lactarius acerrimus JF908318_Italy' 'Lactarius acris AV_97_520' 'Lactarius acris VD_08_094' 'Lactarius albidocinereus KM069457_CHina' 'Lactarius albidocinereus KR082889_10044' 'Lactarius albidocinereus L005_HMJAU42461' 'Lactarius albidocinereus L084_HMJAU42462' 'Lactarius albidocinereus L085_HMJAU42463' 'Lactarius albidocinereus L086_HMJAU42464' 'Lactarius albidocinereus XHW2445_W0167_T' 'Lactarius albidocinereus XHW2920_W0790_H' 'Lactarius albidocinereus XHW3624_w1550_G' 'Lactarius azonites DS_08_514_Belgium' 'Lactarius azonites DS_08_518_Belgium' 'Lactarius azonites LE_254459_Georgia' Lactarius_azonites_MCVE14894 'Lactarius azonites SAV_F2225_Belgium' 'Lactarius dilutisalmoneus L003_Jiaohe' 'Lactarius dilutisalmoneus XHW2603_W1131' 'Lactarius evosmus UP536_DQ658882' 'Lactarius evosmus UP557_EF493283' 'Lactarius fuliginosus AV_00_124' 'Lactarius fuliginosus FA_15833' 'Lactarius fuliginosus JV_16767F' 'Lactarius fumosibrunneus GE3_Mexico' 'Lactarius fumosibrunneus LM4634_Mexico' 'Lactarius fumosus EU819483_USA' 'Lactarius fumosus KJ705224_Canada' 'Lactarius glabrigracilis KW093_type' Lactarius_glabrigracilis_KW321 Lactarius_gracilis_KW006 'Lactarius gracilis KW334_Thai' 'Lactarius haugiae LM4957_KT583640' 'Lactarius haugiae LM4988_KT583641' 'Lactarius haugiae LM4994_KT583642' 'Lactarius hirtipes KF433007_XHW1243_Bich' 'Lactarius hirtipes W1335_XHW2847_Tacheng' 'Lactarius olivaceorimosellus L033_Jiaohe' 'Lactarius olivaceorimosellus w1312_XHW25' 'Lactarius olivaceorimosellus w1316_XHW25' 'Lactarius olivaceorimosellus w1318_XHW26' 'Lactarius olivaceorimosellus w_LKS1072_K' 'Lactarius picinus DS09_616' 'Lactarius picinus JN_2001_62' 'Lactarius picinus JV_97_295' 'Lactarius picinus KVP08_077' Lactarius_picinus_fo46889 'Lactarius psammicola BPL869_USA_KY848507' 'Lactarius pterosporus DS_08_524' 'Lactarius pterosporus FR852031_Iran' Lactarius_pterosporus_LE254462 'Lactarius pterosporus LVL2002_019' 'Lactarius romagnesii BG2011_32_KF432964' Lactarius_romagnesii_JF519140 'Lactarius romagnesii RW_3272' 'Lactarius ruginosus DS_09_615' 'Lactarius ruginosus MTH76_ECM' 'Lactarius ruginosus MW_18_9_1999' 'Lactarius sp EU819487_USA_Wiscoson' 'Lactarius sp FJ196933_ECM_Mexico' 'Lactarius sp HE820611_ECM_USA' 'Lactarius sp KF386751_USA' 'Lactarius sp KX499171_Costa_Rica_ECM' 'Lactarius sp KX499199_Costa_Rica_ECM' 'Lactarius sp LE_16493_Russia_Far_EAST' 'Lactarius yazooensis EU598169_BB2004_265' 'Lactarius yazooensis FJ196936_ECM_mexico' 'Lactarius yazooensis cf_KX444302_Shanxi' 'Lactarius zonarioides EB2516_JF908300_It' 'Lactarius zonarioides w1357_XHW3595_Swed' 'Lactarius zonarioides w1364_XHW3587_swed' 'Lactarius zonarioides w1438_xhw3583_Swed' 'Lactarius zonarius JF908280_Italy' 'Lactarius zonarius UE27_09_2002_4' 'Martellia pila Russia_JN235947' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53932] TITLE Lactarius_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=715; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Lactarius_AB922926_Japan_ECM ----------------------------------------GGCTGTCGCTGACTTTT---AACAC--AAAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCAGGATTGAACCGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA---CCCCCCC-TTTT-AAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-CTTGCTGGCGTCT--CTCTCTTCT-GAAA------CCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTCCT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAACGTTTGGGCGTGTCTCCCTTCTCGGGGAAACGCTCTCAACCCC--ACGAACCCT Lactarius_Olympianus_EB_0070_18_USA_Mont TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCGACCTC--ACAAA---- Lactarius_Olympianus_ED_08_018_USA_KR364 TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACT{CT}TTT--AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCTCTCTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT Lactarius_Olympianus_HQ650733 TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCGACCTC--ACAAACCCT Lactarius_Olympianus_JN2003_032_USA ---------------GT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCGACCTC--ACAAACCCT Lactarius_accerimus_EF493285 TCGTA-CAAAA-TGTGA-GAGGTGTCGTCGC-----AA-GGGCTGTCGCTGACCTTTGATGATGC--AAAGGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGCGGGCACCCTTTGGGATCGAACCGGTCCAGGAGGGGG-CTTGCGTTCT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGTC-CCTAGTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGGAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGC---------TCTTTC-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTG-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius acerrimus