#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:50 GMT TreeBASE (cc) 1994-2008 Study reference: Wanasinghe D.N., Hyde K.D., Jeewon R., Crous P.W., Wijayawardene N., Jones E.B., Bhat J.D., Phillips A., Groenewald J.Z., Dayarathne M., Phukhamsakda C.-., Thambugala K.M., Bulgakov T.S., Camporesi E., Gafforov Y., Mortimer P.E., & Karunarathna S. 2017. Phylogenetic revision of Camarosporium (Pleosporineae, Dothideomycetes) and allied genera. Studies in Mycology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21397] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=212; TAXLABELS Acer_sp._T_332 'Acrocalymma aquatica MFLUCC11_0208' 'Acrocalymma ficus CBS_317.76' 'Acrocalymma medicaginis CPC_24340' 'Acrocalymma medicaginis CPC_24345' Ailanthus_sp._T_767 'Alternaria alternata IT_181_1' 'Alternaria eureka CBS_193.86' 'Alternariaster bidentis CBS_134021' 'Alternariaster helianthi CBS_327.69' 'Amarenographium ammophilae MFLUCC_16_0296' Amorpha_sp._NK0076 Artemisia_sp._T_220 'Ascochyta pisi AFTOL_ID_1583' Ascocylindrica_marina_MD6011 Ascocylindrica_marina_MD6012 Bassia_sp._T_1189 'Boeremia exigua var._exigua_CBS_431.74' CR_006 CR_026 CR_029 CR_032 'Camarosporidiella amorphae fruticosae_MFLUCC_14_0891_T09' 'Camarosporidiella caraganicola MFLUCC_14_0887_T05' 'Camarosporidiella caraganicola MFLUCC_14_0896_T13' 'Camarosporidiella celtidis MFLUCC_16_0556_T358' 'Camarosporidiella celtidis MFLU_16_0469' 'Camarosporidiella eufemiae MFLUCC_17_0207_IT1621' 'Camarosporidiella fabacearum MFLUCC_14_0899_T16' 'Camarosporidiella halimodendroni MFLUCC_14_0901_T18' 'Camarosporidiella halimodendroni MFLUCC_17_0212_T419' 'Camarosporidiella italica MFLUCC_13_0547_IT1283' 'Camarosporidiella korfii MFLUCC_14_0916_T72' 'Camarosporidiella laburni MFLUCC_14_0885_T03' 'Camarosporidiella laburni MFLUCC_14_0919_IT83' 'Camarosporidiella laburnicola MFLUCC_14_0565' 'Camarosporidiella mackenziei MFLUCC_14_0883_T01' 'Camarosporidiella mackenziei MFLUCC_14_0893_T11' 'Camarosporidiella mirabellaea MFLU_16_0228' 'Camarosporidiella mori albae MFLUCC_14_0886_T04' 'Camarosporidiella mori albae MFLUCC_14_0898_T15' 'Camarosporidiella premilcurensis MFLUCC_17_0208_IT1681' 'Camarosporidiella robiniicola MFLUCC_14_0894_T12' 'Camarosporidiella robiniicola MFLUCC_14_0909_T53' 'Camarosporium aborescentis MFLUCC_14_0604' 'Camarosporium arezzoensis CPC_31420_CPC31420' 'Camarosporium arezzoensis MFLUCC_14_0238' 'Camarosporium aureum MFLUCC_140620' 'Camarosporium caraganicola MFLUCC_140605' Camarosporium_clematidis Camarosporium_elaeagnellum_LSU 'Camarosporium moricola MFLUCC_16_1396' 'Camarosporium moricola MFLUCC_16_1397' 'Camarosporium moricola MFLUCC_16_1398' 'Camarosporium quaternatum CPC_23216_CPC23216' 'Camarosporium quaternatum CPC_31081_CPC31081' 'Camarosporium quaternatum CPC_31518_CPC31518' 'Camarosporium robiniicola MFLUCC_13_0527' Camarosporium_sp._1_CPC_12441_CPC12441 Camarosporium_sp._2_CPC_25960_CPC25960 Camarosporium_sp._2_CPC_25962_CPC25962 Camarosporium_sp._3_CPC_31031_CPC31031 Camarosporium_sp._4_CPC_31632_CPC31632 Camarosporium_sp._5_CPC_27667_CPC27667 Camarosporium_sp._5_CPC_30379_CPC30379 'Camarosporium spartii MFLUCC_130548' 'Camarosporomyces flavigenus CBS_314.80_CBS314.80' Caragana_sp._T_318 Caragana_sp._T_538 Caragana_sp._T_810 Caragana_sp._T50 'Cochliobolus heterostrophus AFTOL_ID_54' Colutea_IT2674 Colutea_sp._T_477 'Coniothyrium carteri CBS_101633' 'Coniothyrium carteri CBS_105.91' 'Coniothyrium dolichi CBS_124140' 'Coniothyrium glycines CBS_124455' 'Coniothyrium obiones AFTOL_ID_1240' 'Coniothyrium palmarum CBS_400.71' 'Coniothyrium palmarum CBS_758.73' 'Coniothyrium telephii CBS_188.71' 'Coniothyrium telephii CBS_856.97' 'Cucurbitaria berberidis CBS_363.93' 'Cucurbitaria berberidis MFLUCC_11_0386' 'Cucurbitaria elongata AFTOLID_1568' 'Cucurbitaria elongata MFLUCC_140260' 'Cucurbitaria ephedricola HA_42' Cyclothyriella_rubronotata_TR Cyclothyriella_rubronotata_TR9 Cytisus_sp._T64 Cytisus_sp._T66 Cytisus_sp._T70 'Didymella exigua CBS_183.55' 'Didymellocamarosporium tamaricis MFLUCC_140241' 'Dimorphosporicola tragani CBS_570.85' 'Dothidotthia aspera CPC_12928' 'Dothidotthia aspera CPC_12930' 'Dothidotthia aspera CPC_12932' 'Dothidotthia aspera CPC_12933' 'Dothidotthia symphoricarpi CPC_12929' Elaeagnus_sp._NK0067 Elaeagnus_sp._T_1186 Elaeagnus_sp._T_1488 Elaeagnus_sp._T_511 Elaeagnus_sp._T_813 Elaeagnus_sp._T_815 Elaeagnus_sp._T_819 Elaeagnus_sp._T14 Elaeagnus_sp._T51 Elaeagnus_sp._T55 Elaeagnus_sp._T61 'Foliophoma fallens CBS_161.78_CBS161.78' 'Foliophoma fallens CBS_284.70_CBS284.70' Gleditsia_sp._T_205 Gleditsia_sp._T10 Gleditsia_sp._T40 Gleditsia_sp._T42 Halimodendron_T41 Halimodendron_sp._T_468 'Hazslinszkyomyces aloes CPC_21572' 'Hazslinszkyomyces aptrootii CBS_483.95' 'Hazslinszkyomyces lycii CPC_30998_CPC30998' 'Hazslinszkyomyces lycii CPC_31014_CPC31014' 'Hazslinszkyomyces suttonii MFLUCC_17_0210_T289' 'Hazslinszkyomyces suttonii MFLUCC_17_0211_T418' 'Julella avicenniae BCC_18422' 'Julella avicenniae BCC_20173' 'Julella avicenniae JK_5326A' Laburnum_sp._T_811 Laburnum_sp._T_838 'Leptosphaeria maculans CBS_260.94' 'Leptosphaerulina australis CBS_317.83' 'Libertasomyces myopori CPC_27354' 'Libertasomyces platani CPC_29609' 'Libertasomyces quercus CBS_134.97_CBS134.97' Lycium_sp._T_1346 Lycium_sp._T_1347 'Macroventuria anomochaeta CBS_525.71' 'Melnikia anthoxanthii MFLUCC_14_1010' Moraceae_Maclura_T02 Morus_sp._T_1233 Morus_sp._T_1332 Morus_sp._T_1345 Morus_sp._T_1476 Morus_sp._T_232 Morus_sp._T_239 Morus_sp._T_265 Morus_sp._T_371 Morus_sp._T_518 Morus_sp._T_519 Morus_sp._T_856 'Neocamarosporium betae CBS_109410' 'Neocamarosporium betae CBS_523.66' 'Neocamarosporium calvescens CBS_246.79' 'Neocamarosporium chersinae CPC_27298_CPC27298' 'Neocamarosporium chichastianum CBS_137502' 'Neocamarosporium goegapense CPC_23676' 'Neocamarosporium jorjanensis IBRC_M_30243' 'Neocamarosporium jorjanensis IBRC_M_30263' 'Neocamarosporium lamiacearum MFLUCC_16_0560' 'Neocamarosporium persepolisi IBRC_M_30134' 'Neocamarosporium persepolisi IBRC_M_30264' 'Neocamarosporium salicornicola MFLUCC_15_0957' 'Neocamarosporium solicola IBRC_M_30177' 'Neocamarosporium solicola IBRC_M_30257' 'Neophaeosphaeria agaves CPC_21264' 'Neophaeosphaeria filamentosa CBS_102202' 'Neophaeosphaeria filamentosa CBS_102202_2' 'Neoplatysporoides aloicola CPC_24435' 'Ochrocladosporium elatum CBS_146.33' 'Ochrocladosporium frigidarii CBS_103.81' 'Paradendryphiella salina CBS_142.60' 'Paraleptosphaeria dryadis CBS_643.86' 'Paraleptosphaeria rubi MFLUCC_140211' 'Phaeosphaeria chiangraina MFLUCC_13_0231' 'Phaeosphaeria musae MFLUCC_11_0133' 'Phaeosphaeria thysanolaenicola MFLUCC_10_0563' 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0157' 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0193' 'Phoma herbarum AFTOL_ID_1575' 'Phoma herbarum CBS_615.75' 'Plenodomus guttulatus MFLUCC_151876' 'Plenodomus salviae MFLUCC_130219' 'Pleospora chenopodii CBS_344.78' 'Pleospora halimiones CBS_432.77' 'Pleospora herbarum CBS_191.86' 'Pleospora tarda CBS_714.68' Pleosporaceae_sp._M303 Pleosporaceae_sp._M305 Pleosporaceae_sp._M311 Prunus_sp._T_224 'Pyrenochaeta cava CBS_257.68' 'Pyrenochaeta nobilis AFTOL_ID_1856' 'Pyrenophora phaeocomes AFTOL_ID_283' Rhamnus_sp._YG_S4_4D Rhamnus_sp._YG_S4_5 Robinia_sp._DL0004 Robinia_sp._G_T_403 Robinia_sp._NK0041 Robinia_sp._T_1303 Robinia_sp._T_1305 Robinia_sp._T_1370 Salsola_sp._YG_S6_1 Salsola_sp._YG_S6_2 'Shiraia bambusicola NBRC_30753' 'Shiraia bambusicola NBRC_30754' 'Shiraia bambusicola NBRC_30771' 'Shiraia bambusicola NBRC_30772' Spiraea_sp._T_193 'Subplenodomus valerianae CBS_630.68' 'Subplenodomus violicola CBS_306.68' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M44420] TITLE Camaro_sporidiella; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3461; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acer_sp._T_332 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Acrocalymma aquatica MFLUCC11_0208' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACCTCTTCGGGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGGTCGCATGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTATAGTTGCTCATCCGGGCGCTCGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTA--TCTCCTCCGGGAGACCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCC----TCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGG------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGGGAAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGCTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACG---A---------T-TTC------------------------------------------------------------------GGTTTACACCGTTT---TCTACCTATGTC--TATGCGTA-CCACATGTTTCCTCGGGGGGC-TTGC-CCCCCGCTAGGACTCTTT----AAC-C----TT-TTTTGCAATAGCAGTCAGCGTCTGAAA-TAATT--TAAT-TATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-GTCCCCGCTTT---------GGGACTCGCCTTAAAGG-AATTGGCAGCCAGTAT-ATCCGGCCTTGAGCGCAGCAC-AATGCGTACTCT-AAGCT---GA-TAGATTGGCATCC--AAA-AGCC--C------ATTTTT----------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Acrocalymma ficus CBS_317.76' --------TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGATCTCTTCGAGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGGTCGCATGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCGTTCGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTA--TCTTCTCCGGAAGACCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC----TTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACG---A---------T-TTC------------------------------------------------------------------GGTTTACACCGTTT---TCTACCTATGTC--TACGCGTA-CCACACGTTTCCTCGGGGGGC-TTGC-CCCCCGTTAGGACTTTAT----CAA-C----CT-TTTTGCAATAGCAGTCAGCGTCTGAAA-TAATT--TAAT-TATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCGCCATT---------GGGACTCGCCTTAAAGT-AATTGGCAGCCATGTA-ATTCGGCTTTGAGCGCAGCAC-ATTGCGTACTCT-ATGCT---GG-TACATTGGCATCC--AGA-AGCC--C------TTTTTTACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Acrocalymma medicaginis CPC_24340' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGATCTCTTCGAGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGGTCGCATGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCGTTCGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTA--TCTTCTCCGGAAGACCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC----TCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACG---A---------T-TTC------------------------------------------------------------------GGTTAACACCGTT----TTCACCCTTTGT-TTATACGTA-CCACATGTTTCCTCGGGGGGC-TTGC-CCCCCGTTAGGACACCCC----AAA-C----CT-TTTTGTAATAGCAGTTAGCGTCTGAAA-TAAGT--TAAT-TATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCCGCCTTT---------GGGACTCGCCTTAAAGT-CATTGGCAGCCATGTA-ATTCGGCTTTGAGCGCAGCAC-ATTGCGATCTCT-CTGCT---GG-TACATTGGCATCC--AGA-AGCC--T------TTTTTTACGCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Acrocalymma medicaginis CPC_24345' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGATCTCTTCGAGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGGTCGCATGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCGTTCGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTA--TCTTCTCCGGAAGACCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC----TCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACG---A---------T-TTC------------------------------------------------------------------GGTTAACACCGTT----TTCACCCTTTGT-TTATACGTA-CCACATGTTTCCTCGGGGGGC-TTGC-CCCCCGTTAGGACACCCC----AAA-C----CT-TTTTGTAATAGCAGTTAGCGTCTGAAA-TAAGT--TAAT-TATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCCGCCTTT---------GGGACTCGCCTTAAAGT-CATTGGCAGCCATGTA-ATTCGGCTTTGAGCGCAGCAC-ATTGCGATCTCT-CTGCT---GG-TACATTGGCATCC--AGA-AGCC--T------TTTTTTACGCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ailanthus_sp._T_767 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGTAAAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Alternaria alternata IT_181_1' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCT----------------------????------------------------------------------------------------------------------------------------------------------------------------CCTTGCTGAATTA---TTCACCCTTGTC-TTTTGCGTA-CTTCTTGTTTCCTTGGTGGGT-TCGC-CCACCACTAGGACAAACA----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAT--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-GTCTCTAGCTT---------TAGACTCGCCTTAAAGT-AATTGGCAGCCGGCCT-ACTGGTTTCGGAGCGCAGCAC-AAGTCGCACTCT-CTATC--AGC-AAAGCTAGCATCC--ATT-AAGC--C-TTT--TTTTCAACTTT------------------------------------TGACCTCGGATCAGGTA????------------------------------TGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCATCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTC?GTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Alternaria eureka CBS_193.86' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------AGGTGAACCTGCGGAGGGATCA-TTACCA---A---------T-AACAAGG---CGGGCTGGCTCTTCCCGGGA--------------------------------GGACTG-GCCTTGCTGAATTA---TTCACCCGTGTC-TTTTGCGTA-CTTCTTGTTTCCTGGGCGGGT-TCGC-CCGCCACCAGGACCCCCA----TAA-A----CC-TTTTGCAATGGCAATCAGCGTCAGTAA-CAACA--CAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TTGTCTCCGTT---------GAGACTCGCCTTAAAGT-GATTGGCAGCCGGCCT-ACTGGTTTCGGAGCGCAGCAC-AAGTCGCGCTCT-CTTCA--GCC-AAGGTCAGCGTCC--ACC-AAGC--C-ACC--TTTTTTACCTT------------------------------------TGACCTCGGATCAGGTA????-------------------------CTGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCTTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTT??AA?GG?GACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTG??AACTCTCCTAAGTTCATCAAGT?TGG?GACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Alternariaster bidentis CBS_134021' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCTCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTTTTGCCCAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACC----TTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------ATCA-TTACCT---T---------T-CTG-TCAGGG--GTGTTGGTTA----GAGAAA--AGGGCT------TTTGCCTTGATCTTT-GGCCTC-TCCTTTCTGAT------TCTACCCATGTC-TTTTACGCA-CCATCTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACAATCC----AAA-A----CC-ATTTGTACTTGCAGTCAGCGTCAGTAA-CAA----TAAA-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTTCCC--------------TGAACTCACCTCAAAAC-AATTGGCAGCCGGCAT-GTTGGCC-TGGAGCGCAGCAC-AATTTGCGTCCC-ATTCC--AGT-GGTGTTGGCACCC--ATC-AAGA--C-CTA--TATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Alternariaster helianthi CBS_327.69' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTTTTGCCCAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACC----TTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCT---T---------T-CTA-TCAGGG--GTGTTGGCCG----GAGAAC--AGGGCT------TTTGCCTCGTTCTTT-GGCCTC-TCCCTTCTGAT------TCTACCCATGTC-TTTTACGCA-CTATCTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACAACCT----AAA-A----CC-ATTTGTACTTGCAGTCAGCGTCAGTCA-TAAAA--TTAA-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTTCCC--------------TGAACTCACCTTAAAAC-AATTGGCAGCCGGCAT-GTTGGCC-TGGAGCGCAGCAC-AATTTGCGTCCC-ATTCC--AGT-AGTGTTGGCACCC--ATC-AAGA--C-CTA--TATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Amarenographium ammophilae MFLUCC_16_0296' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCCTTCGGGGTGGCCTTATAGGGGAGACGACATGCAACCAGCCTGAACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCT---TTTAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAG-----????