#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:18 GMT TreeBASE (cc) 1994-2008 Study reference: Siahaan S., Sakamoto H., Shinoda T., & Takamatsu S. 2018. Morphophylogenetic study revealed that Erysiphe gracilis (powdery mildew of evergreen oaks, Erysiphales) is a species complex consisting of six true species. Mycoscience, 59(2): 124-136. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21130] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=62; TAXLABELS Erysiphe_gracilis_Genotype_I_MUMH2027_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH4158_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH4962_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5728_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH4552_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH4586_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH4963_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5723_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5730_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5817_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_II_MUMH6176_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_II_MUMH6185_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca Erysiphe_gracilis_Genotype_III_MUMH6249_ex_Q._glauca Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_TUAMH2712_ex_Q._salicina Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6568_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6570_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6572_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6597_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6600_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6711_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6712_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6714_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6717_ex_Q._sessilifolia Erysiphe_gracilis_Genotype_V_MUMH6718_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6569_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6576_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6587_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6596_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6598_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6719_ex_Q._acuta Erysiphe_japonica_ex_Q._serrata_AB701310 rysiphe_japonica_ex_Q._crispula_AB701312 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=37; TAXLABELS Erysiphe_gracilis_Genotype_I_MUMH122_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5356_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5487_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_II_MUMU6176_ex_Q._myrsinaefolia Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta Erysiphe_japonica_ex_Q._crispula_MUMH4163 Erysiphe_japonica_ex_Q._cuspidata_MUMHs76 Erysiphe_japonica_ex_Q._serrata_MUMH4582 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=56; TAXLABELS Erysiphe_aphananthes_ex_Aphananthe_MUMH4648 Erysiphe_aquilegiae_ex_Ranunculus_japonicus_MUMH287_JPN Erysiphe_arcuata_ex_Carpinus_MUMH2589 Erysiphe_asiatica_ex_Castanopsis_MUMH4989 Erysiphe_australiana_ex_Lagerstroemia_DNA8 Erysiphe_berchemiae_ex_Berchemia_racemosa_MUMH252_JPN Erysiphe_betulina_ex_Betula_MUMH4640 Erysiphe_bivonae_ex_Ulmus_MUMH21 Erysiphe_buhrii_ex_Gypsophila_paniculata_MUMH787_JPN Erysiphe_carpini_laxiflorae_ex_Carpinus_MUMH3640 Erysiphe_carpinicola_ex_Carpinus_MUMH51 Erysiphe_epigena_ex_Quercus_variabilis_AB292720_JPN Erysiphe_frickii_ex_Geum_BCRU01613 Erysiphe_glycines_ex_Desmodium_MUMH52 Erysiphe_gracilis_ex_Q._acuta_MUMH6542 Erysiphe_gracilis_ex_Q._acuta_MUMH6543L Erysiphe_gracilis_ex_Q._acuta_MUMH6545C Erysiphe_gracilis_ex_Q._glauca_MUMH5540 Erysiphe_gracilis_ex_Q._glauca_MUMH5725 Erysiphe_gracilis_ex_Q._glauca_MUMH5726 Erysiphe_gracilis_ex_Q._glauca_MUMH5727 Erysiphe_gracilis_ex_Q._glauca_MUMH5731 Erysiphe_gracilis_ex_Q._glauca_MUMH5839 Erysiphe_gracilis_ex_Q._glauca_MUMH5868 Erysiphe_gracilis_ex_Q._salicina_MUMH5804 Erysiphe_gracilis_ex_Q._x_takaoyamensis_MUMH6537U Erysiphe_havrylenkoana_ex_Nothofagus_MUMH1471 Erysiphe_japonica_var._crispulae_ex_Quercus_MUMH4163 Erysiphe_japonica_var._japonica_ex_Quercus_MUMH4159 Erysiphe_javanica_ex_Castanopsis_MUMH5147 Erysiphe_kasanoi_ex_Celtis_MUMH20 Erysiphe_kenjiana_ex_Ulmus_MUMH4879 Erysiphe_limonii_ex_Limonium_platyphyllum_MUMH2568_UKR Erysiphe_liquidambaris_ex_Liquidambar_MUMH4650 Erysiphe_ljubarskii_ex_Acer_MUMH404 Erysiphe_magellanica_ex_Nothofagus_MUMH2496 Erysiphe_mayorii_ex_Cirsium_MUMH3952 Erysiphe_michikoae_ex_Celtis_MUMH5055 Erysiphe_miyabei_ex_Alnus_MUMH48 Erysiphe_monoperidiata_ex_Castanopsis_MUMH4990 Erysiphe_mori_ex_Morus_MUMH128 Erysiphe_necator_ex_Vitis_MUMH530 Erysiphe_nishidana_ex_Firmiana_MUMH235 Erysiphe_nomurae_ex_Symplocos_chinensis_AB331648_JPN Erysiphe_nothofagi_ex_Nothofagus_MUMH1475 Erysiphe_oleosa_ex_Tilia_YNMH12972 Erysiphe_paracarpinicola_ex_Carpinus_MUMH207 Erysiphe_patagoniaca_ex_Nothofagus_MUMH2511 Erysiphe_prunastri_var._japonica_ex_Prunus_MUMH3575 Erysiphe_pulchra_ex_Swida_controversa_AB000941_JPN Erysiphe_sengokui_ex_Celastrus_MUMH205 Erysiphe_simulans_ex_Rosa_TPU439 Erysiphe_trinae_ex_Quercus_MUMH113 Erysiphe_ulmariae_ex_Filipendula_MUMH2562 Erysiphe_verniciferae_ex_Rhus_MUMH578 Erysiphe_zelkowae_ex_Zelkova_MUMH403 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41486] TITLE 'Erysiphe