#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:28 GMT TreeBASE (cc) 1994-2008 Study reference: Takashima Y., Degawa Y., Ohta H., & Narisawa K. 2018. Mortierella sugadairana, a new homothallic species related to the firstly described heterothallic species in the genus. Mycoscience, 59(3): 200-205. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21369] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=25; TAXLABELS 'Mortierella basiparvispora CBS_517.72_JX976048' 'Mortierella chienii CBS_287.96_JX976013' 'Mortierella chienii CBS_289.96_JX975898' 'Mortierella chienii CBS_290.96_JX976075' 'Mortierella jenkinii CBS_188.73_JX975999' 'Mortierella jenkinii CBS_666.75C_JX975873' 'Mortierella jenkinii CBS_667.70_JX976088' 'Mortierella jenkinii CBS_850.70_JX975849' 'Mortierella jenkinii CBS_965.73C_JX976117' 'Mortierella parvispora CBS_304.52_JX975859' 'Mortierella parvispora CBS_311.52_JX976076' 'Mortierella parvispora CBS_315.61_JX976104' 'Mortierella parvispora CBS_316.61_JX976029' 'Mortierella parvispora CBS_445.68_JX976049' 'Mortierella parvispora FSU_10552_JX976009' 'Mortierella parvispora FSU_10712_JX975941' 'Mortierella parvispora FSU_10730_JX975916' 'Mortierella parvispora FSU_10753_JX976016' 'Mortierella parvispora FSU_10758_JX976005' 'Mortierella parvispora FSU_10759_JX975934' 'Mortierella parvispora FSU_10789_JX976065' 'Mortierella parvispora FSU_2736_JX976093' 'Mortierella sugadairana SUT174_MF510830' 'Mortierella sugadairana YTM128_LC219341' 'Mortierella sugadairana YTM39_LC219340' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=55; TAXLABELS 'Mortierella alliacea CBS_106.78_KC018349' 'Mortierella alliacea CBS_894.68_JX976148' 'Mortierella basiparvispora CBS_517.72_JX976167' 'Mortierella basiparvispora CBS_518.72_KC018343' 'Mortierella capitata CBS_648.68_HQ667418' 'Mortierella chienii CBS_124.71_KC018336' 'Mortierella chienii CBS_287.96_KC018427' 'Mortierella chienii CBS_289.96_JX976161' 'Mortierella chienii CBS_290.96_KC018373' 'Mortierella chienii CBS_292.96_JX976153' 'Mortierella chienii CBS_554.73_KC018381' 'Mortierella cystojenkinii CBS_456.71_HQ667424' 'Mortierella cystojenkinii CBS_660.82_KC018325' 'Mortierella elongatula CBS_488.70_HQ667425' 'Mortierella elongatula CBS_661.70_KC018431' 'Mortierella fimbricystis CBS_943.70_JX976172' 'Mortierella jenkinii CBS_188.73_KC018389' 'Mortierella jenkinii CBS_667.70_KC018422' 'Mortierella jenkinii CBS_850.70_KC018352' 'Mortierella jenkinii CBS_965.73C_JX976139' 'Mortierella macrocystis CBS_314.85_JX976169' 'Mortierella macrocystis CBS_431.81_KC018437' 'Mortierella macrocystis CBS_937.69_KC018341' 'Mortierella macrocystopsis CBS_302.87_KC018362' 'Mortierella macrocystopsis CBS_387.91_JX976144' 'Mortierella macrocystopsis CBS_528.87_JX976164' 'Mortierella parvispora CBS_311.52_HQ667373' 'Mortierella parvispora CBS_445.68_KC018414' 'Mortierella parvispora FSU834_HQ667374' 'Mortierella parvispora FSU835_HQ667375' 'Mortierella parvispora FSU_10552_KC018294' 'Mortierella parvispora FSU_2736_KC018295' 'Mortierella pulchella CBS_205.86_KC018366' 'Mortierella pulchella CBS_312.52_HQ667427' 'Mortierella pulchella CBS_675.88_KC018440' 'Mortierella selenospora CBS_452.88_KC018429' 'Mortierella selenospora CBS_811.68_HQ667419' 'Mortierella sossauensis CBS_110515_KC018351' 'Mortierella sossauensis CBS_110815_KC018450' 'Mortierella sossauensis CBS_153.76C_JX976146' 'Mortierella sossauensis CBS_176.74_KC018428' 'Mortierella sossauensis CBS_281.71_KC018447' 'Mortierella sossauensis CBS_890.72_KC018385' 'Mortierella sossauensis CBS_898.68_KC018374' 'Mortierella sossauensis CBS_915.70_KC018330' 'Mortierella sugadairana SUT174_MF510830' 'Mortierella sugadairana YTM128_LC219341' 'Mortierella sugadairana YTM39_LC219340' 'Mortierella turficola CBS_430.76_KC018444' 'Mortierella turficola CBS_431.76_KC018333' 'Mortierella turficola CBS_432.76_HQ667426' 'Mortierella turficola CBS_433.76_KC018424' 'Mortierella turficola CBS_547.76_KC018339' 'Mortierella turficola CBS_581.80_KC018409' 'Mortierella wolfii CBS_614.70_HQ667420' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46867] TITLE Msugadairana_ITS_combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=531; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Mortierella basiparvispora CBS_517.72_JX976048' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella chienii