#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:40 GMT TreeBASE (cc) 1994-2008 Study reference: Coppard S.E., & Lessios H.A. 2017. Phylogeography of the sand dollar genus Encope: implications regarding the Central American Isthmus and rates of molecular evolution. Scientific Reports, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21395] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=121; TAXLABELS Encope_aberrans_EAFP1 Encope_aberrans_EAFP2 Encope_aberrans_EAFP3 Encope_aberrans_EAFP4 Encope_aberrans_EAFP5 Encope_aberrans_EAFP6 Encope_aberrans_EAGM1 Encope_aberrans_EAGM2 Encope_aberrans_EAGM3 Encope_borealis_EBPPM1 Encope_borealis_EBPPM2 Encope_borealis_EBPPM3 Encope_borealis_EBPPM4 Encope_borealis_EBPPM5 Encope_borealis_EBPPM6 Encope_californica_ECLP1 Encope_californica_ECLP2 Encope_californica_ECLP3 Encope_californica_ECLP4 'Encope californica ECLP5_6' Encope_cocosi_ECOCR1 Encope_ecuadorensis_EESEE1 'Encope emarginata EEPBB1_4' 'Encope emarginata EEPBB2_3_5_8' Encope_emarginata_EEPBB6 Encope_emarginata_EEPBB7 Encope_emarginata_EEPLP1 Encope_emarginata_EEPLP4 'Encope emarginata EERB1_EEPLP2' Encope_emarginata_EERB2 'Encope emarginata EESB1_EEPLP3' 'Encope emarginata EESB2_3' Encope_emarginata_EESMC5 Encope_fragilis_EFCR1 Encope_fragilis_EFCR2 Encope_fragilis_EFCR3 Encope_fragilis_EFCR4 Encope_galapagensis_EGIF1 Encope_galapagensis_EGIF2 'Encope galapagensis EGII1_2' Encope_galapagensis_EGISFl1 Encope_galapagensis_EGISFl2 Encope_galapagensis_EGISFl3 'Encope grandis EGBA1_4' Encope_grandis_EGBA2 Encope_grandis_EGBA3 Encope_insularis_EIIS1 Encope_insularis_EIIS2 Encope_insularis_EIIS3 Encope_irregularis_EIRH1 Encope_laevis_ELNH1 Encope_michelini_EMFP1 Encope_michelini_EMFP2 Encope_michelini_EMFP3 Encope_michelini_EMFP4 Encope_michelini_EMFP5 'Encope michelini EMMKF1_4' Encope_michelini_EMMKF2 'Encope michelini EMMKF3_5' Encope_michelini_EMSLF1 Encope_michelini_EMSLF2 Encope_michelini_EMSLF3 'Encope micropora EMAZ1_4_EMPV1 ' 'Encope micropora EMAZ3_5_EMVP3' Encope_micropora_EMCR1 'Encope micropora EMPV4_EMAZ2' 'Encope micropora EMRP1_5' 'Encope micropora EMRP2_EMSJ2_7' 'Encope micropora EMRP2_EMVP2' 'Encope micropora EMRP3_EMSJ8' 'Encope micropora EMSJ3_EMRP4 ' 'Encope micropora EMSJ4_ETRP1_3' 'Encope micropora EMSJ5_EMST6_8' 'Encope micropora EMST1_4_7' 'Encope micropora EMST3_5_EMSJ3 ' Encope_micropora_Esp1 Encope_micropora_Esp2 Encope_micropora_Esp3 'Encope micropora Esp4_6' Encope_micropora_Esp5 Encope_oblonga_EEV1 Encope_oblonga_EEV2 'Encope perspectiva EPCR1_3' Encope_perspectiva_EPCR2 Encope_perspectiva_EPLPM1 Encope_perspectiva_EPSJP1 'Encope subclausa ESPLP1_2' Encope_subclausa_ESPLP3 'Encope tetrapora ETRP2_EMSJ1 ' Encope_valenciennesii_EVM1 'Encope wetmorei EWBM1_3_EWMM3' 'Encope wetmorei EWBM2_EWMM1 ' Encope_wetmorei_EWBM4 'Encope wetmorei EWBM5_7' 'Encope wetmorei EWBM6_8' Encope_wetmorei_EWBPE1 'Encope wetmorei EWBPE2_3' 'Encope wetmorei EWEC1_3' Encope_wetmorei_EWEC2 Encope_wetmorei_EWLLP1 Encope_wetmorei_EWLLP2 Encope_wetmorei_EWLLP3 Encope_wetmorei_EWLLP4 'Encope wetmorei EWLLP5_ELLP1' Encope_wetmorei_EWMM2 Lanthonia_longifissa_LLGP7 Lanthonia_longifissa_LLGP9 Lanthonia_longifissa_LLMM1 Lanthonia_longifissa_LLMM2 Lanthonia_longifissa_LLPCP3 Leodia_seiesperforata_LSP1 Mellita_quinquiesperforata_MQBTP1 Mellita_quinquiesperforata_MQPP1 Mellita_quinquiesperforata_MQPP4 Mellita_quinquiesperforata_MQSBP1 Mellita_quinquiesperforata_MQSBP2 Mellitella_stokesii_MSPVP1 Mellitella_stokesii_MSPVP2 Mellitella_stokesii_MSPVP3 Mellitella_stokesii_MSRP1 Mellitella_stokesii_MSRP2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42273] TITLE 'Encope concatenated COI, ATPase-6, ATPase-8, 16S and 28S data'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3856; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Encope_aberrans_EAFP1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAFP2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAACAAGACACTACAAGTCTAATATTGTTTAAACAAGTTCAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCAACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCGGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTCGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAFP3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAFP4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCGGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAACACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATTGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAFP5 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAFP6 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTCTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGAATAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAGM1 AAACACAAACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAACAAGACACTACAAGTCTAATATTGTTTAAACAAGTTCAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCGGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCTTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAGM2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCGGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_aberrans_EAGM3 AAACACAAACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACCTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTATTATATTCTAATTTTTT---CTATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAACAAGACACTACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCTTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTTGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTGACTGCTTTCCTCCTGCTTCTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATTCCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATTCTTCCAGGGTTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTCACCGTCGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTTCTATTCACCTTAGGAGGACTCACAGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGACACCTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTCTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTTCTTGTATGGGCAGCTATATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAGACTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGCTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAATTGAGCTCCATCACGATTACAAACAATATGACTATCTTTTCGACATAGAGTCTTAGAAGGGATTTTCCAAAACACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCTTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCGCTAACATACAGCTTAGGCTTTCCGTTATGAATGGCAGTAAAAATACTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGCCACCTAGTACCACAAGGTACTCCTACTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCGCTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTCCTTTCAACTGCCATTTGACTATTAGCTTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTAATACAA Encope_borealis_EBPPM1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_borealis_EBPPM2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGATGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_borealis_EBPPM3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGATGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTTGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_borealis_EBPPM4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGGATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAATGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_borealis_EBPPM5 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGGATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_borealis_EBPPM6 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGGATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTGCTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGCCTTCCTTTATTTGTATGATCGGTTTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGATGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAATGTTGACCAACTATCATCCTCCCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACGTCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGGTTACAATCAATATGACTATCATTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGATTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTGGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCATTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCTAATCCTTTTATTAGCCTACCTATATTCATAATCTTCGTCTTACTATTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_californica_ECLP1 AAACACAAATATTGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATCCCTCTTTGTTATATTCTAATTTCTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAGCAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCGTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTTTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACGTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCAATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGATTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTAAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_californica_ECLP2 AAACACAAATATTGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATCCCTCTTTGTTATATTCTAATTTCTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTTTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACGTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCAATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGATTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTAAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_californica_ECLP3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGAAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATCCCTCTTTGTTATATTCTAATTTCTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTTTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACGTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCAATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_californica_ECLP4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATCCCTCTTTGTTATATTCTAATTTCTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTTTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACGTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCAATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope californica ECLP5_6' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATCCCTCTTTGTTATATTCTAATTTCTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTTTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACGTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCAATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_cocosi_ECOCR1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCCAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_ecuadorensis_EESEE1 AAGCACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGGCTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope emarginata EEPBB1_4' GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAATCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCACAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope emarginata EEPBB2_3_5_8' GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAATCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCACAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EEPBB6 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAATCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCACAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EEPBB7 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAATCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EEPLP1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACGACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTCTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGATTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCTTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EEPLP4 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCTAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope emarginata EERB1_EEPLP2' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTTTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EERB2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTACGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCTATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTACTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope emarginata EESB1_EEPLP3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCGAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope emarginata EESB2_3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTGTTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTCTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCTTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGGTTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_emarginata_EESMC5 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTCTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCTTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_fragilis_EFCR1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_fragilis_EFCR2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACTGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACCTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_fragilis_EFCR3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAACGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_fragilis_EFCR4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACTGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACCTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCAGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_galapagensis_EGIF1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTGCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGCGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCTGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGGCTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACACATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_galapagensis_EGIF2 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTGCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGAGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGGCTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope galapagensis EGII1_2' GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGCGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTCTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCCTTAGTACATTTCTACTTACTACAA Encope_galapagensis_EGISFl1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTGCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGAGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGGCTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_galapagensis_EGISFl2 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAATTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGCGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTCTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGATGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_galapagensis_EGISFl3 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCCAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAATTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTCCTCCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGCGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCTTCATTTATTCTGCTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTCTCCAGCAACATAGCTCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTCTGATCGGTCTTTGTGACCGCCTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGCCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGATCGAACTTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGGGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGGTTCCCATTGTTTTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGGCTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGCTTAATTACTAGCTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACACATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTTAGCCTATTTGCCCAACCAATAGCACTAGGACTACGTCTCGCGGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTTCCTATATTCATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope grandis EGBA1_4' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTGTATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATCTTTT---CCATTAAATTTAACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAGAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATCCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAATATAGCACACGCAGGGGGATCAGTAGATCTTGCCATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATCATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTGACCGCTTTCCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGATCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGGTCGAACCTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCTTGTTTACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGTGCAGTATTTGCGATATTTGCAGGATTTACTCACTGATTCCCATTGTTCTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTGATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCACGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTCTCAACATTCTTTGCATTATCCTGACTACTATTTATCTTTCCTACAAAATGAGCTCCCTCACGACTACAATCAGTATGACTATCTTTCCGACATAAAATCCTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGTCTAATTACTAGTTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTAAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCTTAAGACACTTGGTGCCACAAGGTACTCCTGCAGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCGCTAGGACTGCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCCAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCTTGCTGTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_grandis_EGBA2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTGTATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATCTTTT---CCATTAAATTTAACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAGAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATCCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAATATAGCACACGCAGGGGGATCAGTAGATCTTGCCATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATCATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTGACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGATCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGGTCGAACCTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCTTGTTTACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGTGCAGTATTTGCGATATTTGCAGGATTTACTCACTGATTCCCATTGTTCTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTGATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCACGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTCTCAACATTCTTTGCATTATCCTGACTACTATTTATCTTTCCTACAAAATGAGCTCCCTCACGACTACAATCAGTATGACTATCTTTCCGACATAAAATCCTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGTCTAATTACTAGTTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTAAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCTTAAGACACTTGGTGCCACAAGGTACTCCTGCAGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCGCTAGGACTGCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCCAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCTTGCTGTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_grandis_EGBA3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTGTATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATCTTTT---CCATTAAATTTAACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAGAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATCCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAATATAGCACACGCAGGGGGATCAGTAGATCTTGCCATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATCATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTGACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGATCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGGTCGAACCTGCAATGAGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCTTGTTTACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGTGCAGTATTTGCGATATTTGCAGGATTTACTCACTGATTCCCATTGTTCTCAGGTTACAGCCTGCACCCGCTTTGAGGTAAGGCACACTTCTTTTTGATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAGCACTTCCTAGGGCTAGCACGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCCTCTCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTCTCAACATTCTTTGCATTATCCTGACTACTATTTATCTTTCCTACAAAATGAGCTCCCTCACGACTACAATCAGTATGACTATCTTTCCGACATAAAATCCTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGAACCGGTCTAATTACTAGTTTATTTGTATTGATATTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGGTTTCCACTATGAATGGCAGTAAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCTTAAGACACTTGGTGCCACAAGGTACTCCTGCAGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCGCTAGGACTGCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCCAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCTTGCTGTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_insularis_EIIS1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACCTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_insularis_EIIS2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGATGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTGGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACCTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_insularis_EIIS3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTGGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACCTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_irregularis_EIRH1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCTACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_laevis_ELNH1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCCCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCCATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_michelini_EMFP1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTCGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACATCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTTTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMFP2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTATGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCGCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMFP3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTACTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTTTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMFP4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTATGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCGCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMFP5 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAGGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTTAAACAAGTTCTACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATCCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTATGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATAGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCCTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCGCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACCAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA 'Encope michelini EMMKF1_4' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTATGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCGCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMMKF2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTTAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTCTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTATGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCGCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA 'Encope michelini EMMKF3_5' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGTTCAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTCTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGGCTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTCGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACATCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTTTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMSLF1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTACAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACATCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTTTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCTTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMSLF2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTTGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCCGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACATCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTTTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCTTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA Encope_michelini_EMSLF3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAGTTCCTCTTTATTATATTCTAATTTTTTT---TATTAAATTTAACTAA-GAGAAAATTGTTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCACTTACAATAAATAAAAATAAGACACCACAAGTCTAATATTGTTCAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGCATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTTGCCCAACCCGGGTCTCTACTTCAAGACGACCAAATTTATAATGTAATTGTAACAGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCTATAATGATAGGCGGATTCGGAAACTGACTAATCCCTTTAATGATAGGAGCGCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTCGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCCGGAACAGGATGAACGATCTACCCACCTCTTTCTAGAAATATAGCACACGCAGGAGGGTCAGTAGACCTTGCCATTTTTTCACTACATCTTGCCGGTGCCTCTTCAATCCTGGCATCGATAAATTTCATCACAACAATTATAAACATGCGTACTCCAGGAATCTCTTTCGACCGTCTTCCTCTATTTGTATGATCGGTCTTTGTAACTGCTTTCCTCCTGCTCCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATTTCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTTTATATTCTAATCCTTCCAGGATTTGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTTTAGGTTTCTTAGTCTGAGCCCACCACATGTTTACCGTTGGGATGGATGTAGACACACGAGCATACTTTACAGCCGCTACAATGATAATCGCTGTTCCCACTGGAATCAAGGTATTTAGCTGAATGGCTACACTTCAAGGATCAAACCTACAATGAGAAACTCCCCTACTATGATCACTAGGCTTCGTATTCTTATTCACCTTAGGAGGACTCACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCCTTCACGACACTTACTATGTAGTAGCTCACTTCCACTACGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTTCCACTATTTTCAGGTTACAGCCTACACCCACTTTGAGGGAAGGCACACTTCTTTCTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCACAGCACTTCTTAGGGCTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTCCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATTAAATTTTTCCTTGTATGGGCAGCTGTATTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTCCTTCTAAAGTTGACCAACTCTCTTCTTCCCCTGAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTAATTCCTATGAACATCTTCTCAACATTCTTTGCATTATCTTGACTATTATTTATCTTTCCTACGAACTGAGCTCCATCACGATTACAGACAATATGACTGTCCTTTCGACATAAAGTCTTAGAAATGATTTTCCAAAATACAAGCCCTAATTCAGCCCCATGAACTGGCCTAATTACTAGTTTATTTGTGTTAATCCTATCTATCAATGTCCTAGGCCTATTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCCTAGGCTTTCCGTTATGAATGGCAGTAAAAATATTAGGGTTTTATTTAGCATTCAAAGCCCGCCTAAGTCACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCAATGGTCTGAATAGAAACACTGAGACTATTTGCTCAGCCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATCTTCCTTCTTTCAACTGCCATTTGACTATTAGCCTCCAATCCCTTTATTAGCCTCCCTATATTCATAATCTTCGTCTTACTCTTTATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTTTTCACTGCCTTAGTACATTTCTACCTACAACAA 'Encope micropora EMAZ1_4_EMPV1 ' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAAGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMAZ3_5_EMVP3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTTCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAATATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_micropora_EMCR1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGATGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTTACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACTCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMPV4_EMAZ2' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATCTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCCTCCTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTGGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMRP1_5' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCACCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTAGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTAAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMRP2_EMSJ2_7' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAGGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGATGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTGTGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMRP2_EMVP2' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATCTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMRP3_EMSJ8' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGATGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTCCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMSJ3_EMRP4 ' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCCACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGGATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACGTTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMSJ4_ETRP1_3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTGTTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCCAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMSJ5_EMST6_8' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCGTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGGCTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTTTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMST1_4_7' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCACAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora EMST3_5_EMSJ3 ' AAACACCAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAAAGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGTCGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGATGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACATCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_micropora_Esp1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGGAAAACCCTCCGCTTACAATAAATAAAAACAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACGATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACACCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTGAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCCGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCCCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTGATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTACTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_micropora_Esp2 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGGAAAACCCTCCGCTTACAATAAATAAAAACAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACTGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACGATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACACCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTGAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCCGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCCCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTGATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTACTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_micropora_Esp3 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGGAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACGATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACACCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGAAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTAGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope micropora Esp4_6' GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGGAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGTCGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACGATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACACCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCCATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_micropora_Esp5 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGGAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTAGCGTCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACGATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACACCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCCCCTAATATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTGATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTTGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTACTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_oblonga_EEV1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCTAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_oblonga_EEV2 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCTAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCACAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope perspectiva EPCR1_3' ATACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTAACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCCATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_perspectiva_EPCR2 ATACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTAACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACGTACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCAGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_perspectiva_EPLPM1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCTACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_perspectiva_EPSJP1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGAGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAATCTGCAATGGGAAACCCCTCTGCTATGATCACTGGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTATTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTACAGAATTTTTGGTCAATTTTTCCCAAATACTCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTGGCATTTAAAGCCCGCCTAAGACACCTTGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGTTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope subclausa ESPLP1_2' GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCCGGGAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTCCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAAGGGTCGAACTTGCAGTGAGAAACCCCTCTACTGTGATCGCTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGGGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTCTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAATTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCTTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTTAGCCTATTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTCCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA Encope_subclausa_ESPLP3 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGAATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCTAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCGCTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTGTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTATTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGATTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope tetrapora ETRP2_EMSJ1 ' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTCAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAATGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGCATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACCCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTCCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_valenciennesii_EVM1 GAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTGAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTGATATTGTTTAAACAAGT-CAACTGATCCACTATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGAGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGATCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTTTTCATGGTGATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATTCTACTCCTAGCATCAGCCGGAGTAGAAAGAGGTGCCGGAACAGGATGAACTATTTACCCACCTCTTTCTAGTAACATAGCGCACGCAGGAGGATCAGTAGACCTTGCTATCTTTTCACTTCATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGCACTCCAGGAATCTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTCACCGCTTTCCTCCTACTTCTATCCCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATCAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTTTAATACTCCCAGGATTCGGGATGATTTCACACGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATATCTAGGTATGGTTTATGCTATGATAGCAATAGGAATTCTAGGTTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGAATGGATGTAGACACACGGGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCCACCGGAATCAAGGTATTCAGCTGGATGGCTACACTTCAGGGGTCTAACTTGCAGTGAGAAACCCCTCTACTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACGGGAATAGTACTAGCTAATTCTTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAGCACTTCTTAGGACTAGCAGGAATGCCCCGGCGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCGTACTAGTTTCAAAAGAGACTTCCTCTAAAGTTGACCAACTATCATCCTCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCAAATACCCTATTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTATCTTGACTACTCTTTATCTTTCCTACAAAATGAGCTCCTTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAGATGATTTTCCAAAATACAAGCCCTAACTCAGCACCATGGACCGGACTAATTACTAGTTTATTTGTGTTAATCTTATCTATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGATTTCCACTATGAATGGCAGTAAAAATCTTAGGGTTTTACTTAGCATTTAAAGCCCGCCTAAGACACCTAGTACCACAAGGTACTCCTGCTGCACTGATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTGTTTGCTCAACCAATAGCGCTAGGACTTCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTTCTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGCCTCCCTATATTCATAATTTTCGTCCTGCTATTCATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACTTACTACAA 'Encope wetmorei EWBM1_3_EWMM3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTTCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWBM2_EWMM1 ' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAAAGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATCACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTGCGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWBM4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATTAACACGACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTACCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTACAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACCTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTTCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWBM5_7' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCCTTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTTCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWBM6_8' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATCACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGGGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTTCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWBPE1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCTACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTATTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWBPE2_3' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGTAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCTACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWEC1_3' AAACACAAGTATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAATAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTGATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWEC2 AAACACAAGTATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGGATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACGATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGGCACCTAGTGCCACAAGGTACCCCTGCTGCATTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWLLP1 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATCATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTCCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCCATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACTTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWLLP2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATCATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTCCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTCCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWLLP3 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAAAGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCCCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCCATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTCCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGACTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWLLP4 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCACTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTTTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA 'Encope wetmorei EWLLP5_ELLP1' AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATCGTAACAGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGAGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTCTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTATTTGCGATATTCGCAGGATTCACTCACTGATTCCCACTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATTTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCCATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCTTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTCCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTGCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Encope_wetmorei_EWMM2 AAACACAAATATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTCTAATTCCTCTTTGTTATATTCTAATTTTTT---CTATTAAATTTGACTAA-GAGAAAATTATTAGTGCAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAAATAAAAATAAGACACTACAAGTCTAATATTGTTTAAACAAGT-CAACTGATCCACCATGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATCTTTGGGGCCTGAGCAGGAATGGTTGGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCTGGGTCTCTACTTCAAGACGATCAAATTTATAATGTAATTGTAACGGCCCATGCCTTAGTAATGATTTTCTTCATGGTAATGCCTATAATGATAGGTGGATTCGGAAACTGATTAATCCCTTTAATGATCGGAGCCCCAGATATGGCTTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCGTTTATTCTACTCCTTGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACAGGATGAACTATTTACCCACCTCTTTCCAGCAACATAGCACACGCAGGGGGATCAGTAGACCTTGCCATCTTTTCACTTCATCTTGCTGGTGCTTCTTCAATCCTAGCATCAATAAACTTTATTACAACAATTATAAACATGCGTACTCCAGGAATTTCTTTTGACCGTCTTCCTTTATTTGTATGATCGGTCTTTGTAACCGCTTTTCTCCTACTTCTATCTCTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATTCCAACATCTTTTCTGGTTCTTTGGTCACCCAGAAGTTTATATTCTAATACTTCCAGGATTCGGAATGATTTCACACGTTATTGCCCATTACTCCGGGAAGCGAGAACCATTCGGGTATCTAGGTATGGTTTATGCCATGATAGCAATAGGAATTCTAGGCTTCTTGGTCTGGGCCCATCACATGTTCACTGTAGGGATGGATGTAGACACACGAGCATACTTCACAGCCGCCACAATGATAATTGCTGTTCCTACCGGAATCAAGGTATTCAGCTGAATGGCTACACTTCAAGGATCTAACCTGCAATGGGAAACCCCTCTGCTATGATCACTAGGCTTCGTATTCCTATTCACTCTAGGAGGACTCACAGGAATAGTACTAGCTAATTCCTCAATAGACGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTATGTTCTATCAATGGGAGCAGTGTTTGCCATATTCGCAGGATTCACTCACTGATTCCCATTGTTTTCAGGTTACAGCCTACACCCACTTTGAGGTAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAATCTAACTTTCTTTCCGCAACACTTCCTAGGGCTAGCAGGAATGCCCCGACGATACTCGGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGACGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAACAGCTATACTAGTTGTTCTTACCATACTAGTCTCAAAAGAGACTTCTTCTAAAGTTGACCAACTATCCTCATCTCCTAAGATAACTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTGTTTTTGATCCCGATGAACATCTTTTCAACATTCTTTGCATTGTCTTGACTATTATTTATCTTTCCTACAAAATGAGCTCCCTCACGATTACAATCAATATGACTATCTTTCCGACATAAAGTCTTAGAAATGATTTTCCAGAATACAAGCCCTAATTCAGCGCCATGAACCGGCCTAATTACTAGCTTATTCGTCTTAATACTATCCATCAATGTCCTAGGCCTACTACCTTACGCCTTTACTTCAACAAGACATATTTCACTAACATACAGCTTAGGCTTTCCACTATGAATGGCAGTGAAAATCTTGGGGTTTTATTTAGCATTTAAAGCCCGCCTAAGACACCTAGTTCCACAAGGTACCCCTGCTGCACTAATTCCAGCGATGGTCTGAATAGAAACACTGAGCCTATTCGCTCAACCAATAGCACTAGGACTACGTCTCGCAGCCAACCTAACAGCAGGACATCTTCTAATTTTCCTACTTTCAACTGCCATCTGGCTATTAGCCTCTAATCCTTTTATTAGTCTCCCTATATTTATAATTTTCGTCTTGCTATTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTGCTACAA Lanthonia_longifissa_LLGP7 AAACA-AGATATAGAGGGTCCTGCCTGCCCAGTGACA-GAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAAC-ACTAATTTCTAATTACTCTCTATCATATTCTAATTATT-TA-C-ACTAAATATGATAGAT-AGAAAATTATTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAGATAAAAATAAGACTCTACAAGTCTAATATTGTACAAACAAGT-CAATTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCT??????????????????????????????????????????????????????GGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCAGGGTCTCTCCTTCAAGATGACCAAATTTACAATGTGATAGTAACAGCCCATGCTTTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATAGGTGGATTTGGAAACTGACTAATCCCCCTAATGATTGGTGCTCCAGACATGGCCTTTCCTCGAATGAATAAAATGAGATTTTGACTAGTACCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATTTACCCTCCTCTTTCCAGAAATATAGCGCATGCAGGTGGATCAGTAGACCTTGCAATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATTTTAGCATCTATAAACTTCATCACAACCATCATAAATATGCGCACCCCAGGAATTTCCTTTGACCGCCTTCCTTTATTTGTATGATCTGTATTTGTGACCGCCTTCCTACTACTTTTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTTTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGGGACCCTATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCATCCAGAAGTATACATTCTCATACTTCCTGGGTTTGGAATGATTTCACACGTAATTGCTCACTACTCCGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATCCTAGGATTCCTAGTTTGAGCTCACCACATGTTCACCGTCGGAATGGATGTGGATACACGGGCATATTTCACAGCTGCCACCATGATAATTGCTGTTCCCACAGGAATTAAGGTATTTAGCTGAATGGCTACCCTCCAAGGATCAAACCTACAATGAGAAACACCACTACTATGATCACTAGGATTCGTATTTCTATTTACTTTAGGGGGACTAACAGGAATAGTACTAGCTAACTCTTCAATAGACGTTGTCTTACACGACACTTACTATGTGGTAGCCCACTTCCACTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGTTTTACCCACTGATTCCCATTATTCTCAGGTTATAGACTACACCCACTTTGAGGAAAGGCACACTTCTTCTTAATGTTTATAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGACTAGCTGGAATGCCACGACGGTACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACTGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCCTCGGGCCAGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAAGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACATTTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTAGTTCTTACTATCTTAGTCTCAAAAGAAACTCCTTCTAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAACTAAGAAAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCCTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTACTTTTAATTCCAATGAACATCTTTTCGACGTTCTTTGCATTATCCTGACTACTATTTATCTTTCCCACAAACTGAGCCCCTTCACGACTACAATCAGTGTGGTTATCCTTTCGACATAAAGTCCTAGAAATGATTTTTCAAAACACAAGCCCAAACTCAGCTCCATGAACAGGATTAATTACCAGTTTATTTGTATTAATTCTATCCATAAATGTTCTAGGTCTACTACCTTACGCTTTCACTTCAACAAGACACATTTCATTAACATATAGCCTAGGCTTCCCATTATGAATGGCAGTAAAAATCTTAGGCTTTTATTTAGCATTTAAAGCTCGACTAAGTCACCTTGTCCCACAAGGCACTCCTGCCGCTTTAATTCCAGCAATGGTCTGAATAGAAACTCTTAGTCTATTTGCTCAACCAATAGCATTAGGACTACGTTTAGCAGCCAATTTAACAGCAGGTCACCTACTAATATTCCTGCTCTCAACTGCAATTTGACTATTAGCCTCTAATCCTTTTATTAGATTACCTATATTTATAATCTTCGTATTGCTATTTATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTACTACAA Lanthonia_longifissa_LLGP9 AAACA-AGATATAGAGGGTCCTGCCTGCCCAGTGACA-GAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAAC-ACTAATTTCTAATTACTCTCTATCATATTCTAATTATT-TA-C-ACTAAATATGGCAGAT-AGAAAATTATTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAGATAAAAATAAGACCCTACAAGTCTAATATTGTACAAACAAGT-CAATTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCT??????????????????????????????????????????????????????GGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCAGGGTCTCTCCTTCAAGATGACCAAATTTACAATGTGATAGTAACAGCCCATGCTTTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATAGGTGGATTTGGAAACTGACTAATCCCCCTAATGATTGGTGCTCCAGACATGGCCTTTCCTCGAATGAATAAAATGAGATTTTGACTAGTACCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATTTACCCTCCTCTTTCCAGAAATATAGCGCATGCAGGTGGATCAGTAGACCTTGCAATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATTTTAGCATCTATAAACTTCATCACAACCATCATAAATATGCGCACCCCAGGAATTTCCTTTGACCGCCTTCCTTTATTTGTATGATCTGTATTCGTGACCGCCTTCCTACTACTTTTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTTTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGGGACCCTATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCATCCAGAAGTATACATTCTCATACTTCCTGGGTTTGGAATGATTTCACACGTAATTGCTCACTACTCCGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCCTAGTTTGAGCTCACCACATGTTCACCGTCGGAATGGATGTGGATACACGGGCATATTTCACAGCTGCCACCATGATAATTGCTGTTCCCACAGGAATTAAGGTATTTAGCTGAATGGCTACCCTCCAAGGATCAAACCTACAATGAGAAACACCACTACTATGATCACTAGGATTCGTATTTCTATTTACTTTAGGGGGACTAACAGGAATAGTACTAGCTAACTCTTCAATAGACGTTGTCTTACACGACACTTACTATGTGGTAGCCCACTTCCACTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGTTTTACCCACTGATTCCCATTATTCTCAGGTTATAGACTACACCCACTTTGAGGAAAGGCACACTTCTTCTTAATGTTTATAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGACTAGCTGGAATGCCACGACGGTACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACTGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCCTCGGGCCAGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAAGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACATTTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTAGTTCTTACTATCTTAGTCTCAAAAGAAACTCCTTCTAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAACTAAGAAAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCCTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTACTTTTAATTCCAATGAACATCTTTTCGACGTTCTTTGCATTATCCTGACTACTATTTATCTTTCCCACAAACTGAGCCCCTTCACGACTACAATCAGTGTGGTTATCCTTTCGACATAAAGTCCTAGAAATGATTTTTCAAAACACAAGCCCAAACTCAGCTCCATGAACAGGATTAATTACCAGTTTATTTGTATTAATTCTATCCATAAATGTTCTAGGTCTACTACCTTACGCTTTCACTTCAACAAGACACATTTCATTAACATATAGCCTAGGCTTCCCATTATGAATGGCAGTAAAAATCTTAGGCTTTTATTTAGCATTTAAAGCTCGACTAAGTCACCTTGTCCCACAAGGCACTCCTGCCGCTTTAATTCCAGCAATGGTCTGAATAGAAACTCTTAGTCTATTTGCTCAACCAATAGCATTAGGACTACGTTTAGCAGCCAATTTAACAGCAGGTCACCTACTAATATTCCTGCTCTCAACTGCAATTTGACTATTAGCCTCTAATCCTTTTATTAGATTACCTATATTTATAATCTTCGTATTGCTATTTATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTACTACAA Lanthonia_longifissa_LLMM1 AAACA-AGATATAGAGGGTCCTGCCTGCCCAGTGACA-GAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAAC-ACTAATTTCTAATTACTCTCTATCATATTCTAATTATT-TA-C-ACTAAATATGGCAGAT-AGAAAATTATTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAGATAAAAATAAGACCCTACAAGTCTAATATTGTACAAACAAGT-CAATTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCT??????????????????????????????????????????????????????GGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCAGGGTCTCTCCTTCAAGATGACCAAATTTACAATGTGATAGTAACAGCCCATGCTTTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATAGGTGGATTTGGAAACTGACTAATCCCCCTAATGATTGGTGCTCCAGACATGGCCTTTCCTCGAATGAATAAAATGAGATTTTGACTAGTACCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGAGCCGGAACAGGATGAACTATTTACCCTCCTCTTTCCAGAAATATAGCGCATGCAGGTGGATCAGTAGACCTTGCAATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATTTTAGCATCTATAAACTTCATCACAACCATCATAAATATGCGCACCCCAGGAATTTCCTTTGACCGCCTTCCTTTATTTGTATGATCTGTATTCGTGACCGCCTTCCTACTACTTTTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTTTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGGGACCCTATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCATCCAGAAGTATACATTCTCATACTTCCTGGATTTGGAATGATTTCACACGTAATTGCTCACTACTCCGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATCCTAGGATTCCTAGTTTGAGCTCACCACATGTTCACCGTCGGAATGGATGTAGATACACGGGCATATTTCACAGCTGCCACCATGATAATTGCTGTTCCCACAGGAATTAAGGTATTTAGCTGAATGGCTACCCTCCAAGGATCAAACCTACAATGAGAAACACCACTACTATGATCACTAGGATTCGTATTTCTATTTACTTTAGGGGGACTAACAGGGATAGTACTAGCTAACTCTTCAATAGACGTTGTCTTACACGACACTTACTATGTGGTAGCCCACTTCCACTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGTTTTACCCACTGATTCCCATTATTCTCAGGTTATAGACTACACCCACTTTGAGGAAAGGCACACTTCTTCTTAATGTTTATAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGACTAGCTGGAATGCCACGACGGTACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACTGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCCTCGGGCCAGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAAGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACATTTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTAGTTCTTACTATCTTAGTCTCAAAAGAAACTCCTTCTAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAACTAAGAAAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCCTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTACTTTTAATTCCAATGAACATCTTTTCGACGTTCTTTGCATTATCCTGACTACTATTTATCTTTCCCACAAACTGAGCCCCTTCACGACTACAATCAGTGTGGTTATCCTTTCGACATAAAGTCCTAGAAATGATTTTTCAAAACACAAGCCCAAACTCAGCTCCATGAACAGGATTAATTACCAGTTTATTTGTATTAATTCTATCCATAAATGTTCTAGGTCTACTACCTTACGCTTTCACTTCAACAAGACACATTTCATTAACATATAGCCTAGGCTTCCCATTATGAATGGCAGTAAAAATCTTAGGCTTTTATTTAGCATTTAAAGCTCGACTAAGTCACCTTGTCCCACAAGGCACTCCTGCCGCTTTAATTCCAGCAATGGTCTGAATAGAAACTCTTAGTCTATTTGCTCAACCAATAGCGTTAGGACTACGTTTAGCAGCCAATTTAACAGCAGGTCACCTACTAATATTCCTGCTCTCAACTGCAATTTGACTATTAGCCTCTAATCCTTTTATTAGATTACCTATATTTATAATCTTCGTATTGCTATTTATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTACTACAA Lanthonia_longifissa_LLMM2 AAACA-AGATATAGAGGGTCCTGCCTGCCCAGTGACA-GAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAAC-ACTAATTTCTAATTACTCTCTATCATATTCTAATTATT-TA-C-ACTAAATATGGCAGAT-AGAAAATTATTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAGATAAAAATAAGACCCTACAAGTCTAATATTGTACAAACAAGT-CAATTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCT??????????????????????????????????????????????????????GGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCAGGGTCTCTCCTTCAAGATGACCAAATTTACAATGTGATAGTAACAGCCCATGCTTTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATAGGTGGATTTGGAAACTGACTAATCCCCCTAATGATTGGTGCTCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTTTGACTAGTACCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATTTACCCTCCTCTTTCCAGAAATATAGCGCATGCAGGTGGATCAGTAGACCTTGCAATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATTTTGGCATCTATAAACTTCATCACAACCATCATAAATATGCGCACCCCAGGAATTTCCTTTGACCGCCTTCCTTTATTTGTATGATCTGTATTCGTGACCGCCTTCCTACTACTTTTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTTTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGGGACCCTATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCATCCAGAAGTATACATTCTCATACTTCCTGGGTTTGGAATGATTTCACACGTAATTGCTCACTACTCCGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCCTAGTTTGAGCTCACCACATGTTCACCGTCGGAATGGATGTAGATACACGGGCATATTTCACAGCTGCCACCATGATAATTGCTGTTCCCACAGGAATTAAGGTATTTAGCTGAATGGCTACCCTCCAAGGATCAAACCTGCAATGAGAAACACCACTACTATGATCACTAGGATTCGTATTTCTATTTACTTTAGGGGGACTAACAGGAATAGTACTAGCTAACTCTTCAATAGACGTTGTCTTACACGACACTTACTATGTGGTAGCCCACTTCCACTACGTTTTATCAATGGGAGCAGTATTTGCAATATTCGCAGGTTTTACCCACTGATTCCCATTATTCTCAGGTTATAGACTACACCCACTTTGAGGAAAGGCACACTTCTTCTTAATGTTTATAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGACTAGCTGGAATGCCACGACGGTACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACTGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCCTCGGGCCAGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAAGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACATTTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTAGTTCTTACTATCTTAGTCTCAAAAGAAACTCCTTCTAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAACTAAGAAAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCCTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTACTTTTAATTCCAATGAACATCTTTTCGACGTTCTTTGCATTATCCTGACTACTATTTATCTTTCCCACAAACTGAGCCCCTTCACGACTACAATCAGTGTGGTTATCCTTTCGACATAAAGTCCTAGAAATGATTTTTCAAAACACAAGCCCAAACTCAGCTCCATGAACAGGATTAATTACCAGTTTATTTGTATTAATTCTATCCATAAATGTTCTAGGTCTACTACCTTACGCTTTCACTTCAACAAGACACATTTCATTAACATATAGCCTAGGCTTCCCATTATGAATGGCAGTAAAAATCTTAGGCTTTTATTTAGCATTTAAAGCTCGACTAAGTCACCTTGTCCCACAAGGCACTCCTGCCGCTTTAATTCCAGCAATGGTCTGAATAGAAACTCTTAGTCTATTTGCTCAACCAATAGCGTTAGGACTACGTTTAGCAGCCAATTTAACAGCAGGTCACCTACTAATATTCCTGCTCTCAACTGCAATTTGACTATTAGCCTCTAATCCTTTTATTAGATTACCTATATTTATAATCTTCGTATTGCTATTTATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTACTACAA Lanthonia_longifissa_LLPCP3 AAACA-AGATATAGAGGGTCCTGCCTGCCCAGTGACA-GAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTACATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAGAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAAC-ACTAATTTCTAATTACTCTCTATCATATTCTAATTATT-TA-C-ACTAAATATGGCAGAT-AGAAAATTATTAGTATAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAATAGATAAAAATAAGACCCTACAAGTCTAATATTGTACAAACAAGT-CAATTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCT??????????????????????????????????????????????????????GGAACCGCTATGAGCGTAATTATACGAGCTGAGCTCGCCCAACCAGGGTCTCTCCTTCAAGATGACCAAATTTACAATGTGATAGTAACAGCCCATGCTTTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATAGGTGGATTTGGAAACTGACTAATCCCCCTAATGATTGGTGCTCCAGACATGGCCTTTCCTCGAATGAATAAAATGAGATTTTGACTAGTACCTCCCTCATTTATTCTACTCCTAGCATCAGCTGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATTTACCCTCCTCTTTCCAGAAATATAGCGCATGCAGGTGGATCAGTAGACCTTGCAATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATTTTAGCATCTATAAACTTCATCACAACCATCATAAATATGCGCACCCCAGGAATTTCCTTTGACCGCCTTCCTTTATTTGTATGATCTGTATTCGTGACCGCCTTCCTACTACTTTTATCCCTACCAGTTCTAGCAGGAGCAATTACAATGCTTTTGACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCTTATTCCAACATCTTTTCTGGTTCTTTGGTCATCCAGAAGTATACATTCTCATACTTCCTGGGTTTGGAATGATTTCACACGTAATTGCTCACTACTCCGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTATGCCATGATAGCAATAGGAATCCTAGGCTTCCTAGTTTGAGCTCACCACATGTTCACCGTCGGAATGGATGTGGATACACGGGCATATTTCACAGCTGCCACCATGATAATTGCTGTTCCCACAGGAATTAAGGTATTTAGCTGAATGGCTACCCTCCAAGGATCAAACCTACAATGAGAAACACCACTACTATGATCACTAGGATTCGTATTTCTATTTACTTTAGGAGGACTAACAGGAATAGTACTAGCTAACTCTTCAATAGACGTTGTCTTACACGACACTTACTATGTGGTAGCCCACTTCCACTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGTTTTACCCACTGATTCCCATTATTCTCAGGTTATAGACTACACCCACTTTGAGGAAAGGCACACTTCTTCTTAATGTTTATAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGACTAGCTGGAATGCCACGACGGTACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCTCGGTTTCGGATCCGCAAGGACTGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCCTCGGGCCAGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAAGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACATTTAGACTTTGTTTGATGAATAATAAAATTTTTCCTTGTATGAGCAGCTATACTAGTAGTTCTTACTATCTTAGTCTCAAAAGAAACTCCTTCTAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAACTAAGAAAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCCTATAGAATTTTTGGTCAATTTTTCCCAAATACTCTACTTTTAATTCCAATGAACATCTTTTCGACGTTCTTTGCATTATCCTGACTACTATTTATCTTTCCCACAAACTGAGCCCCTTCACGACTACAATCAGTGTGGTTATCCTTTCGACATAAAGTCCTAGAAATGATTTTTCAAAACACAAGCCCAAACTCAGCTCCATGAACAGGATTAATTACCAGTTTATTTGTATTAATTCTATCCATAAATGTTCTAGGTCTACTACCTTACGCTTTCACTTCAACAAGACACATTTCATTAACATATAGCCTAGGCTTCCCATTATGAATGGCAGTAAAAATCTTAGGCTTTTATTTAGCATTTAAAGCTCGACTAAGTCACCTTGTCCCACAAGGCACTCCTGCCGCTTTAATTCCAGCAATGGTCTGAATAGAAACTCTTAGTCTATTTGCTCAACCAATAGCATTAGGACTACGTTTAGCAGCCAATTTAACAGCAGGTCACCTACTAATATTCCTGCTCTCAACTGCAATTTGACTATTAGCCTCTAATCCTTTTATTAGATTACCTATATTTATAATCTTCGTATTGCTATTTATACTAGAAATAGGTGTAGCTTGTATACAAGCCTACGTTTTCACTGCTTTAGTACATTTCTACCTACTACAA Leodia_seiesperforata_LSP1 AGACA-AAATATAGAGGGTCCTGCCTGCCCAGTGACATAAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATGTTCGTTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAA-TACTAATTTTTAATCACTCTTTGTTTTATTCTAATTTTACTTCC-ACTAAATTCAACTAA-GAGAAAATTATTGGTACAAGCTTTGGTTGGGGCAACCGCGGAGAAGAAAAACCCTCCGCTTACAACAAATAAATGTAAGACTCTACAAGTCTAATATTGTATAAACAAGTAATACTGATCCACTACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATTTAATTTTTGGGGCCTGAGCAGGAATGGTCGGGACCGCCATGAGCGTAATCATACGAGCTGAGCTCGCTCAACCAGGTTCTCTACTCCAAGACGACCAAATTTACAATGTAATCGTAACAGCCCACGCCCTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGAGGATTTGGAAACTGATTAATTCCTCTAATGATCGGTGCTCCAGATATGGCCTTTCCTCGAATGAATAAAATGAGATTCTGACTAGTGCCTCCCTCATTTATCCTACTTCTAGCGTCAGCAGGAGTAGAGAGAGGAGCTGGAACAGGCTGAACTATCTACCCCCCACTTTCTAGCAACATAGCACATGCGGGCGGATCAGTAGACCTTGCCATTTTTTCACTACATCTTGCTGGTGCCTCCTCAATCTTAGCCTCAATAAATTTTATTACAACGATCATAAACATGCGTACCCCAGGTATCTCTTTTAGCCGTCTTCCTTTATTCGTATGATCTGTCTTTGTAACAGCCTTCCTTCTGCTTTTATCTCTACCAGTATTAGCAGGAGCCATTACAATGCTTCTAACAGACCGAAATATTAATACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTCTTCCAACATCTTTTTTGATTCTTTGGTCACCCAGAAGTTTATATTCTAATACTCCCAGGATTCGGAATGATTTCGCATGTTATTGCCCACTACTCTGGAAAGCGAGAACCATTCGGATACCTAGGTATGGTTTACGCAATGATAGCAATAGGAATTTTAGGTTTCCTAGTCTGAGCTCACCATATGTTTACCGTAGGGATGGACGTTGACACACGAGCATACTTTACGGCCGCCACAATGATAATCGCTGTCCCTACTGGAATCAAGGTATTCAGCTGAATGGCTACTCTCCAAGGGTCAAATTTACAGTGAGAAACTCCTCTACTCTGATCGCTAGGCTTTGTATTCCTATTTACCCTAGGAGGACTAACCGGAATAGTGCTGGCTAATTCTTCAATAGACGTTGTTCTTCACGATACTTACTACGTAGTAGCACACTTCCACTACGTTTTATCAATGGGGGCAGTATTCGCAATATTCGCAGGATTCACTCACTGATTTCCACTGTTCTCTGGTTATAGCCTACATCCATTTTGAGGGAAGGCACACTTCTTTATAATGTTCATAGGAGTAAACCTAACCTTTTTCCCGCAGCATTTCTTAGGACTAGCAGGAATGCCTCGACGATATTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAACAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTTGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCGGCCCGGTTTCGGATCCGCAAGGACCGTGCCGGAGTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGTCGCAGGTAGCTCCACCATCGGTCTTCGGGCCAGGCGGAGAACTAATAGCGTCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCCACCGTCTCCCGCAGGTCTCCCCGCGGTTTACTGTACTCAGTGCTCTGCGAGGGACGGCAGGCGGCGAGTGCGGATGGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGATTTTGTTTGATGAATAATAAAATTTTTCCTTGTCTGAACAGCCATACTAGTTGTTCTTACCATCCTAATCTCGAAAGAGACATCCTACAGAGTTGACCAACTCTCTTCCTCCCCTGAAATAGAAAAGGGAACAACAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATTTTTGGTCAATTTTTCCCTAGTACATTATTTTTAATTCCTATGAATATCTTCTCAACTTTCTTTGCATTGTCCTGACTACTATTCATCTTCCCCACAAACTGAGCTCCCTCACGATTACAATCGATATGATTATCTTTTCGTCATAAAGTCCTAGAAATGATCTTCCAAAATACAAGCCCTAATTCAGCTCCATGAACAGGTCTAATTACCAGTCTATTCATACTAATATTATCCATCAACGTTTTAGGCTTACTTCCTTACGCTTTTACCTCAACTAGACACATTTCACTAACCTATAGTTTAGGCTTTCCATTATGAATGGCAGTAAAAATACTAGGATTTTATTTAGCATTCAAAGCCCGGCTAAGACACCTTGTCCCGCAAGGTACTCCAGCCGCCCTCATCCCAGCAATGGTATGAATAGAAACGCTAAGACTATTCGCGCAGCCAATAGCACTAGGATTACGTCTTGCAGCCAACCTAACAGCAGGGCACCTTCTAATTTTCCTGCTCTCAACCGCTATTTGACTGTTAGCCTCTAATCCATTCATTAGCCTTCCTATCTTTATAGTATTCGTCCTTCTCTTCATACTAGAAATAGGCGTAGCTTGTATACAAGCCTATGTCTTCACCGCTTTAGTACATTTCTACCTACTGCAA