JF908318_Italy' TCGTA-CAAAA-TGTGA-GAGGTGTCGTCGC-----AA-GGGCTGTCGCTGACCTTTGATGATGC--AAAGGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGCGGGCACCCTTTGGGATCGAACCGGTCCAGGAGGGGG-CTTGCGTTCT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGTC-CCTAGTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGGAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGC---------TCTTTC-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTG-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius acris AV_97_520' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGCGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAA?AACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius acris VD_08_094' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGCGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus KM069457_CHina' ----------GACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus KR082889_10044' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGTGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus L005_HMJAU42461' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus L084_HMJAU42462' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus L085_HMJAU42463' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus L086_HMJAU42464' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus XHW2445_W0167_T' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus XHW2920_W0790_H' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius albidocinereus XHW3624_w1550_G' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CAAACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius azonites DS_08_514_Belgium' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-ATCATTTTGTTTGCGTTGACACGTGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-GCTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius azonites DS_08_518_Belgium' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-ATCATTTTGTTTGCGTTGACACG{CT}GATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-GCTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius azonites LE_254459_Georgia' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-ATCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-GCTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT Lactarius_azonites_MCVE14894 TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-ATCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-GCTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCAAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGACGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius azonites SAV_F2225_Belgium' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGC{CG}TGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-ATCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-GCTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius dilutisalmoneus L003_Jiaohe' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACCTTT---AACGC--AAAGGTCGT-GCACGCC-AGG-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGGACAGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA-----CCCCC--TTTTAAAAA--GTGTAGAATGAC-CTTGTTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius dilutisalmoneus XHW2603_W1131' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACCTTT---AACGC--AAAGGTCGT-GCACGCC-AGG-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGGACAGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA-----CCCCC--TTTTAAAAA--GTGTAGAATGAC-CTTGTTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius evosmus UP536_DQ658882' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTTG--AACAC--AAAAGTCGT-GCACGTC-CGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCAAAAAGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGAACCT--TTCTCTCTT-GAAA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCTGCTTCTAACCGTCTC--AAACTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTCCTC-GGGAAACTCTCTCAACACC--ACGAACCCT 'Lactarius evosmus UP557_EF493283' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTTG--AACAC--AAAAGT{CT}GT-GCACGTC-CGA-GTGTGTC{CT}TCTCACATAA-AATCCA{CT}CTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATC{AT}AAAAGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGAACCT--TTCTCTCTT-GAAA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCTGCTTCTAACCGTCTC--AAACTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTCCTC-GGGAAACTCTCTCAACACC--ACGAACCCT 'Lactarius fuliginosus AV_00_124' TCGTAACAAAGACGTGG-GAGG---T---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------ACGCCTCGACC----ACGTACCC- 'Lactarius fuliginosus FA_15833' TCGTAACAAAGACGTGG-GAGG---T---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------ACGCCTCGACC----ACGTACCCT 