--------------------------------------------CTAAT-CATGCTAAAA-CCCC-ACTTCGGGAGGG-TGTATTTA-TAGATAAAAA--CCCACGCCCTTCGGGGCTTCTTGGTGATTCATGATA-CTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAA-????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCTT-CAGTAGCTTGCTACTGGTCGGGAGGCGCTGTAACTCCGCATAGTATTAGTTTACTGATGAGCGGCC----------------GGCCCTCTGTC------TGTACCCTTGTC-TTTTGCGCA-CT-CATGTTTCCTCGGCGGGC-TTGC-CCGCCGATTGGACAAAAC----TATAA----CC-TTTTTAATTTTCAATCAGCGTCTGAAA-AAACG--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCACTCCCT----GCGTTTGGACTCGCCTTAAAGC-AATTGGCAGCCAGTGT-TTTGGTATTGAAGCGCAGCAC-ATTTTGCGATTC-TAGCC--GAT-AATACTTGCGTCC--ATA-AGCC--C------TTTTTTCACTT------------------------------------TGACCTCGGATCAGGTA????----------CTGGTACCTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTG-TGAGTTCGAGGCTGGTATCTCCAAGGACGGACAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGACAACTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGGCCACCGGAAAGACCCTGCTCGAGGCCATTGATGCCATCGACCCCCCGTCCCGTCCTACCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTTGCCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCACAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTACCGGTAAGGCCACTGAGGCCAACCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCT Amorpha_sp._NK0076 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTGT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCACTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Artemisia_sp._T_220 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT 'Ascochyta pisi AFTOL_ID_1583' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGA------------------------------------------????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAGTTTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CT-TACGTTTCCTCGGTGGGC-TCGC-CCGCCGATTGGACAAAAT----TAA-A----CC-CTTTGCAGTTGCAATCAGCGTCTG-AA-AAACA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCTCGCCTCT---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AGTA--C-ATT--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------TGGTATCTCCAAGGACGGCCAGACTCGTGAG?ACGCTCTCCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCCACCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTTCAGGACGTCTACAAGATTGGCGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTTACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTGAACCACCCCGGTCAGGTTGGTGCTGGTTACGCCCCAGTTCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCCACCGAGGCCAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCCCCT Ascocylindrica_marina_MD6011 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTCGCCAGCCTTTGCCGTGTAAAGCCCCTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGCTTTTGCCTGGTGTATTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGCCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGTAATGCAGCCAGCCTGGACTGAGGTCCGCGCT--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCC--TTTGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGCTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCA-TTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTATCTT------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ascocylindrica_marina_MD6012 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTCGCCAGCCTTTGCCGTGTAAAGCCCCTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGCTTTTGCCTGGTGTATTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGCCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGTAATGCAGCCAGCCTGGACTGAGGTCCGCGCT--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCC--TTTGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bassia_sp._T_1189 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCCGGGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAATCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCATCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????----------------CTTCCCAGGCCGATTGCGCTATTCTCA-TATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGATACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCTACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Boeremia exigua var._exigua_CBS_431.74' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGAACTTATAGGGGAGACGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAG-TTGTGGCTTT-GCCTACC---ATCT---CTTACCCATGTC-TTTTGAGTA-CC-TTCGTTTCCTCGGCGGGT-CCGC-CCGCCGATTGGACAAACT----TAA-A----CC-CTTTGTAATTGAAATCAGCGTCTGAAA-AAACA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCCTTT---------GAGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AAGT--A-C-T--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAAGCCTCCCCTAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACACACCCACCCGTCCCACCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTCTACAAGATTGGCGGCATTGGCACGGTTCCCGTCGGTCGTGTTGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTTATCGTCCTGAACCACCCTGGTCAGGTTGGTGCTGGTTACGCCCCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTACTGAGGCCAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGA-GGTCCCCTCCAAGCCCA-------------------------------- CR_006 ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAACCACAAAAGCG--CGAGCT-------CCGGCTTGTGTTTTTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCTCTCTGG---------AGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTC-TTTCC--ATG-AATGTCAGCATCC--ATC-AAGA--C-CAT---TTTTCACTC-------------------------------------TGACCTC-GATCAGGTA????AACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGCCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACC----- CR_026 ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG--GATGGGGAGCCACGGCATCA--GGCGCT-------CCGGCGTGTAATGCCG-CCCC-ATCTGGCTGAC-TA---TTCACCCATGTC-TTTTGCGTA-CCATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAGTAT----TAA-A----CC-ATTTGCAATTGCAGTCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCTTCCGCTG--------GGAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCAGCGTCC--ATC-AAGA--C-CAT---TTTTCACTC-------------------------------------TGACCTCGGATCAGG--????AACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGCGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACTCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCT CR_029 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCTTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????ACCATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT CR_032 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCTTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????ACCATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella amorphae fruticosae_MFLUCC_14_0891_T09' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGATACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella caraganicola MFLUCC_14_0887_T05' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGAC-------------????-------------------------CCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella caraganicola MFLUCC_14_0896_T13' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATC-----????-------------------------CCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATCGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella celtidis MFLUCC_16_0556_T358' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACC----ACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella celtidis MFLU_16_0469' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACC----ACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella eufemiae MFLUCC_17_0207_IT1621' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGTGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella fabacearum MFLUCC_14_0899_T16' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella halimodendroni MFLUCC_14_0901_T18' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella halimodendroni MFLUCC_17_0212_T419' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????----------GTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATCGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella italica MFLUCC_13_0547_IT1283' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCA?CAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-CGTG--CG-TACCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATCCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCGTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella korfii MFLUCC_14_0916_T72' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella laburni MFLUCC_14_0885_T03' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella laburni MFLUCC_14_0919_IT83' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella laburnicola MFLUCC_14_0565' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A--AA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGT------------------------------------------------------- 'Camarosporidiella mackenziei MFLUCC_14_0883_T01' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGCTGTGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--ATAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCTGACCTCGGATCAGGTGTAAGTCTACATATTTTGCTCTGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella mackenziei MFLUCC_14_0893_T11' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGCTGTGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--ATAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCTGACCTCGGATCAGA-GTAAGTCTACATATTTTGCTCTGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCTCCCGCTGGTGTAACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella mirabellaea MFLU_16_0228' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella mori albae MFLUCC_14_0886_T04' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGT-????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella mori albae MFLUCC_14_0898_T15' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGA--------------????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella premilcurensis MFLUCC_17_0208_IT1681' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGTGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporidiella robiniicola MFLUCC_14_0894_T12' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT 'Camarosporidiella robiniicola MFLUCC_14_0909_T53' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT 'Camarosporium aborescentis MFLUCC_14_0604' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGC------------------????---------------------------------------------------------------CCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTGT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCACTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGC---------------------------------------------------------------------------------------????--------------------------------------------------------------------------------CTCCAAGGATGGCCAGACCCGAGAGCACG-CCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Camarosporium arezzoensis CPC_31420_CPC31420' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-----ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGCGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium arezzoensis MFLUCC_14_0238' ---------------------------------------------------------------------------------------------------GCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAG-----????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------TATTGCGGGA--GGCCGGAT-CC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATCT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGGTTTCAACGGTGACAACATGATCGACACTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCA--- 'Camarosporium aureum MFLUCC_140620' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA---------------????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATC---????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACC------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium caraganicola MFLUCC_140605' ------------------------------------------------------CTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTG--------------------------------------------------------------------------------------????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CGTTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------AGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Camarosporium_clematidis ---------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGC--------------------------------------------------------------------------------------------------????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCG-CA-CTTACGAGAAATCAAA????-----------------------------------------------------------------------------------CC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A--AA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_elaeagnellum_LSU ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium moricola MFLUCC_16_1396' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-----------TTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTC-GATCAG-TA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium moricola MFLUCC_16_1397' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-----------TTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTC-GATCAG-TA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium moricola MFLUCC_16_1398' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-----------TTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTC-GATCAG-TA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium quaternatum CPC_23216_CPC23216' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGATGTAATGTAGCCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCGACTTCTGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCC---T---------T-CAAATCAGGA--GGCTGTGGGC-------------------------------TGTTTCTCAGACCAT-GGTCCCCTGCATT----TAAACCCATGGT-TATTGCGTA-CTATTAGTTTCCTCGGCGGGC-TTGC-CTGCCGATAGGACAACCA----AAA-C----CC-ATTTGTAATTGCGGTCAGCGTCTGTAA-AAGTAATAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCTCTGCTCTTTTTGCGAGGGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGGCC-TGGAGCGCAGCAC-AATTTGCGCCTCTTTGTC--ATG-TATGTTGGCACCC--ATC-AAGA--C-CTA--TTTTTTGCTCT------------------------------------TGACCTCGGATCAGGT-????-----------------------GGCCGATTGCGCTATTCTCATTATCGCTGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACTGCCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCATGTTCCCTTCGTGCCCATCTCTGGATTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATCAAGGCCAAGGTCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGACCTGCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCGCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAACTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGGACACCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCATGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCCCCT 'Camarosporium quaternatum CPC_31081_CPC31081' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGATGTAATGTAGCCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAG------------------------------------------------------????