Mellita_quinquiesperforata_MQBTP1 AAATAT-AACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTCATATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAGAAC-GCTAATTTCTACTTCCTCTTAATTACATTCTAATTTTT-TTTCTGTTAAATTTAACTAA-GAGAAAATTATTAGTACAAGCTTTGGTTGGGGCAACCACGGAGAAGAAAAATCCTCCGCTTACAACAGATAAAAACAAGACCCTACAAGTCTAATATTGTATAAACAAGT-CAACTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATCTTTGGAGCCTGAGCAGGAATGGTCGGGACTGCTATGAGAGTAATTATACGAGCTGAGCTTGCCCAACCGGGATCTCTACTTCAAGACGACCAAATTTACAATGTAATCGTAACAGCACATGCCTTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCTCGTATGAACAAAATGAGATTCTGACTGGTACCTCCCTCATTCATCCTACTATTAGCATCAGCTGGAGTGGAAAGAGGAGCTGGGACAGGATGAACTATTTACCCACCTCTTTCCAGTAACATAGCACACGCTGGTGGATCAGTAGACCTTGCTATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAATTTTATAACAACAATCATAAACATGCGTACTCCAGGCATTTCTTTTGATCGACTACCTTTATTTGTGTGGTCAGTATTCGTAACAGCTTTTCTACTACTTTTATCTTTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATTTCAACATCTTTTCTGATTCTTTGGTCATCCAGAAGTTTATATCCTTATACTTCCAGGATTCGGAATGATCTCACACGTTATTGCTCATTACTCTGGAAAGCGAGAACCATTTGGATACCTAGGCATGGTATACGCCATGATAGCAATAGGAATACTAGGCTTTTTAGTTTGAGCCCACCACATGTTTACTGTAGGAATGGACGTAGATACACGAGCATACTTTACAGCTGCTACCATGATAATTGCTGTTCCCACAGGGATTAAGGTATTCAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAGTGAGAAACTCCCCTACTGTGATCACTAGGATTTGTATTCTTATTTACCCTAGGAGGACTAACAGGAATAGTACTAGCAAATTCCTCAATAGATGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTACGTACTATCAATGGGAGCAGTATTCGCAATATTTGCAGGATTTACTCATTGATTTCCATTATTTTCCGGTTATAGCCTACATCCGCTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTTAACCTAACCTTTTTTCCACAACACTTCCTAGGGCTAGCAGGAATGCCACGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGAC-GGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGTCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCTATACTAGTAGTTCTTACTATACTAGTCTCAAAAGAGACGCCTTCCAAAGTTGACCAACTATCTTCTTCCCCCAAGATAGCTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATCTTTGGTCAATTTTTTCCGAATACTTTACTTCTAATTCCTATGAACGTTTTTTCAACGTTTTTCGCACTATCCTGACTATTATTCATCTTCCCCACAAACTGAGCCCCCTCACGACTACAATCAATATGACTATCCTTTCGACACAAAATACTGGAAATGATTTTCCAAAATACAAGCCCCAATTCAGCACCATGAACTGGTCTGATTACCAGCTTATTTGTGTTAATCTTATCTATTAATGTTCTAGGATTATTACCTTATGCTTTCACCTCAACAAGACACATCTCACTAACATATAGCTTAGGCTTCCCATTATGAATGGCAGTTAAAATCCTAGGATTTTACCTAGCATTTAAAGCCCGACTAAGTCACCTAGTTCCACAAGGAACCCCCGCTGCCTTAATCCCAGCAATGGTCTGGATAGAAACACTAAGTCTCTTCGCTCAACCAATAGCATTAGGGCTACGTCTCGCAGCTAATTTAACAGCAGGACATCTTTTAATTTTCCTTCTTTCAACTGCTATTTGATTATTAGCCTCTAACCCCTTTATTAGCTTACCTATATTTATAATTTTCGTCTTATTATTTATACTAGAAATAGGCGTAGCTTGCATACCAGCCTACGTTTTTACTGCTTTAGTACATTTCTACCTACTACAA Mellita_quinquiesperforata_MQPP1 AAATAT-AACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTCATATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAGAAC-GCTAATTTCTAGTTCCTCTTAATTACATTCTAATTTTT-TTTCTGTTAAATTTAACTAA-GAGAAAATTATTAGTACAAGCTTTGGTTGGGGCAACCACGGAGAAGAAAAATCCTCCGCTTACAACAGATAAAAACAAGACCCTACAAGTCTAATATTGTATAAACAAGT-CAACTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAAGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATCTTTGGAGCCTGAGCAGGAATGGTCGGGACTGCTATGAGAGTAATTATACGAGCTGAGCTTGCCCAACCGGGATCTCTACTTCAAGACGACCAAATTTACAATGTAATCGTAACAGCACATGCCTTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCTCGTATGAACAAAATGAGATTCTGACTGGTACCTCCCTCATTCATCCTACTATTAGCATCAGCCGGAGTGGAAAGAGGAGCTGGGACAGGATGAACTATTTACCCACCTCTTTCCAGTAACATAGCACACGCTGGTGGATCAGTAGACCTTGCTATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAATTTTATAACAACAATCATAAACATGCGTACTCCAGGCATTTCTTTTGATCGACTACCTTTATTTGTGTGGTCAGTATTCGTAACAGCTTTTCTACTACTTTTGTCTTTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATTTCAACACCTTTTCTGATTCTTTGGTCATCCAGAAGTTTATATCCTTATACTTCCAGGATTCGGAATGATCTCACACGTTATTGCTCATTACTCTGGAAAGCGAGAACCATTTGGATACCTAGGCATGGTATACGCCATGATAGCAATAGGAATACTAGGCTTTTTAGTTTGAGCCCACCACATGTTTACTGTAGGAATGGACGTAGATACACGAGCATACTTTACAGCTGCTACCATGATAATTGCTGTTCCCACAGGGATTAAGGTATTCAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAGTGAGAAACTCCCCTACTGTGATCACTAGGATTTGTATTCTTATTTACCCTAGGAGGACTAACAGGAATAGTACTAGCAAATTCCTCAATAGATGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTACGTACTATCAATGGGAGCAGTATTCGCAATATTTGCAGGATTTACTCATTGATTTCCATTATTTTCCGGTTATAGCCTACATCCGCTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTTAACCTAACCTTTTTTCCACAACACTTCCTAGGGCTAGCAGGAATGCCACGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGAC-GGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGTCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCTATACTAGTAGTTCTTACTATACTAGTCTCAAAAGAGACGCCTTCCAAAGTTGACCAACTATCTTCTTCCCCCAAGATAGCTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATCTTTGGTCAATTTTTTCCGAATACTTTACTTCTAATTCCTATGAACGTTTTTTCAACGTTTTTCGCACTATCCTGACTATTATTCATCTTCCCCACAAACTGAGCCCCCTCACGACTACAATCAATATGACTATCCTTTCGACACAAAATACTGGAAATGATTTTCCAAAATACAAGCCCCAATTCAGCACCATGAACTGGACTGATTACCAGCTTATTTGTGTTAATCTTATCTATTAATGTTCTAGGATTATTACCTTATGCTTTCACCTCAACAAGACACATCTCACTAACATATAGCTTAGGCTTCCCATTATGAATGGCAGTAAAAATCCTAGGATTTTACCTAGCATTTAAAGCCCGACTAAGTCACCTAGTTCCACAAGGAACCCCCGCTGCCTTAATCCCAGCAATGGTCTGGATAGAAACACTAAGCCTCTTCGCTCAACCAATAGCATTAGGGCTACGTCTCGCAGCTAATTTAACAGCAGGACATCTTTTAATTTTCCTTCTTTCAACTGCTATTTGATTATTAGCCTCTAACCCCTTTATTAGCTTACCTATATTTATAATTTTCGTCTTATTATTTATACTAGAAATAGGCGTAGCTTGCATACCAGCCTACGTTTTTACTGCTTTAGTACATTTCTACCTACTACAA Mellita_quinquiesperforata_MQPP4 AAATAT-AACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTCATATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAGAAC-GCTAATTTCTACTTCCTCTTAATTACATTCTAATTTTT-TTTCTGTTAAATTTAACTAA-GAGAAGATTATTAGTACAAGCTTTGGTTGGGGCAACCACGGAGAAGAAAAATCCTCCGCTTACAACAGATAAAAACAAGACCCTACAAGTCTAATATTGTATAAACAAGT-CAACTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATCTTTGGAGCCTGAGCAGGAATGGTCGGGACTGCTATGAGAGTAATTATACGAGCTGAGCTTGCCCAACCGGGATCTCTACTTCAAGACGACCAAATTTACAATGTAATCGTAACAGCACATGCCTTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCTCGTATGAACAAAATGAGATTCTGACTGGTACCTCCCTCATTCATCCTACTATTAGCATCAGCTGGAGTGGAAAGAGGAGCTGGGACAGGATGAACTATTTACCCACCTCTTTCCAGTAACATAGCACACGCTGGTGGATCAGTAGACCTTGCTATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAATTTTATAACAACAATCATAAACATGCGTACTCCAGGCATTTCTTTTGATCGACTACCTTTATTTGTGTGGTCAGTATTCGTAACAGCTTTTCTACTACTTTTATCTTTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATTTCAACATCTTTTCTGATTCTTTGGTCATCCAGAAGTTTATATCCTTATACTTCCAGGATTCGGAATGATCTCACACGTTATTGCTCATTACTCTGGAAAGCGAGAACCATTTGGATACCTAGGCATGGTATACGCCATGATAGCAATAGGAATACTAGGCTTTTTAGTTTGAGCCCACCACATGTTTACTGTAGGAATGGACGTAGATACACGAGCATACTTTACAGCTGCTACCATGATAATTGCTGTTCCCACAGGGATTAAGGTATTCAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAGTGAGAAACTCCCCTACTGTGATCACTAGGATTTGTATTCTTATTTACCCTAGGAGGACTAACAGGAATAGTACTAGCAAATTCCTCAATAGATGTCGTTCTTCACGATACTTACTATGTAGTAGCACACTTTCACTACGTACTATCAATGGGAGCAGTATTCGCAATATTTGCAGGATTTACTCATTGATTTCCATTATTTTCCGGTTATAGCCTACATCCGCTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTTAACCTAACCTTTTTTCCACAACACTTCCTAGGGCTAGCAGGAATGCCACGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGAC-GGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGTCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCTATACTAGTAGTTCTTACTATACTAGTCTCAAAAGAGACGCCTTCCAAAGTTGACCAACTATCTTCTTCCCCCAAGATAGCTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATCTTTGGTCAATTTTTTCCGAATACTTTACTTCTAATTCCTATGAACGTTTTTTCAACGTTTTTCGCACTATCCTGACTATTATTCATCTTCCCCACAAACTGAGCCCCCTCACGACTACAATCAATATGACTATCCTTTCGACACAAAATACTGGAAATGATTTTCCAAAATACAAGCCCCAATTCAGCACCATGAACTGGTCTGATTACCAGCTTATTTGTGTTAATCTTATCTATTAATGTTCTAGGATTATTACCTTATGCTTTCACCTCAACAAGACACATCTCACTAACATATAGCTTAGGCTTCCCATTATGAATGGCAGTTAAAATCCTAGGATTTTACCTAGCATTTAAAGCCCGACTAAGTCACCTAGTTCCACAAGGAACCCCCGCTGCCTTAATCCCAGCAATGGTCTGGATAGAAACACTAAGTCTCTTCGCTCAACCAATAGCATTAGGGCTACGTCTCGCAGCTAATTTAACAGCAGGACATCTTTTAATTTTCCTTCTTTCAACTGCTATTTGATTATTAGCCTCTAACCCCTTTATTAGCTTACCTATATTTATAATTTTCGTCTTATTATTTATACTAGAAATAGGCGTAGCCTGCATACCAGCCTACGTTTTTACTGCTTTAGTACATTTCTACCTACTACAA Mellita_quinquiesperforata_MQSBP1 AAATAT-AACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTCATATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAGAAC-GCTAATTTCTACTTCCTCTTAATTACATTCTAATTTTT-TTTCTGTTAAATTTAACTAA-GAGAAAATTATTAGTACAAGCTTTGGTTGGGGCAACCACGGAGAAGAAAAATCCTCCGCTTACAACAGATAAAAACAAGACCCTACAAGTCTAATATTGTATAAACAAGT-CAACTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATCTTTGGAGCCTGAGCAGGAATGGTCGGGACTGCTATGAGAGTAATTATACGAGCTGAGCTTGCCCAACCGGGATCTCTACTTCAAGACGACCAAATTTACAATGTAATCGTAACAGCACATGCCTTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCTCGTATGAACAAAATGAGATTCTGACTGGTACCTCCCTCATTCATCCTACTATTAGCATCAGCTGGAGTGGAAAGAGGAGCTGGGACAGGATGAACTATTTACCCACCTCTTTCCAGTAACATAGCACACGCTGGTGGATCAGTAGACCTTGCTATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAATTTTATAACAACAATCATAAACATGCGTACTCCAGGCATTTCTTTTGATCGACTACCTTTATTTGTGTGGTCAGTATTCGTAACAGCTTTTCTACTACTTTTATCTTTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATTTCAACATCTTTTCTGATTCTTTGGTCATCCAGAAGTTTATATCCTTATACTTCCAGGATTCGGAATGATCTCACACGTTATTGCTCATTACTCTGGAAAGCGAGAACCATTTGGATACCTAGGCATGGTATACGCCATGATAGCAATAGGAATACTAGGCTTTTTAGTTTGAGCCCACCACATGTTTACTGTAGGAATGGACGTAGATACACGAGCATACTTTACAGCTGCTACCATGATAATTGCTGTTCCCACAGGGATTAAGGTATTCAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAGTGAGAAACTCCCCTACTGTGATCACTAGGATTTGTATTCTTATTTACCCTAGGAGGACTAACAGGAATAGTACTAGCAAATTCCTCAATAGATGTCGTTCTTCACGATACTTACTATGTAGTAGCACACTTTCACTACGTACTATCAATGGGAGCAGTATTCGCAATATTTGCAGGATTTACTCATTGATTTCCATTATTTTCCGGTTATAGCCTACATCCGCTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTTAACCTAACCTTTTTTCCACAACACTTCCTAGGGCTAGCAGGAATGCCACGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGAC-GGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGTCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCTATACTAGTAGTTCTTACTATACTAGTCTCAAAAGAGACGCCTTCCAAAGTTGACCAACTATCTTCTTCCCCCAAGATAGCTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATCTTTGGTCAATTTTTTCCGAATACTTTACTTCTAATTCCTATGAACGTTTTTTCAACGTTTTTCGCACTATCCTGACTATTATTCATCTTCCCCACAAACTGAGCCCCCTCACGACTACAATCAATATGACTATCCTTTCGACACAAAATACTGGAAATGATTTTCCAAAATACAAGCCCCAATTCAGCACCATGAACTGGTCTGATTACCAGCTTATTTGTGTTAATCTTATCTATTAATGTTCTAGGATTATTACCTTATGCTTTCACCTCAACAAGACACATCTCACTAACATATAGCTTAGGCTTCCCATTATGAATGGCAGTTAAAATCCTAGGATTTTACCTAGCATTTAAAGCCCGACTAAGTCACCTAGTTCCACAAGGAACCCCCGCTGCCTTAATCCCAGCAATGGTCTGGATAGAAACACTAAGTCTCTTCGCTCAACCAATAGCATTAGGGCTACGTCTCGCAGCTAATTTAACAGCAGGACATCTTTTAATTTTCCTTCTTTCAACTGCTATTTGATTATTAGCCTCTAACCCCTTTATTAGCTTACCTATATTTATAATTTTCGTCTTATTATTTATACTAGAAATAGGCGTAGCCTGCATACCAGCCTACGTTTTTACTGCTTTAGTACATTTCTACCTACTACAA Mellita_quinquiesperforata_MQSBP2 AAATAT-AACATAGAGGGTCCTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTTAACTGTCTCCTTTTCTCATATCCTAATTTCACTTTCCCGTGAAGAGGCGGGAAAACATTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAGAAC-GCTAATTTCTAGTTCCTCTTAATTACATTCTAATTTTT-TTTCTGTTAAATTTAACTAA-GAGAAAATTATTAGTACAAGCTTTGGTTGGGGCAACCACGGAGAAGAAAAATCCTCCGCTTACAACAGATAAAAACAAGACCCTACAAGTCTAATATTGTATAAACAAGT-CAACTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATCTTTGGAGCCTGAGCAGGAATGGTCGGGACTGCTATGAGAGTAATTATACGAGCTGAGCTTGCCCAACCGGGATCTCTACTTCAAGACGACCAAATTTACAATGTAATCGTAACAGCACATGCCTTAGTAATGATTTTTTTCATGGTAATGCCTATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCTCGTATGAACAAAATGAGATTCTGACTGGTACCTCCCTCATTCATCCTACTATTAGCATCAGCCGGAGTGGAAAGAGGAGCTGGGACAGGATGAACTATTTACCCACCTCTTTCCAGTAACATAGCACACGCTGGTGGATCAGTAGACCTTGCTATTTTTTCACTACATCTTGCTGGTGCCTCTTCAATCTTAGCATCAATAAATTTTATAACAACAATCATAAACATGCGTACTCCAGGCATTTCTTTTGATCGACTACCTTTATTTGTGTGGTCAGTATTCGTAACAGCTTTTCTACTACTTTTGTCTTTACCAGTTCTAGCAGGAGCAATTACAATGCTTCTGACAGACCGAAACATTAACACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATTTCAACACCTTTTCTGATTCTTTGGTCATCCAGAAGTTTATATCCTTATACTTCCAGGATTCGGAATGATCTCACACGTTATTGCTCATTACTCTGGAAAGCGAGAACCATTTGGATACCTAGGCATGGTATACGCCATGATAGCAATAGGAATACTAGGCTTTTTAGTTTGAGCCCACCACATGTTTACTGTAGGAATGGACGTAGATACACGAGCATACTTTACAGCTGCTACCATGATAATTGCTGTTCCCACAGGGATTAAGGTATTCAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAGTGAGAAACTCCCCTACTGTGATCACTAGGATTTGTATTCTTATTTACCCTAGGAGGACTAACAGGAATAGTACTAGCAAATTCCTCAATAGATGTTGTCCTTCACGATACTTACTATGTAGTAGCACACTTTCACTACGTACTATCAATGGGAGCAGTATTCGCAATATTTGCAGGATTTACTCATTGATTTCCATTATTTTCCGGTTATAGCCTACATCCGCTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTTAACCTAACCTTTTTTCCACAACACTTCCTAGGGCTAGCAGGAATGCCACGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCAGGGCCCGAC-GGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGTCGTCCCGGCTCGGTTTCGGATCCGCAAGGACCGTACCGG-GTCGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGTCCAGGTCGGCCGAAGGCATCGGTGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGCGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCGCCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAGTAAAATTTTTCCTTGTATGAACAGCTATACTAGTAGTTCTTACTATACTAGTCTCAAAAGAGACGCCTTCCAAAGTTGACCAACTATCTTCTTCCCCCAAGATAGCTAAGAAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGCTTACAGAATCTTTGGTCAATTTTTTCCGAATACTTTACTTCTAATTCCTATGAACGTTTTTTCAACGTTTTTCGCACTATCCTGACTATTATTCATCTTCCCCACAAACTGAGCCCCCTCACGACTACAATCAATATGACTATCCTTTCGACACAAAATACTGGAAATGATTTTCCAAAATACAAGCCCCAATTCAGCACCATGAACTGGACTGATTACCAGCTTATTTGTGTTAATCTTATCTATTAATGTTCTAGGATTATTACCTTATGCTTTCACCTCAACAAGACACATCTCACTAACATATAGCTTAGGCTTCCCATTATGAATGGCAGTAAAAATCCTAGGATTTTACCTAGCATTTAAAGCCCGACTAAGTCACCTAGTTCCACAAGGAACCCCCGCTGCCTTAATCCCAGCAATGGTCTGGATAGAAACACTAAGCCTCTTCGCTCAACCAATAGCATTAGGGCTACGTCTCGCAGCTAATTTAACAGCAGGACATCTTTTAATTTTCCTTCTTTCAACTGCTATTTGATTATTAGCCTCTAACCCCTTTATTAGCTTACCTATATTTATAATTTTCGTCTTATTATTTATACTAGAAATAGGCGTAGCTTGCATACCAGCCTACGTTTTTACTGCTTTAGTACATTTCTACCTACTACAA Mellitella_stokesii_MSPVP1 AAATATAAACATAGAGGGTACTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTCAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATACTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAATTACTAATTTTTAATTAATTTTAGTTATATTCTAATT--ACTCCC-ACTAAATACAACTAA-AATTAAATTATTAGTATAAGCTTTGGTTGGGGCAACCACGGAGAAAAAGAATCCTCCGATTACAATAAATAAAAACAAGACT-TACAAATCTAATATTGCAGAAGCAAGTAA-ATTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATTTTTGGGGCCTGAGCAGGTATGGTTGGAACAGCCATGAGCGTAATTATACGAGCTGAACTAGCCCAACCCGGATCCTTACTTCAAGACGATCAAATTTATAATGTAATAGTAACTGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCCCCAGACATGGCATTCCCACGTATGAATAAAATGAGATTCTGATTAGTACCCCCATCATTTATTCTCCTTCTAGCATCAGCCGGAGTAGAAAGAGGGGCTGGTACAGGATGAACTATTTACCCACCTCTTTCTAGAAATATAGCACATGCTGGCGGATCAGTTGACCTTGCTATTTTCTCACTTCATCTTGCTGGAGCTTCTTCAATCCTAGCATCAATAAACTTCATCACAACTATTATAAATATGCGCACTCCAGGTATTTCTTTTGACCGTCTACCTTTATTTGTATGATCGGTTTTTGTTACCGCTTTCCTACTTCTTTTATCTCTGCCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGTAAAATAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTCTCTTCCAACACCTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATGATCTCACACGTTATTGCTCACTACTCAGGAAAGCGAGAACCGTTTGGATACTTAGGAATGGTTTATGCAATGATTGCAATAGGAATCCTAGGCTTCTTAGTATGAGCTCATCACATGTTCACTGTTGGAATGGACGTAGACACACGAGCATACTTTACAGCAGCTACAATGATAATCGCCGTGCCAACTGGAATTAAGGTATTTAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAATGGGAAACCCCCCTGCTATGATCACTAGGTTTTGTATTCTTATTTACTCTTGGAGGACTAACGGGAATAGTATTAGCCAATTCTTCAATAGACGTCGTTCTTCATGACACTTACTACGTAGTAGCACACTTTCATTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTCCCACTATTTTCAGGCTATAGTCTTCACCCACTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGACTAGCAGGAATGCCTCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCAGTTTGGTTTCGGATCCGCAAGGACCGTACCGG-GTTGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGCCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCTGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTTCTCGTGTGATCAGCTATACTAGTAGTTATTACTATAATAATCTCAAAAGAGACTTCCCCAAAAGTTGACCAACTATCTTCTTCTCCAGAAATAACTAAGGAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTTCCAAATACGTTATTTTTAATCCCAATGAATGTATTTTCGACATTCTTTGCACTGTCTTGGCTATTATTTATATTCCCCACAAACTGAGCCCCATCACGACTACAGTCAATATGAACATCTTTTCGATACAAAGTTCTAGAAATGATTTTCCAAAATACAAGACCTAACTCAGCGCCATGAACCGGACTAATAACCAGATTGTTTATACTAATTTTATCTATTAATGTATTAGGACTTTTACCTTATGCTTTTACATCAACAAGACATATCTCACTAACATACAGCCTAGGTTTCCCATTATGAATGGCAGTAAAAATACTAGGGTTTTATTTGGCATTTAAAGCTCGTCTAAGACACCTAGTACCACAAGGTACTCCTGCCGCCTTAATACCAGCTATGGTTTGAATAGAAACACTAAGTTTGTTCGCCCAACCAATAGCACTAGGATTACGTCTCGCGGCTAATCTAACAGCAGGACACCTTTTAATTTTTCTACTTTCAACTGCCATTTGACTATTAGCTTCTAATCCTTTTATCAGACTACCTATATTTATAATATTTGTCCTATTATTTATACTAGAAATAGGCGTAGCTTGCATACAAGCCTATGTTTTCACTGCTCTAGTACATTTCTACTTACTACAA Mellitella_stokesii_MSPVP2 AAATATAAACATAGAGGGTACTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTCAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATACTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAATTACTAATTTTTAATTAATTTTAGTTATATTCTAATT--ACTCCC-ACTAAATACAACTAA-AATTAAATTATTAGTATAAGCTTTGGTTGGGGCAACCACGGAGAAAAAGAATCCTCCGATTACAATAAATAAAAACAAGACT-TACAAATCTAATATTGCAGAAGCAAGTAA-ATTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATTTTTGGGGCCTGAGCAGGTATGGTTGGAACAGCCATGAGCGTAATTATACGAGCTGAACTAGCCCAACCCGGATCTTTACTTCAAGACGATCAAATTTATAATGTAATAGTAACTGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCCCCAGACATGGCATTCCCACGTATGAATAAAATGAGATTCTGATTAGTACCCCCATCATTTATTCTCCTTCTAGCATCAGCCGGAGTAGAAAGAGGGGCTGGTACAGGATGAACTATTTACCCACCTCTTTCTAGAAATATAGCACATGCTGGCGGATCAGTTGACCTTGCTATTTTCTCACTTCATCTTGCTGGAGCTTCTTCAATCCTAGCATCAATAAACTTCATCACAACTATTATAAATATGCGCACTCCAGGTATTTCTTTTGACCGTCTACCTTTATTTGTATGATCGGTTTTTGTTACCGCTTTCCTACTTCTTTTATCTCTGCCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGTAAAATAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTCTCTTCCAACACCTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATGATCTCACACGTTATTGCTCACTACTCAGGAAAGCGAGAACCGTTTGGATACTTAGGAATGGTTTATGCAATGATTGCAATAGGAATCCTAGGCTTCTTAGTATGAGCTCATCACATGTTCACTGTTGGAATGGACGTAGACACACGAGCATACTTTACAGCAGCTACAATGATAATCGCCGTGCCAACTGGAATTAAGGTATTTAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAATGGGAAACCCCCCTGCTATGATCACTAGGTTTTGTATTCTTATTTACTCTTGGAGGACTAACGGGAATAGTATTAGCCAATTCTTCAATAGACGTCGTTCTTCATGACACTTACTACGTAGTAGCACACTTTCATTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTCCCACTATTTTCAGGCTATAGTCTTCACCCACTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGACTAGCAGGAATGCCTCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCAGTTTGGTTTCGGATCCGCAAGGACCGTACCGG-GTTGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGCCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCTGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTTCTCGTGTGATCAGCTATACTAGTAGTTATTACTATAATAATCTCAAAAGAGACTTCCCCAAAAGTTGACCAACTATCTTCTTCTCCAGAAATAACTAAGGAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTTCCAAATACGTTATTTTTAATCCCAATGAATGTATTTTCGACATTCTTTGCACTGTCTTGGCTATTATTTATATTCCCCACAAACTGAGCCCCATCACGACTACAGTCAATATGAACATCTTTTCGATACAAAGTTCTAGAAATGATTTTCCAAAATACAAGACCTAACTCAGCGCCATGAACCGGACTAATAACCAGATTGTTTATACTAATTTTATCTATTAATGTATTAGGACTTTTACCTTATGCTTTTACATCAACAAGACATATCTCACTAACATACAGCCTAGGTTTCCCATTATGAATGGCAGTAAAAATACTAGGGTTTTATTTGGCATTTAAAGCTCGTCTAAGACACCTAGTACCACAAGGTACTCCTGCCGCCTTAATACCAGCTATGGTTTGAATAGAAACACTAAGTTTGTTCGCCCAACCAATAGCACTAGGATTACGTCTCGCGGCTAATCTAACAGCAGGACACCTTTTAATTTTTCTACTTTCAACTGCCATTTGACTATTAGCTTCTAATCCTTTTATCAGACTACCTATATTTATAATATTTGTCCTACTATTTATACTAGAAATAGGCGTAGCTTGCATACAAGCCTATGTTTTCACTGCTCTAGTACATTTCTACTTACTACAA Mellitella_stokesii_MSPVP3 AAATATAAACATAGAGGGTACTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTCAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATACTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAATTACTAATTTTTAATTAATTTTAGTTATATTCTAATT--ACTCCC-ACTAAATACAACTAA-AATTAAATTATTAGTATAAGCTTTGGTTGGGGCAACCACGGAGAAAAAGAATCCTCCGATTACAATAAATAAAAACAAGACT-TACAAATCTAATATTGCAGAAGCAAGTAA-ATTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATTTTTGGGGCCTGAGCAGGTATGGTTGGAACAGCCATGAGCGTAATTATACGAGCTGAACTAGCCCAACCCGGATCCTTACTTCAAGACGATCAAATTTATAATGTAATAGTAACTGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCCCCAGACATGGCATTCCCACGTATGAATAAAATGAGATTCTGATTAGTACCCCCATCATTTATTCTCCTTCTAGCATCAGCCGGAGTAGAAAGAGGGGCTGGTACAGGATGAACTATTTACCCACCTCTTTCTAGAAATATAGCACATGCTGGCGGATCAGTTGACCTTGCTATTTTCTCACTTCATCTTGCTGGAGCTTCTTCAATCCTAGCATCAATAAACTTCATCACAACTATTATAAATATGCGCACTCCAGGTATTTCTTTTGACCGTCTACCTTTATTTGTATGATCGGTTTTTGTTACCGCTTTCCTACTTCTTTTATCTCTGCCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGTAAAATAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTCTCTTCCAACACCTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATGATCTCACACGTTATTGCTCACTACTCAGGAAAGCGAGAACCGTTTGGATACTTAGGAATGGTTTATGCAATGATTGCAATAGGAATCCTAGGCTTCTTAGTATGAGCTCATCACATGTTCACTGTTGGAATGGACGTAGACACACGAGCATACTTTACAGCAGCTACAATGATAATCGCCGTGCCAACTGGAATTAAGGTATTTAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAATGGGAAACCCCCCTGCTATGATCACTAGGTTTTGTATTCTTATTTACTCTTGGAGGACTAACGGGAATAGTATTAGCCAATTCTTCAATAGACGTCGTTCTTCATGACACTTACTACGTAGTAGCACACTTTCATTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTCCCACTATTTTCAGGCTATAGTCTTCACCCACTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGACTAGCAGGAATGCCTCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCAGTTTGGTTTCGGATCCGCAAGGACCGTACCGG-GTTGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGCCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCTGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTTCTCGTGTGATCAGCTATACTAGTAGTTATTACTATAATAATCTCAAAAGAGACTTCCCCAAAAGTTGACCAACTATCTTCTTCTCCAGAAATAACTAAGGAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTTCCGAATACGTTATTTTTAATCCCAATGAATGTATTTTCGACATTCTTTGCACTGTCTTGGCTATTATTTATATTCCCCACAAACTGAGCCCCATCACGACTACAGTCAATATGAACATCTTTTCGATACAAAGTTCTAGAGATGATTTTCCAAAATACAAGACCTAACTCAGCGCCATGAACCGGACTAATAACCAGATTGTTTATACTAATTTTATCTATTAATGTATTAGGACTTTTACCTTATGCTTTTACATCAACAAGACATATCTCACTAACATACAGCCTAGGTTTCCCATTATGAATGGCAGTAAAAATACTAGGGTTTTATTTGGCATTTAAAGCTCGTCTAAGACACCTGGTACCACAAGGTACTCCTGCCGCCTTAATACCAGCTATGGTTTGAATAGAAACACTAAGTTTGTTCGCCCAACCAATAGCACTAGGATTACGTCTCGCGGCTAATCTAACAGCAGGACACCTTTTAATTTTTCTACTTTCAACTGCCATTTGACTATTAGCTTCTAATCCTTTTATCAGACTACCTATATTTATAATATTTGTCCTACTATTTATACTAGAAATAGGCGTAGCTTGCATACAAGCCTATGTTTTCACTGCTCTAGTACATTTCTACTTACTACAA Mellitella_stokesii_MSRP1 AAATATAAACATAGAGGGTACTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTCAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATACTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAATTACTAATTTTTAATTAATTTTAGTTATATTCTAATT--ACTCCC-ACTAAATACAACTAA-AATTAAATTATTAGTATAAGCTTTGGTTGGGGCAACCACGGAGAAAAAGAATCCTCCGATTACAATAAATAAAAACAAGACT-TACAAATCTAATATTGCAGAAGCAAGTAA-ATTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATTTTTGGGGCCTGAGCAGGTATGGTTGGAACAGCCATGAGCGTAATTATACGAGCTGAACTAGCCCAACCCGGATCCTTACTTCAAGACGATCAAATTTATAATGTAATAGTAACTGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCCCCAGACATGGCATTCCCACGTATGAATAAAATGAGATTCTGATTAGTACCCCCATCATTTATTCTCCTTCTAGCATCAGCCGGAGTAGAAAGAGGGGCTGGTACAGGATGAACTATTTACCCACCTCTTTCTAGAAATATAGCACATGCTGGCGGATCAGTTGACCTTGCTATTTTCTCACTTCATCTTGCTGGAGCTTCTTCAATCCTAGCATCAATAAACTTCATCACAACTATTATAAATATGCGCACTCCAGGTATTTCTTTTGACCGTCTACCTTTATTTGTATGATCGGTTTTTGTTACCGCTTTCCTACTTCTTTTATCTCTGCCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGTAAAATAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTCTCTTCCAACACCTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATGATCTCACACGTTATTGCTCACTACTCAGGAAAGCGAGAACCGTTTGGATACTTAGGAATGGTTTATGCAATGATTGCAATAGGAATCCTAGGCTTCTTAGTATGAGCTCATCACATGTTCACTGTTGGAATGGACGTAGACACACGAGCATACTTTACAGCAGCTACAATGATAATCGCCGTGCCAACTGGAATTAAGGTATTTAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAATGGGAAACCCCCCTGCTATGATCACTAGGTTTTGTATTCTTATTTACTCTTGGAGGACTTACGGGAATAGTATTAGCCAATTCTTCAATAGACGTCGTCCTTCATGACACTTACTACGTAGTAGCACACTTTCATTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTCCCACTATTTTCAGGCTATAGTCTTCACCCACTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGACTAGCAGGAATGCCTCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCAGTTTGGTTTCGGATCCGCAAGGACCGTACCGG-GTTGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGCCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCTGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTTCTCGTGTGATCAGCTATACTAGTAGTTATTACTATAATAATCTCAAAAGAGACTTCCCCAAAAGTTGACCAACTATCTTCTTCTCCAGAAATAACTAAGGAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTTCCAAATACGTTATTTTTAATCCCAATGAATGTATTTTCGACATTCTTTGCACTGTCTTGGCTATTATTTATATTCCCCACAAACTGAGCCCCATCACGACTACAGTCAATATGAACATCTTTTCGATACAAAGTTCTAGAAATGATTTTCCAAAATACAAGACCTAACTCAGCGCCATGAACCGGACTAATAACCAGATTGTTTATACTAATTTTATCTATTAATGTATTAGGACTTTTACCTTATGCTTTTACATCAACAAGACATATCTCACTAACATACAGCCTAGGTTTCCCATTATGAATGGCAGTAAAAATACTAGGGTTTTATTTGGCATTTAAAGCTCGTCTAAGACACCTAGTACCACAAGGTACTCCTGCGGCCTTAATACCAGCTATGGTTTGAATAGAAACACTAAGTTTGTTCGCCCAACCAATAGCACTAGGATTACGTCTCGCGGCTAATCTAACAGCAGGACACCTTTTAATTTTTCTACTTTCAACTGCCATTTGACTATTAGCTTCTAATCCTTTTATCAGACTACCTATATTTATAATATTTGTCCTACTATTTATACTAGAAATAGGCGTAGCTTGCATACAAGCCTATGTTTTCACTGCTCTAGTACATTTCTACTTACTACAA Mellitella_stokesii_MSRP2 AAATATAAACATAGAGGGTACTGCCTGCCCAGTGACA-AAAAGTTAAACGGCCGCGGTATCTTGACCGTGCGAAGGTAGCATAATCACTTGTCTCCTAAATAGAGACTGGTATGAATGGCAAGACGGAACTCAACTGTCTCCTTTTCTTATATCTTAATTTCACTTTCCCGTGAAGAGGCGGGAAAATACTCGCTAGACGAGAAGACCCTGTCGAGCTTAAGCAAAATTACTAATTTTTAATTAATTTTAGTTATATTCTAATT--ACTCCC-ACTAAATACAACTAA-AATTAAATTATTAGTATAAGCTTTGGTTGGGGCAACCACGGAGAAAAAGAATCCTCCGATTACAATAAATAAAAACAAGACT-TACTAATCTAATATTGCAGAAGCAAGTAA-ATTGATCCACCACGGTGATCAAAGGAAAAAGTTACCGCAGGGATAACAGCGTTATCTTTTCTGAGAGTTCACATTGACGAAAAGGTTTGCGACCTCGATGTTGGATCGGGACATCCTAAGGGTGCAGAAGCTTTTAAGGGTTGGTCTGTTCGACCATTAAAGTCCTCACAAGGACATCGGAACACTTTATCTAATTTTTGGGGCCTGAGCAGGTATGGTTGGAACAGCCATGAGCGTAATTATACGAGCTGAACTAGCCCAACCCGGATCCTTACTTCAAGACGATCAAATTTATAATGTAATAGTAACTGCCCATGCCCTAGTAATGATTTTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAACTGACTAATCCCTTTAATGATTGGTGCCCCAGACATGGCATTCCCACGTATGAATAAAATGAGATTCTGATTAGTACCCCCATCATTTATTCTCCTTCTAGCATCAGCCGGAGTAGAAAGAGGGGCTGGTACAGGATGAACTATTTACCCACCTCTTTCTAGAAATATAGCACATGCTGGCGGATCAGTTGACCTTGCTATTTTCTCACTTCATCTTGCTGGAGCTTCTTCAATCCTAGCATCAATAAACTTCATCACAACTATTATAAATATGCGCACTCCAGGTATTTCTTTTGACCGTCTACCTTTATTTGTATGATCGGTTTTTGTTACCGCTTTCCTACTTCTTTTATCTCTGCCAGTTCTAGCAGGAGCAATTACAATGCTTCTAACAGACCGTAAAATAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTCTCTTCCAACACCTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATGATCTCACACGTTATTGCTCACTACTCAGGAAAGCGAGAACCGTTTGGATACTTAGGAATGGTTTATGCAATGATTGCAATAGGAATCCTAGGCTTCTTAGTATGAGCTCATCACATGTTCACTGTTGGAATGGACGTAGACACACGAGCATACTTTACAGCAGCTACAATGATAATCGCCGTGCCAACTGGAATTAAGGTATTTAGCTGAATGGCCACTCTTCAAGGATCAAACCTACAATGGGAAACCCCCCTGCTATGATCACTAGGTTTTGTATTCTTATTTACTCTTGGAGGACTTACGGGAATAGTATTAGCCAATTCTTCAATAGACGTCGTCCTTCATGACACTTACTACGTAGTAGCACACTTTCATTACGTTTTATCAATGGGAGCAGTATTTGCAATATTTGCAGGATTTACTCACTGATTCCCACTATTTTCAGGCTATAGTCTTCACCCACTTTGAGGAAAGGCACACTTCTTTTTAATGTTTATAGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGACTAGCAGGAATGCCTCGACGATACTCAGACTACACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGCGGGAATAGCCCATCGCTGAATCCCGGGGCCCGACCGGACCCCGGGAGTTGTGGCGTGAGGCGGCTTCGGGCGCTCGAGTTCACGGTGCCGAGGTCCTCCTGATCGGGGCACCTTACCCAGAGCGGGTGTCAGGCCCGTTCAGGCGCCGGAACTCGCGGGCCTGGAGCCACCAAGAGTCGGGTAGTTTTGGAATGCTGCCCAAAGAGGGGTGGTGAACTCCATCCAAGGCTAAATACTGGCACGAGACCGATAGCAGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTCTGAAGAGAGAGTTCAAGAGGACGTGAAACCGCCAAGAAGCAAACGAGCAGGACCCGCGGCACGGGCCCGTGGAGATTCAGCGTGTCGGTCGCCGTCCCAGTTTGGTTTCGGATCCGCAAGGACCGTACCGG-GTTGGGCGGCGGCGGTCGATGCGTGCACTTCTCCCGGGCGCGGCGCTCGGGACCGGCAGCCCAGGTCGGCCGAAGGCATCGGCGCAGGTAGCTCCACCATCGGTCTTCGGGCCCGGAGGAGAACTAATAGCATCGGCTGCAACGCCGACCGAGCTGCCGAGGAAGGGACGCGAGCCGCGCCCGCCCCGTTCGCGGGGCTGCACCTACCGTCTCCCGCAGGTCTCCCCGCCGTTTACTGTACTCAGTGCTCGGTGAGGGACGGCAGGCGGCGAGTGCGGATAGGTGGCACGTGGCGCCTCGGGTCGCCGAGCGAAGCTGGGCGCCTGCTCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGGGCCCGCGAGTCAAGGGGCCTCTCGAAACCCCACGGCGCAATGAAGGTGAAGGTCGATTCGGTCGACCGAGGTGGGATCCTCTCTTCGGGGAGGCGCACCACCGCCCCGCCATATCCGCTCTGCTCGGTGTGGCGGAGGTAGAGCGGGCACGCTAGGACCCGAAAGATGGTGAACTATGCCCGAGCAGGATGAAGCCAGAGGAAACTCTGGTGGAGGTCCGCAGCGATTCTGACGTGCAAATCGATCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCTGAAGTTCCCTGTGCCACAATTAGACTTTGTTTGATGAATAATAAAATTTTTTCTCGTGTGATCAGCTATACTAGTAGTTATTACTATAATAATCTCAAAAGAGACTTCCCCAAAAGTTGACCAACTATCTTCTTCTCCAGAAATAACTAAGGAAACAGCAGAATGACAATGACTTTAGATGACAATGACTTTAGTTTATAGAATTTTTGGTCAATTTTTTCCAAATACGTTATTTTTAATCCCAATGAATGTATTTTCGACATTCTTTGCACTGTCTTGGCTATTATTTATATTCCCCACAAACTGAGCCCCGTCACGACTACAGTCAATATGAACATCTTTTCGATACAAAGTTCTAGAAATGATTTTCCAAAATACAAGACCTAACTCAGCACCATGAACCGGACTAATAACCAGATTGTTTATACTAATTTTATCTATTAATGTATTAGGACTTTTACCCTATGCTTTTACATCAACAAGACATATCTCACTAACATACAGCCTAGGTTTCCCATTATGAATGGCAGTAAAAATACTAGGGTTTTATTTGGCATTTAAAGCTCGTCTAAGACACCTAGTACCACAAGGTACTCCTGCCGCCTTAATACCAGCTATGGTTTGAATAGAAACACTAAGTTTATTCGCCCAACCAATAGCACTAGGATTACGTCTCGCGGCTAATCTAACAGCAGGACACCTTTTAATTTTCCTACTTTCAACTGCCATTTGACTATTAGCTTCTAATCCTTTTATCAGACTACCTATATTTATAATATTTGTCCTACTATTTATACTAGAAATAGGCGTAGCTTGCATACAAGCCTATGTTTTCACTGCTCTAGTACATTTCTACTTACTACAA ; END; BEGIN TREES; TITLE 'Encope concatenated COI, ATPase-6, ATPase-8, 16S and 28S data'; LINK TAXA = Taxa1; TRANSLATE 1 Leodia_seiesperforata_LSP1, 2 Mellitella_stokesii_MSPVP1, 3 Mellitella_stokesii_MSPVP2, 4 Mellitella_stokesii_MSPVP3, 5 Mellitella_stokesii_MSRP2, 6 Mellitella_stokesii_MSRP1, 7 Mellita_quinquiesperforata_MQPP1, 8 Mellita_quinquiesperforata_MQPP4, 9 Mellita_quinquiesperforata_MQBTP1, 10 Mellita_quinquiesperforata_MQSBP1, 11 Mellita_quinquiesperforata_MQSBP2, 12 Lanthonia_longifissa_LLMM1, 13 Lanthonia_longifissa_LLMM2, 14 Lanthonia_longifissa_LLGP7, 15 Lanthonia_longifissa_LLGP9, 16 Lanthonia_longifissa_LLPCP3, 17 Encope_michelini_EMSLF1, 18 Encope_michelini_EMSLF2, 19 Encope_michelini_EMSLF3, 20 Encope_michelini_EMFP1, 21 Encope_michelini_EMFP2, 22 Encope_michelini_EMFP3, 23 Encope_michelini_EMFP5, 24 Encope_michelini_EMFP4, 25 'Encope michelini EMMKF1_4', 26 Encope_michelini_EMMKF2, 27 'Encope michelini EMMKF3_5', 28 Encope_aberrans_EAFP1, 29 Encope_aberrans_EAFP2, 30 Encope_aberrans_EAFP3, 31 Encope_aberrans_EAFP4, 32 Encope_aberrans_EAFP5, 33 Encope_aberrans_EAFP6, 34 Encope_aberrans_EAGM1, 35 Encope_aberrans_EAGM2, 36 Encope_aberrans_EAGM3, 37 'Encope grandis EGBA1_4', 38 Encope_grandis_EGBA2, 39 Encope_grandis_EGBA3, 40 Encope_borealis_EBPPM1, 41 Encope_borealis_EBPPM2, 42 Encope_borealis_EBPPM3, 43 Encope_borealis_EBPPM4, 44 Encope_borealis_EBPPM5, 45 Encope_borealis_EBPPM6, 46 'Encope subclausa ESPLP1_2', 47 Encope_subclausa_ESPLP3, 48 Encope_emarginata_EESMC5, 49 Encope_emarginata_EEPLP1, 50 Encope_emarginata_EEPLP4, 51 'Encope emarginata EERB1_EEPLP2', 52 Encope_emarginata_EERB2, 53 'Encope emarginata EESB1_EEPLP3', 54 'Encope emarginata EESB2_3', 55 'Encope emarginata EEPBB2_3_5_8', 56 'Encope emarginata EEPBB1_4', 57 Encope_emarginata_EEPBB6, 58 Encope_emarginata_EEPBB7, 59 Encope_oblonga_EEV2, 60 Encope_oblonga_EEV1, 61 Encope_valenciennesii_EVM1, 62 'Encope galapagensis EGII1_2', 63 Encope_galapagensis_EGIF1, 64 Encope_galapagensis_EGIF2, 65 Encope_galapagensis_EGISFl1, 66 Encope_galapagensis_EGISFl2, 67 Encope_galapagensis_EGISFl3, 68 Encope_micropora_Esp1, 69 Encope_micropora_Esp2, 70 Encope_micropora_Esp3, 71 'Encope micropora Esp4_6', 72 Encope_micropora_Esp5, 73 Encope_californica_ECLP1, 74 Encope_californica_ECLP2, 75 Encope_californica_ECLP3, 76 Encope_californica_ECLP4, 77 'Encope californica ECLP5_6', 78 Encope_wetmorei_EWBM4, 79 'Encope wetmorei EWEC1_3', 80 Encope_wetmorei_EWEC2, 81 Encope_wetmorei_EWMM2, 82 'Encope wetmorei EWBM1_3_EWMM3', 83 'Encope wetmorei EWBM5_7', 84 'Encope wetmorei EWBM2_EWMM1 ', 85 'Encope wetmorei EWBM6_8', 86 'Encope micropora EMAZ3_5_EMVP3', 87 'Encope micropora EMRP1_5', 88 'Encope micropora EMRP2_EMVP2', 89 'Encope micropora EMSJ3_EMRP4 ', 90 Encope_fragilis_EFCR1, 91 Encope_perspectiva_EPSJP1, 92 'Encope micropora EMSJ5_EMST6_8', 93 Encope_ecuadorensis_EESEE1, 94 Encope_fragilis_EFCR2, 95 Encope_fragilis_EFCR4, 96 Encope_insularis_EIIS1, 97 Encope_insularis_EIIS2, 98 Encope_insularis_EIIS3, 99 Encope_micropora_EMCR1, 100 'Encope micropora EMRP2_EMSJ2_7', 101 'Encope micropora EMRP3_EMSJ8', 102 'Encope micropora EMST3_5_EMSJ3 ', 103 Encope_fragilis_EFCR3, 104 'Encope micropora EMPV4_EMAZ2', 105 'Encope micropora EMAZ1_4_EMPV1 ', 106 'Encope tetrapora ETRP2_EMSJ1 ', 107 'Encope micropora EMST1_4_7', 108 'Encope micropora EMSJ4_ETRP1_3', 109 Encope_cocosi_ECOCR1, 110 Encope_perspectiva_EPLPM1, 111 Encope_irregularis_EIRH1, 112 Encope_wetmorei_EWBPE1, 113 'Encope wetmorei EWBPE2_3', 114 'Encope perspectiva EPCR1_3', 115 Encope_perspectiva_EPCR2, 116 Encope_laevis_ELNH1, 117 Encope_wetmorei_EWLLP3, 118 Encope_wetmorei_EWLLP1, 119 Encope_wetmorei_EWLLP2, 120 Encope_wetmorei_EWLLP4, 121 'Encope wetmorei EWLLP5_ELLP1'; TREE con_50_majrule = [&R] (1:0.2092299,((16:0.154102734,14:0.315584623,15:0.3101242724,12:0.318983113,13:0.319055994):0.205190094,(2:0.002104069,3:0.001712943,4:0.005029781,5:0.010883054,6:0.005134833):0.54443092,((7:0.002119468,11:8.855848E-4):0.003893202,9:0.0078774313,(8:0.002212868,10:9.043134E-4):0.011750598000000001):0.35685692,(((30:8.917346E-4,33:0.003385002,28:0.005435384,31:0.009059623000000001,32:0.0059418827,35:0.008902519000000001,36:0.011226329,29:0.015222726,34:0.01740954):0.03563407,(19:8.714428E-4,22:0.005381404,(17:0.002163202,18:0.003315236):0.00674283,(20:0.00335153,27:0.003620838):0.007963783,(23:0.009879015,(21:8.534486E-4,25:0.002036304):0.002180408,(24:8.914911E-4,26:0.003516624):0.002080026):0.003248229):0.04852854):0.09640387,(((37:0.001242737,38:0.003910932,39:0.005122242):0.06206466,((67:0.008336538000000001,62:0.008354777,66:0.008688557999999999,63:0.0068564970000000005,(64:0.001578049,65:0.001289982):0.0061004990000000005):0.04281716,((40:8.333867E-4,41:0.0028730841,42:0.004210802,44:0.0031777223,43:0.006555053,45:0.006392921):0.03377099,(49:0.003925245,(46:8.525928E-4,48:0.003330117):0.004470972,(54:0.001658838,(52:0.005207799,51:0.006854989000000001,53:0.010531684000000001,47:0.0109915963,50:0.0121195,60:0.0156458735,61:0.022119957000000003,59:0.018733434,(55:0.006374301,56:0.004163368,57:0.0041888151,58:0.004793226):0.021568979):0.01886544):0.0065253229999999995):0.03146101):0.03003327):0.01473105):0.01770099,(((73:0.003652113,74:0.002896465):0.005463041,75:0.006615016,76:0.003800713,77:0.0027057748):0.01045257,((71:0.006161253,(70:0.003563913,(72:0.002022662,(68:8.706156E-4,69:0.002123282):0.005933239):0.004539774):0.005324447):0.01172187,78:0.019971604,81:0.015992003,82:0.0135452878,(79:0.032272345,80:0.011173693):0.011173693,83:0.016790685,84:0.021908756,85:0.019372006,86:0.011539938,87:0.014480119,88:0.010387911,89:0.013130065,90:0.009369917,91:0.021235023,92:0.013775784,93:0.016007647,(94:9.448729E-4,95:0.002302096):0.011314078,(96:9.007572E-4,97:0.004180725,98:0.0041405650000000006):0.011248026,99:0.017616675,100:0.014939131999999999,101:0.012416937,102:0.019730768,103:0.009205568,(104:0.011783239000000001,105:0.006216983,106:0.009872276,107:0.008416036,(108:0.002034266,109:0.003401082):0.00969606):0.010324136,(110:9.625934E-4,111:0.002195181,112:0.0042146679999999995,113:0.005571908):0.014415385999999999,114:0.018961643,115:0.022200748,116:0.020403515999999997,117:0.026245680999999996,118:0.025751898999999995,119:0.024665857999999995,120:0.021985435999999997,121:0.021616710999999997):0.004986744):0.04939095):0.09876826):0.07899101):0.2092299); END;