#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:52 GMT TreeBASE (cc) 1994-2008 Study reference: Le Y.T., Yamaguchi K., Tsurumi Y., Hop D.V., & Ando K. 2017. Hamatispora, a new genus of aquatic anamorphic fungi in Microthyriales, isolated from fallen leaves in Vietnam. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21330] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=28; TAXLABELS Asterina_phenacis_GU586217 Asterina_weinmanniae_GU586218 Chaetothyriothecium_elegans_KF268420 Condylospora_vietnamensis_LC146724 Fusicladium_pini_EU035436 Fusicladium_ramoconidii_EU035439 Hamatispora_phuquocensis Microthyrium_buxicola_KT306551 Microthyrium_microscopicum_GU301846 Microthyrium_propagulensis_KU948989 Natipusilla_decorospora_HM196369 Natipusilla_limonensis_HM196370 Natipusilla_naponensis_HM196371 Phaeotrichum_benjaminii_AY004340 Spirosphaera_beverwijkiana_HQ696657 Spirosphaera_minuta_HQ696659 Stomiopeltis_betulae_GU214701 Sympoventuria_capensis_DQ885904 Sympoventuria_capensis_DQ885906 Trichodelitschia_bisporula_GU348996 Trichodelitschia_munkii_DQ384096 Venturia_inaequalis_EU035460 Venturia_tremulae_EU035438 Zeloasperisporium_eucalyptorum_GQ303329 Zeloasperisporium_ficusicola_KT387733 Zeloasperisporium_hyphopodioides_EU035442 Zeloasperisporium_siamense_JQ036228 Zeloasperisporium_wrightiae_KT387737 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41929] TITLE Phylogeny_of_Hamatispora; LINK TAXA = Taxa1; DIMENSIONS NCHAR=488; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Asterina_phenacis_GU586217 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGCGGCCCCGGCCCGAGTCCCTTGGAACAGGGCGCCGTAGAGGGTGAGGGCCCCGTACGGCCGGAGTCCCCGTGCGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAACGGGAGGTATATTCCTCCCAAGGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCGGCCAGACCTGTGCGTTGCTCAGCCGGTCGGCGCACTCTTCCGCCACTGGCCAGCATCGGTTCGGGCGGCCGGATAAAGGTTGGGGGAACGTGGCCCCTCGGGGGTTATAGCCCCCTTCACAATGCGGCCCGCCCGGACCGAGGACAGCGTTCCTAGGATGCTGGCGTAATGGCAGCCAACGGC Asterina_weinmanniae_GU586218 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGAAGCTTCGGGGTGCCCCCGGTCCAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGAGGATCCCGTACGGCCGGAGTCCCCGTGCGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAACGGGAGGTATATTCCTCCCAAGGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTCTGCGGCCAGACCTGCACGCGGCTCAGCCGGCCGGCGCACTCCGCCGTCGCTGGCCAGCATCGGTTCGGGCGGCTGGACAAAGGCCCGGGGAACGTGGCCCTTCGGGGGTTATAGCCCCGGGCACAATGCAGCCCGCCCGGACCGAGGACAGCGTTCCTAGGATGCTGGCGTAATGGCCGCCGACGGC Chaetothyriothecium_elegans_KF268420 