CBS_287.96_JX976013' GTGTGTATCGTAACAAACAACCTAATATGATTTTTAGCAAGACCGTCTGAATGCATCTCATTAGCCGATCTGCGAAAGCAGGGAGGAAAAAAAAAT-GAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGAGAACATCTCGAACCCTTTTTTT---GAGGGATCGAGGAACTGAGTAATTCCGGTTCTTGTCAA------CTGGGTTACTTGAAATGAGGGTGCATCAATCTCCTTCCTTGGCCTGAAAGCATATCTATTTAGTCCCGTCAAAAGGATTATTGCCTTTGCTGAAAGCGCTATAGGGGAGCCTGAAGGAGTCTTGCCTCGAATACAGGAACTCTAA-----------------TCATAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella chienii CBS_289.96_JX975898' GTGTGCATCGTAACAAACAACCTAATATGATTTTTAGCAAGACCGTCTGAATGCATCTCATTAGCCGATCTGCGAAAGCGGAAAGGAAAAAAAAAT-GAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGAGAACATCTCGAACCCTTTTTTTAAAGAGGGATCGAGGAACTGAGTAATTCCGGTTCTCGTCAA------CTGGGTTACTTGAAATGAGGGTGCATCAATCTCCTTCCTTGGCCTGAAAGCATATCTATTTAGTCCCGTCAAAAGGATTATTA-CTTTGCTGAAAGCGCTATAGGGGAGCCTGAAGGAGTCTTGCCTCGAATACAGGAACTCTAA-----------------TCATAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella chienii CBS_290.96_JX976075' GTGTGCATCGTAACAAACAACCTAATATGATTTTTTGCAAGACCGTCTGAATGCATCTCATTAGCCGATCTGCGCAAGCAGAGAGGGAAAAAAAAT-GAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGAGAACATCTCGAACCCTTTTTTTAAAGAGGGATCGAGGAACTGAGTAATTCCGGTTCTCGTCAA------CTGGGTTACTTGAAATGAGGGTGCATCAATCTCCTTCCTTGGCCTGAAAGCATATCTATTTAGTCCCGTCAAAAGGATTATTGCCTTTGCTGAAAGCGCTATAGGGGAGCCTGAAGGAGTCTTGCCTCGAATACAGGAACTCTAA-----------------TCATAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella jenkinii CBS_188.73_JX975999' GTGTGCAATGTTGTGTGGAATTTCAGAGATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATACAAAGGTCGAATGTGCTACATGCTGACTGATGCAGGATTACCAAGTTTCGTCAAAAGAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella jenkinii CBS_666.75C_JX975873' GTGTGCAATGTTGTGTGAAC-TTTAAAAAGTTCATACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCCTTCTTGAGAAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATACAGGTCGAATGTTCTATATGCTGACTGATGCAGGATTACCAAGTTTTACTAGCTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella jenkinii CBS_667.70_JX976088' GTGTGCAATGTTGTGTGGAATTTCAGAGATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATACAAAGGTCGAATGTGCTACATGCTGACTGATGCAGGATTACCAAGTTTCGTCAAAAGAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella jenkinii CBS_850.70_JX975849' GTGTGCAATGTTGTGTGGAATTTCAGAGATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATACAAAGGTCGAATGTGCTACATGCTGACTGATGCAGGATTACCAAGTTTCGTCAAAAGAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella jenkinii CBS_965.73C_JX976117' GTGTGCAATGTTGTGTGAAC-TTTAAAAAGTTCATACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCCTTCTTGAGAAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATACAGGTCGAATGTTCTATATGCTGACTGATGCAGGATTACCAAGTTTTACTAGCTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora CBS_304.52_JX975859' GTGTGCAATGTTGTGTGGAATTCGAAGAATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAAGTGCAGCTGGACATTCTTCTGAGCTAAAATCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATAAAGGTTGAATGTGCTACATGCTGACTGATGC-GGATTACCAAGTTTCGTCAAAATAAATTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora CBS_311.52_JX976076' GTGTGCAATGTTGTGTGGAATTTCAGAGATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATACAAAGGTCGAATGTGCTACATGCTGACTGATGCAGGATTACCAAGTTTCGTCAAAAGAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora CBS_315.61_JX976104' GTGTGCAATGTTGTGCTAGAGATCGGATTTCTTGCACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAACTCTCTTCTCTCGAGAAGTGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATAAAGGTCGATTTTTCTCTATGCTGACTGATGCAGGATTACCAAGGGTCTCTAGTAGACACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora CBS_316.61_JX976029' GTGTGCAATGGTGTGCTAGAGATCGGATCTCTTGCACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAAAGTATGCTTGTTTGAGTATCAGTAAACACCTCAACTCTCTTCTCTCGAGAAGTGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAACTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATAAAGGTCGATTTTTCTCTATGCTGACTGATGCAGGATTACCAAGGGTCTCTAGTAGACACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora CBS_445.68_JX976049' GTGTGCAATGTTGTGTGGAATTCGAAGAATTTCACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCGACATTCGTGTTGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGGGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATAAAGGTTGAATGTGCTACATGCTGACTGATGCAGGATTACCAAGTTTCGTCAAAAGAAATTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10552_JX976009' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTACTATACGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10712_JX975941' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGCGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10730_JX975916' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGCGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10753_JX976016' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTACTATACGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10758_JX976005' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTACTATACGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10759_JX975934' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGCGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_10789_JX976065' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTACTATACGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella parvispora FSU_2736_JX976093' GTGTGCAATGTTGTGTGGACTTTTAAAAAGTTCATACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAATCTCTTTCTTGAGAAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAACATACAGGTCGAATGTTCTATATGCTGACTGATGCAGGATTACCAAGTTTTACTAGCTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella sugadairana SUT174_MF510830' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGCGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella sugadairana YTM128_LC219341' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGCGCTATATGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA 'Mortierella sugadairana YTM39_LC219340' GTGTGCAATGTTGTGTTTCTTTTCGAGAA----ACACCTACACCAACCTATAACCTTGAACCACTTTGTCTGAAAAACTATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACTCTCTGGTATTCCGGAGAGTATGCTTGTTTGAGTATCAGTAAACACCTCAAGTCTCTTCTCTAGAGAAGAGAATTGGACTTGAGCAATCCCAACTCTTTGCAAAAAGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTTCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTGCTCTAGCTAATATAAAGGTCGAATGTACTATACGCTGACTGATGCAGGATTACCAAGTTTTACCTAGTAAAACTTGTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46868] TITLE Msugadairana_LSU_combined; LINK TAXA = Taxa2; DIMENSIONS NCHAR=633; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Mortierella alliacea CBS_106.78_KC018349' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATAGGGGAGGTGTGGACCGTAAGGCCGCTCTTTCTTATATCTTTCTCGCCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella alliacea CBS_894.68_JX976148' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATAGGGGAGGTGTGGACCGTAAGGCCGCTCTTTCTTATATCTTTCTCGCCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella basiparvispora CBS_517.72_JX976167' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTGGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAGTTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTTCAGTTGTGCT 'Mortierella basiparvispora CBS_518.72_KC018343' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTGCCGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCCTTTCTATACTCGTTCAATTGAGCT 'Mortierella capitata CBS_648.68_HQ667418' AATTTAAAATCTGGCCGGGTTACAGTTGTAGTTTATAGAAGTGTTTTCGGCGGCAACCTGGGTACAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGACCCAGTGGATGCTGCTATGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGGCACCAGTCATGCGTTCAGGAAATCAGTCTATCGAGGTGGGGAGTGGCAGGAGTTTGGACCGCAAGGCCAACTTTTGTTGCATTTCTATTTGGATGGATGCACTTTTCTGTATGCAGGTCAACATCAGTTTTGTTCGCCGGACAAAACCCCAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACGGTGGACGAGACTGAGGCTTT--CAGTGTGTGCTCTCGGGCAAGGCTGACCGGGTGCTATGAGCCAGTACGGGGTACAATACATGTATTTTGCTTCGTGTCTGGCTTGTACTCGCTCGAATCAGCT 'Mortierella chienii CBS_124.71_KC018336' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTTAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGAGGAGCTATGAGGGGTTCGGAGCGCAAGCCCGGCCTTTTTGGCATCCGTATCACAATGGGTGCACTTTTTCGTTTGCAGGTCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTCTTGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCTTACACTCGCTCATCTCTACT 'Mortierella chienii CBS_287.96_KC018427' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTTAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGAGGAGCTATGGGGGGTTCGGAGCGCAAGCCCGGCCTTTTTGGCATCCGTATCACAATGGGTGCACTTTTTCGTTTGCAGGTCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTCTTGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCTTACACTCGCTCATCTCTACT 'Mortierella chienii