gracilis Fig. 2 ITS+28S 37 taxa'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1369; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_gracilis_Genotype_I_MUMH122_ex_Q._glauca CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca ------GTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCT?AAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca ------GTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca ------GTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5356_ex_Q._glauca -------TGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5487_ex_Q._glauca ------GTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca ------G?GAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCG?CGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca -------------------------------GCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca ----------------------TAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGCCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AACCCCCATCA--------------CTCCTTGATT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAGCCATGGCA-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGATT---TTCAATCAAAATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca --------GAGGTT-AGC--CATGGCAG-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACCAGCCAA---------------------AACCCCCACCA--------------CTCGTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca ---------------AGC--CATGGCAG-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGT?TAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACCAGCCAA---------------------AACCCCCACCA--------------CTCGTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca ---------------------------G-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTTTGTGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACCAGCCAA---------------------AACCCCCACCA--------------CTCGTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia CAGAGCGTGAGGTTCAGC--CATGGCAG-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GGTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia CAGAGCGTGAGGTTCAGC--CATGGCAG-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GGTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_II_MUMU6176_ex_Q._myrsinaefolia CAGAGCGTGAGGTTCAGC--CATGGCAG-TTGCTGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GGTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---TCATGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGTAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATCGCTCGCGACAGAGCGGCGATGGTGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca --------------------------AG-TTGCCGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGATGGCGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AACAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca CAGAGCGTGAGGTTCAGC--CATGGCAG-TTGCCGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGATGGCGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AACAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca CAGAGCGTGAGGTTCAGC--CATGGCAG-TTGCCGTGTGCCGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GTTGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCAAGCT-ACCA-TTT--TGTGTGGCTACGGCGTTGGGGCTCGCCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGATGGCGACTAGCCAA---------------------AACCCCCACCA--------------CTCCTTGACT---TTCAGTC--AACAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGGCCCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina CAGAGCGTGAGGTCCAGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CGTGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCC-ACCA-TTT--GGTGTGGCTGCGGCGTTGGGGCTCGCCGAATC-CGGCGG{CG}CCTTAAAGGTAGTGGCGGTGTCGACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--ACCATCA--------------GTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGAGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGT--------- Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta CAGAGCGTGAGGTCCAGC--TATAGCAG-TTGCTGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCGT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGAT-TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-TCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATACCTCGCGACAGAGCGGCGACGGCGACTAGCCAA---------------------AA--CCTACTA--------------CTTCTTGACT---TTCAAGC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTGCCTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis CAGAGCGTGAGATCTGGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCGCATAGTCGCGTTTCGTGCG-TGAG-TATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCTT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCATTTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGACGACGGCGGCTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTAGGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTCCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta CAGAGCGTGAGATCTGGC--CATAGCAG-TTGCCGTGTGCTGGA--TCGACCCTCCACCCGTGTCGACTTATATTTTTGTTGCTTTGGCGGGCCGGGCT--CGCGCATAGTCGCGTTTCGTGCG-TGAG-TATGGCG-T--GCTGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCTT--ACATCCAAACTCATGTTGT---CCTTGTAGTCTAAG-GCAAGA--TTTAAGAATTGAT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCATTTT--TGTGTGGCTGCGGTGTTGGGGCTCACCGAATC-CGGTGGCCCTTAAAGGCAGTGGCGGTGCCAACGTCAGCTTTACGCGTAGTAA---ATAGCTCGCGACAGAGCGACGACGGCGGCTAGCCAA---------------------AA-CCCCATCA--------------CTCCTTGACT---TTCAATC--AATAGGTTGACCTCGAATCAGGTA-GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGATCGGAGGAACGTAGCTCCCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTCCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_japonica_ex_Q._crispula_MUMH4163 