GCTCAGATTTGAAATCCGCCTCGAGTTGTAATCTGCAGAGGAACGTTCGGCGGAGCGGCGGCCTAAGTTTCCTGGAACGGAACGTCGCAGAGGGTGAGAACCCCGTACGGTTGCGGCCTGCCTGTGTACGTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGCGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGATCAGATTTTGACGCGGTTCACCTCTTGGGGGCACTCCACCGCTCAATGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCGCGAGGAACGTGATTCCTCGGAAGTTATAGCCTCGCGCACAATACGGCCAGCCGGGACCGAGGGACGCGCCTCCAGGATGCTGGCGTAATGGTCGCTAGCGGC Condylospora_vietnamensis_LC146724 GCTCAAATTTGAAACCTGGCCCGGATTGTAATTTGTAGAGGATGATAAAGTCTTGTATTAGTTCAAGTCTTCTGGAACGAAGCGCCATGGAGGGTGAGAGCCCCGTTGAATTGGTACTGACTTGTTTATCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTACAATCAGACTTGTGCATTGTTCCGCCTTTAGGTTCATTCTTCTGTCTCAGGCCAACATCAATTTCGATAGTTGGATAAAGGTTTTGGGAATGTGGCTCCTCGGAGGTTATAGCCCTTTACACAATACAACTTATTGGGATTGAGGTCAGCGTTCCTAGGATGTTGGCGTAATGGTTGTCAGCGGC Fusicladium_pini_EU035436 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGGCGCCTCGGGTGGGCACCGGTCCAAGTGCCTTGGAACAGGATACCGCAGAGGGTGAGAGTCCCGTACGGCCGGTGTGCCCATGTGAGGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATACGGCCAGACTTGCGCGATGCTCAGCCCGTGGGTGCACTCTTCCGCGGCAGGCCAGCATCGGTTTGGGGGGCCGGACAACGGCGGCGGGAATGTGGCACCTCGGTGGTTATAGCCCGGCGTGCAATGCGGCCAGCCCGGACCGAGGATCGCGCTTCTAGGATGCTGGCGTAATGGCCTTATACGGC Fusicladium_ramoconidii_EU035439 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGGCGCCTCGGGTGGGCACCGGTCCAAGTGCCTTGGAACAGGATACCGCAGAGGGTGAGAGTCCCGTACGGCCGGTGTGCCCATGTGAGGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATACGGCCAGACTTGCGCGATGCTCAGCCCGTGGGTGCACTCTTCCGCGGCAGGCCAGCATCGGTTTGGGGGGCCGGACAACGGCGGCGGGAATGTGGCACCTCGGTGGTTATAGCCCGGCGTGCAATGCGGCCAGCCCGGACCGAGGATCGCGCTTCTAGGATGCTGGCGTAATGGCCTTATACGGC Hamatispora_phuquocensis GCTCAAATTTGAAATCTGGCCCGAATTGTAATTTGTAGAGGAATGTTCGGCAATACATTGGTCCAAGTTTTCTGGAATGGAACATCTTGGAGGGTGAGAATCCCGTACGATCAATCTCCGCTTGTGAACTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATTGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTACTTTGTTCCCCCTCTGGGCTTACTCAAAAGTGTCAGGCCAACATCAGTTTTGGCGGTTGGATAAAGGTTTAGGGAATGTGGCTCCTCGGAGGTTATAGCCCTTTTCATAATACAGCCTGCCGGGACTGAGGTCAGCGTTCCTAGGATGTTGGCGTAATGGTTGTCAGCGGC Microthyrium_buxicola_KT306551 GCTCAAATTTTAAATCTGCCCCGAGTTGTAATTTGCAGAGGAATATTCGGTGAAGCCTAGGTCCAAGTCTTCTGGAAGGAAGCGCCGATGAGGGTGAGAGCCCCGTACGACTGACGTTAGCCTGTGAATATCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGCGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCAATCAGACTTGTTGACAGTTCAAGGGTTCCTGGTACTTCTGTTTGACAGGCCAACATCAGTTCGGACGGTCGGATAAAATTGCGGGGAACGTGGCTCTTCGGAGGTTATAGCCCTGTAAAGAATACGGCCCGATCGGACTGAGGACAGCCTTTGTAGGATGTTGGCGTAATGGTTGCAAGCGGC Microthyrium_microscopicum_GU301846 