'Lactarius fuliginosus JV_16767F' TCGTAACAAAGACGTGG-GAGG---{CT}---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGA{CT}--------GAGACAACGTTCGAGC---------------------A{CT}GCCTCGACC----ACGTACCCT 'Lactarius fumosibrunneus GE3_Mexico' TCGTAACAAAGACGTGG-GAGG---C---AC--TCTGA--GGCTGTCGCCGAC----------TCGAAAGGGTCGTTGCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACGC{AG}CGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTG------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTTGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----AC{AG}TACCCT 'Lactarius fumosibrunneus LM4634_Mexico' TCGTAACAAAGACGTGG-GAGG---C---AC--TCT{AG}A--GGCTGTCGCCGAC----------TCGAAAGGGTCGTTGCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACGCGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTG------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTTGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius fumosus EU819483_USA' TCGTAACAAAGACGTGG-GAGG---C---GC--TCCAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGTTGCACGCCGGGA-GGGCGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAC-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTG------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius fumosus KJ705224_Canada' TCGTAACAAAGACGTGG-GAGG---C---AC--TCTAA--GGCTGTCGCCGAC----------TCGAAAGGGTTGTTGCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACGCGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTG------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius glabrigracilis KW093_type' TCGTA-CAAAA-TGTGTAGAGG---CAT-GC-----CG-GGGTTGTCGCTGAC-----------C-AAAAAGTTGT-GCACGCC-ACA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTCTGGGATCGCACCGATCTCAGAGGGGA-CTCGCGTTTT--CACACAAAAA--CCCCCC--TTTGAAAAA--GTATAGAATGTC-CTCATTTAC-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--CTGGAGATCAAAGGAGGCTTGGACTTTGGAGGCCCTTTGCTGGCATCG--CTCTCCTTT-GAAAGGTG--GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTTGACATGTGATAAGATGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCCAATCGTCTC--AACA-----TCGAGACAATGTTCGAGCCTGTTGCCCTTCTC-GGGAAACGCTCTCGACCCC--ACGAACCCT Lactarius_glabrigracilis_KW321 TCGTA-CAAAA-TGTGTAGAGG---CAT-GC-----CG-GGGTTGTCGCTGAC-----------C-AAAAAGTTGT-GCACGCC-ACA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTCTGGGATCGCACCGATCTCAGAGGGGA-CTCGCGTTTT--CACACAAAAA--CCCCCC--TTTGAAAAA--GTATAGAATGTC-CTCATTTAC-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--CTGGAGATCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCG--CTCTCCTTT-GAAAGGTG--GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTTGACATGTGATAAGATGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCCAATCGTCTC--AACA-----TCGAGACAATGTTCGAGCCTGTTGCCCTTCTC-GGGAAACGCTCTCGACCCC--ACGAACCCT Lactarius_gracilis_KW006 TCGTA-CAAAA-TGTGTAGAGG---CAT-GC-----CG-GGGTTGTCGCCGAC-----------C-GAAATGTTGT-GCACGCC-ACA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTCTGGGATCGCACCGACCTCAGAGGGGA-CTCGCGTTTT--CACACAAAA--CCCCCCC--TTTGAAAAA--GTATAGAATGTA-CTCATTTAC-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--CTGGAGATCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--CTCTCCTTT-GAAAGGTG--GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTTGACATGTGATAAGATGTTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCCAACCGTCTC--AACA-----TCGAGACAATGTTCGAGCCTGTTGCCCTTCTC-GGGAAACGCTCTCGACCCCCCACGAACCCT 'Lactarius gracilis KW334_Thai' TCGTA-CAAAA-TGTGTAGAGG---CAT-GC-----CG-GGGTTGTCGCCGAC-----------C-GAAATGTTGT-GCACGCC-ACA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTCTGGGATCGCACCGACCTCAGAGGGGA-CTCGCGTTTT--CACACAAAA--CCCCCCC--TTTGAAAAA--GTATAGAATGTA-CTCATTTAC-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--CTGGAGATCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--CTCTCCTTT-GAAAGGTG--GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTTGACATGTGATAAGATGTTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCCAACCGTCTC--AACA-----TCGAGACAATGTTCGAGCCTGTTGCCCTTCTC-GGGAAACGCTCTCGACCCCCCACGAACCCT 'Lactarius haugiae LM4957_KT583640' ------------TGTGT-GAGG---CAC-GC-----AA-GGGCTGTCGCTGACTTTT---AACGC--AAAAGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCGAACCGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCCTTATTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACTGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCTCTCTCTCTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGTTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACTGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius haugiae