CBS_289.96_JX976161' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTTAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGAGGAGCTATGAGGGGTTCGGAGCGCAAGCCCGGCCTTTTTGGCATCCGTATCACAATGGGTGCACTTTTTCGTTTGCAGGTCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTCTTGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCTTACACTCGCTCATCTCTACT 'Mortierella chienii CBS_290.96_KC018373' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTTAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGAGGAGCTATGGGAGGTTCGGAGCGCAAGCCCGGCCTTTTTGGCATCCGTATCACAATGGGTGCACTTTTTCGTTTGCAGGTCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTCTTGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCTTACACTCGCTCATCTCTACT 'Mortierella chienii CBS_292.96_JX976153' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATGGAGGGTGAGAATCCCGTCTTTGACCCAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGGGGAGCTATTGGAGGTTCGGAGCGCAAGCCCGGCCTTTGTGGCATCTTTGTCACAATGGGTGCACTTTTTCGTTTGCAGGCCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTTTCGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCCTGCACTCGCTCATCTCTACT 'Mortierella chienii CBS_554.73_KC018381' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATGGAGGGTGAGAATCCCGTCTTTGACCCAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGGGGAGCTATTGGAGGTTCGGAGCGCAAGCCCGGCCTTTGTGGCATCTTTGTCACAATGGGTGCACTTTTTCGTTTGCAGGCCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTTTCGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCCTGCACTCGCTCATCTCTACT 'Mortierella cystojenkinii CBS_456.71_HQ667424' AATTTAAAATCTGACTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGTTGTGGACCGCAAGGCCGCTCTTTTTCATATCTCTTTTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTTGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella cystojenkinii CBS_660.82_KC018325' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACAAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTCGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella elongatula CBS_488.70_HQ667425' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTAAAAGTCCTTTGGAATAGGGCATCACAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGCTGGGAAATCAGTCTCTGACGAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCTGCTCTTTTTCATATCTTTTTCGGCAGGGATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCCTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTGGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella elongatula CBS_661.70_KC018431' AATTTAAAATCTGACTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGTTGTGGACCGCAAGGCCGCTCTTTTTCATATCTCTTTTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTTGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella fimbricystis CBS_943.70_JX976172' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella jenkinii CBS_188.73_KC018389' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGTTCAATTGAGCT 'Mortierella jenkinii CBS_667.70_KC018422' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGTTCAATTGAGCT 'Mortierella jenkinii CBS_850.70_KC018352' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGTTCAATTGAGCT 'Mortierella jenkinii CBS_965.73C_JX976139' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGAGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCGGTTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGCTTAATTGTGCT 'Mortierella macrocystis CBS_314.85_JX976169' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACAAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTCGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGCTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella macrocystis CBS_431.81_KC018437' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACAAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTCGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGCTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella macrocystis CBS_937.69_KC018341' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACAAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTCGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGCTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella macrocystopsis CBS_302.87_KC018362' AATTTAAAATCTGACTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACATGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTTGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella macrocystopsis