#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:10 GMT TreeBASE (cc) 1994-2008 Study reference: Scholler M., Schmidt A., Meeboon J., Braun U., & Takamatsu S. 2018. Phyllactinia fraxinicola, another Asian fungal pathogen on Fraxinus excelsior (Common ash) introduced to Europe?. Mycoscience, 59(1): 85-88. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21263] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=24; TAXLABELS Chionanthus_virginicus_MUMH926_Germany Fraxinus_excelsior_AF073350_Switzerland Fraxinus_excelsior_KRM24918_Germany Fraxinus_excelsior_KRM48243_Germany Fraxinus_excelsior_KRM48246_Germany Fraxinus_excelsior_KRM48247_Germany Fraxinus_excelsior_KUS_F17216_Korea Fraxinus_excelsior_MUMH644_Switzerland Fraxinus_excelsior_MUMH911_Lithuania Fraxinus_excelsior_MUMH912_Lithuania Fraxinus_excelsior_MUMH913_Lithuania Fraxinus_excelsior_MUMH914_Lithuania Fraxinus_excelsior_MUMH915_Lithuania Fraxinus_lanuginosa_f._serrata_MUMH2902_Japan Fraxinus_longicuspis_MUMH212_Japan Fraxinus_longicuspis_MUMH566_Japan Fraxinus_mandshurica_SMK10643_Korea Fraxinus_ornus_GLM_F80911_Germany Fraxinus_ornus_GLM_F91208_Germany Fraxinus_pennsylvanica_GLM_F56423_Germany Fraxinus_sieboldiana_MUMH426_Japan Fraxinus_sp._MUMH917_Iran Syringa_vulgaris_MUMH907_Germany Wisteria_sinensis_MUMH908_Germany ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41769] TITLE 'Phyllactinia fraxinicola ITS+28S 24taxa'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1299; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chionanthus_virginicus_MUMH926_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA??????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCACAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_AF073350_Switzerland CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTCAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Fraxinus_excelsior_KRM24918_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_KRM48243_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCA???????????????????????????????????????????????????????????????????GCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_KRM48246_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_KRM48247_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_KUS_F17216_Korea ???????????????????????????????????????????????????????????????TCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTATCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGTACCAGACCCAGCCAAAACCTGACGCCGACAAGGTGTCAACCCCCCTCTTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_MUMH644_Switzerland CAGAGCGTGAAGACTTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCC-TGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Fraxinus_excelsior_MUMH911_Lithuania CAGAGCGTGAAGAC?TCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_MUMH912_Lithuania CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGG{AT}ATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_MUMH913_Lithuania CAGAGCGTGAAGACTTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_MUMH914_Lithuania CAGAGCGTGAAGACTTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_excelsior_MUMH915_Lithuania CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_lanuginosa_f._serrata_MUMH2902_Japan CAGAGCGTGAAGACCTCGGCCCCTCCCGCGGCGCAAGTCGAGGTGGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTAGCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Fraxinus_longicuspis_MUMH212_Japan CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCCCTTGGCACTCCGCCGGCCCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCGGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAATACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCCC-TTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_longicuspis_MUMH566_Japan CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCCCTTGGCACTCCGCCGGCCCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCGGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAATACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC--TTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_mandshurica_SMK10643_Korea CAGAGCGTGAAGACCTCGGCCCCTCCCGCGGCGCAAGTCGAGGTGGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTATCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGTACCAGACCCAGCCAAAACCTGACGCCGACAAGGTGTCAACCCCCCTCTTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_ornus_GLM_F80911_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCCCTCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_ornus_GLM_F91208_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCCCTCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_pennsylvanica_GLM_F56423_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCACAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_sieboldiana_MUMH426_Japan CAGAGCGTGAAGACCTCGGCCCCTCCCGCGGCGCAAGTCGAGGTGGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTAGCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCGCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCC--TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Fraxinus_sp._MUMH917_Iran CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGCGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA??????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Syringa_vulgaris_MUMH907_Germany CAGAGCGTGAAGACCTCGGCCCCTCC-GCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Wisteria_sinensis_MUMH908_Germany ??????????????????????????????????????????????????????????????????ACCCTCCCACCCGTGTCGAT-TTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCC-TTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG ; END; BEGIN TREES; TITLE 'Phyllactinia fraxinicola ITS+28S 24 taxa'; LINK TAXA = Taxa1; TRANSLATE 1 Fraxinus_excelsior_MUMH644_Switzerland, 2 Fraxinus_excelsior_MUMH913_Lithuania, 3 Fraxinus_excelsior_MUMH914_Lithuania, 4 Fraxinus_excelsior_MUMH911_Lithuania, 5 Chionanthus_virginicus_MUMH926_Germany, 6 Fraxinus_excelsior_MUMH912_Lithuania, 7 Fraxinus_sp._MUMH917_Iran, 8 Syringa_vulgaris_MUMH907_Germany, 9 Wisteria_sinensis_MUMH908_Germany, 10 Fraxinus_excelsior_AF073350_Switzerland, 11 Fraxinus_excelsior_MUMH915_Lithuania, 12 Fraxinus_excelsior_KRM48243_Germany, 13 Fraxinus_excelsior_KRM24918_Germany, 14 Fraxinus_excelsior_KRM48246_Germany, 15 Fraxinus_excelsior_KRM48247_Germany, 16 Fraxinus_ornus_GLM_F91208_Germany, 17 Fraxinus_ornus_GLM_F80911_Germany, 18 Fraxinus_pennsylvanica_GLM_F56423_Germany, 19 Fraxinus_sieboldiana_MUMH426_Japan, 20 Fraxinus_lanuginosa_f._serrata_MUMH2902_Japan, 21 Fraxinus_mandshurica_SMK10643_Korea, 22 Fraxinus_excelsior_KUS_F17216_Korea, 23 Fraxinus_longicuspis_MUMH212_Japan, 24 Fraxinus_longicuspis_MUMH566_Japan; TREE Fig._3 = [&R] (((1,2,3),4,(5,18),6,7,8,9,10,11,12,13,14,15,(16,17)),(((19,20),(21,22)),(23,24))); END;