LM4988_KT583641' TCGTA-CAAAA-TGTGT-GAGG---CAC-GC-----AA-GGGCTGTCGCTGACTTTT---AACGC--AAAAGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCGAACCGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCCTTATTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACTGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCTCTCTCTCTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACTGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius haugiae LM4994_KT583642' ------------TGTGT-GAGG---CAC-GC-----AG-GAGCTGTCGCTGACTTTT---AACGC--AAAAGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCGAACCGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCCTTATTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACTGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCTCTCTCTCTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACTGTCTC--AACCTTGCATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius hirtipes KF433007_XHW1243_Bich' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----TC-GGGCTGTCGCTGAC----------TC---AAAGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTCGCGTTTT--CACACAATAAA--ACCCC--TTTGAAAAA--GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTTTT--CTGAAGACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTG----------CTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACATGTGATAAGATGTTTCCGTGTCTTGGTTTCCGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--{AG}ACCTTGCGTCGAGACAATGTTCGAGCCTGTCTCCCTTCTC-GGGAAACGCTCTCGACCCC--ACGAACCCT 'Lactarius hirtipes W1335_XHW2847_Tacheng' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----TC-GGGCTGTCGCTGAC----------TC---AAAGTCGT-GCACGCC-GGA-GTGTGTCCTCTCACATAACAATCCATCTCACCC--TTTGTGCACCACCGCGTGGGCACCCTTTGGGATCACACCGATCTCAGAG{CG}GGG-CTCGCGTTTT--CACACAATAAA--ACCCC--TTTGAAAAA--GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTTTT--CTGAAGACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTG----------CTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACATGTGATAAGATGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--{AG}ACCTTGCGTCGAGACAATGTTCGAGCCTGTCTCCCTTCTC-GGGAAAC{CG}CTCTCGACCCC--ACGAACCCT 'Lactarius olivaceorimosellus L033_Jiaohe' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----GA-GGGCTGTTGCTGAC----------TC---AAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAACCATCCATCTCACCC--TTTGTGCACCACCGCGTGGGTACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTTGCGTTTT--CACAAAAAAAA-CCCCCC--TTTGAAAA---GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAG{CT}GTCGTGAAAATATCAACCTCCTTGGTTTCTT--CTGGAG{AG}CCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--TTCTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCAGGGTCCTCTTTGCCAACCCTTGACATGTGATAATACGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTCT-GGGACCTGCTTCCAACCGTCTC--AACCTTGCATCGAGACAATGTTCGGGCACGTCTCCCTTCTT-GGGAAACCCCCTCGACCCC--ACGAACCCT 'Lactarius olivaceorimosellus w1312_XHW25' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----GA-GGGCTGTTGCTGAC----------TC---AAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAACCATCCATCTCACCC--TTTGTGCACCACCGCGTGGGTACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTTGCGTTTT--CACAAAAAAA--CCCCCC--TTTGAAAA---GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATATCAACCTCCTTGGTTTCTT--CTGGAGACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--TTCTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCAGGGTCCTCTTTGCCAACCCTTGACATGTGATAATACGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTCT-GGGACCTGCTTCCAACCGTCTC--AACCTTGCATCGAGACAATGTTCGGGCACGTCTCCCTTCTT-GGGAAACCCCCTCGACCCC--ACGAACCCT 'Lactarius olivaceorimosellus w1316_XHW25' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----GA-GGGCTGTTGCTGAC----------TC---AAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAACCATCCATCTCACCC--TTTGTGCACCACCGCGTGGGTACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTTGCGTTTT--CACAAAAAAA--CCCCCC--TTTGAAAA---GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATATCAACCTCCTTGGTTTCTT--CTGGAGACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--TTCTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCAGGGTCCTCTTTGCCAACCCTTGACATGTGATAATACGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTCT-GGGACCTGCTTCCAACCGTCTC--AACCTTGCATCGAGACAATGTTCGGGCACGTCTCCCTTCTT-GGGAAACCCCCTCGACCCC--ACGAACCCT 'Lactarius olivaceorimosellus