CBS_387.91_JX976144' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTAAAAGTCCTTTGGAATAGGGCATCACAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGCTGAGAAATCAGTCTCTGACGAGGGGGAATGGGAGAGGTGTGGACCGCAAGGCTGCTCTTTTTCATATCTTTTTCGGCAGGGATGCACTTTTTCTTTCGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTGGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella macrocystopsis CBS_528.87_JX976164' AATTTAAAATCTGACTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTAAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACATGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTTTCATATCTTTTGTGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGAAAGGTGATAGCTTAGGCTATGTTATAGTCCAAGAGCGATACGGTGGAGCGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGAGTACAATACATGTATTTTGCTTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella parvispora CBS_311.52_HQ667373' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGTTCAATTGAGCT 'Mortierella parvispora CBS_445.68_KC018414' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGGGGGAATGGGAGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCACAGGTCAACATCAGTTTCTTCTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGATGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGTTTAGTTGAGCT 'Mortierella parvispora FSU834_HQ667374' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTTGGGTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTCTCTAGTCAGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCTGCTGGGCGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCCTTTCTATACTCGTTTAGTTGTGCT 'Mortierella parvispora FSU835_HQ667375' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTTGGGTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTCATATCTCTCTAGTCAGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCTGCTGGGCGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTCTAGTTGTGCT 'Mortierella parvispora FSU_10552_KC018294' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTGGTTGGAAAATCAGTGTTCAACTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTTCAGTTGAGCT 'Mortierella parvispora FSU_2736_KC018295' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTAGTTGGAAAATCAGTGTTCAATTGGAGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCCGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCGGTTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCTTCGTGTCTTTTCTATACTCGCTTAATTGTGCT 'Mortierella pulchella CBS_205.86_KC018366' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGGCGAGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTTCTATATTCTTTTCGTCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella pulchella CBS_312.52_HQ667427' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGGCGAGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTTCTATATTCTTTTCGTCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella pulchella CBS_675.88_KC018440' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGGCGAGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTTCTATATTCTTTTCGTCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella selenospora CBS_452.88_KC018429' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATGGAGGGTGAGAATCCCGTCTTTGACCCAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGTGGGGAGCTATTGGAGGTTCGGAGCGCAAGCCCGGCCTTTGTGGCATCTTTGTCACAATGGGTGCACTTTTTCGTTTGCAGGCCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGCGGACTGAGG-AGTCGCAGCGTGTGCTTTCGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCCTGCACTCGCTCATCTCTACT 'Mortierella selenospora CBS_811.68_HQ667419' AATTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATGGAGGGTGAGAATCCCGTCTTTGACCTAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGGCGAGGAGCTATTGGGGGTTCGGAGCGCAAGCCCGGCCTTTGTGGCATCTTTGTCACAATGGGTGCACTTTTTCGTTTGCAGGCCAACATCAGTTTGCTTTGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTTTCGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCCTACACTCGCTCATCTCTACT 'Mortierella sossauensis CBS_110515_KC018351' AATTTGAAATCTGGCTGGTTTACAGTTGTAATTTAAAGAAGCGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACCTAGTGCATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGACACCAGTCATGTGGGTGGAAAATCAGTCTTTTGCATTGGGGAGTTGTAAGGGTTCGGACCGCAAGGCCGGCTTTTGCTTCATCTTTGGTGTAAGTGATGCACTTTTTCATCTACAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCCAGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGAAGGGGACTGAGGTTTTCGCAGCGTGTGCTCTCGGGCAAGGCTGGATGGGTGCTATGGGATCGTTCGGGGTACAATGCCTGCATTTTGCTTCGTGTCTTTTCTATACTCGCTCAACTCAGCT 'Mortierella sossauensis