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCGACTTCTGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCC---T---------T-CAAATCAGGA--GGCTGTGGGC-------------------------------TGTTTCTCAGACCAT-GGTCCCCTGCATT----TAAACCCATGGT-TATTGCGTA-CTATTAGTTTCCTCGGCGGGC-TTGC-CTGCCGATAGGACAACCA----AAA-C----CC-ATTTGTAATTGCGGTCAGCGTCTGTAA-AAGTAATAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCTCTGCTCTTTTTGCGAGGGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGGCC-TGGAGCGCAGCAC-AATTTGCGCCTCTTTGTC--ATG-TATGTTGGCACCC--ATC-AAGA--C-CTA--TTTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-----------------------GGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACTGCCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGATTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATCAAGGCCAAGGTCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGACCTGCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCGCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAACTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGGACACCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCCCCT 'Camarosporium quaternatum CPC_31518_CPC31518' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCTAGATAAAGATCTCCATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGATGTAATGTAGCCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGC-----------------------------------------------------????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCGACTTCTGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCC---T---------T-CAAATCAGGA--GGCTGTGGGC-------------------------------TGTTTCTCAGACCAT-GGTCCCCTGCATT----TAAACCCATGGT-TATTGCGTA-CTATTAGTTTCCTCGGCGGGC-TTGC-CTGCCGATAGGACAACCA----AAA-C----CC-ATTTGTAATTGCGGTCAGCGTCTGTAA-AAGTAATAAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCTCTGCTCTTTTTGCGAGGGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGGCC-TGGAGCGCAGCAC-AATTTGCGCCTCTTTGTC--ATG-TATGTTGGCACCC--ATC-AAGA--C-CTA--TTTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-----------------------GGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACTGCCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGATTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATCAAGGCCAAGGTCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGACCTGCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCGCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAACTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGGACACCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCATGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCCCCT 'Camarosporium robiniicola MFLUCC_13_0527' ---------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGC--------------------------------------------------------------------------------------------------????----------------A--TGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACC------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_sp._1_CPC_12441_CPC12441 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------GGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGCTGCCTGAAA-AGGTAGCGTGCTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_sp._2_CPC_25960_CPC25960 -----------------AACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGG-----------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------GTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGCTGTGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--ATAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????----------------------------ATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATTAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTAACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTT---------------- Camarosporium_sp._2_CPC_25962_CPC25962 --------TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------C--AG-AGTA--CGTAGCCTGAAA-GGGCTGTGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--ATAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------------------------------------------------------------------------------------------------------ACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTAACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Camarosporium_sp._3_CPC_31031_CPC31031 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_sp._4_CPC_31632_CPC31632 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------AGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_sp._5_CPC_27667_CPC27667 ---GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_sp._5_CPC_30379_CPC30379 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------GTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporium spartii MFLUCC_130548' ---------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGC--------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGA---------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGAT-CC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A--AA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Camarosporomyces flavigenus CBS_314.80_CBS314.80' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTCGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGTAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????--GATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTACCC---T---------T-CTATCCCGAG--AGCGCCAGCCTTGAGAAGCC------------------TCTTGTGCTTCCAGGGCG-GTTCTTATGGATT----TTGACCCATGTC-TTTTGCGTA-CCATTTGTTTCCTTGGTGGGCTTTGC-CTGCCGATAGGACACCCC----AAA-ACACCCT-TTTTGTAGTTGCAATCAGCGTCAGAAA-AAC-A--CAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCCGTTTC--GTCGCGGTGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAC-ACATGGCTTGGAGCGCAGCAC-AATTTGCGCCTC-TTGCC--GTG-CGTATTGGCGTCC--ATC-AAGA--C-CACATTTTTGTTCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Caragana_sp._T_318 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGTGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Caragana_sp._T_538 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATCGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Caragana_sp._T_810 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGACGGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????----AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGCTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--ATAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Caragana_sp._T50 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCG-ATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Cochliobolus heterostrophus AFTOL_ID_54' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGAAGTTTACGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--------------------------------AGGGATCA-TTACCA---A---------C-AAAATATGAG--GCCTGG--CTTTCGG--------------------------------------CCG-GCTGAAATATTTTT---TTCACCCATGTC-TTTTGCGCA-CTTGTTGTTTCCTGGGCGGGT-TCGC-CCGCCACCAGGACCAAAC----TAA-A----CC-TTATGCAGTTGCAATCAGCGTCAGTAA-CAATG--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-TTGTCTCCCTT---------GAGACTCGCCTTAAAAC-GATTGGCAGCCGGCCT-ACTGGTTTCGGAGCGCAGCAC-ATATTTTGCACT-CTGTC--AGG-AGAACGGTAATCC--ATC-AAGA--C-TCT-ATTTTTAACTTT------------------------------------TGA--------------????-----------------------------------------------------------------------TGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGTCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTCCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGCTTCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAG-TCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Colutea_IT2674 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTGT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCACTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCA----????-ACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Colutea_sp._T_477 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCTGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTGT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCACTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCA----????-------------GTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Coniothyrium carteri CBS_101633' ---GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCG---------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAAAC---A---------T-ATT-ACGGGG--GGCCGGACC-------------CAAGGTGCGTGGATTTCCATGTGCTTT-GACCCG-CCCTGTCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTCGGTGGGC-TTGC-CTGCCGATAGGACACTAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAAATAATT--TAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-GTCCCGCGTTG-----CGCGTGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCATCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium carteri CBS_105.91' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGGAGAGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAAAC---A---------T-ATT-ACGGGG--GGCCGGAC--------------CAAGGTGCGTGGATTTCCATGTGCTTT-GACCCG-CCCTGTCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTCGGTGGGC-TTGC-CTGCCGATAGGACACTAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-GTCCCGCGTTG----------GGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCATCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium dolichi CBS_124140' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACTTTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGAAGAGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACAC---A---------T-ATT-ACGGGG--GGTCGGACC-------------CAAAGTGCGTGTA-ACCCATGTGCTTT-GACCTG-CCCTGTCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTAGGC-TTGC-CTGCCAATAGGACATTAT----ACA-A----CC-CTTTGTAATTGCAATCAGCGTCAGTAA-AAATT--TAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCTCGCGTT----------GGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGTTTC-TTGTC--ATG-AATGTTGGCATCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium glycines CBS_124455' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACTTTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGAAGAGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGTAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACAC---A---------T-ATT-ACGGGG--GGTCGGATC-------------CAAGGTACGTGTA-ACCCATGTGCTTT-GACCTG-CCCTGTCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCAGGC-TCGC-CTGCCAATAGGACATTAT----ACA-A----CC-TTTTGTAATTGCAATCAGCGTCAGTAA-AAATT--TAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTCT-GTCTCGCGTT----------GAGACTCGCCTCAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT--ACTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium obiones AFTOL_ID_1240' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTAACTCCTTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTTCAAT???????????????????????????????????????????????????????????????????????????????ATTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGC?TTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????AACATGATCACTGGTACCTCCCAGGCCGACTGCGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTTATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCTCTGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCACTCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTTGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGC?TTGAGGCTTTCACTGACTACCCTCCT 'Coniothyrium palmarum CBS_400.71' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGTGTACCTCTCTTCGGGGAGGCCGTATAGGGGAGGCGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAC-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????---------------------------------AGGATCA-TTAACT---A---------T-ATC-TCGGGG--GGCCGGACCC---GA-CGTA--CACGGC-GTTTAACCATTCGACATTTT-GACCCG-CCCTGTCTGAATA----TATACCCCTGTT-TATTGCGTA-CTACTTGTTTCCTTGGTGGGC-TTGC-CCGCCAAAAGGACACCTA----AAA-A----CC-TCTTGTAATTGCAGTCAGCGTCAGAAA-AAC-T--TAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCCGT-GTT---------AGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCGTGGAGCGCAGTAC-ATTCAGCTCTCT-ACACC--ATA-AA-GTTGGCATCC--ATC-AAGT--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGG--????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium palmarum CBS_758.73' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGTGTACCTCTCTTCGGGGAGGCCGTATAGGGGAGGCGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAC-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium telephii CBS_188.71' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCAACTTCGGGAGAGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAACT---A---------T-ATGAGGGGAG--GGCTGG--------------------------------------GCTTC-GGCCTG-CCCTCTCTGACTAT---TCTACCCGTGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CCGCCGATAGGACACTAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGTAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-GTCCCGCGTTT---------GGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-AATTTGCGTTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT-AACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coniothyrium telephii CBS_856.97' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCAACTTCGGGAGAGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAACT---A---------T-ATGAGGGGAG--GGCTGG--------------------------------------GCTTC-GGCCTG-CCCTCTCTGACTAT---TCTACCCGTGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CCGCCGATAGGACACTAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGTAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-GTCCCGCGTTT---------GGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-AATTTGCGTTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT-AACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria berberidis CBS_363.93' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCA---A---------T-TTTCGGGGGG--ACTTCGGT-------------------------------------------------CCCTGTC----------TGAACCCTTGTC-TTTTGCGTA-CCATTTGTTTCCTCGGCGGGC-CTGC-CTGCCGATAGGATACTAT----ACA-A----CC-CTTTGTAATTGCAATCAGCGTCAGAAA-ACACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCCGTTTT---------AGGACTCGCCTCAAAGC-AATTGGCAGCCGGCGT-ACTCGCCTTGGAGCGCAGCAC-ATCTTGCGTCCC-TTGGC--CTG-AACGCTTGCGTCC--ACA-AAGC--C-TAT--ACTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria berberidis MFLUCC_11_0386' ---GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria elongata AFTOLID_1568' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCA?CAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------GGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria elongata MFLUCC_140260' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cucurbitaria ephedricola HA_42' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCTGGGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGGAGAAAGGCCTCTGTCACGTATCTCCCTCCGGGGTGACCTTATAGGGGAGGCGTAATGCAGCCAGCTCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTCGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACTA-------------------------------------------------TGGGTCCTGCCTCACGGCAGGCACCAGAGATTCCCCCCTCGGGGGG------CCTACCCTTTGT-CTACGAGTACCTAGTTGTTTCCTCGGCAGCC-TTGTGCTGCCAATGGGGACCTTA----AAC-C----CT-TTTTGTAGTGAGAAGTTTCTTCTGAAA-ACAGT--AAAT-TATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTT-GTCGCGGCTTT----GAGCCCCGACTCGCCTTAAAAT-AATTGGCAGCTCATGTGGGTTGGTTCCTTGCGCAGCAC-AGTACGCGCTCT-GGGTC---GC-CCCGTGAATATCC--AAA-AGCC--T------TTTTTTCAACT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTCCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR9 ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCTGGGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGGAGAAAGGCCTCTGTCACGTATCTCCCTCCGGGGTGACCTTATAGGGGAGGCGTAATGCAGCCAGCTCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTCGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTGCTTGGTGATTCATGATAACTTTTCAGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACTA-------------------------------------------------TGGGTCCTGCCTCACGGCAGGCACCAGAGATTCCCCCCTCGGGGGG------CCTACCCTTTGT-CTACGAGTACCTAGTTGTTTCCTCGGCAGCC-TTGTGCTGCCAATGGGGACCTTA----AAC-C----CT-TTTTGTAGTGAGAAGTTTCTTCTGAAA-ACAGT--AAAT-TATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTT-GTCGCGGCTTT----GAGCCCCGACTCGCCTTAAAAT-AATTGGCAGCTCATGTGGGTTGGTTCCTTGCGCAGCAC-AGTACGCGCTCT-GGGTC---GC-CCCGTGAATATCC--AAA-AGCC--T------TTTTTTCAACT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTCCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cytisus_sp._T64 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTATCTGAAA-GGGTAGCGTACGCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGCGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACTCACCT Cytisus_sp._T66 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCG-ATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Cytisus_sp._T70 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCTACCGGTAAGACTCTCCTCGAGGCTATCGATGCTATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Didymella exigua CBS_183.55' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAGGTTTTTACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAG-TTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CC-TTCGTTTCCTCGGCGGGT-CCGC-CCGCCGATTGGAC-AATT----TAA-A----CC-ATTTGCAGTTGCAATCAGCGTCTAAAA-AAACA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTAGCCTCT---------GAGACTCGCCTCAAAAG-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CGG-AACGACGACGTCC--AAA-AGTA--C-A-T--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Didymellocamarosporium tamaricis MFLUCC_140241' -----------CCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-------GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCA-TGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTG--CCTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGG-TTTTACCCGGTGCACTCTTC-----GCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTAACTCTCTTCGGAGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-T---CGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTA-????