w1318_XHW26' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----GA-GGGCTGTTGCTGAC----------TC---AAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAACCATCCATCTCACCC--TTTGTGCACCACCGCGTGGGTACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTTGCGTTTT--CACAAAAAAAA-CCCCCC--TTTGAAAA---GTGTAGAATGTC-CTCATTTAT-------------GC{AG}ATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATATCAACCTCCTTGGTTTCTT--CTGGAGACCAAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCT--TTCTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCAGGGTCCTCTTTGCCAACCCTTGACATGTGATAATACGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTCT-GGGACCTGCTTCCAACCGTCTC--AACCTTGCATCGAGACAATGTTCGGGCACGTCTCCCTTCTT-GGGAAACCCCCTCGACCCC--ACGAACCCT 'Lactarius olivaceorimosellus w_LKS1072_K' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----GA-GGGCTGTTGCTGAC----------TC---AAAGTCGT-GCACGCC-AGA-GTGTGTCCTCTCACATAACCATCCATCTCACCC--TTTGTGCACCACCGCGTGGGTACCCTTTGGGATCACACCGATCTCAGAGGGGG-CTTGCGTTTT--CACAAAAAAAA-CCCCCC--TTTGAAAA---GTGTAGAATGTC-CTCATTTAT-------------GCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATATCAACCTCCTTGGTTTCTT--CTGGAGACCAAAGGAGGATTGGACTTTGGAGGCC-TTTGCTGGCATCT--TTCTCTTTT-GAAG------GCCAGCTCCTCTTGAATGAATTAGCAGGGTCCTCTTTGCCAACCCTTGACATGTGATAATACGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCTTCT-GGGACCTGCTTCCAACCGTCTC--AACCTTGCATCGAGACAATGTTCGGGCACGTCTCCCTTCTT-GGGAAACCTCCTCGACCC------------ 'Lactarius picinus DS09_616' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGGA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT 'Lactarius picinus JN_2001_62' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT 'Lactarius picinus JV_97_295' TCGTAACAAAGACGTGG-GAGG---{CT}---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------ACGCCTCGACC----ACGTACCCT 'Lactarius picinus KVP08_077' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCACCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT Lactarius_picinus_fo46889 TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCTGGAA--GGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TCCCTCCTCGAGGGGG-CTCGCGTTTTT-CATACAAA------CCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTTGGTTTCTT--TTGAACGCC-AAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT 'Lactarius psammicola BPL869_USA_KY848507' TCGTA-CAAAA-TGTGT-GAGG---CAC-GC-----AA-GGGCTGTCGCTGACTTTT---AACGC--AAAAGTCGT-GCACGC{CT}-GGA-GTGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCAAACCGATCCAGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCCTTATTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACATGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACTGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCATCTCTCTCTCTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACTGTCTC--AACCTTGCATCGAGACAACGTTTGAG{AG}GCGTCTCCCTTCTC-GGGAAACCCTCTCAACCTC--ACGAACCCT 'Lactarius pterosporus DS_08_524' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius pterosporus FR852031_Iran' TCGTAACAA-GACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT Lactarius_pterosporus_LE254462 TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius pterosporus LVL2002_019' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CACACAAA-----CCCCC--TTGTAAAT-GTCTGTTGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT-TTTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCACCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTGGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius romagnesii BG2011_32_KF432964' TCGTAACAAAGACGTGG-GAGG---T---GC--TCGAA--GGCTGTCGCCGGC----------TCGAAAGGGTCGT-GCACGCCGGAA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CATACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CCCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTT--TTGAATGCCGAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTTAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------GTGCCTCGACC----ACGTACCCT Lactarius_romagnesii_JF519140 TCGTAACAAAGACGTGG-GAGG---T---GC--TCGAA--GGCTGTCGCCGGC----------TCGAAAGGGTCGT-GCACGCCGGAA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CATACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CCCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTT--TTGAATGCCGAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTTAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------GTGCCTCGACC----ACGTACCCT 'Lactarius romagnesii RW_3272' TCGTAACAAAGACGTGG-GAGG---T---GC--TCGAA--GGCTGTCGCCGGC----------TCGAAAGGGTCGT-GCACGCCGGAA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-CATACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CCCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTT--TTGAATGCCGAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTTAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAACGTTCGAGC---------------------GCGCCTCGACC----ACGTACCCT 'Lactarius ruginosus DS_09_615' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTTTTACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGACACTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCC- 