GCTCAAATTTGAAATCTGGCCCGAATTGTAATTTGTAGAGGAATGTTCGGCGACGTCTAGGTCTGATTTTTCTGGAAGGAAAAGCCACTGAGGGTGAGAGCCCCGTACGACTGATACTAACCTGTGTACATCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTAGCAACCAGACTTGAATTACATTCAGCAATTTTGTGTATTTTGTTGATACAGGCCAGCATCAGTTTTCGCGGTTGGAAAAAAGCATTGATAATGTGGCTCCTCGGAGGTTATAGATCTTTGCAGAATACAGCCAGTGAAGACTGAGGAACGCCTTTGTAGGATGCTGGCATAATGGTTGTTAGCGGC Microthyrium_propagulensis_KU948989 GCTCAAATTTGAAATCTGGCCCGAATTGTAATTTGTAGAGGAACGTTCGGCGACGTCTAGGTCTGATTTTTCTGGAAGGAAAAGCCAATGAGGGTGAGAGCCCCGTACGACTGAAACTAACCTGTGTACGTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTAGCAATCAGACTTGAATGGTATTCAGCAGTTCTGTGTATTTTGCCTGTTCAGGCCAGCATGAGTTTTTGCGGTTGGAAAAAAGTAGTGGGAACGTGGCTCCTTGGAGGTTATAGCCCATTGCAGAATACAGCCAGCGGAGACTGAGGAACGCCTTTGAAGGATGCTGGCATAATGGTTGTTAGCGGC Natipusilla_decorospora_HM196369 GCTCAGATTTGAAATCTGGCCCGAGTTGTAATCTGCAGAGGATGCTTTGGCAAACCCCCGGCCCGAGTCCCCTGGGACGGGACGCCATAGAGGGTGAGAGCCCCGTGTGGGCGGGGGCGCCCTGTAAAGCTCCTTCGAAGAGTCGAGTTGTTTGAGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTAATCGAAAGGCGAAAAGCACTTTGAAAAGAGAGTGAAACAGAAAGTGAAATCGTTGCAGGGGAACCGCATGCGGTCAGACTCCCGCGGGGTTCCACCGGCCGGTGTACTCCCCGCCGGAGGGCCAGCATCGGCTTGGGCGGCCGCGGAAGGGCCCTGGGAATTCTGCCCCTCGGGGGTTGTAGCCCGGGGTCGGATGCGGCCCGGCCAGGCCGAGGACCGCGCTCCGAGGGTGCTGGCGTAATGGCAATATGCGAC Natipusilla_limonensis_HM196370 GCTCAGATTTGAAATCTGGCCCGAGTTGTAATCTGCAGAGGATGCTTTGGCAACCCTCCGGCCCGAGTCCCCTGGGACGGGACGCCATAGAGGGTGAGAGCCCCGTGTGGGCGGGGGCGCCCTGTAAAGCTCCTTCGAAGAGTCGAGTTGTTTGAGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTAATCGAAAGGCGAAAAGCACTTTGAAAAGAGAGTGAAACAGAAAGTGAAATCGTTGCAGGGGAACCGCATGCGGTCAGACTCCCACGGGGTTCCACCGGCCGGTGTACTCCCCGCCGGAGGGCCAGCATCGGCTTGGGCGGCCGCGGAAGGGCCCTGGGAATTCTGCCCCTCGGGGGTTGTAGCCCGGGGTCGGATGCGGCCAGGCCAGGCCGAGGACCGCGCTCCGAGGGTGCTGGCGTAATGGCAATATGCGAC Natipusilla_naponensis_HM196371 GCTCAGATTTGAAATCTGGCCCGAGTTGTAATCTGCAGAGGATGCTTCGGCAAGCCTCCGGCCCGAGTCCCCTGGGACGGGATGCCGCAGAGGGTGAGAGCCCCGTGTGGGCCGGGGCGCCCCGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGAGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTAATCGAAAGGCGAAAAGCACTTTGAAAAGAGAGTGAAATAGCAAGTGAAATCGTTGCAGGGGAACCGCATGCGGTCAGGCGCCCCCGGGGCTCCGCCGCCCGGTGCACTCCCCGGCGGGGGGCCAGCATCGGTCGTGGCGGCCGCGGAAGGGCCCCGGGAACTCTGCCCCTCGGGGGTTGCAGCCCGGGGCCGGATGCGGCCCGCCGCGACCGAGGACCGCGCTCCGAGGGTGCTGGCGTAATGGCAATATGCGAC Phaeotrichum_benjaminii_AY004340 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGCGCGCGCCGACCGAAGTTCTTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTACGTTCGGCCGCTTCTTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCGCGGGGTATCGTTCGCGCGTATACGCCTCCGCGGCGGGCCAGCATCGGTTTGGGCGACCGGATAAAGGCCCTAGGAATGTGACTCCTTGGAGGTTATAGCCTAGGGTGCAATGCGGCCAGCCTGGACCGAGGTCCGCGCTCCTAGGATGCTGGCGTAATGGTTGTAAGCGGC