CAGAGCGAGAGGTCCAGC--CATGGCAG-TTGTCGTGCGCTGGATCTCGACCCTCCACCCGTGTCGACTTGTATTTTTGTTGCTTTGGCGGGCCGGGCCGGCGCCCATGGTCGCGTTTCGTACGATGAG-CATGGCG-TGAGCGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTTTAACACCCAAACTCATGTTGT-CCCCCTGTTGTCTAAG-?CAAAGA-TTTAAGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCTAACCATTTT--GGTGTGGCTGCGGTATTGGGGCTCGCTGAATCTCGGCGGCCCTTAAAGGCAGTGGCGGGGCTAACGTCGGCTCTACGCGTAGTAATAGATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAAAGAAGAAGAAG----------AAGAAAAAACA--------------CTTCTTGACT---TTAGATC--AATAGGTTGACCTCGAATCAGGTA-GGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCATCCAGAG--TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_japonica_ex_Q._cuspidata_MUMHs76 CAGAGCGAGAGGTCCAGC--CATGGCAG-TTGTCGTGCGCTGGATCTCGACCCTCCACCCGTGTCGACTTGTATTTTTGTTGCTTTGGCGGGCCGGGCCGGCGCCCATGATCGCGTTTCGTACGATGAG-CATGGCG-TGAGCGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTTTAACACCCAAACTCATGTTGTCCCCCCTGTTGTCTAAG-GCAAAGA-TTTAAGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCCTCGAGCT-ACCATTTT--TGTGTGGCTACGGTATTGGGGCTCGCTGAATCTCGGCGGCCCTTAAAGGCAGTGGCGGGGCTAACGTCGGCTCTACGCGTAGTAATAGATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAAAAGAAAAAAAAAGAAGAAG--AAAAAAAAACA--------------CTTCTTGACT---TTAGATC--AATAGGTTGACCTCGAATCAGGTA-GGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCATCCAGAG--TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT Erysiphe_japonica_ex_Q._serrata_MUMH4582 CAGAGCGAGAGGTCCGGC--CATGGCAG-TTGTCATGCGCTGGA--TCGACCCTCCACCCGTGTCGACTTGTATTTTTGTTGCTTTGGCGGGCCGGGCTAGCGCCCATGGTCGCGTTTCGTGCG-TGAG-CATGGCG-TGAGCGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTTTAACACCCAAACTCATATTGT-CCCCCTGTTGTCTAAG-GCAAAAGATTTAAGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC-CCCCCTCGAGCT-ACCA-TTT--TGTGTGGCTTCGGTATTGGGGCTCGCTGAATCTCGGCGGCCCTTAAAGGCAGTGGCGGGGCTAACGTCGGCTCTACGCGTAGTAATAAATAGCTCGCGACAGAGCGGCGACAGCGACTAGCCAAAAAAGAAGAAGAGAGAAACAAAAACAAAAACAAAAACAAAAACACTCTTCTTGACT---TTAGGAT--CATAGGTTGACCTCGAATCAGGTA-GGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTTGGGCGCTGCTGATCATCCAGAG--TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAACTACCTTTCGGGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTTGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41487] TITLE Erysiphe_gracilis_Fig._3_IGS_62_taxa; LINK TAXA = Taxa1; DIMENSIONS NCHAR=391; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_gracilis_Genotype_I_MUMH2027_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGCTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH4158_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH4962_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5728_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGGAGACAG-----TCCTTGG--TAAAC----AGGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCCCTTA-GGGGTTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTGAAC-GCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH4552_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH4586_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH4963_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TAGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5723_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5730_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH5817_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTG-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH6176_ex_Q._myrsinaefolia ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTG-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH6185_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCATATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAGAC----AGGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTG-AAAGGTCCTTA-TGGGCTCTCCTGCC-TAG-TAGCCGTTGCGGTTGCACCGTTCGCGCGGTGTGGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCTCGT--GGGCCCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAAGC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCCGT--GGGCGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAAGC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCCGT--GGGCGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_III_MUMH6249_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAAGC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCCGT--GGGCGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca ATGGCTACCCTGACCTCAAGACC-TTTGGGGGCAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG-----TTCTTGG--TAAGC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGTT-AAAGGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCCGT--GGGCGCCCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_IV_TUAMH2712_ex_Q._salicina ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCGCACCCGAGG--ACAG------TCTTGGTTTAAAC----AAGGACTCGAATCGGTGTGTGACGGACCGTCCTGTGAGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCT-AAAGGTCCTTT-GGGGCTCTCCTGCCTTAG-TAACCGTTGCGGTTACATCGTT--CGCGGTGTTGACGGCCATCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCC-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6568_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6570_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6572_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6597_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6600_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6711_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6712_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6714_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6717_ex_Q._sessilifolia ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMH6718_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATTCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-GACAG-----TCTTTGG--CAAAC----AAGGACTCGATTCGGTGTGTGACGGACCGTCCCGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGCGGAGGGAGCTAAATAGCCCTTA-TGGGCTCTCCTACC-TAG-TAACCGTTGCGGTGGCACTGTT--CGCGGTGTTGAC-GCCATCCAGTGTACAACTCAACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCG-AT-GAGGCGCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta ATGGCTACCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6569_ex_Q._acuta -------CCCTGACCTCAAGACCTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6576_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGGGGGTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6587_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACACAAAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6596_ex_Q._acuta ------------------------TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6598_ex_Q._acuta ----------------------CTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACACAAAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_gracilis_Genotype_VI_MUMH6719_ex_Q._acuta ----------------------CTTTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGCCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGG-AACAC-AAGTCCCTTGG--TAAAACACAAAGGATTCGAATCGGTGTGTGACGGACCGTCCTGTGGGAAACTCAGTGGGGGCAATTGGATAGCGGGTGCGAGGAGGGAGCTAAAAGGCTCTTATGGGGCTCTCCTGCC-TAG-TAACCGTTGCGGTTGCACCGTT--CGCGGTGTTGAC-GCCACCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCT-GT-GGGGCTCTCTCGTCACGATAGATACCTGGTTGATTCTGCCA Erysiphe_japonica_ex_Q._serrata_AB701310 ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCCGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACTCGAGG-CACAG-----GTCTGG---TA-------AAGGACTCGAATCGGTGTGTGGCGGACCGTCCTGTGGGGAACTCAGTGGGGGCAATTGGATAGCGGGCGCGAGTCCGGAGC--AAGGCCCCTTGTGGGGCTCTCTTGGT-TAG-CGACCGTTGCTGTCACACCGTT--CGCGGTGT-GAC-GCCGTCCAGTGTACAACTCGACCCTCGTTCGCGGGG--GTGTCGAGGGAGCCCGGTTGGGGCTCTCTCGCTACGATAGATACCTGGTTGATTCTGCCA rysiphe_japonica_ex_Q._crispula_AB701312 ATGGCTACCCTGACCTCAAGACC-TTTGGGGGTAAGCCGCCGCTGGTAGCCGCCGTCAGGCGTGATCCAGTGGTCGGTATCCTCCTCTTGCGGGGCGTATGGCACACCCGAGGGCACAG-----TCTGGTG--TA-------AAGGACTCGAATCGGTGTGTGGCGGACCGTCCTGTGGGGAACTCAGTGGGGGCAATTGGATAGCGGGCGCGAATCGGGAACA-AAAGCCCCTTG-TGGGCTCTCTTGGT-TAGCCGACCGTTGCTGTCACACCGTT--CGCGGTGT-GAC-GCCGTCCAGTGTACAACTCTACCCTCGTTCGCGGGGGTGTGTCGAGGGAGCCC-GT--GGGCTCTCTCGCCATGATAGATACCTGGTTGATTCTGCCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41485] TITLE Erysiphe_gracilis_28s_56_taxa; LINK TAXA = Taxa3; DIMENSIONS NCHAR=759; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_aphananthes_ex_Aphananthe_MUMH4648 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGC-------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTC-TTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_aquilegiae_ex_Ranunculus_japonicus_MUMH287_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCC-GAG--TTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAATGTAGCTCTCTTC----GGGGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_arcuata_ex_Carpinus_MUMH2589 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAG--TTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_asiatica_ex_Castanopsis_MUMH4989 -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACCGGGAGGAACGTAGCTCCCTTT-CGCGGGGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAACTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_australiana_ex_Lagerstroemia_DNA8 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAAC---GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGTGG-CTTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGAC-TTGGGCATC-GCTGATCATCCG-GGG--GTAT-CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCT-GTGGGAACGTGGCTCCTTTC----GAGGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_berchemiae_ex_Berchemia_racemosa_MUMH252_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGCGA-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTT-GAG--TTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_betulina_ex_Betula_MUMH4640 ----------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TCGTAGACTTGGCCTAAGTTCCTTGGAA?AGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGACCCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTCGATCATCCATGAG--TTCGTCTCTGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGAAACGTAGCTCGCTTC----GGCGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAGCCCC Erysiphe_bivonae_ex_Ulmus_MUMH21 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATAT?AATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-CTGTGGGTTCGGCCTAAGATCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_buhrii_ex_Gypsophila_paniculata_MUMH787_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCTT-GAG--GTCTCCTCGAGTGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TAC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_carpini_laxiflorae_ex_Carpinus_MUMH3640 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CAAGGTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGCTGATCATCCA-GAG--TTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCC-GGAGAAACGTAGCTCCTCTC----GGGGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAAACCCATACGCGGAATGAAAGTGAAACG-------------- Erysiphe_carpinicola_ex_Carpinus_MUMH51 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGACTCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGGCTGATCATCCATGA?--TTCGTCTCT?GTGCACTC?AC?GCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGCAACGTAGCTCCCTTC----GGGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_epigena_ex_Quercus_variabilis_AB292720_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-GC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCC-GAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_frickii_ex_Geum_BCRU01613 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAG--------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-AC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCTA-GAG--TTCT-CTCTGGTGCACTCGGCAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACT-GGAGGAACGTAGCTCGCCTT-CG-GGGGAGTG--TTATAGCCTCCAGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_glycines_ex_Desmodium_MUMH52 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCTA-GAG--TTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTG-AACGCAGGTGAGAACCCC Erysiphe_gracilis_ex_Q._acuta_MUMH6542 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTGC-CTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._acuta_MUMH6543L TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTGC-CTCTGGTGCACTCAGGAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._acuta_MUMH6545C TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGATC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TCC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5540 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGGTTTCC-CTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5725 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGGTTTCC-CTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5726 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5727 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5731 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5839 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-AGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._glauca_MUMH5868 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTTTGGTGCACTCAGTAGGGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGATCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._salicina_MUMH5804 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-AGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_gracilis_ex_Q._x_takaoyamensis_MUMH6537U TTGACCTCGAATCAGGTAGGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCA-GAGG-TTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGATC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TCC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_havrylenkoana_ex_Nothofagus_MUMH1471 -----------------------------------------------ATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCATTC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGCGGAACGTAGCTCTCCTT-CG-GGGGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_japonica_var._crispulae_ex_Quercus_MUMH4163 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-AGAGGAACGTAGCTACCTTT-CG-GGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGAAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_japonica_var._japonica_ex_Quercus_MUMH4159 -----------------------------------------------------------------------------------------------------------------------AAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-AGAGGAACGTAACTACCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_javanica_ex_Castanopsis_MUMH5147 -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATGGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTT-CGCGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_kasanoi_ex_Celtis_MUMH20 TTGACCTCGAATCAGGTAGG-GATACCCGCTG??CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTA-CTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_kenjiana_ex_Ulmus_MUMH4879 -------------------------------------------------------------------------------------------------------------------TTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-CTGTGGGTTCGGCCTAAGATCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACT-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_limonii_ex_Limonium_platyphyllum_MUMH2568_UKR TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-CCCGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCTT-GAG--TTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGA-AAGCCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_liquidambaris_ex_Liquidambar_MUMH4650 ------------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TTAGCCGGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-CCTACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTTGGGCACT-GCTGATCAGCCG-GAG--TTCT-CTCCGATGCACTCGACAGCGCACAGGCCAGCATCGGTTTGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTTCC----GGGGAGTG--TTATAGCCTATGGTGCCATGCAGCCCATCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_ljubarskii_ex_Acer_MUMH404 