'Lactarius ruginosus MTH76_ECM' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-TACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTCCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGACACTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GA?ACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius ruginosus MW_18_9_1999' TCGTAACAAAGACGTGG-GAGG---C---GC--TTGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGTTTTT-TACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAA?AACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGACACTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius sp EU819487_USA_Wiscoson' TCGTAACAAAGACGTGG-GAGG---C---GC--TCAAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGCA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCACGTTTTT-CACACAAA-----CCCCC-TTTGTAAAC-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTTTTTTGGACTCCGAAGAAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTC------------AAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCTAC--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT 'Lactarius sp FJ196933_ECM_Mexico' TCGTAACAAAGACGTGG-GAGG---G---GCGTTCCAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGTTGCACGCCGGAA-GGGCGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAC-GTCTGTAGAATGTA-CTCATCTTGTTTGCGTTGACGCGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTG------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATTGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TCGCCTCGACC----ACGTACCCT 'Lactarius sp HE820611_ECM_USA' TCGTA?CA?AGACGTGG-GAGG---C---GC--TCAAA--GGCTGTCGCCGAC----------TCGAAAGGGTCGT-GCACGCCGGCA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCACCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCACGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTTTTTTGGACTCCGAAGAAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTC------------AAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTCCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCTAC--------GAGACAACGTTCGAGC---------------------ATGCCTCGACC----ACGTACCCT 'Lactarius sp KF386751_USA' -------------------AGG---C---GC--TCGAA--GGCTGTCGCAGAC----------TCGAAAGGGTCGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGAGG-CTCGCGTTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTCGGTTTCTT--TTGGATCCCGAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius sp KX499171_Costa_Rica_ECM' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCGGAC----------TCGAAAGGGTCGT-GCACGCCGGCA-GGGTGTCCTCTTGCGTGA-AATCCATCTCA-CCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCAC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTCGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGCCGTGAAAATCTCAACCTCCCTGGTTTCTT--CTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCAAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTTGGTCTTTGGCTCTGTCGCCTCTTGGGACCTGCTTCCAATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius sp KX499199_Costa_Rica_ECM' TCGTAACAAAGACGTGG-GAGG---C---GC--TCGAA--GGCTGTCGCGGAC----------TCGAAAGGGTCGT-GCACGCCGGCA-GGGTGTCCTCTTGCGTGA-AATCCATCTCA-CCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGGGG-CTCGCGTTTTT-CACACAAA-----CCCAC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTCGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTCGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCCTGGTTTCTT--CTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCC{AG}CGTCTTGGTCTTTGGCTCTGTCGCCTCTTGGGACC{CT}GC{CT}{CT}CC{AT}ATCGTCTCTCGAT--------GAGACAACGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius sp LE_16493_Russia_Far_EAST' TCGTAACAAAGACGTGG-GAGG---T---GC--TCGAA--GGCTGTCGCCAAC----------TCGAAAGGGTTGT-GCACGCCGGGA-GGGTGTCCTCTTGCGTGA-AATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGC----------------TTCCTCCTCGAGGCGG-CTCGCGCTTTT-CACACAAA-----CCCCC-TTTGTAAAT-GTCTGTAGAATGTC-CTCATTTTGTTTGCGTTGACACGCGATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTT--TTGGATGCCAAAGGAGGCTTGGACTTTGGAGGGC-TTTGCTGG-ACTT------------GAAAG-----GTCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCATGTCTTGGTCTTTGGCTCTGTCACCTCTTGGGACCTGCTTCCAATTGTCTCTCGAC--------GAGACAATGTTCGAGC---------------------TTGCCTCGACC----ACGTACCCT 'Lactarius yazooensis EU598169_BB2004_265' TCGTA-CAAAA-TGTGT-GAGG---CAT-GT-----GAGGGGCTGTCGCTGACTTTT---AACAC--AAAAGTCGT-GCACGCC-TGA-GCATGTCCTCCCGCATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATTGAACCGATCCGGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCCCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGTGTCT----CTCTTTT-GAAA------CCCAGCTCCTCT?AAATGAATTAGCGGGGTCCTCATTGCCGATCCTTGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCCTTT-GGGACCTGCTTCTAACCGTCTC--AACCTCACATCGAGACAACGTTTGAGTGCGTCTCCCTTCTC-GGGAAACTCTCTCAACCCC--ACGAACCCT 