Spirosphaera_beverwijkiana_HQ696657 GCTCAAATTTGAAATCTGGCCCGAATTGTAATTTGTAGAGGAATGTTCGGCGACGTCTAGGTCTGATTTTTCTGGAAGGAAAAGCCACTGAGGGTGAGAGCCCCGTACGACTGATACTAACCTGTGTACATCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAACGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTAGCAACCAGACTTGAATTACATTCAGCAATTTTGTGTATTTTGTCTATTCAGGCCAGCATCAGTTGTTGCGGTTGGAAAAAAGCATTGGTAATGTGGCTCCTCGGAGGTTATAGACCTTTGCAGAATACAGCCAGCGACGACTGAGGAACGCCTTTGAAGGATGCTGGCATAATGGTTGTTAGCGGC Spirosphaera_minuta_HQ696659 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGTAGAGGATAGTTCGGTGATACCTTGACCCAAGTCTCCTGGAACGGAGTGCCTTGGAGGGTGAGAGCCCCGTACGGTCAGAGGTAGCCTGTGAACTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATTGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGAGCAAAGTTCCGCCGGTCGGTTCATTCTTCTGTATCAGGCCAGCATCGATTTCGTCGGTTGGATAAAGGCCTTGGGAATGTGACTCCTTGGAGGTTATAGCCCATTGCACAATACAGCCTGACGGGATCGAGGACCGCGTTCCTTGGATGCTGGCGTAATGGTTGTTAGCGGC Stomiopeltis_betulae_GU214701 GCTCAGATTTGAAATCTGCCCCGAGTTGTAATCTGCAGAGGAACGTTCGGTCTCGCGCCGGTCCAAGTCTCTTGGAACGGAGCGTCGTGGAGGGTGAGAACCCCGTACGGCCGGTGCCGACCTGTGAACGTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGAGGTTCCCCCCGCGGGGTCACTCCGCCGCGTCAGGCCAGCATCGGTTCGGGCGGCCGGAGAAAGGCGACGGGAATGTGGCTCCTCGGAGGTTATAGCCCGGCGCACAATACGGCCAGCCGGGACCGAGGACCGCGCTCCTAGGATGCTGGCGTAATGGTTGTCAGCGGC Sympoventuria_capensis_DQ885904 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGTAGAGAGTGTCTCGGGTGGGCACCGGTCCAAGTCCCTTGGAACAGGATATCATAGAGGGTGAGAATCCCGTACGGCCGGCCCCCCCGTGTGAGACCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCGGCCAGACTTGCCCATTGCTCAGCCCGTGGGTGTACTCTTCTGGGGCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGACTTCGGGAATGTGGCCCCTCGGGGGTTATAGCCCGTCGTGCAATGCGTCCAGCCCGGACCGAGGCCCGCGTCTCTAGGATGCTGGCGTAATGGCCGTATACGGC Sympoventuria_capensis_DQ885906 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGTAGAGAGTGTCTCGGGTGGGCACCGGTCCAAGTCCCTTGGAACAGGATATCATAGAGGGTGAGAATCCCGTACGGCCGGCCCCCCCGTGTGAGACCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCGGCCAGACTTGCCCATTGCTCAGCCCGTGGGTGTACTCTTCTGGGGCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGACTTCGGGAATGTGGCCCCTCGGGGGTTATAGCCCGTCGTGCAATGCGTCCAGCCCGGACCGAGGCCCGCGTCTCTAGGATGCTGGCGTAATGGCCGTATACGGC Trichodelitschia_bisporula_GU348996 GCTCAAATTTGAAATCGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGACACGCGTCGGCCGAAGTTCTTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGTTCGACTGCTTCTTGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGACTCGCGTAAGGTAGCGTTCGCGCGTATACGCCTCTACGGCGGGCCAGCATCGGTTTGGGCGACCGGATAAAGGCCCTAGGAATGTGGCTCTTCGGAGGTTATAGCCTAGGGTGTAATGCGGCCAGCCCGGACCGAGGTCCGCGCTCCTAGGATGCTGGCGTAATGGTCGTAAGCGGC