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG---GGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dimorphosporicola tragani CBS_570.85' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACGCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGGACCACAGGAACA--AGGGCT-------TCGGCTCGCGTTTCTG-CCCC-ATCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACAATAT----TAA-A----CCTTTTTGTAATTGCAATCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-TGTCCTCTTCT-------GGAGGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTC-TTTCC--ATG-AATGTTGGCATCC--ATC-AAGA--CTTAT--TTTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia aspera CPC_12928' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGACTTATAGGGGAGGCGACATGCAACCAGCCCAGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia aspera CPC_12930' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGACTTATAGGGGAGGCGACATGCAACCAGCCCCGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCACGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia aspera CPC_12932' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGACTTATAGGGGAGGCGACATGCAACCAGCCCCGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGAAGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia aspera CPC_12933' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGACTTATAGGGGAGGCGACATGCAACCAGCCCCGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCACGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dothidotthia symphoricarpi CPC_12929' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTTGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGCTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCACGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Elaeagnus_sp._NK0067 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--CATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTTTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T_1186 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T_1488 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????CCGCAGCGAAGCTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Elaeagnus_sp._T_511 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T_813 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-----GATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T_815 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTTTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T_819 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T14 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CATAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAATCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG---????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Elaeagnus_sp._T51 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T55 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--------------------------------------------------------------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT Elaeagnus_sp._T61 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGGCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTCTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-AAATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCAGTCGGCCGTGTCGAGACTGGTATTATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCACCT 'Foliophoma fallens CBS_161.78_CBS161.78' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????--GATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????----AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACC---A---------T-ATGAACGCAG--G-TGGGGGTTCACAAGCA-------------------TATTCGTACGCTTG-CCCT-GCCTGTCCTAA-TA---TCCACCCATGCT-TTTTGCGTA-CTATTCGTTTCCTCGGCGGGC-TTGC-CCGCCAGTAGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCCCCTTTAC--------AAGGACTCGCCTTAAAAA-TATTGGCAGCCGGCAT-ACTGGTCTCGGAGCGCAGCAC-ATTTTGCGCCCC-ATTTC--CTG-AATACTGGCGTCC--ATG-AAGC--C-CACATATTTTAACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Foliophoma fallens CBS_284.70_CBS284.70' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????--GATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACC---A---------T-ATGAACGCAG--G-TGGGGGTTCACAAGCA-------------------TATTCGTACGCTTG-CCCT-GCCTGTCCTAA-TA---TCCACCCATGTT-TTTTGCGTA-CTATTCGTTTCCTCGGCGGGC-TTGC-CCGCCAGTAGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCCCCTTTAC--------AAGGACTCGCCTCAAAAA-TATTGGCAGCCGGCAT-ACTGGTCTCGGAGCGCAGCAC-ATTTTGCGCCCC-ATTTC--CTG-AATACTGGCGTCC--ATG-AAGC--C-CATATATTTTAACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gleditsia_sp._T_205 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CATAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAATCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Gleditsia_sp._T10 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCGACTTCGGAAGGGATGTATTTATTAGATTAAAAA-CCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTTACGGATCGCATGGCCCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT Gleditsia_sp._T40 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-----------------------------------GATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Gleditsia_sp._T42 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCGACTTCGGAAGGGATGTATTTATTAGATTAAAAA-CCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTTACGGATCGCATGGCCCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCTGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGATGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT Halimodendron_T41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Halimodendron_sp._T_468 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Hazslinszkyomyces aloes CPC_21572' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------T-ATTAACGGGG--GGTGGGACC-----------------------------------------------------ACTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTCGGTGGGC-TTGC-CTGCCGATCGGACACTAT----AAA-A----CC-TTTTGTAATAGCAGTCAGCGTCAGAAA-CAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT-------C--AGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--G-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces aptrootii CBS_483.95' -------------------------------------CAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCATTAGAGTATATTAAAGTTGTGGCAGTTAAAAAGCTTGTAGATGAAACTTGGGTCTGGGTGGCAGGTCTGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAATGTTCAAAGCAGGCCTTTGCTCGAATACGTTAACATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTTTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTGGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTGTGACTCGCTCGGCACCTTACGAGAAATCAAA????T--T--C-----TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAAAC---A---------ATGTTGACGGGG--GGCCGGACC-------------CAACGTGCGCGTA-CTCCGCGTGCCTT-GACCTG-CCCTGTCTGAATATATATTCACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGTAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TATATACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces lycii CPC_30998_CPC30998' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-----ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTTACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGTGTGCTTT-GCCCTG-CCCTGTCTGAATAT---TTAACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGACTGGACACCAT----AAACA----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TCATT--GAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces lycii CPC_31014_CPC31014' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTTACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGTGTGCTTT-GCCCTG-CCCTGTCTGAATAT---TTAACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGACTGGACACCAT----AAACA----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TCATT--GAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Hazslinszkyomyces suttonii MFLUCC_17_0210_T289' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-AATAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTCGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAATGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTACCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCTGTTGAGATGCACCACGAGCAGCTTGCCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Hazslinszkyomyces suttonii MFLUCC_17_0211_T418' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-----------------TA-------CTGCGGA-GGA-CA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTCGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAATGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTACCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCTGTTGAGATGCACCACGAGCAGCTTGCCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Julella avicenniae BCC_18422' ----GAATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTTAAATTTAAAATCTAGCTCCTTTAGGGTCTAAGTTGTAATTTGCAGAGAGTGCTTTAGTGTTAGTAAGAGCCTAAGTTCCTTAGAATAGGGCGTTATAGAGGGTAAGAATCCTGTATATAGTTGCTATTCTTTACTGTGTAAAGCCCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTAGGCTTTTGCCCGGTGCACTCTTCTATAGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGTGAAATACAGCCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAT-CCGTGGTAATTCTAGAGCTAATACATGCGTAAATCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCAGAATAACTTTTCAGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTT?CCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCC-TTCCTCCTGGAGAATCTCATGCCCTTCACTGGGCGTGCTGGGG-TCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG-GCAGTCTTATTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTGTGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------TGCGCTATTCTGATTATCGCTGCCGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAAACTCGTGAGCACGCTTTGCTTGCCTACACTCTTGGTGTCAAGCAGCTTATTGTTGCCATCAACAAGATGGACACCACCAAATGGTCAGAGGATCGTTACAATGAGATCATCAAAGAGACGACCAACTTCATCAAGAAGGTCGGATACAACCCCAAGGCCGTCCCATTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGGCTCCACCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGGTCAAAACCAAGTACACTGGCAAGACTCTGCTCGAGGCCATTGACAAGATCGTCCCCCCGACCCGTCCTTCTGACAAGCCTCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTACCATCAAGGCTGGTATGGTCGTCACTTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTGTCCGCGGGTATGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGAAACGTCGCTGGTGACTCCAAAACCGACCCCCCCAAGGGCTGCGACTCTTTCAACGCTCAGGTCATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCATATCGCTTGCAAGTTCTCTGAGCTCCTTGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAGCAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTCCCCTCCAAGCCGATGTGCGTTGAGACATTCAACGAGTACCCACCT 'Julella avicenniae BCC_20173' -------------------CGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGGAGCCTAAGTTCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGTTGCTATCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTGGGCTTTTGCCCGGTGCACTCTTCTATAGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGTGAAATACAGCCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAT-CCGTGGTAATTCTAGAGCTAATACATGCGTAAATCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCAGAATAACTTTTCAGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCC-TTCCTCCTGGAGAATCTCATGCCCTTCACTGGGCGTGCTGGGG-TCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG-GCAGTCTTATTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTGTGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------TGCGCTATTCTGATTATCGCTGCCGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAAACTCGTGAGCACGCTTTGCTTGCCTACACTCTTGGTGTCAAGCAGCTTATTGTTGCCATCAACAAGATGGACACCACCAAATGGTCAGAGGATCGTTACAATGAGATCATCAAAGAGACGACCAACTTCATCAAGAAGGTCGGATACAACCCCAAGGCCGTCCCATTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGGCTCCACCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGGTCAAAACCAAGTACACTGGCAAGACTCTGCTCGAGGCCATTGACAAGATCGTCCCCCCGACCCGTCCTTCTGACAAGCCTCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTACCATCAAGGCTGGTATGGTCGTCACTTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTGTCCGCGGGTATGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGAAACGTCGCTGGTGACTCCAAGACCGACCCCCCCAAGGGCTGCGACTCTTTCAACGCTCAGGTCATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCATATCGCTTGCAAGTTCTCTGAGCTCCTTGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAGCAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTCCCCTCCAAGCCGATGTGCGTTGAGACATTCAACGAGTACCCACCT 'Julella avicenniae JK_5326A' ------------------------------------AAAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGGAGCCTAAGTTCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGTTGCTATCCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTGGGCTTTTGCCCGGTGCACTCTTCTATAGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGTGAAATACAGCCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAT-CCGTGGTAATTCTAGAGCTAATACATGCGTAAATCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCAGAATAACTTTTCAGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCC-TTCCTCCTGGAGAATCTCATGCCCTTCACTGGGCGTGCTGGGG-TCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG-GCAGTCTTATTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTGTGCCGACTAGGGAT-------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Laburnum_sp._T_811 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATC-----????ACCATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Laburnum_sp._T_838 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------ATGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCTTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-CGTA--CGCTGCCTGAAA-AGGTAGCGTGCTCT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--A-CAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????ACCATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Leptosphaeria maculans CBS_260.94' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTTTTGTCCAGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCC---A---------T-TTTCAAAGCA----------------------------------CTGCCGCCTCGATCAGT-GCGGCA-TCTACTTTGAT------TCTGCCCATGTT-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATTGGATCCCCT----AAA-A----CC-ACTTCCAATTGCAGTCAGCGTCAGTAA-CAATG--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTTCCAC-------------TGGACTCGCCTTGAAAC-AATTGGCAGCCGGCAC-ATTGGCC-TGGAGCGCAGCAC-ATTTTGCGCCTC-TTGTC--ATG-GTTGTTGGCATCC--ATC-AAGA--C-ACT--TTTTAAGCTCT------------------------------------TGACCTCGGATCAGGTA????