'Lactarius yazooensis FJ196936_ECM_mexico' TCGTA-CAAAA-TGTGT-GAGG---CAT-GT-----GAGGGGCTGTCGCTGACTTTT---AACAC--AAAAGTTGT-GCACGCC-TGA-GCATGTCCTCCCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATTGAACCGATCCGGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCCCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGTGTCT----CTCTTTT-GAAA------CCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCATTGCCGATCCTTGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCCTTT-GGGACCTGCTTCTAACCGTCTC--AACCTCACATCGAGACAACGTTTGAGCGTGTCTCCCTTTTC-GGGAAACTCTCTCAACCCC--ACGAACCCT 'Lactarius yazooensis cf_KX444302_Shanxi' ------------------------------------GAGGGGCTGTCGCTGACTTTT---AACAC--AAAAGTCGT-GCACGCC-TGA-GCGTGTCCTCCCGCATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATTGAACCGATCCGGGAGGGGGGCTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGACCCTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCCCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGTGTCT----CTCTTTT-GAAA------CCCAGCTCCTCTTAAATGAATTAGCGGGGACCTCATTGCCGATCCTTGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCCTTT-GGGACCTGCTTCTAACCGTCTC--AACCTCACATCGAGACAACGTTTGAGCGTGTCTCCCTTCTC-GGGAAACTCTCTCAACCCC--ACGAACCCT 'Lactarius zonarioides EB2516_JF908300_It' ----------------------------------------------------CTTTT---AACAC--AAAGGTCGT-GCACGCC-AGAAGCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius zonarioides w1357_XHW3595_Swed' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius zonarioides w1364_XHW3587_swed' --------------TGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACT{AC}TT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius zonarioides w1438_xhw3583_Swed' TCGTA-CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCGCTGACTTTT---AACAC--AAAGGTCGT-GCACGCC-AGA-GCGTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGAACCGATCCAGGAGGGGG-CTCGCGTTTT--CACACAAA----CCCCCC--TTTTAAAA---GTGTAGAATGAC-CTCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTT-GAGA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACCGTCTC--AACCTTGCATCGAGACAATGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC--ACGAACCCT 'Lactarius zonarius JF908280_Italy' TCGTA-CAAAA-TGCGT-GAGG---CAT-GC-----AAGGGGCTGTCGCTGACTTTT---AACAC--AAAAGTTGT-GCACGCC-CGA-GCTTGTCCTCTCGCATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCAAACCGATCCGGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGTGTCT--CTCTCTTTT-GAAA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCATTGCCGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCCCTT-GGGACCCGCTTCTAACCGTCTC--AGCATCGCATTGAGACAACGTTTGGGCGTGTCTCCCTTCTC-GGGAAACTCTCTCAACCC---ACGAACCCT 'Lactarius zonarius UE27_09_2002_4' TCGTA-CAAAA-TGCGT-GAGG---CAT-GC-----AAGGGGCTGTCGCTGACTTTT---AACAC--AAAAGTTGT-GCACGCC-CGA-GCTTGTCCTCTCGCATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCAAACCGATCCGGGAGGGGG-CTTGCGTTTT--CACACAAA------CCCC-TTTTTAAAA---GTGTAGAATGAC-CCCATTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGTGTCT--CTCTCTTTT-GAAA------GCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCATTGCCGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCCCTT-GGGACCCGCTTCTAACCGTCTC--AGCATCGCATTGAGACAACGTTTGGGCGTGTCTCCCTTCTC-GGGAAA-TCTCTCAACCCC--ACGAACCCT 'Martellia pila Russia_JN235947' T?GT--CAAAA-TGTGT-GAGG---CAT-GC-----AA-GGGCTGTCG{CT}TGACCTTT---AACAC--AAAG-CCGT-CCACCCC-GGG-G?GTGTCCTCTCACATAA-AATCCATCTCACCC-TTTTGTGCACCACCGCGTGGGCCCCCTTCGGGATCGAACCG{AG}TCCAGGAGGGGG-CTCGCGTTTT--CACACAAA-----CCCCC--TTTTAAAA---GTGTAGAATGAC-CTTGTTTTT---GCGATAACACGCAATCAA-TACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTT--CTGGACACCGAAGGAGGCTTGGACTTTGGAGGCC-TTTGCTGGCGTCT--CTCTTTTTTTGAGAGAGAGAGCCAGCTCCTCTTAAACGAATTAGCGGGGTCCTCTTTGCTGATCCTCGACATGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTTGCTTTT-GGGACCCGCTTCTAACTGTCTC--AACTTCGCATCGAGAAGACGTTTGAGCGTGTCTCCCTTCTC-GGGGAACACTCTCAACCTC----------- ; END; BEGIN TREES; TITLE Lactarius_ITS; LINK TAXA = Taxa1; TRANSLATE 1 Lactarius_accerimus_EF493285, 2 'Lactarius acerrimus JF908318_Italy', 3 'Lactarius evosmus UP536_DQ658882', 4 'Lactarius evosmus UP557_EF493283', 5 Lactarius_AB922926_Japan_ECM, 6 'Lactarius psammicola BPL869_USA_KY848507', 7 'Lactarius haugiae LM4957_KT583640', 8 'Lactarius haugiae LM4988_KT583641', 9 'Lactarius haugiae LM4994_KT583642', 10 'Lactarius yazooensis cf_KX444302_Shanxi', 11 'Lactarius yazooensis