Trichodelitschia_munkii_DQ384096 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGACACGCGCCGGCCGAAGTTCTTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTACGTTCGGCTGCTTCTTGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCGTAAGGTAGCGTTCGCGCGTAGACGCTTCTACGGCGGGCCAGCATCGGTTTGGGCGACCGGATAAAGGCCCTAGGAATGTGGCTCTTCGGAGGTTATAGCCTAGGGTGCAATGCGGCCAGCCTGGACCGAGGTCCGCGCTCCTAGGATGCTGGCGTAATGGTCGTAAGCGGC Venturia_inaequalis_EU035460 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGAGCCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGGCCGTCGTGCCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCGCGTTGCTCAGCCCGCGGGTGCACTCTTCCGCGGCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGTCGGGAACGTGGCCCCTCGGGGGTTATAGCCCGGCGCGCAATGCGGCCAGCCCGGACCGAGGTTCGCGCTTCTAGGATGCTGGCGTAATGGCCGTAAGCGGC Venturia_tremulae_EU035438 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGAGCCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGGCCGTCGTGCCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCGCGTTGCTCAGCCCGCGGGTGCACTCTTCCGCGGCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGCCGGGAACGTGGCCCCTCGGGGGTTATAGCCCGGCGCGCAATGCGACCAGCCCGGACCGAGGTTCGCGCTTCTAGGATGCTGGCGTAATGGCCGTAAGCGGC Zeloasperisporium_eucalyptorum_GQ303329 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCGTTGCACCGGTTCAAGTGCCTTGGAACAGGCCGTCCTAGAGGGTGAGAGCCCCGTCGGACCGTGCGCGCCCTGTGTAGCTCCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGCGCGGGGTTCAGCCGGCCGGTCCACTCCCTCGTCCCGGGCCAGCATCAGTTGGGGCGGTCGGAGAACGGCGCCGGGAACGTAGCCCCTCGGGGGTTATAGCCCGGCGCACAATGCGACCCGCCCCGACTGAGGATCGCGCTCCTCGGATGCTGGCGTAATGGCCGTGAGCGGC Zeloasperisporium_ficusicola_KT387733 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCGTCGCACCGGCCCAAGTGCCTTGGAACAGGCCGTCCCAGAGGGTGAGAACCCCGTGCGGCCGTGCGCTCCCTGTGTAGCTCCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGCGCGGGGTTCAGCCGGCCGGTCCACTCCCTCGTCCCGGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCGCCGGGAACGTAGCCCCTCGGGGGTTATAGCCCGGCGCACAATGCGGCCCGTCCGGACTGAGGATCTCGCTCCTCGGATGCTGGCGTAATGGCCGTGAGCGGC Zeloasperisporium_hyphopodioides_EU035442 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCGTTGCACCGGCCCAAGTGCCTTGGAACAGGCCGTCCCAGAGGGTGAGAACCCCGTGCGGCCGCGCGCGCCCTGTGTAGCTCCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGCGCGGGGTTCAGCCGGCCGGTCCACTCCCCCGCCCCGGGCCAGCATCAGTTGGGGCGGCCGGAGAACGGCGCCGGGAACGTAGCCCCTCGGGGGTTATAGCCCGGCGCACAATGCGGCCCGCCCCGACTGAGGATCGCGCTCCCCGGATGCTGGCGTAATGGCCGTGAGCGGC