-----------------------------TTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTTGCCTACACTCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAAATCATCAAAGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATCAAGAGCAAGGTCACTGGTAAGACCCTGCTCGAGGCCATTGACGCCATTGACCCTCCATCCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGCGGTATTGGCACGGTTCCCGTTGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTTCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCGGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTTCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTTCTCGAGAAGATTGACCGTCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTCCCTCCA--------------------------------------- 'Leptosphaerulina australis CBS_317.83' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCCGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAG-----????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGCTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAG-TTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CT-TACGTTTCCTCGGCGGGT-CCGC-CCGCCGATTGGAC-AATT----TAA-A----CC-ATTTGCAGTTGCAATCAGCGTCTG-AA-AAATT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCTCGCCTCT---------GAGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AGTA--C-A-T--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------------------------------------------------------------------------------------------------TCGCCTACACCCTTGGTGTC-AGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTAAGGCCACTGGTAAGACCCTTCTCGAGGCCATCGATGCTATCGACCCCCCCACACGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCTGAGGGTGTTCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTAAAGGAAATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGGCTGACCCCCCCAAGGGTGCTGAGTCTTTCAACGCCCAGGTCATCGTCCTGAACCACCCCGGTCAGGTTGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGA-------------------------------------------------- 'Libertasomyces myopori CPC_27354' -------TTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCGACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACTTCCTCTCGGGGAAGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAAGGGCTGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGGAATGAAAGTAAACGGAGGTAGGAACCC--TTCGGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAAT------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GCTGGGGTCTTCAAGCG----CATGCT-------TCGGC--GTACGGTTG-CCCA-GCCTGTCTGAATTA---TTCACCCATGTC-TTTTGCGTA-CTACTTGTTTCCTCGGTGGGT-TCGC-CCACCAGCAGGACATTTC----AAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-CAACA--CAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTG--AACTTCAAGCATTGCTTGGTGATGGGCGTTT-TGTCTCTGC-----------GAGACTCGCCTCAAAAC-GATTGGCAGCCGGCAC-ACTGGTATTGAAGCGCAGCAC-AAAACGCGCTAC-TGTCC--ACGCAGTGTCGGCATCC--ATG-AAGC--C-TTT-TTATTCAACTTT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Libertasomyces platani CPC_29609' ------------------ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCGTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACTTCCTCTCGGGGAAGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-TGCTAGGATGCTGGCGTAAAGGCTGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTC----------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????---------------CGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-AT-AAAGCGG---GTTGGGACTCCCAGCAG----CGTGCT-------CCGGC--GCGCTGCTGGCCCGGCCTTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATCTGTTTCCTCGGTGGGT-TCGC-CCACCAGCAGGACATTAC----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA--AACA--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCCTTGCTTGGTGTTGGGTGTTT-TGTCTTCTTCT-------CGGAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAC-ACTGGTATTGAAGCGCAGCAC-AATTTGCGCTTC-TGTCC--ACG-CGTGCCCGCATCC--ACA-AAGC--C-CAT--TTTTTCACTTT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Libertasomyces quercus CBS_134.97_CBS134.97' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCGTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACTTCCTCTCGGGGAAGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAAAGGCTGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-AT-AAAGCGG--G-CTGGGACCCCCAGAAG----CGTGCT-------CCGGC--GTGCTGCTG-CCCG-GCCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTACTTGTTTCCTCGGTGGGC-CTGC-CCACCAGCAGGACATAAT----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA--AACA--TAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCCTTGCTTGGTGTTGGGCGTTT-GTCTCCTT-----------GGGGACTCGCCTCAAAAT-AATTGGCAGCCGGCAC-ATTGGTATTGAAGCGCAGCAC-ATTTTGCGCTCC-TGTCC--ATG-CGTGTCCGCGTCC--ACG-AAGC----TCT--ATTTTCACTTT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lycium_sp._T_1346 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGGCGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTCGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAATGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTACCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCTGTTGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTTCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Lycium_sp._T_1347 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGGCGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTCGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????GACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAATGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTACCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCTATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCTGTTGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTTCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Macroventuria anomochaeta CBS_525.71' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCCGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAG-TTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CT-TACGTTTCCTCGGCGGGT-CCGC-CCGCCGATTGGAC-AATT----TAA-A----CC-CTTTGCAGTTGCAATCAGCGTCTG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCTCGCCTCT---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AGTA--C-A-T--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????----------------------------------------------------------------------------------------------------------------TTCTCGCCTACACTCTCGGTGTCCGACAGATCATCGTCGCTATCAACAAGATGGACACCGCCAAGTGGAGCGAGGACCGTTACAAGGAGATTGTCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAATCCCAAGCACGTCCCCTTCGTCCCAATCTCTGGCTTCTACGGCGACAACATGATTGACTCGTCCGCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACCAAAACTAAGGTCACCGGCAAGACCCTCCTTGAGGCTATCGACAACATCGACCCCCCGTCCCGTCCTTCCGACAAGCCCCTTCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACTGTCCCTGTCGGCCGTGTCGAGACCGGTATCATCAAGGCTGGTATGGTCGTCACCTTTGCTCCGGCTGGTGTGACCACTGAAGTCAAGTCTGTCGAGATGCACCACGAACAGCTTGTCCAGGGTGTTCCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGCGACTCCAAGAACGACCCGCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGCCAGGTTGGTGCTGGTTACGCTCCTGTCCTCGACTGCCACACCGCCCACATCGCCTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCCGCTATCGTCAAGATGATTCCGTCAAAGCCCATGTGC--------------------------- 'Melnikia anthoxanthii MFLUCC_14_1010' -----------------------------------------------------------------------------------------------------------------------------GAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCT---TTTAGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Moraceae_Maclura_T02 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGGAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_1233 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_1332 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCGTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_1345 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTCCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_1476 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCGTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_232 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_239 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGTAAAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_265 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????-------TCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGGTTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_371 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????-------TCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGGTTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_518 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCATGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGGTTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_519 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATA-TTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGATATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Morus_sp._T_856 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGCCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-AGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAATAGGACAACCT-AAAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Neocamarosporium betae CBS_109410' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------ATTATCGCCGCCGGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCTTCCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCTCCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTA------- 'Neocamarosporium betae CBS_523.66' ----GGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGC---GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium calvescens CBS_246.79' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium chersinae CPC_27298_CPC27298' --------TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAAT------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-----ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---ATGGGGAACCACGGACACG--TGGGCT-------TCGGCTCTCGTTTCTG-CCCC-ATCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATAT----CAA-A----CC-TTTTGCAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTTCT-------GGAGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTC-GTTCC--ATG-AATGTTGGCATCC--ATC-AAGA--C-CAT--TTTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium chichastianum CBS_137502' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAAC--ACGGAACA--TGGGCT-------TCGGCTCGCGTTTCTG-CCCC-GTCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATAT----CAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTT------------GGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTT-GTTCC--ATG-AATGTTGGCATCC--ATC-AAGA--C-CAT--TTTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium goegapense CPC_23676' ---------------------------------------------ATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAAC--ACGCAATA--GGAGCT-------CCGGCTTGTGTTGCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCTCT--------------GGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCTGCATCC--ATC-AAGA--C-TAT----TTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium jorjanensis IBRC_M_30243' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------T-ATGAAAGCGG---ATGGGGAACCACGGGAACAA-TGGGCT-------CCGGCCTGCGTTCCTG-CCCC-ATTTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATCT----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTTTT-------CGAGGACTCGCCTCAAAACAAATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCCCATGA-AATGTTGGCGTCC--ATC-CAAGAAC----------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium jorjanensis IBRC_M_30263' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------CGGGAACAA-TGGGCT-------CCGGCCTGCGTTCCTG-CCCC-ATTTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATCT----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTTTT-------CGAGGACTCGCCTCAAAACAAATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCCCATGA-AATGTTGGCGTCC--ATC-CA---------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium lamiacearum MFLUCC_16_0560' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCA---A---------T-ATGAAAGCGG--GATGGGGAGCCACGGCA-----TGCGCT-------CCGGCGTGTAATGCCG-CCCC-ATCTGGCTGAC-TA---TTCACCCATGTC-TTTTGCGTA-CCATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAGTAT----TAA-A----CC-ATTTGCAATTGCAGTCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCTTCCGCT---------GGAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCAGCGTCC--ATC-AAGA--C-CAT---TTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGCGACAACATGATCGACGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACTCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Neocamarosporium persepolisi IBRC_M_30134' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------TTGTAGGCGG---GTGGGGACC--ACGGGACA--TGGGCT-------TCGGCTCGCGTTTCTG-CCCC-GTCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATAT----CAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTTCT-------GGAGGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTT-GTTCC--ATG-AATGTTGGCATCC--ATC-AAGA--C-CAT--TTTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium persepolisi IBRC_M_30264' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-----------------------------------------------------------------------G---GTGGGGACCCACGGGAACA--TGGGTT-------TCGGCTCGCGTTTCTG-CCCC-GTCTTGCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCGATAGGACAATAT----CAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCTCTTCT-------GGAGGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTT-GTTCC--ATG-AATGTTGGCATCC--ATC-AA---------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium salicornicola MFLUCC_15_0957' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGTTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGATT--ACGGAACA--TGGGCT-------TCGGCCTGCGTTTTTG-CCCC-ATCTTGCTGAATTA---TTCACCCATGTC-TTTTGCGTA-CTACTTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACAATAT----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAG-AA-AACTT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-TGTCCTCC-------------GGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCACTTC-TTTCC--ATG-AATGTTGGCATCC--ATC-AAGA--C-TAT---TTTTCACTC-------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium solicola IBRC_M_30177' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-----------------------------------------TTGTGT---G---------G-TGTGGAGCGG---GTGGGGAGCCACAGAAGCCGGAGCCCT-------CGTGGCTCTGTTTCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CCAATTGTTTCCTTGGCGGGC-TTGC-CCGCCAACAGGACATTGT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCTCCCCTGG---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TGTCC--ATG-AATGTCGGCGTCC--AGC-AAGA--C-CAT---TTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neocamarosporium solicola IBRC_M_30257' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------ATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAGCCACAGAAGCCGGAGCCCT-------CGTGGCTCTGTTTCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CCAATTGTTTCCTTGGCGGGC-TTGC-CCGCCAACAGGACATTGT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCTCCCCTGG---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TGTCC--ATG-AATGTCGGCGTCC--AGC-AAGATCT-CAT---TTTTCACTCT------------------------------------TGACCTCCGATCA----????