FJ196936_ECM_mexico', 12 'Lactarius yazooensis EU598169_BB2004_265', 13 'Lactarius zonarius UE27_09_2002_4', 14 'Lactarius zonarius JF908280_Italy', 15 Lactarius_Olympianus_HQ650733, 16 Lactarius_Olympianus_JN2003_032_USA, 17 Lactarius_Olympianus_EB_0070_18_USA_Mont, 18 Lactarius_Olympianus_ED_08_018_USA_KR364, 19 'Lactarius zonarioides w1438_xhw3583_Swed', 20 'Lactarius zonarioides w1364_XHW3587_swed', 21 'Lactarius zonarioides w1357_XHW3595_Swed', 22 'Lactarius zonarioides EB2516_JF908300_It', 23 'Martellia pila Russia_JN235947', 24 'Lactarius dilutisalmoneus XHW2603_W1131', 25 'Lactarius dilutisalmoneus L003_Jiaohe', 26 'Lactarius gracilis KW334_Thai', 27 Lactarius_gracilis_KW006, 28 'Lactarius glabrigracilis KW093_type', 29 Lactarius_glabrigracilis_KW321, 30 'Lactarius hirtipes KF433007_XHW1243_Bich', 31 'Lactarius hirtipes W1335_XHW2847_Tacheng', 32 'Lactarius olivaceorimosellus w_LKS1072_K', 33 'Lactarius olivaceorimosellus w1312_XHW25', 34 'Lactarius olivaceorimosellus L033_Jiaohe', 35 'Lactarius olivaceorimosellus w1318_XHW26', 36 'Lactarius olivaceorimosellus w1316_XHW25', 37 'Lactarius picinus JN_2001_62', 38 'Lactarius picinus DS09_616', 39 Lactarius_picinus_fo46889, 40 'Lactarius picinus KVP08_077', 41 'Lactarius picinus JV_97_295', 42 'Lactarius fuliginosus JV_16767F', 43 'Lactarius fuliginosus AV_00_124', 44 'Lactarius fuliginosus FA_15833', 45 'Lactarius romagnesii RW_3272', 46 'Lactarius romagnesii BG2011_32_KF432964', 47 Lactarius_romagnesii_JF519140, 48 'Lactarius azonites DS_08_514_Belgium', 49 'Lactarius azonites SAV_F2225_Belgium', 50 'Lactarius azonites LE_254459_Georgia', 51 Lactarius_azonites_MCVE14894, 52 'Lactarius azonites DS_08_518_Belgium', 53 'Lactarius ruginosus DS_09_615', 54 'Lactarius ruginosus MW_18_9_1999', 55 'Lactarius ruginosus MTH76_ECM', 56 'Lactarius pterosporus DS_08_524', 57 'Lactarius pterosporus FR852031_Iran', 58 Lactarius_pterosporus_LE254462, 59 'Lactarius pterosporus LVL2002_019', 60 'Lactarius acris VD_08_094', 61 'Lactarius acris AV_97_520', 62 'Lactarius albidocinereus KM069457_CHina', 63 'Lactarius albidocinereus XHW2445_W0167_T', 64 'Lactarius albidocinereus L005_HMJAU42461', 65 'Lactarius albidocinereus L084_HMJAU42462', 66 'Lactarius albidocinereus L085_HMJAU42463', 67 'Lactarius albidocinereus L086_HMJAU42464', 68 'Lactarius albidocinereus XHW2920_W0790_H', 69 'Lactarius albidocinereus XHW3624_w1550_G', 70 'Lactarius albidocinereus KR082889_10044', 71 'Lactarius sp LE_16493_Russia_Far_EAST', 72 'Lactarius sp KX499171_Costa_Rica_ECM', 73 'Lactarius sp KX499199_Costa_Rica_ECM', 74 'Lactarius sp KF386751_USA', 75 'Lactarius sp HE820611_ECM_USA', 76 'Lactarius sp EU819487_USA_Wiscoson', 77 'Lactarius fumosus EU819483_USA', 78 'Lactarius fumosus KJ705224_Canada', 79 'Lactarius fumosibrunneus LM4634_Mexico', 80 'Lactarius fumosibrunneus GE3_Mexico', 81 'Lactarius sp FJ196933_ECM_Mexico'; TREE con_50_majrule = [&R] ((((32:0.04918209,33:0.01101987,34:0.01076768,35:0.01111569,36:0.0115722):0.4432385,((30:0.0300706,31:0.01189266):0.1752113,((26:0.01051471,27:0.01219418):0.1272045,(28:0.01129309,29:0.01094477):0.04514667):0.3479421):0.07471054):0.3016061,(5:0.1859384,(3:0.01070046,4:0.01066399):0.3382145,((13:0.02757743,14:0.0113661):0.2112373,(10:0.03368412,(11:0.06112556,12:0.04529703):0.02907863):0.2007995):0.2049337,((1:0.01117782,2:0.01103117):0.2995473,(6:0.07482341,7:0.0280843,8:0.01071203,9:0.04488462):0.09230805):0.09408596,((23:0.2298718,(24:0.01088563,25:0.01159727):0.1045437):0.09176374,(18:0.01162839,19:0.01115675,20:0.02540008,21:0.01097593,22:0.01141076,(15:0.01124703,16:0.011525,17:0.02879807):0.04406364):0.045627):0.1683805):0.1929845):0.633036,(((75:0.0138462,76:0.03097367):0.1954849,((45:0.03087815,46:0.01264233,47:0.01235708):0.150123,(37:0.01328269,38:0.03128735,39:0.01193979,40:0.03219759,42:0.01255386,(41:0.01258855,43:0.01169248,44:0.01126835):0.04066749):0.1243472):0.09014706):0.04647471,(74:0.09680679,(((77:0.04153523,81:0.1465277):0.06056175,(78:0.03053464,(79:0.01242298,80:0.01797299):0.04331453):0.05207686):0.1352331,((72:0.05145362,73:0.03032793):0.1687074,((62:0.01285811,63:0.01295354,64:0.01271746,65:0.01225087,66:0.01178939,67:0.01225503,68:0.01116862,69:0.01167057,70:0.0305355):0.03685532,(56:0.01275298,57:0.01343199,58:0.01191628,59:0.05114623,(53:0.01193329,54:0.01200598,55:0.05189185):0.08671215,(71:0.1766209,(60:0.01181577,61:0.01220265):0.03512913):0.04280583,(48:0.02876027,49:0.02996998,50:0.01123723,51:0.05082749,52:0.01214954):0.08133467):0.05247456):0.07820323):0.03756224):0.04894301):0.07598763):0.633036); END;