CBS_110815_KC018450' AATTTGAAATCTGGCTGGTTTACAATTGTAGTTTATAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGGAACCAGTCATGCGGTTGGGAAATCAGTGTTTTGCAAGGGGGAATGGGGGAGGTGTGGACCGTAAGGCTGCTCTTTCCTATATCTTTTTTGTAAGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACCCTTGAGAAGGTAGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella sossauensis CBS_153.76C_JX976146' AATTTGAAATCTGGCTGGTTTACAATTGTAGTTTATAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGGAACCAGTCATGCGGTTGGGAAATCAGTGTTTTGCAAGGGGGAATGGGGGAGGTGTGGACCGTAAGGCTGCTCTTTCCTATATCTCTTTTGTAAGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACCCTTGAGAAGGTAGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella sossauensis CBS_176.74_KC018428' AATTTGAAATCTGGCTGGTTTACAGTTGTAATTTAAAGAAGCGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACCTAGTGCATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGACACCAGTCATGTGGGTGGAAAATCAGTCTTTTGCATTGGGGAGTTGTAAGGGTTCGGACCGCAAGGCCGGCTTTTGCTTCATCTTTGGTGTAAGTGATGCACTTTTTCATCTACAGGTCAACATCAGTTTCTTTTACTGGACAAAACTCCAGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGAAGGGGACTGAGGTTTTCGCAGCGTGTGCTCTCGGGCAAGGCTGGATGGGTGCTATGGAATCGTTCGGGGTACAATGCCTGCATTTTGCTTCGTGTCTTTTCTATACTCGCTCAACTCAGCT 'Mortierella sossauensis CBS_281.71_KC018447' AATTTGAAATCTGGCTGGTTTACAATTGTAGTTTATAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGGAACCAGTCATGCGGTTGGGAAATCAGTGTTTTGCAAGGGGGAATGGGGGAGGTGTGGACCGTAAGGCTGCTCTTTCCTATATCTTTTTTGTAAGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACCCTTGAGAAGGTAGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella sossauensis CBS_890.72_KC018385' AATTTGAAATCTGGCTGGTTTACAATTGTAGTTTATAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGGAACCAGTCATGCGGTTGGGAAATCAGTGTTTTGCAAGGGGGAATGGGGGAGGTGTGGACCGTAAGGCTGCTCTTTCCTATATCTTTTTTGTAAGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACCCTTGAGAAGGTAGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella sossauensis CBS_898.68_KC018374' AATTTGAAATCTGGCTGGTTTACAGTTGTAATTTAAAGAAGCGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACCTAGTGCATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGACACCAGTCATGTGGGTGGAAAATCAGTCTTTTGCATTGGGGAGTTGTAAGGGTTCGGACCGCAAGGCCGGCTTTTGCTTCATCTTTGGTGTAAGTGATGCACTTTTTCATCTACAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCCAGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGAAGGGGACTGAGGTTTTCGCAGCGTGTGCTCTCGGGCAAGGCTGGATGGGTGCTATGGGATCGTTCGGGGTACAATGCCTGCATTTTGCTTCGTGTCTTTTCTATACTCGCTCAACTCAGCT 'Mortierella sossauensis CBS_915.70_KC018330' AATTTGAAATCTGGCTGGTTTACAATTGTAGTTTATAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGGAACCAGTCATGCGGTTGGGAAATCAGTGTTTTGCAAGGGGGAATGGGGGAGGTGTGGACCGTAAGGCTGCTCTTTCCTATATCTTTTTTGTAAGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTCTGCTGGACAAAACCCTTGAGAAGGTAGCAGCTTTGGCTGTGTTATAGCTCTGGGGCGATACAGTGGAGGGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGGGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTCTATACTCGCTCAACTCGGCT 'Mortierella sugadairana SUT174_MF510830' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTGGTTGGAAAATCAGTGTTCAACTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTTCAGTTGAGCT 'Mortierella sugadairana YTM128_LC219341' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTGGTTGGAAAATCAGTGTTCAACTGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTTCAGTTGAGCT 'Mortierella sugadairana YTM39_LC219340' AATTTAAAATCTGGCTGGTTTACAATTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATTTGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGTGGTTGGAAAATCAGTGTTCAACTGGGGGGAAGGGGGGAGGTGTGGACCGCAAGGCTGCTCTTTTCTATATCTCTTTTGTTGGGCATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTCTTTTGCTGGACAAAACTCTTGAGAAGGTAGCAGCTTAGGCTGTGTTATAGCTCTGGAGCGATACAGTGGAGGAGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCCAATTGGGTGCTATGGGATCGTTCGGGGTACAATACATGTATTTTGCCTCGTGTCTTTTCTATACTCGTTCAGTTGAGCT 'Mortierella turficola CBS_430.76_KC018444' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella turficola CBS_431.76_KC018333' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella turficola CBS_432.76_HQ667426' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella turficola CBS_433.76_KC018424' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella turficola CBS_547.76_KC018339' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella turficola