TTGACCTCGAATCAGG-AGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-T?TGCGCCCGTGTAAAGCTCTTTCGAC?AGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGGGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCTA-TAG--TTTT-CTCTGGTGCACTCGACAGCCCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCATCCGGACCGAGAACCGCGCC-TTC-TGGCTAGGATGCTCGCGTATTGTTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGCAATGAAAGTGAAACACATGTGAGAACCCC Erysiphe_magellanica_ex_Nothofagus_MUMH2496 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTTC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGCCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCCGGAGAAAGACT-GGAGGAACGTAGCTCCCTCT-CG-GGGGAGTG--TTATAGCCTCTGGTGTCATACGGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_mayorii_ex_Cirsium_MUMH3952 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-AC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCCA-GAG--TTTT-CTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACC-GGAGGAACGTAGCTCCCCTT-TG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_michikoae_ex_Celtis_MUMH5055 -----------------------------------------------------------------------------------------------------GGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTT-CG-GGGGAGTG-TTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_miyabei_ex_Alnus_MUMH48 TTGATCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAA--GGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACTTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGACCCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAG--TTTTGCTCTGGTGCACTCGGCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGAAACGTAGCTCGCTTC----GGGGAGTG--TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAGCCCC Erysiphe_monoperidiata_ex_Castanopsis_MUMH4990 -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGGGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTT-CGTGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_mori_ex_Morus_MUMH128 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTCT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGCAGGTG-------- Erysiphe_necator_ex_Vitis_MUMH530 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-CTGTAGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-CTTGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCGGATCACCTC-GGG--TTTT-CTCGAGGGCACTCGGTAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCC-GTTGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCAACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCACACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_nishidana_ex_Firmiana_MUMH235 TTGACCTCGAATCAGGTATG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-CGGTAGGTGCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGCGG-CCTCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCCA-GAG--TTTT-CTCTGGTGCACTCGGCAGCGGACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGTGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_nomurae_ex_Symplocos_chinensis_AB331648_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CC-----AGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCCGCGCCCATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCATCTC-GAG--TTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_nothofagi_ex_Nothofagus_MUMH1475 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCATTC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCTA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGCGGAACGTAGCTCTCCTT-CG-GGGGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_oleosa_ex_Tilia_YNMH12972 -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTCT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_paracarpinicola_ex_Carpinus_MUMH207 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGACTCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGGCTGATCATCCATGAG--TTTGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGTC-GGAGCAACGTAGCTCCCTTC----GAGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_patagoniaca_ex_Nothofagus_MUMH2511 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCATTC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGCGGAACGTAGCTCCCCTT-CG-GGAGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_prunastri_var._japonica_ex_Prunus_MUMH3575 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGCCGCT-GTTGATCATCCA-AAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGATC-GAAGGAACGTAGCTCTCCCT-CG-GGTGAGTG--TTATAGCCTCCGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AACCCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_pulchra_ex_Swida_controversa_AB000941_JPN TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGG-TGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCCA-GAG--TTTC-TTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AATGTAGGTGAGAACCCC Erysiphe_sengokui_ex_Celastrus_MUMH205 TTGACCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-CCGCAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGC-CGAGACCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGCTGATCATCCATGAG--TTCTTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCC-GGAGAAACGTAGCTCCCTCT-----GGGAGTG--TTATAGTCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTTT-AGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC Erysiphe_simulans_ex_Rosa_TPU439 