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeosphaeria agaves CPC_21264' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCACGTACCCCTCTTCGGGGGGGCCTTATAGGGGAAACGACATGCAACCAGCCCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTAGGAACCC--ATTAGGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAAAC---A---------T-ATTTCCAGGG--GTTTGGGTC-------AGAG--CGCGCC------CACAAAGCGTGCTCT-GTCTCA-CCTTGTCTGAATAT---TATACCCATGTC-ATTTGCGTA-CCGTTTGTTTCCTTGGTGGGC-TCGC-CCGCCAAAAGGACACCCA----AAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-ACAAA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGCGTCT-GTCCCGC-TTT---------AGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCATAGAAGCGCAGCAC-ATTTTGCGTCTC-TTGTC--CTT-TACGCTAGCGTCC--AGC-AAGC--C-TAA--TTTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeosphaeria filamentosa CBS_102202' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCACGTACCCCTCTTCGGGGGGGCCTTATAGGGGGAACGACATGCAACCAGCCCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTAGGAACCC--GTTAGGGCGCACTATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAAAC---A---------T-ATTTCCAGGG--GTTTGGGTC-------AGGG--CGCGCC------CACAAAGCGTGCCCT-GCCTCA-CCTTGTCTGAATAT---TATACCCATGTC-ATTTGCGTA-CCGTTTGTTTCCTTGGTGGGC-TCGC-CTGCCAAAAGGACACCTA----TAA-A----AC-TCTTGTAATTGCAATCAGCGTCAGAAA-ACAAA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGCGTCT-GTCCCGC-TTT---------AGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCATAGAAGCGCAGCAC-ATTTTGCGTCTC-TTGTC--CTT-CATGCTGGCATCC--AGT-AAGC--C-TAA--CTTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-----------------------------------------CATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACTCTCCTCGAGGCCATTGACGCTATCGACACCCCCACCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGACCGCCGTACCGGAAAGTCGGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGGTGCCTTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTA------- 'Neophaeosphaeria filamentosa CBS_102202_2' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCACGTACCCCTCTTCGGGGGGGCCTTATAGGGGGAACGACATGCAACCAGCCCAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTAGGAACCC--GTTAGGGCGCACTATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAAAC---A---------T-ATTTCCAGGG--GTTTGGGTC-------AGGG--CGCGCC------CACAAAGCGTGCCCT-GCCTCA-CCTTGTCTGAATAT---TATACCCATGTC-ATTTGCGTA-CCGTTTGTTTCCTTGGTGGGC-TCGC-CTGCCAAAAGGACACCTA----TAA-A----AC-TCTTGTAATTGCAATCAGCGTCAGAAA-ACAAA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGCGTCT-GTCCCGC-TTT---------AGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCATAGAAGCGCAGCAC-ATTTTGCGTCTC-TTGTC--CTT-CATGCTGGCATCC--AGT-AAGC--C-TAA--CTTTTTGCTCT------------------------------------TGACCTCGGATCAGGTA????-----------------------------------------CATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACTCTCCTCGAGGCCATTGACGCTATCGACACCCCCACCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGACCGCCGTACCGGAAAGTCGGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGGTGCCTTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTA------- 'Neoplatysporoides aloicola CPC_24435' --------TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGGTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTACCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTCCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCCGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--ATTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTG---------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAGGCGG---GCTGGGGCACCCAGCAGA---CATGCT-------TCGGC--GTGCTGCTG-CCCA-GCTTAGCTGAATTA---TTCACCCATGTC-TTTTGCGTA-CTACTTGTTTCCTTGGTGGGT-TCGC-CCACCAGCAGGACACTCA----TAA-A----CC-TTTTGTAATTGCAATCAGCGTCAGAAA--AACA--CAAT-TGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGA-ACCCTCAAGCCTTGCTTGGTGTTGGGCGTTT-GTCCTCTTCTT------AGGGGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAC-ACTGGTATTGAAGCGCAGCAC-AAAACGCGCTCC-TGTCC--TTG-CGTGCCCGCGTCC--ACA-AAGC--A-CCT--CTATTCACTTT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Ochrocladosporium elatum CBS_146.33' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGATGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAACT---A---------T-ATGAGGAGAG--GGCTGG--------------------------------------GTCTC-GGCCTGCCCCTCTCTGACTAT---TCTACCCGTGTCTTTTTGCGTA-CTATTTGTTTCCTCGGTAGGC-TTGC-CTGCCGATAGGACACTAT---AAAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGTAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTGTCCCGCGTTT----GCGTGTGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TGGTC--TTG-AATGTTGGCGTCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TGACCTCG---------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Ochrocladosporium frigidarii CBS_103.81' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTC-CAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGATGTCATACAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAAAGAAAGTGAACGGAGGTGGGAGCCC--TTAAGGGTGCACCATCGACCGATCTTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACACGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGA----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------AAGGATCA-TTAACT---A---------T-ATGAGGAGAG--GGCTGG--------------------------------------GTCTC-GGCCTGCCCCTCTCTGACTAT---TCTACCCGTGTCTTTTTGCGTA-CTATTTGTTTCCTCGGTAGGC-TTGC-CTGCCGATAGGACACTAT---AAAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGTAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTGTCCCGCGTTT----GCGTGTGGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TGGTC--TTG-AATGTTGGCGTCC--ATT-AAGC--C-TAT--ACATTTGCTCT------------------------------------TG---------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paradendryphiella salina CBS_142.60' ---GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG---------------------------------------------------????-------------------TGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------ACCTGCGGAGGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTTGGGACCATTCGGTGGGG-----------------------------GCTCCA-GCTTGTCTGAATTA---TTCACCCATGTC-TTTTGCGCA-CTTCTTGTTTCCTGGGCGGGT-TCGC-CCGCCACCAGGACCCAAC----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCAGTAA-CAATG--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TTGTCTCT------------CAGACTCGCCTTAAAAT-GATTGGCAGCCGGCCT-ACTGGTTTCGGAGCGCAGCAC-AACTTGCACTTC-TGATC--AGC-CATGTGAGCATCC--ATC-AAGA--C-CAC-ATTTCTCACTTT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGACTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGTCCAAGGCTACCGGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Paraleptosphaeria dryadis CBS_643.86' ---------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTAACC---T---------T-C-A-TCGGGG--GGCTGGATCA---GA-CTGT--AGAGCT------TCGGCCCTGCTTTCT-GCCCTA-CCCTTTCTGAT------TACACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AAC-A--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCGT-TTC---------TGGACTCACCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCT-TGGAGCGCAGCAC-ATTTTGCGCCTC-TTGTC--ATG-ATTGTTGGCATCC--ATC-AAGA--C-TAT-TT--TTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------CGATTGCGCTATCCTCATCATTGCCGCCGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGTCCAAGACCACCGGAAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCCCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCATCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCACTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCT 'Paraleptosphaeria rubi MFLUCC_140211' ------------------------------------------------------------------------------------------------------------------------------------ACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGTCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCAT----------------????---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTAAAT---A---------T-C-A-TCGGGG--GGTTGGATAA---GA-TTGC--TGGGCT------TTGGCCTGGCCTTCT-GCCCTT-CCCTTACTGAT------TTAACCCATGTT-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACATTAT----CAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AAT-T--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTATGCTTGGTGTTGGGTGTTT-GTCCCGC-TTT---------TGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGCC-TGAAGCGCAGCAC-ATTTTGCGTCTC-TTGTC--ATG-ATTGTTGGCATCC--ATC-AA---------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Phaeosphaeria chiangraina MFLUCC_13_0231' ---GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCG---------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATATATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATATCTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAT---T---------C-AGTAGC---------------------------------------------CC----------------AGCTACTTGTT------TACACCCTTGTT-TTTTGCGTA-CTTATCGTTTCCTCGGCGGGC-TTGC-CTGCCGGTTGGACAACTT----TAA-C----CT-TTTTAAATCTTCAATCAGCGTCTGAAT-AATTA--CAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGCTT-GTCT--------------TTTAGACTCACCTCAAAGT-CATTGGCAGCCAGTGT-TTTGGTAGT-AAGCGCAGCAC-ATTTTGCGTCTT-GGTCC--CTC-AACAGCAGCTTCC--ATC-AAGC--C--AT--TTTCTCACTTT-------------------------------------GACCTC----------????------------------------------------------------------GGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCCCTTCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTACCAGGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGTCTAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATTGACCCTCCTTCCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTCCAGGACGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAACTTACTGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAATGACCCTCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTTGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCAGTTGAAAACTCCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Phaeosphaeria musae MFLUCC_11_0133' ---------------------------------------------ATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATATATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATATCTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGA--------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAT---T---------C-AGTAGC---------------------------------------------CC----------------AGCTACTTGTT------TACACCCTTGTC-TTTTGCGTA-CTTATCGTTTCCTCGGCGGGC-TTGC-CTGCCGGTTGGACAACTT----TAA-C----CT-TTTTAAATCTTCAATCAGCGTCTGAAT-AATTA--CAAA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGCTT-GTCT--------------TTTAGACTCACCTCAAAGT-CATTGGCAGCCAGTGT-TTTGGTAGT-AAGCGCAGCAC-ATTTTGCGTCTT-GGTCC--CTT-AACAGCAGCATCC--ATC-AAGC--C--AT--TTTCTCACTTT------------------------------------TGACCTCGGATCAGGTA????------------------------------------------------------GGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGCGACAACATGATCGACGCCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGTCTAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGACCCTCCTTCCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Phaeosphaeria thysanolaenicola MFLUCC_10_0563' ------------------------------GCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-------------------------????------------------TTGGATAA-CCGTGGTAAATCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATATATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATATCTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAT---T---------C-AGTAGC---------------------------------------------CC----------------AGCTACTTGTT------TACACCCTTGTT-TTTTGCGTA-CTTATCGTTTCCTCGGCGGGC-TTGC-CTGCCGGTTGGACAACTT----TAA-C----CT-TTTTAAATCTTCAATCAGCGTCTGAAT-AATTA--CAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTTTGCTTGGTGTTGGGTGCTT-GTCT--------------TTTAGACTCACCTCAAAGT-CATTGGCAGCCAGTGT-TTTGGTAGT-AAGCGCAGCAC-ATTTTGCGTCTT-GGTCC--CTC-AACAGCAGCTTCC--ATC-AAGC--C--A---TTTCTCACTTT-------------------------------------GACCTC----------????------------------------------------------------------GGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTATAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGCGACAACATGATCGACGCCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGTCTAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGACCCTCCTTCCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAATGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCGGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0157' -------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCTAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTCGCTAGCCTTTGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGTTTATCTAGACTTCTGTCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTATTTGGGTGTCAAGCCCAGATGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA---------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAATAAGCTCGTAGTTGAATTTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATC-----------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAAAT---A---------C-AGTAGTTGGG--AGTTGAAAGTCC----------TGGCCGCTAGGTCACGAGT----------------GATCTCCTATT------TCTACCCTTGTC-TTTTGCGTA-CT-TACGTTTCCTTGGTAGGT-TTGC-CTGCCAAAAGGACACTTG----TAA-A----CT-TTTTAAATATACCATCAGCGTCTGAAA-AATTT--AAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTATGCTTGGTGTTGGGTGTTT-GTCCCTTCCCT---------GGGACTCGCCTCAAATT-TATTGGCAGCCAGTGT-ATTGGTTTTGAAGCGCAGCAC-AATTGCGGTTCT-CACGT--ATT-ACTGTTGGCATCC--AAC-AAGC--C-ATT--TTTATCACTTT------------------------------------TGACCTCGGATCAGGTA????------------------------------------------------------GGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCTTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCTTTCGTCCCCATTTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATCAAGACCAAGGCCACCGGTAAGACCCTTCTCGAGGCCATTGACGCCATCGAGCCCCCCTCGCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTCGAGACTGGTGTCATTAAGGCTGGTATGGTCGTTACCTTCGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAACTTTCTGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCTAAGGGTGCTGAGTCCTTCAACGCCCAGGTTATCGTTCTCAACCACCCCGGTCAGGTTGGTGCAGGTTACGCACCCGTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTGCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGGTGCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0193' ---------------------------------------------ATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCTAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGCTAGCCTTTGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTAGACTTTTGTCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTATTTGGGTGTCAAGCCCAGATGCGTAATGAAAGTGAACGGAGGTGGGAACCC---TTTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-------------------------????