Zeloasperisporium_siamense_JQ036228 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCGTCGCACCGGCCCAAGTGCCTTGGAACAGGCCGTCCCAGAGGGTGAGAACCCCGTGCGGCCGTGCGCTCCCTGTGTAGCTCCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGCGCGGGGTTCAGCCGGCCGGTCCACTCCCCCGTCCCGGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCGCCGGGAACGTAGCCCCTCGGGGGTTATAGCCCGGCGCACAATGCGGCCCGTCCGGACTGAGGATCTCGCTCCTCGGATGCTGGCGTAATGGCCGTGAGCGGC Zeloasperisporium_wrightiae_KT387737 GCTCAAATTTGAAATCTGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCGTTGCACCGGTCAAAGTGCCTTGGAACAGGTCGTCCTAGAGGGTGAGAGCCCCGTAGGACCGTGCGCGCCCTGTGTAGCTCCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGCGCGGGGTTCAGCCGGCCGGTCCACTCCCTCGTCCCGGGCCAGCATCAGTTGGGACGGTTGGAGAACGGCGCCGGGAACGTAGCCCCTCGGGGGTTATAGCCCGGCGCACAATGCGACCTGTCCCGACTGAGGATCGCGCTCCTCGGATGCTGGCGTAATGGCCGTGAGCGGC ; END; BEGIN TREES; TITLE Phylogeny_of_Hamatispora; LINK TAXA = Taxa1; TRANSLATE 1 Asterina_phenacis_GU586217, 2 Asterina_weinmanniae_GU586218, 3 Chaetothyriothecium_elegans_KF268420, 4 Condylospora_vietnamensis_LC146724, 5 Fusicladium_pini_EU035436, 6 Fusicladium_ramoconidii_EU035439, 7 Microthyrium_buxicola_KT306551, 8 Microthyrium_microscopicum_GU301846, 9 Microthyrium_propagulensis_KU948989, 10 Natipusilla_decorospora_HM196369, 11 Natipusilla_limonensis_HM196370, 12 Natipusilla_naponensis_HM196371, 13 Phaeotrichum_benjaminii_AY004340, 14 Spirosphaera_beverwijkiana_HQ696657, 15 Spirosphaera_minuta_HQ696659, 16 Stomiopeltis_betulae_GU214701, 17 Sympoventuria_capensis_DQ885904, 18 Sympoventuria_capensis_DQ885906, 19 Trichodelitschia_bisporula_GU348996, 20 Trichodelitschia_munkii_DQ384096, 21 Hamatispora_phuquocensis, 22 Venturia_inaequalis_EU035460, 23 Venturia_tremulae_EU035438, 24 Zeloasperisporium_eucalyptorum_GQ303329, 25 Zeloasperisporium_ficusicola_KT387733, 26 Zeloasperisporium_hyphopodioides_EU035442, 27 Zeloasperisporium_siamense_JQ036228, 28 Zeloasperisporium_wrightiae_KT387737; TREE Fig._4 = [&R] ((2:0.03573,1:0.03523):0.05074,((((6:0.0,5:0.0)1000:0.03872,(18:0.0,17:0.0)1000:0.05518)928:0.01969,(22:0.00151,23:0.0026)1000:0.02632)976:0.02017,((((26:0.00996,(28:0.01075,24:0.00583)998:0.01423)657:0.00405,(25:0.00205,27:0.0)998:0.01497)1000:0.04551,((11:0.0058,10:0.00452)1000:0.02732,12:0.03957)1000:0.1097)925:0.01569,((13:0.01904,(19:0.01288,20:0.00791)996:0.01928)1000:0.06905,((16:0.04004,3:0.09461)761:0.01009,((7:0.08574,(9:0.02643,(8:0.01277,14:0.01014)999:0.023)1000:0.07108)878:0.02369,(15:0.05521,(21:0.05986,4:0.09937)757:0.01573)650:0.01407)998:0.04188)991:0.02533)721:0.01172)527:0.0082):0.00267)1000; END;