#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 3:56 GMT TreeBASE (cc) 1994-2008 Study reference: Kryukov V.Y., Tomilova O.G., Yaroslavtseva O.N., Wen T., Kryukova N.A., Polenogova O.V., Tokarev Y., & Glupov V.V. 2017. Temperature preferences of Cordyceps militaris and its ability to kill insects under different thermo-physiological states. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21210] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Cordyceps_militaris_8b8l Cordyceps_militaris_8b8m Cordyceps_militaris_C14 Cordyceps_militaris_C19 Cordyceps_militaris_C20 Cordyceps_militaris_C7 Cordyceps_militaris_CM001 Cordyceps_militaris_CMKP094 Cordyceps_militaris_CMKar07 Cordyceps_militaris_CMMR06 Cordyceps_militaris_CMZBS09 Cordyceps_militaris_Cnap001 Cordyceps_militaris_Crbol001 Cordyceps_militaris_NBRC30377 Cordyceps_militaris_NBRC9787 Cordyceps_militaris_OSC93623 Cordyceps_militaris_Pad1 Cordyceps_militaris_Pad2 Cordyceps_militaris_Pad3 Cordyceps_militaris_Pad45 Cordyceps_militaris_Pad53 Cordyceps_militaris_Sm1 Microhilum_oncoperae_AFSEF4358 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43273] TITLE Cordyceps_militaris_TEF_alignment_matrix; LINK TAXA = Taxa1; DIMENSIONS NCHAR=265; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cordyceps_militaris_8b8l CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_8b8m CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_C14 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_C19 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_C20 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_C7 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_CM001 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_CMKP094 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_CMKar07 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_CMMR06 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_CMZBS09 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_Cnap001 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_Crbol001 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Cordyceps_militaris_NBRC30377 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_NBRC9787 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_OSC93623 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAACCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATTGG Cordyceps_militaris_Pad1 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_Pad2 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_Pad3 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_Pad45 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_Pad53 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACCGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCAGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGG Cordyceps_militaris_Sm1 CCTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGAGAACATGCCCTGGTACACCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTGCAGGCCATCGACGCCATTGAGCCCCCTGAGCGTCCCACCAACAAGCCCCTCCGCCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGG Microhilum_oncoperae_AFSEF4358 CCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCGACACTGTCCCCTTCGTCCCCATCTCCGGTTTCCACGGCGACAACATGGTTCTGCCCACCGACAACATGCCCTGGTACAGCGGCTGGACCAAGACGTCCAAGGCTACCGGCAAGACTGTCACTGGCAAGACCCTCCTTCAGGCCATCGACGCCATCGAGCCCCCGGAGCGTCCCACCAGCAAGCCCCTCCGCCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGG ; END; BEGIN TREES; TITLE Cordyceps_militaris_TEF; LINK TAXA = Taxa1; TRANSLATE 1 Cordyceps_militaris_8b8l, 2 Cordyceps_militaris_8b8m, 3 Cordyceps_militaris_C14, 4 Cordyceps_militaris_C19, 5 Cordyceps_militaris_C20, 6 Cordyceps_militaris_C7, 7 Cordyceps_militaris_CM001, 8 Cordyceps_militaris_CMKP094, 9 Cordyceps_militaris_CMKar07, 10 Cordyceps_militaris_CMMR06, 11 Cordyceps_militaris_CMZBS09, 12 Cordyceps_militaris_Cnap001, 13 Cordyceps_militaris_Crbol001, 14 Cordyceps_militaris_NBRC30377, 15 Cordyceps_militaris_NBRC9787, 16 Cordyceps_militaris_OSC93623, 17 Cordyceps_militaris_Pad1, 18 Cordyceps_militaris_Pad2, 19 Cordyceps_militaris_Pad3, 20 Cordyceps_militaris_Pad45, 21 Cordyceps_militaris_Pad53, 22 Cordyceps_militaris_Sm1, 23 Microhilum_oncoperae_AFSEF4358; TREE 'PAUP_1' = [&R] (23:0.0208305,((21:0.0,20:0.0,19:0.0,18:0.0,17:0.0,15:0.0,14:0.0,10:0.0,7:0.0,9:0.0):0.009722,(16:0.011876,8:0.0,11:0.0,12:0.0,13:0.0,22:0.0,(6:0.0,(5:0.0,(4:0.0,(3:0.0,(1:0.0,2:0.0):0.0):0.0):0.0):0.0):0.0):0.007947):0.0208305); END;