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-GC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-CTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-TGAGG-CCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-GCCGATCATTCC-GAG--TTCT-CTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACC-GGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AACCCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_trinae_ex_Quercus_MUMH113 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG-TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGCC---AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGAC-TTGGGCGCT-GCCGATCATCCC-GAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCCTT-CG-GGGCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_ulmariae_ex_Filipendula_MUMH2562 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-AC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CAAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACC-GGAGGAACGTAGCTCCCCTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT Erysiphe_verniciferae_ex_Rhus_MUMH578 TTGATCTCGAATCAGGTAGG-AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGACCCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAG--TTTTGCTCTGGTGCACTCGGCAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGAAACGTAGCTCGCTTC----GGGGAGTG--TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCTATTGTTTGGGTGTT-AAACCCATACCCGGAATGAAAGTG-AACGTAGGTGAGAGCCCC Erysiphe_zelkowae_ex_Zelkova_MUMH403 TTGACCTCGAATCAGGTAGG-GATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAGCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCATCCA-GAG--TTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAATGTAGCTCCCTTT-CG-GGGGAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCT ; END; BEGIN TREES; TITLE 'Erysiphe gracilis Fig. 2_ITS+28S_37taxa'; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_gracilis_Genotype_I_MUMH122_ex_Q._glauca, 2 Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca, 3 Erysiphe_gracilis_Genotype_I_MUMH5487_ex_Q._glauca, 4 Erysiphe_gracilis_Genotype_I_MUMH5356_ex_Q._glauca, 5 Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca, 6 Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca, 7 Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca, 8 Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca, 9 Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca, 10 Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca, 11 Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca, 12 Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca, 13 Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca, 14 Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca, 15 Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia, 16 Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia, 17 Erysiphe_gracilis_Genotype_II_MUMU6176_ex_Q._myrsinaefolia, 18 Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca, 19 Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca, 20 Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca, 21 Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina, 22 Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca, 23 Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina, 24 Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina, 25 Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina, 26 Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca, 27 Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta, 28 Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta, 29 Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta, 30 Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta, 31 Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta, 32 Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta, 33 Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis, 34 Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta, 35 Erysiphe_japonica_ex_Q._crispula_MUMH4163, 36 Erysiphe_japonica_ex_Q._cuspidata_MUMHs76, 37 Erysiphe_japonica_ex_Q._serrata_MUMH4582; TREE Fig._2 = [&R] ((((1,2,3,4,5,6,7,8,9,10,11),((((12,13,14),(15,16,17)),(18,19,20)),(21,22,23,24,25,26))),((27,28,29,30,31,32),(33,34))),((35,36),37)); END; BEGIN TREES; TITLE 'Erysiphe gracilis 28s_56taxa'; LINK TAXA = Taxa3; TRANSLATE 1 Erysiphe_buhrii_ex_Gypsophila_paniculata_MUMH787_JPN, 2 Erysiphe_limonii_ex_Limonium_platyphyllum_MUMH2568_UKR, 3 Erysiphe_berchemiae_ex_Berchemia_racemosa_MUMH252_JPN, 4 Erysiphe_nomurae_ex_Symplocos_chinensis_AB331648_JPN, 5 Erysiphe_epigena_ex_Quercus_variabilis_AB292720_JPN, 6 Erysiphe_pulchra_ex_Swida_controversa_AB000941_JPN, 7 Erysiphe_aquilegiae_ex_Ranunculus_japonicus_MUMH287_JPN, 8 Erysiphe_glycines_ex_Desmodium_MUMH52, 9 Erysiphe_necator_ex_Vitis_MUMH530, 10 Erysiphe_nishidana_ex_Firmiana_MUMH235, 11 Erysiphe_arcuata_ex_Carpinus_MUMH2589, 12 Erysiphe_miyabei_ex_Alnus_MUMH48, 13 Erysiphe_verniciferae_ex_Rhus_MUMH578, 14 Erysiphe_betulina_ex_Betula_MUMH4640, 15 Erysiphe_carpinicola_ex_Carpinus_MUMH51, 16 Erysiphe_paracarpinicola_ex_Carpinus_MUMH207, 17 Erysiphe_sengokui_ex_Celastrus_MUMH205, 18 Erysiphe_carpini_laxiflorae_ex_Carpinus_MUMH3640, 19 Erysiphe_ulmariae_ex_Filipendula_MUMH2562, 20 Erysiphe_frickii_ex_Geum_BCRU01613, 21 Erysiphe_mayorii_ex_Cirsium_MUMH3952, 22 Erysiphe_simulans_ex_Rosa_TPU439, 23 Erysiphe_magellanica_ex_Nothofagus_MUMH2496, 24 Erysiphe_prunastri_var._japonica_ex_Prunus_MUMH3575, 25 Erysiphe_patagoniaca_ex_Nothofagus_MUMH2511, 26 Erysiphe_havrylenkoana_ex_Nothofagus_MUMH1471, 27 Erysiphe_nothofagi_ex_Nothofagus_MUMH1475, 