CBS_581.80_KC018409' AATTTAAAATCTGGCTGGTTTACAGTTGTAGTTTAAAGAAGCGTTTTCGGTGGCAGTCTCGGTATAAATCCTTTGGAATAGGGTATCATAGAGGGTGAGAATCCCGTCTTTGACTGAGAATATGCTACTATGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGCTTGAAACCAGTCATGCGGTTGGGAAATCAGTCTCTGACGGGGGGGAATGGGGGAGGTGTGGACCGCAAGGCCGCTCTTTCTTATATCTTTCTCGGCAGGGATGCACTTTTTCTTCTGCAGGTCAACATCAGTTTGCTTTGCCGGACAAAACTCTTGGGAAGGTGACAGCTTAGGCTGTGTTATAGCCCTTGAGCGATACGGTGGAGTGGACTGAGGTTTTCGCAGCATGTGCTCTCGGGCAAGGCTGATTGGGTGCTATGAGATCGTTCAGGGTACAATACATGTATTTTGCCTTGTGTCTTTTTTATACTCGCTCAACTCGGCT 'Mortierella wolfii CBS_614.70_HQ667420' ATTTTGAAATCTGGCTGGTTTACAGTTGTAGTTTATAGAGGTGTTTTCGGTGGCAGCCTGGGTATAAATCCTTTGGAATAGGGTATCATGGAGGGTGAGAATCCCGTCTTTGACCCAGGTTATGCTACTATGTGATACATCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTGCGTGAAATTGTTGAAAGGGAAACGTTTGAAGCCAGCCGTGCGGGCGGAAAATCAGCCTCTGTGATGAGGAGCTATTGGGGGTTCGGAGCGCAAGCCCGGCCTTTGTGGAATCTTTGTCACAATGGGTGCACTTTTTCGTTTGCAGGCCAACATCAGTTTGCTTCGCTGGAAAAGGCCTTAGGGAATGTGGCAGCTTTGGCTGTGTTATAGCCCTGAGGAGATACAGTGGAGTGGACTGAGG-AGTCGCAGCGTGTGCTCTTGGGCAAGGTAGACTGGGTGCTGTGGGATGGGGCGAGGTACAATGCATGCATTTTGCTTCGTCTTTTTCCTGCACTCGCTCATCTCTACT ; END; BEGIN TREES; TITLE Msugadairana_ITS_RAxML; LINK TAXA = Taxa1; TRANSLATE 1 'Mortierella sugadairana YTM39_LC219340', 2 'Mortierella basiparvispora CBS_517.72_JX976048', 3 'Mortierella chienii CBS_287.96_JX976013', 4 'Mortierella chienii CBS_289.96_JX975898', 5 'Mortierella chienii CBS_290.96_JX976075', 6 'Mortierella jenkinii CBS_188.73_JX975999', 7 'Mortierella jenkinii CBS_667.70_JX976088', 8 'Mortierella jenkinii CBS_850.70_JX975849', 9 'Mortierella jenkinii CBS_965.73C_JX976117', 10 'Mortierella parvispora FSU_2736_JX976093', 11 'Mortierella jenkinii CBS_666.75C_JX975873', 12 'Mortierella parvispora CBS_311.52_JX976076', 13 'Mortierella parvispora CBS_445.68_JX976049', 14 'Mortierella parvispora FSU_10552_JX976009', 15 'Mortierella parvispora CBS_315.61_JX976104', 16 'Mortierella parvispora CBS_316.61_JX976029', 17 'Mortierella parvispora CBS_304.52_JX975859', 18 'Mortierella parvispora FSU_10759_JX975934', 19 'Mortierella parvispora FSU_10712_JX975941', 20 'Mortierella parvispora FSU_10730_JX975916', 21 'Mortierella parvispora FSU_10758_JX976005', 22 'Mortierella parvispora FSU_10753_JX976016', 23 'Mortierella parvispora FSU_10789_JX976065', 24 'Mortierella sugadairana YTM128_LC219341', 25 'Mortierella sugadairana SUT174_MF510830'; TREE ITS = [&R] ((4:7.7575616112451E-7,(3:0.0065967796662632396,5:0.006608820944239991)67:0.00652101101135554)100:0.5589298393578042,((10:7.7575616112451E-7,(9:7.7575616112451E-7,11:7.7575616112451E-7)97:0.004009393350920007)94:0.008516010494585556,(((15:7.7575616112451E-7,16:0.007931259630016764)100:0.0572851823321263,((13:7.7575616112451E-7,17:0.005960422260651489)100:0.01155781100453491,(6:7.7575616112451E-7,(7:7.7575616112451E-7,(8:7.7575616112451E-7,12:7.7575616112451E-7)21:7.7575616112451E-7)22:7.7575616112451E-7)99:0.006743237237640059)99:0.028197085332684058)52:0.01255004498101524,(2:0.002000783246962693,((1:7.7575616112451E-7,((14:7.7575616112451E-7,21:7.7575616112451E-7)22:7.7575616112451E-7,(22:7.7575616112451E-7,23:7.7575616112451E-7)31:7.7575616112451E-7)71:0.002013454265589463)81:0.004046649285837292,((24:7.7575616112451E-7,25:7.7575616112451E-7)69:7.7575616112451E-7,(20:7.7575616112451E-7,(18:7.7575616112451E-7,19:7.7575616112451E-7)28:7.7575616112451E-7)68:0.0020069383386370813)62:0.0020167874330004492)42:7.7575616112451E-7)92:0.02049556231918106)70:0.024492084755011977)100:0.5589298393578042); END; BEGIN TREES; TITLE Msugadairana_LSU_RAxML; LINK TAXA = Taxa2; TRANSLATE 1 'Mortierella parvispora CBS_311.52_HQ667373', 2 'Mortierella parvispora FSU834_HQ667374', 3 'Mortierella parvispora FSU835_HQ667375', 4 'Mortierella elongatula CBS_488.70_HQ667425', 5 'Mortierella turficola CBS_432.76_HQ667426', 6 'Mortierella pulchella CBS_312.52_HQ667427', 7 'Mortierella jenkinii CBS_965.73C_JX976139', 8 'Mortierella macrocystopsis CBS_387.91_JX976144', 9 'Mortierella sossauensis CBS_153.76C_JX976146', 10 'Mortierella alliacea CBS_894.68_JX976148', 11 'Mortierella chienii CBS_292.96_JX976153', 12 'Mortierella chienii CBS_289.96_JX976161', 13 'Mortierella macrocystopsis CBS_528.87_JX976164', 14 'Mortierella basiparvispora CBS_517.72_JX976167', 15 'Mortierella macrocystis CBS_314.85_JX976169', 16 'Mortierella fimbricystis CBS_943.70_JX976172', 17 'Mortierella parvispora FSU_10552_KC018294', 18 'Mortierella parvispora FSU_2736_KC018295', 19 'Mortierella cystojenkinii CBS_660.82_KC018325', 