28 Erysiphe_mori_ex_Morus_MUMH128, 29 Erysiphe_oleosa_ex_Tilia_YNMH12972, 30 Erysiphe_monoperidiata_ex_Castanopsis_MUMH4990, 31 Erysiphe_javanica_ex_Castanopsis_MUMH5147, 32 Erysiphe_asiatica_ex_Castanopsis_MUMH4989, 33 Erysiphe_japonica_var._crispulae_ex_Quercus_MUMH4163, 34 Erysiphe_japonica_var._japonica_ex_Quercus_MUMH4159, 35 Erysiphe_ljubarskii_ex_Acer_MUMH404, 36 Erysiphe_trinae_ex_Quercus_MUMH113, 37 Erysiphe_gracilis_ex_Q._glauca_MUMH5731, 38 Erysiphe_gracilis_ex_Q._glauca_MUMH5726, 39 Erysiphe_gracilis_ex_Q._glauca_MUMH5540, 40 Erysiphe_gracilis_ex_Q._glauca_MUMH5725, 41 Erysiphe_gracilis_ex_Q._glauca_MUMH5727, 42 Erysiphe_gracilis_ex_Q._glauca_MUMH5868, 43 Erysiphe_gracilis_ex_Q._salicina_MUMH5804, 44 Erysiphe_gracilis_ex_Q._glauca_MUMH5839, 45 Erysiphe_gracilis_ex_Q._acuta_MUMH6542, 46 Erysiphe_gracilis_ex_Q._acuta_MUMH6543L, 47 Erysiphe_gracilis_ex_Q._acuta_MUMH6545C, 48 Erysiphe_gracilis_ex_Q._x_takaoyamensis_MUMH6537U, 49 Erysiphe_kenjiana_ex_Ulmus_MUMH4879, 50 Erysiphe_bivonae_ex_Ulmus_MUMH21, 51 Erysiphe_aphananthes_ex_Aphananthe_MUMH4648, 52 Erysiphe_kasanoi_ex_Celtis_MUMH20, 53 Erysiphe_michikoae_ex_Celtis_MUMH5055, 54 Erysiphe_zelkowae_ex_Zelkova_MUMH403, 55 Erysiphe_liquidambaris_ex_Liquidambar_MUMH4650, 56 Erysiphe_australiana_ex_Lagerstroemia_DNA8; TREE Fig._1 = [&R] ((((((((((1,2),3),4),5),7),6),11),(((8,35),9),((10,((((((19,22),21),20),(25,(26,27))),(((((23,24),(28,29)),((30,31),32)),((33,34),((49,50),51,(52,53),54))),((37,38,((45,46),(47,48))),(39,40,(41,42)),(43,44)))),36)),(((((12,13),14),17),(15,16)),18)))),55),56); END; BEGIN TREES; TITLE 'Erysiphe gracilis Fig. 3_IGS62taxa'; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_gracilis_Genotype_I_MUMH4962_ex_Q._glauca, 2 Erysiphe_gracilis_Genotype_I_MUMH3560_ex_Q._glauca, 3 Erysiphe_gracilis_Genotype_I_MUMH3608_ex_Q._glauca, 4 Erysiphe_gracilis_Genotype_I_MUMH5536_ex_Q._glauca, 5 Erysiphe_gracilis_Genotype_I_MUMH4107_ex_Q._glauca, 6 Erysiphe_gracilis_Genotype_I_MUMH4158_ex_Q._glauca, 7 Erysiphe_gracilis_Genotype_I_MUMH2027_ex_Q._glauca, 8 Erysiphe_gracilis_Genotype_I_MUMH5724_ex_Q._glauca, 9 Erysiphe_gracilis_Genotype_I_MUMH5728_ex_Q._glauca, 10 Erysiphe_gracilis_Genotype_I_MUMH5731_ex_Q._glauca, 11 Erysiphe_gracilis_Genotype_I_MUMH5762_ex_Q._glauca, 12 Erysiphe_gracilis_Genotype_I_MUMH5726_ex_Q._glauca, 13 Erysiphe_gracilis_Genotype_II_MUMH4552_ex_Q._glauca, 14 Erysiphe_gracilis_Genotype_II_MUMH4586_ex_Q._glauca, 15 Erysiphe_gracilis_Genotype_II_MUMH5381_ex_Q._glauca, 16 Erysiphe_gracilis_Genotype_II_MUMH5540_ex_Q._glauca, 17 Erysiphe_gracilis_Genotype_II_MUMH4963_ex_Q._glauca, 18 Erysiphe_gracilis_Genotype_II_MUMH5723_ex_Q._glauca, 19 Erysiphe_gracilis_Genotype_II_MUMH5730_ex_Q._glauca, 20 Erysiphe_gracilis_Genotype_II_MUMH5725_ex_Q._glauca, 21 Erysiphe_gracilis_Genotype_II_MUMH5817_ex_Q._glauca, 22 Erysiphe_gracilis_Genotype_II_MUMH6185_ex_Q._glauca, 23 Erysiphe_gracilis_Genotype_II_MUMH6161_ex_Q._myrsinaefolia, 24 Erysiphe_gracilis_Genotype_II_MUMH6343_ex_Q._myrsinaefolia, 25 Erysiphe_gracilis_Genotype_II_MUMH6176_ex_Q._myrsinaefolia, 26 Erysiphe_gracilis_Genotype_III_MUMH5727_ex_Q._glauca, 27 Erysiphe_gracilis_Genotype_III_MUMH5868_ex_Q._glauca, 28 Erysiphe_gracilis_Genotype_III_MUMH6249_ex_Q._glauca, 29 Erysiphe_gracilis_Genotype_III_TUAMH3181_ex_Q._glauca, 30 Erysiphe_gracilis_Genotype_IV_MUMH5839_ex_Q._glauca, 31 Erysiphe_gracilis_Genotype_IV_MUMH5804_ex_Q._salicina, 32 Erysiphe_gracilis_Genotype_IV_MUMH6168_ex_Q._salicina, 33 Erysiphe_gracilis_Genotype_IV_TUAMH2712_ex_Q._salicina, 34 Erysiphe_gracilis_Genotype_IV_MUMH6578_ex_Q._salicina, 35 Erysiphe_gracilis_Genotype_IV_MUMH6589_ex_Q._salicina, 36 Erysiphe_gracilis_Genotype_IV_MUMH5842_ex_Q._glauca, 37 Erysiphe_gracilis_Genotype_V_TUAMH0615_ex_Q._acuta, 38 Erysiphe_gracilis_Genotype_V_MUMH6542_ex_Q._acuta, 39 Erysiphe_gracilis_Genotype_V_MUMH6543_ex_Q._acuta, 40 Erysiphe_gracilis_Genotype_V_MUMHs25_ex_Q._acuta, 41 Erysiphe_gracilis_Genotype_V_MUMH6564_ex_Q._acuta, 42 Erysiphe_gracilis_Genotype_V_MUMH6566_ex_Q._acuta, 43 Erysiphe_gracilis_Genotype_V_MUMH6568_ex_Q._acuta, 44 Erysiphe_gracilis_Genotype_V_MUMH6570_ex_Q._acuta, 45 Erysiphe_gracilis_Genotype_V_MUMH6572_ex_Q._acuta, 46 Erysiphe_gracilis_Genotype_V_MUMH6711_ex_Q._acuta, 47 Erysiphe_gracilis_Genotype_V_MUMH6712_ex_Q._acuta, 48 Erysiphe_gracilis_Genotype_V_MUMH6714_ex_Q._acuta, 49 Erysiphe_gracilis_Genotype_V_MUMH6717_ex_Q._sessilifolia, 50 Erysiphe_gracilis_Genotype_V_MUMH6718_ex_Q._acuta, 51 Erysiphe_gracilis_Genotype_V_MUMH6597_ex_Q._acuta, 52 Erysiphe_gracilis_Genotype_V_MUMH6600_ex_Q._acuta, 53 Erysiphe_gracilis_Genotype_VI_MUMH6576_ex_Q._acuta, 54 Erysiphe_gracilis_Genotype_VI_MUMH6596_ex_Q._acuta, 55 Erysiphe_gracilis_Genotype_VI_MUMH6587_ex_Q._acuta, 56 Erysiphe_gracilis_Genotype_VI_MUMH6569_ex_Q._acuta, 57 Erysiphe_gracilis_Genotype_VI_MUMH6545_ex_Q._acuta, 58 Erysiphe_gracilis_Genotype_VI_MUMH6537_ex_Q._x_takaoyamensis, 59 Erysiphe_gracilis_Genotype_VI_MUMH6719_ex_Q._acuta, 60 Erysiphe_gracilis_Genotype_VI_MUMH6598_ex_Q._acuta, 61 Erysiphe_japonica_ex_Q._serrata_AB701310, 62 rysiphe_japonica_ex_Q._crispula_AB701312; TREE Fig._3 = [&R] ((((((1,2,3,4,5,6,7,8,9,10,11),12),(((((53,54,55,60),58),56),59),57)),(((13,14,15,16,17,18,19,20,21,22,(23,24,25)),(26,27,28,29)),((37,38,39,40,43,44,45,46),41,42,47,48,49,50,51,52))),(30,31,32,33,34,35,36)),(61,62)); END;