20 'Mortierella turficola CBS_431.76_KC018333', 21 'Mortierella turficola CBS_547.76_KC018339', 22 'Mortierella macrocystis CBS_937.69_KC018341', 23 'Mortierella alliacea CBS_106.78_KC018349', 24 'Mortierella jenkinii CBS_850.70_KC018352', 25 'Mortierella macrocystopsis CBS_302.87_KC018362', 26 'Mortierella chienii CBS_290.96_KC018373', 27 'Mortierella sossauensis CBS_898.68_KC018374', 28 'Mortierella chienii CBS_554.73_KC018381', 29 'Mortierella sossauensis CBS_890.72_KC018385', 30 'Mortierella jenkinii CBS_188.73_KC018389', 31 'Mortierella turficola CBS_581.80_KC018409', 32 'Mortierella parvispora CBS_445.68_KC018414', 33 'Mortierella jenkinii CBS_667.70_KC018422', 34 'Mortierella turficola CBS_433.76_KC018424', 35 'Mortierella chienii CBS_287.96_KC018427', 36 'Mortierella sossauensis CBS_176.74_KC018428', 37 'Mortierella selenospora CBS_452.88_KC018429', 38 'Mortierella elongatula CBS_661.70_KC018431', 39 'Mortierella macrocystis CBS_431.81_KC018437', 40 'Mortierella pulchella CBS_675.88_KC018440', 41 'Mortierella turficola CBS_430.76_KC018444', 42 'Mortierella sossauensis CBS_281.71_KC018447', 43 'Mortierella selenospora CBS_811.68_HQ667419', 44 'Mortierella wolfii CBS_614.70_HQ667420', 45 'Mortierella sugadairana YTM39_LC219340', 46 'Mortierella sugadairana YTM128_LC219341', 47 'Mortierella pulchella CBS_205.86_KC018366', 48 'Mortierella capitata CBS_648.68_HQ667418', 49 'Mortierella basiparvispora CBS_518.72_KC018343', 50 'Mortierella sossauensis CBS_110815_KC018450', 51 'Mortierella sossauensis CBS_110515_KC018351', 52 'Mortierella sossauensis CBS_915.70_KC018330', 53 'Mortierella chienii CBS_124.71_KC018336', 54 'Mortierella cystojenkinii CBS_456.71_HQ667424', 55 'Mortierella sugadairana SUT174_MF510830'; TREE LSU = [&R] (48:0.08559226191036323,(((43:0.006193622984290607,(37:0.0016817263594892207,(11:1.55618658587356E-6,28:1.55618658587356E-6)75:1.55618658587356E-6)90:0.0040643510762993105)35:0.0017421553771568617,(44:0.00596532756578774,(26:0.0016957577260178509,(35:1.55618658587356E-6,(12:1.55618658587356E-6,53:1.55618658587356E-6)75:0.0016958415005409748)39:1.55618658587356E-6)92:0.018891998942670643)32:0.0016274044955229786)100:0.1885875539118366,((36:0.005092991148080201,(27:1.55618658587356E-6,51:1.55618658587356E-6)96:1.55618658587356E-6)98:0.039448876305109556,(((9:1.55618658587356E-6,(52:1.55618658587356E-6,(42:1.55618658587356E-6,(29:1.55618658587356E-6,50:1.55618658587356E-6)18:1.55618658587356E-6)15:1.55618658587356E-6)64:0.0016921417189913793)90:0.018040070085850034,((45:0.0017042710039234304,(17:1.55618658587356E-6,(46:1.55618658587356E-6,55:1.55618658587356E-6)30:1.55618658587356E-6)58:1.55618658587356E-6)81:1.55618658587356E-6,(14:0.003543280942644147,(49:0.003482258335730862,((24:1.55618658587356E-6,(33:1.55618658587356E-6,(1:1.55618658587356E-6,30:1.55618658587356E-6)17:1.55618658587356E-6)17:1.55618658587356E-6)88:1.55618658587356E-6,(32:0.00690577849934563,((2:0.0014450635124989071,3:0.0036536913731913894)100:0.030039605642622688,(7:1.55618658587356E-6,18:1.55618658587356E-6)100:0.0039018077717738503)44:0.006721244984878184)22:0.0017319822325581823)23:0.0034220550900199713)36:0.007110337505646928)36:0.001623095921533733)100:0.03779881098482583)63:0.009649012632672932,((6:1.55618658587356E-6,(40:1.55618658587356E-6,47:1.55618658587356E-6)32:1.55618658587356E-6)98:0.0032002506075855916,(((4:0.0015018614409257054,8:0.0035769917027021324)100:0.01509053474485374,((13:1.55618658587356E-6,25:1.55618658587356E-6)99:0.004280036187385499,(19:1.55618658587356E-6,(39:1.55618658587356E-6,(15:1.55618658587356E-6,22:1.55618658587356E-6)30:1.55618658587356E-6)71:0.0016903881699836987)93:0.002581412521224499)100:0.027786331899621656)51:0.0038746418602339625,((38:1.55618658587356E-6,54:1.55618658587356E-6)100:0.009579795623384886,((16:1.55618658587356E-6,(10:1.55618658587356E-6,23:1.55618658587356E-6)97:0.005122967440337444)55:0.001683927902861499,(20:1.55618658587356E-6,(34:1.55618658587356E-6,(41:1.55618658587356E-6,(31:1.55618658587356E-6,(5:1.55618658587356E-6,21:1.55618658587356E-6)13:1.55618658587356E-6)4:1.55618658587356E-6)3:1.55618658587356E-6)6:1.55618658587356E-6)57:1.55618658587356E-6)62:0.004337642283575552)31:0.0016767684059053522)61:0.006484763835863399)97:0.03565755593400086)95:0.07564632212944566)87:0.04617095693377412):0.08559226191036323); END;