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTC------------------------------------------------------------------------------------------------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTAAAC---A---------C-AGTAGTTGGG--GGTTGAAAGTCC----------TGGCCGCTAGGTTACGAGT----------------GACCTCCTGTT------TCTACCCTTGTC-TTTTGTGTA-CT-TACGTTTCCTTGGTAGGT-TAGC-CTGCCAAAAGGACACTTA----TAA-A----CT-CTTTTAATCTATTATCAGCGTCTGAAA-CATTA--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTATGCTTGGTGTTGGGTGTTT-GTCCTGTCCCT---------GGGACTCGCCTCAAATT-CATTGGCAGCCAGTGT-ATTGGTTTTGAAGCGCAGCAC-AATTGCGGTTCT-CACGT--ATT-ACTGTTGGTATCC--AAC-AAGC----CTT--TCTATCACGTT------------------------------------TGACCTCGGATCAGGTA????------------------------------------------------------GGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATCAAGACCAAGGCTACTGGTAAGACCCTTCTCGAGGCTATTGATGCTATCGAGCCCCCCTCGCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTTGTCACCTTTGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTTCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCTAAGGGTGCTGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTTGGTGCTGGTTACGCACCTGTCCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTGCTTGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGAGATGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC------------------- 'Phoma herbarum AFTOL_ID_1575' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGA------------------------------------------????------------TTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCT--------------------------------------------------------------------AGAGTTTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CT-TACGTTTCCTCGGTGGGT-TCGC-CCGCCGATTGGAC-AATT----TAA-A----CC-CTTTGCAGTTGCAATCAGCGTCTG-AA-AAACA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCATTGCTTGGTGTTGGGTGTTT-GTCTCGCCTTT---------GAGACTCGCCTTAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AGTA--C-A-T--TTTAACACTCT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGATTGCGCTATT?TCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCT??TCGC?TACACTCTCGGTGTCAAGCAG?????????????TCAACAAGATGGACACCA?CAAGTGGT??GAGTCCCGTTTCCAGGAGATCATCAAGGAGACCT?CAA?TTCATCAAGAAGGT?GGCTACAACCCCAAGCACG??CCTTTCGTGCCCATATCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCC?TGGTACAAGGGCTGGGAGAAGGAGACCAAG?CCAAGTCCACTGGTAAGACCCTT?TCGAGGCCATCGACGCCAT?GATGCCCCCACCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTTC?????????????????????????????????????????????????????????????????????????????????????????????????????GTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGATTCCAAGCAGGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCA?GTCATCGTCCTGAACCACCCTGGTCAGGTTGGTGCTGGTTACGCCCCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCACTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATTGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Phoma herbarum CBS_615.75' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCT--TTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCT--------------------------------------------------------------------AGAG-TTGTGGCTTT-GCCTGCT---ATCT---CTTACCCATGTC-TTTTGAGTA-CC-TTCGTTTCCTCGGCGGGT-CCGC-CTGCCGATTGGAC-AATT----TAA-A----CC-ATTTGCAGTTGCAATCAGCGTCTGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCCTCT---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCGT-ATTGATTTCGGAGCGCAGTAC-ATCTCGCGCTTT-GCACT--CAT-AACGACGACGTCC--AAA-AGTA--C-A-T--TTTTACACTCT------------------------------------TGACCTCGGATCAGGTA????---------------------------------------CTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCTCTCCTCGCTTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATTTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCAGCAATTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCCACACGTCCCACCGACAAGCCTCTCCGCCTTCCCCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTTCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGGCCGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTGAACCACCCCGGTCAGGTTGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACAGCCCCAAATTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCCTCCAAGCCTATGTGCGTTG----------------------- 'Plenodomus guttulatus MFLUCC_151876' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTGGAGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAGCCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????--------------------------------------------------------------------------------------------------GGCT------TTTGCCCTGTTCTCT-GCCCTT-TCCTTTCTGAT------TCTACCCATGT--TTTTGCGCA-CTATTTGTTTCCTTGGTAGGC-TTGC-CTGCCTATAGGACAATAT----AAA-A----CT-ACTTGTACTTGCAATCAGCGTCAGTAA-CAATG--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTCT-GTTCTCTGTGC---------TGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAG-ATTGGCC-TGGAGCGCAGCAC-ATTTTGCGCCCC-TTGTC--ATG-GTTGTTGGCATCC--ATC-AAGA--T-CTT--TTATTAGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Plenodomus salviae MFLUCC_130219' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTACGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGT{AT}AGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATC-GGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTATCC---T---------T-TTA-TCAGGG--AGTTTGCTGC------------AGGTTTGGGCGCTTCGCTCAGCGCATT-GCTTCA-CTCTTTCTGAT------TCTACCCATGTT-TTTTGCGTA-CTACTTGTTTCCTTGGTGGGC-TTGC-CTGCCGATAGGACAAAAC----AAA-A----CC-TCTTGTAATTGCAGTCAGCGTCAGTAA-CAATG--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGCCC-GTCTTTCCC-----------TAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATAAGCC-TGGAGCGCAGCAC-AATTTGCGCCTC-TTGCT--TTG-ATTGTTGGCATCC--ATC-AAGA--C-CTT-TTCATTAGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleospora chenopodii CBS_344.78' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleospora halimiones CBS_432.77' ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--GTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAGC--ACGAAGCA--TGAGCT-------CCGGCTTGTGCCTTTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAGCAGGACATTAT----TAA-A----CC-TTTTGTAATTGAAGTCAGCGTCAG-AA-TAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCTCCCT-----------CAGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCAGCATCC--ATC-AAGA--C-CAT---TTT------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleospora herbarum CBS_191.86' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------CTCCGTAGGTGAACCTGCGGAGGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTTGGGACCACTTGGTGAGG-----------------------------GCTCCA-GCTCGTCTGAATTA---TTCACCCATGTC-TTTTGCGCA-CTTCTTGTTTCCTGGGCGGGT-TCGC-CCGCCACCAGGACCAAAC----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCAGTAA-CAATG--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCC-TTGTCTCT------------CAGACTCGCCTTAAAAT-GATTGGCAGCCGACCT-ACTGGTTTCGGAGCGCAGCAC-AATTCTTGCACT-TTGTC--AGC-CTTGTGAGCATCC--ATC-AAGA--C-CAC-ATTTTTAACTTT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGACTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCCCTGCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATTAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCT 'Pleospora tarda CBS_714.68' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCA---A---------T-ATGAAAGCGG---GTTGGGACCACTTGGTGAGG-----------------------------GCTCCA-GCTCGTCTGAATTA---TTCACCCATGTC-TTTTGCGCA-CTTCTTGTTTCCTGGGCGGGT-TCGC-CCGCCACCAGGACCAAAC----AAA-C----CT-TTTTGTAATTGCAATCAGCGTCAGTAA-CAATG--TAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTCC-TTGTCTCT------------CAGACTCGCCTTAAAAT-GATTGGCAGCCGACCT-ACTGGTTTCGGAGCGCAGCAC-AATTCTTGCACT-TTGTC--AGC-CTTGTGAGCATCC--ATC-AAGA--C-CAC-ATTTTTAACTTT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGACTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pleosporaceae_sp._M303 ------ATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCT-TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------------------------------------------------------CACAGAAGCCGGAGCCCT-------CGTGGCTCTGTTTCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CCAATTGTTTCCTTGGCGGGC-TTGC-CCGCCAACAGGACATTGT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-GTCTCCCCTGG---------GAGACTCGCCTCAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TGTCC--ATG-AATGTCGGCGTCC--AGC-AAGA--C-CAT---TTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------CGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCACCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCTCCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACC----- Pleosporaceae_sp._M305 --------TGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCT-TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--------------------------------------------------------------------------------------CAGATG-TAGAGCCCT-------TGTGGTTCTGTTTCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAACAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-GTCTCCCCTGG---------GAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTT-TGTCC--ATG-AATGTCGGCGTCC--ATC-AAGA--C-CAT---TTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------CGACTGCGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACC----- Pleosporaceae_sp._M311 --------TGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCT-TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------------------------------------------------------CACAGATG-TAGAGCCCT-------TGTGGTTCTGTTTCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGCGGGC-TTGC-CCGCCAACAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-GTCTCCCCTGG---------GAGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTT-TGTCC--ATG-AATGTCGGCGTCC--ATC-AAGA--C-CAT---TTTTCACTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------CGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTTACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCT------------------ Prunus_sp._T_224 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????---TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCACTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Pyrenochaeta cava CBS_257.68' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGCTTTTGCCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAAGGAGCCCGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGTAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????------------------------------------ATCA-TTACCA---------------ATTTCGGGGG--ACTTCGGT-------------------------------------------------CCCTGTCTGAA---------ACCCTTGTC-TTTTGAGTA-CCATTTGTTTCCTTGGTAGGC-TTGC-CTACCATTAGGACACCAC----TTA-A----CC-TCTTGTAATTGCAATCAGCGTCAGAAA--AACA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ATCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCGC-TTT---------GGGACTCGCCTTAAAGC-AATTGGCAGCCGGCGT-ACTAGTCTGGGAGCGCAGCAC-AATTTGCGCCTC-TGAAC--CTG-AACGCTTGCGTCC--ATG-AAGT--C-TAT--ACTTTTGCTTT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pyrenochaeta nobilis AFTOL_ID_1856' ------------------------------------TCAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCC--TTAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAA????----------------------------------GGATCA-TTATCA---A---------T-TACAGCGGA------------------------------------------------------------TCGGTCCTGTC------TGCACCCTTGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTAGGC-TTGC-CTGCCAAAAGGACCACAT----CAA-C----CC-TTTTGTAATTGCAATCAGCGTCAGAAA-AACTA--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCCGT------------TGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ACTAGCCTTGGAGCGCAGCAC-ATTTTGCGCCTC-TTGAC--TTG-AATGACGGCGTCC--ATC-AAGC--C-TAC-AATTTTTGCTCT------------------------------------TGACCTCGGATCAGGT-????-------------------------CCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAG?ATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCTTTCGTTCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCTATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGCCTCCCTCTTCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTACCGAGGGTGTTCCCGGTGACAATGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCACCCGTTCTCGATTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGATTACCCTCCT 'Pyrenophora phaeocomes AFTOL_ID_283' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACCACCAGCCTGGACTGAGGTCCGCGCA--TT-CGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--GCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAA-CCAATGCCCTCCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAG-CCTTGCGCT-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--------------------------------------CA-TTACCA---A---------T-ATGGAAT---GCGGCTGGGAAAAGGAGGCGTCTTGTTTCC-------GGGGCGAGCGTCTT-TCCCTG-GCCAGCCTGACATA---TTCACCCGTGTC-TTTTGCGTA-CTACTTGTTTCCTTGGTGGGT-TCGC-CCCCCAATAGGACCCAAT----AAA-C----CT-TTTTGTAATTGCAATCCGCGTCAGAAA-CAATG--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGCGGTT-GTCTCTGGCCC---------TAGACTCGCCTTAAAAT-CATTGGCAGCCGACGT-ACTGATTTTGGAGCGCAGCAC-AATTTGCGCTCC-TTCAG--CTA-GCGGTCAGCATCC--ATG-AAGC--C-ACA--TTTTCAACGTT------------------------------------TGACCTCGGATCAGGTA????-------------------------CCGACTGCGCTATTCTCATCATTGCTGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACGCTCGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATGGACACAACTAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAAACTTCCAACTTTATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGATTCAACGGCGACAACATGATTGATGCTTCCCCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACTCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTTTACAAG?TTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTTGCGCCCGCTGGTGTGACCACTGAGGTCAAGTCAGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAAGTCATCGTCCTC?ACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCATATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGAAAGTCTG?TGAGAACTCCCCCAAGTTCATCAAGTCCGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGTGTTGAGGCTTTCACTGACTACCCTCCT Rhamnus_sp._YG_S4_4D ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTACCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCCCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGATGCTGCAATCGTCAAGATGGTTCCCTCTAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Rhamnus_sp._YG_S4_5 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTACCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACAC---A---------A-ATTGACGGGG--GGCCGGACC-------------CAAAGTGCGCGTA-CTCCGCGTGCCTT-GCCCTG-CCCTGTCTGAATAT---TTTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGTGGGC-TTGC-CTGCCGATTGGACACCAT----AAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAGAAA-TAATT--TAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCTCGCGTTT----CCGCGTAGACTCGCCTTAAAGC-GATTGGCAGCCGGCAT-ATTGGCCTTGGAGCGCAGCAC-ATTTTGCGCTTC-TAGTC--ATG-AATGTTGGCGTCC--ATT-AAGC--C-TAT-TACATTTGCTC-------------------------------------TGACCTCGGATCAGGTA????---------------------------------------------------GCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCCCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGATGCTGCCATCGTCAAGATGGTTCCCTCTAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Robinia_sp._DL0004 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTAAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT Robinia_sp._G_T_403 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCTGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGATGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT Robinia_sp._NK0041 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????--GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TGGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Robinia_sp._T_1303 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCA-TTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CGTAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTCGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAC-AAACA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCACCT Robinia_sp._T_1305 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CATAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGTAAAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Robinia_sp._T_1370 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--CATAACCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCT--AAAAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAG-TA????AACATGATCACTGGTACCTCCCAGGCCGATTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGAGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT Salsola_sp._YG_S6_1 ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTAGCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAACCACAGCAATA--GGAGCT-------CCGGCTTGTGTTGCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCTCTCTGG---------AGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCAGCATCC--ATC-AAGA--C-TAT-----TTCACTC-------------------------------------TGACCTCGGATCAG-TA????-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTTGTCCCCATCTCCGGATTCAACGGTGACAACATGATCGACGTCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGC-TTCACTGACTACCCTCCT Salsola_sp._YG_S6_2 ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTAGCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCC--TTTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????ACGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTACCA---A---------T-ATGAAAGCGG---GTGGGGAACCACAGCAATA--GGAGCT-------CCGGCTTGTGTTGCTG-CCCC-ATCTGTCTGAA-TA---TTCACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCACCAATAGGACATTAT----TAA-A----CC-TTTTGTAATTGCAGTCAGCGTCAG-AA-AAACT--TAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTTTGCTTGGTGTTGGGTGTTT-GTCCTCTCTGG---------AGGACTCGCCTTAAAAC-AATTGGCAGCCGGCAT-ATTGGTATCGGAGCGCAGCAC-AAGTCGCGCTTC-TTTCC--ATG-AATGTCAGCATCC--ATC-AAGA--C-TAT----TTTCACTC-------------------------------------TGACCTCGGATCAG-TA????AAAATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTAAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCTTTCGTCCCCATCTCCGGATTCAACGGTGACAACATGATCGACGTCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT 'Shiraia bambusicola NBRC_30753' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGTCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGGACTTTTGTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGCTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????--------------------------------AAGGATCA-TTACCT---------------------------------------------------------AGTAGTAGGGTTATAGAAATAGCCCCAGTC--------------TGCACCCATGTC-TTTTGCGTA-CTAAATGTTTCCTCGGCAGGC-CTGC-CTGCCGGTTGGACACGCT----TAT-A----CT-CTTTGTAATTGCAATCAGCGTCTGAAC-CAATA--TAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-AAACTCAAGCTTTGCTTGGTATTGGGTGGTT-GTCCTGTTCTT---------GGGACTCGCCTTAAAGA-TATTGGCAGCCGGCAT-TTTGGCCTTGGAGCGCAGCAC-AATTTGCGGATC-CAGGT--TGG-AGTACTGACGTCC--ATT-TAAG--CTTAC------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30754' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGTCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGGACTTTTGTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------AGCAATCATAGCCCCAGTCTC------------ATCACCCATGTC-TTTTGCGTA-CTAAATGTTTCCTCGGCAGGC-CTGC-CTGCCGGTTGGACACGCT----TAT-A----CT-CTTTGTAATTGCAATCAGCGTCTGAAC-CAATA--TAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-AAACTCAAGCTTTGCTTGGTATTGGGTGGTT-GTCCTGTTCTT---------GGGACTCGCCTTAAAGA-TATTGGCAGCCGGCAT-TTTGGCCTTGGAGCGCAGCAC-AATTTGCGGATC-CAGGT--TGG-AGTACTGACG--------------------------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30771' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGTCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGGACTTTTGTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGCTGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------CCCCAG----------------TGCACCCATGTC-TTTTGCGTA-CTAAATGTTTCCTCGGCAGGC-CTGC-CTGCCGGTTGGACACGCT----TAT-A----CT-CTTTGTAATTGCAATCAGCGTCTGAAC-CAATA--TAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-AAACTCAAGCTTTGCTTGGTATTGGGTGGTT-GTCCTGTTCTT---------GGGACTCGCCTTAAAGA-TATTGGCAGCCGGCAT-TTTGGCCTTGGAGCGCAGCAC-AATTTGCGGATC-CAGGT--TGG-AGTACTGACGTCC--ATT-TAAG--CTTAC------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Shiraia bambusicola NBRC_30772' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGTCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTATCTGTAGTTGCTTATCTGGACTTTTGTCCAGTGCACTCTTCTATAGGTAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA--TC-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????-------------------------------------------------------------------------------------------------------------------------------------------------------ACCCATGTC-TTTTGCGTA-CTAAATGTTTCCTCGGCAGGC-CTGC-CTGCCGGTTGGACACGCT----TAT-A----CT-CTTTGTAATTGCAATCAGCGTCTGAAC-CAATA--TAAT-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGA-AAACTCAAGCTTTGCTTGGTATTGGGTGGTT-GTCCTGTTCTT---------GGGACTCGCCTTAAAGA-TATTGGCAGCCGGCAT-TTTGGCCTTGGAGCGCAGCAC-AATTTGCGGATC-CAGGT--TGG-AGTACTGACGTCC--ATT-TAAG--CTTAC------------------------------------------------------------------????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiraea_sp._T_193 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCA-TTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCC--ATTAGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????TTGATAGTACCTTACTACTTGGATAACCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAA????-CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TTAATTG-AA-----------CATTGCGGGA--GGCCGGATCCC--AG-AGTA--TGTAGCCTGAAA-GGGTTGCGTACTTT-GGCCCT-GCCCACCTGAATAT---TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTTGGTGGGC-TTGC-CCGCCAATAGGACAACCA--AACAA-C----CT-TTTTGTAATTGCAATCAGCGTCTGAAT-AATTA--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCTTCAAGCTCTGCTTGGTGTTGGGTGATT-GTCTATCTTTT---------TAGACTCGCCTTAAAGT-CATTGGCAGCCGGCAT-ATTGGCCTGGGAGCGCAGCAC-AAGTCGCGCTTC-TTGTC--ATG-AATGTTGGCGTCC--AGT-AAGT--C-TAC-ATATTTTGCTC-------------------------------------TGACCTCGGATCAGGTA????AACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCAT-ATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGATGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGATGCCATCGACCCCCCTAGCCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCACCT 'Subplenodomus valerianae CBS_630.68' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTACGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTACCC---T---------T-CTA-TCAGGG--GGCTGGAGGA---GT-TGGC--GGGGCT------CTTGTCCTGCTCTCT-GCCCTA-CCCTTTCTGTA------TATACCCATGTC-TTTTGCGCA-CTATTTGTTTCCTCGGCGGGC-TTGC-CTGCCGGTAGGACAATCC----TTA-A----AC-CCTTGTAATTGCAGTCAGCGTCAGAAA-AAC-A--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCGC-TTT---------GGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCC-TGGATCGCAGCAC-ATATTGCGAC-C-TTGCC--ATG-ATTGTTGGCGTCC--ATC-AAGA--C-TAT-TT--TTTGCTCT------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Subplenodomus violicola CBS_306.68' ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCA--TT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCC--TTTAGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAA????------------------TTGGATAA-CCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAA-CCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGG-CCTTGCGCC-GGCGAC-GGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGTAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTC---------------------????------------------------------------ATCA-TTACCC---T---------T-CTA-TCAGAG--GGTTGGACGA---GC-GTGC--AGGGCT------TCGGTCTCGCGCTCT-GCCCCG-CCCTTTCTGAT------TCTACCCATGTC-TTTTGCGTA-CTATTTGTTTCCTCGGCGGGC-TTGC-CTGCCGATCGGACATTAT----TCA-A----CC-CTTTGTAATTGCAGTCAGCGTCAGAAA-AAC-A--TAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGT-ACCCTCAAGCTCTGCTTGGTGTTGGGTGTTT-GTCCCGC-CTT---------GGGACTCGCCTTAAAGC-AATTGGCAGCCGGCAT-ATTGGCC-TGGAGCGCAGCAC-ATTTTGCGCCTC-TTGTC--AGG-ATTGTTGGCATCC--ATC-AAGA--C-------TCTTTTGCTC------------------------------------TGACCTCGGATCAGGTA????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN TREES; TITLE Camaro_sporidiella; LINK TAXA = Taxa1; TRANSLATE 1 'Acrocalymma aquatica MFLUCC11_0208', 2 'Acrocalymma ficus CBS_317.76', 3 'Acrocalymma medicaginis CPC_24340', 4 'Acrocalymma medicaginis CPC_24345', 5 'Alternaria alternata IT_181_1', 6 'Alternaria eureka CBS_193.86', 7 'Alternariaster bidentis CBS_134021', 8 'Alternariaster helianthi CBS_327.69', 9 'Amarenographium ammophilae MFLUCC_16_0296', 10 'Ascochyta pisi AFTOL_ID_1583', 11 Ascocylindrica_marina_MD6011, 12 Ascocylindrica_marina_MD6012, 13 'Boeremia exigua var._exigua_CBS_431.74', 14 'Camarosporidiella amorphae fruticosae_MFLUCC_14_0891_T09', 15 'Camarosporidiella caraganicola MFLUCC_14_0887_T05', 16 'Camarosporidiella caraganicola MFLUCC_14_0896_T13', 17 'Camarosporidiella celtidis MFLU_16_0469', 18 'Camarosporidiella celtidis MFLUCC_16_0556_T358', 19 'Camarosporidiella eufemiae MFLUCC_17_0207_IT1621', 20 'Camarosporidiella fabacearum MFLUCC_14_0899_T16', 21 'Camarosporidiella halimodendroni MFLUCC_14_0901_T18', 22 'Camarosporidiella halimodendroni MFLUCC_17_0212_T419', 23 'Camarosporidiella italica MFLUCC_13_0547_IT1283', 24 'Camarosporidiella korfii MFLUCC_14_0916_T72', 25 'Camarosporidiella laburnicola MFLUCC_14_0565', 26 'Camarosporidiella laburni MFLUCC_14_0885_T03', 27 'Camarosporidiella laburni MFLUCC_14_0919_IT83', 28 'Camarosporidiella mackenziei MFLUCC_14_0883_T01', 29 'Camarosporidiella mackenziei MFLUCC_14_0893_T11', 30 'Camarosporidiella mirabellaea MFLU_16_0228', 31 'Camarosporidiella mori albae MFLUCC_14_0886_T04', 32 'Camarosporidiella mori albae MFLUCC_14_0898_T15', 33 'Camarosporidiella premilcurensis MFLUCC_17_0208_IT1681', 34 'Camarosporidiella robiniicola MFLUCC_14_0894_T12', 35 'Camarosporidiella robiniicola MFLUCC_14_0909_T53', 36 'Camarosporium aborescentis MFLUCC_14_0604', 37 'Camarosporium arezzoensis MFLUCC_14_0238', 38 'Camarosporium aureum MFLUCC_140620', 39 'Camarosporium caraganicola MFLUCC_140605', 40 Camarosporium_clematidis, 41 Camarosporium_elaeagnellum_LSU, 42 'Camarosporium moricola MFLUCC_16_1396', 43 'Camarosporium moricola MFLUCC_16_1397', 44 'Camarosporium moricola MFLUCC_16_1398', 45 'Camarosporium robiniicola MFLUCC_13_0527', 46 'Camarosporium spartii MFLUCC_130548', 47 'Libertasomyces quercus CBS_134.97_CBS134.97', 48 'Foliophoma fallens CBS_161.78_CBS161.78', 49 'Foliophoma fallens CBS_284.70_CBS284.70', 50 'Camarosporomyces flavigenus CBS_314.80_CBS314.80', 51 'Cochliobolus heterostrophus AFTOL_ID_54', 52 'Coniothyrium carteri CBS_101633', 53 'Coniothyrium carteri CBS_105.91', 54 'Coniothyrium dolichi CBS_124140', 55 'Coniothyrium glycines CBS_124455', 56 'Coniothyrium obiones AFTOL_ID_1240', 57 'Coniothyrium palmarum CBS_400.71', 58 'Coniothyrium palmarum CBS_758.73', 59 'Coniothyrium telephii CBS_188.71', 60 'Coniothyrium telephii CBS_856.97', 61 Camarosporium_sp._1_CPC_12441_CPC12441, 62 'Camarosporium quaternatum CPC_23216_CPC23216', 63 Camarosporium_sp._2_CPC_25960_CPC25960, 64 Camarosporium_sp._2_CPC_25962_CPC25962, 65 'Neocamarosporium chersinae CPC_27298_CPC27298', 66 Camarosporium_sp._5_CPC_27667_CPC27667, 67 Camarosporium_sp._5_CPC_30379_CPC30379, 68 'Hazslinszkyomyces lycii CPC_30998_CPC30998', 69 'Hazslinszkyomyces lycii CPC_31014_CPC31014', 70 Camarosporium_sp._3_CPC_31031_CPC31031, 71 'Camarosporium quaternatum CPC_31081_CPC31081', 72 'Camarosporium arezzoensis CPC_31420_CPC31420', 73 'Camarosporium quaternatum CPC_31518_CPC31518', 74 Camarosporium_sp._4_CPC_31632_CPC31632, 75 CR_006, 76 CR_026, 77 CR_029, 78 CR_032, 79 'Cucurbitaria berberidis CBS_363.93', 80 'Cucurbitaria berberidis MFLUCC_11_0386', 81 'Cucurbitaria elongata AFTOLID_1568', 82 'Cucurbitaria elongata MFLUCC_140260', 83 'Cucurbitaria ephedricola HA_42', 84 Cyclothyriella_rubronotata_TR, 85 Cyclothyriella_rubronotata_TR9, 86 'Didymella exigua CBS_183.55', 87 'Didymellocamarosporium tamaricis MFLUCC_140241', 88 'Dimorphosporicola tragani CBS_570.85', 89 Robinia_sp._DL0004, 90 'Dothidotthia aspera CPC_12928', 91 'Dothidotthia aspera CPC_12930', 92 'Dothidotthia aspera CPC_12932', 93 'Dothidotthia aspera CPC_12933', 94 'Dothidotthia symphoricarpi CPC_12929', 95 Elaeagnus_sp._T14, 96 Elaeagnus_sp._T51, 97 Elaeagnus_sp._T55, 98 Elaeagnus_sp._T61, 99 Caragana_sp._T50, 100 Cytisus_sp._T64, 101 Cytisus_sp._T66, 102 Cytisus_sp._T70, 103 Gleditsia_sp._T10, 104 Gleditsia_sp._T40, 105 Gleditsia_sp._T42, 106 Halimodendron_T41, 107 'Hazslinszkyomyces aloes CPC_21572', 108 'Hazslinszkyomyces aptrootii CBS_483.95', 109 'Hazslinszkyomyces suttonii MFLUCC_17_0210_T289', 110 'Hazslinszkyomyces suttonii MFLUCC_17_0211_T418', 111 Colutea_IT2674, 112 'Julella avicenniae BCC_18422', 113 'Julella avicenniae BCC_20173', 114 'Julella avicenniae JK_5326A', 115 'Leptosphaeria maculans CBS_260.94', 116 'Leptosphaerulina australis CBS_317.83', 117 'Libertasomyces myopori CPC_27354', 118 'Libertasomyces platani CPC_29609', 119 'Macroventuria anomochaeta CBS_525.71', 120 'Melnikia anthoxanthii MFLUCC_14_1010', 121 Moraceae_Maclura_T02, 122 'Neocamarosporium betae CBS_109410', 123 'Neocamarosporium betae CBS_523.66', 124 'Neocamarosporium calvescens CBS_246.79', 125 'Neocamarosporium chichastianum CBS_137502', 126 'Neocamarosporium goegapense CPC_23676', 127 'Neocamarosporium jorjanensis IBRC_M_30243', 128 'Neocamarosporium jorjanensis IBRC_M_30263', 129 'Neocamarosporium lamiacearum MFLUCC_16_0560', 130 'Neocamarosporium persepolisi IBRC_M_30134', 131 'Neocamarosporium persepolisi IBRC_M_30264', 132 'Neocamarosporium salicornicola MFLUCC_15_0957', 133 'Neocamarosporium solicola IBRC_M_30177', 134 'Neocamarosporium solicola IBRC_M_30257', 135 'Neophaeosphaeria agaves CPC_21264', 136 'Neophaeosphaeria filamentosa CBS_102202', 137 'Neophaeosphaeria filamentosa CBS_102202_2', 138 'Neoplatysporoides aloicola CPC_24435', 139 Robinia_sp._NK0041, 140 Elaeagnus_sp._NK0067, 141 Amorpha_sp._NK0076, 142 'Ochrocladosporium elatum CBS_146.33', 143 'Ochrocladosporium frigidarii CBS_103.81', 144 'Paradendryphiella salina CBS_142.60', 145 'Paraleptosphaeria dryadis CBS_643.86', 146 'Paraleptosphaeria rubi MFLUCC_140211', 147 'Phaeosphaeria chiangraina MFLUCC_13_0231', 148 'Phaeosphaeria musae MFLUCC_11_0133', 149 'Phaeosphaeria thysanolaenicola MFLUCC_10_0563', 150 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0157', 151 'Phaeosphaeriopsis dracaenicola MFLUCC_11_0193', 152 'Phoma herbarum AFTOL_ID_1575', 153 'Phoma herbarum CBS_615.75', 154 'Plenodomus guttulatus MFLUCC_151876', 155 'Plenodomus salviae MFLUCC_130219', 156 Pleosporaceae_sp._M303, 157 Pleosporaceae_sp._M305, 158 Pleosporaceae_sp._M311, 159 'Pleospora chenopodii CBS_344.78', 160 'Pleospora halimiones CBS_432.77', 161 'Pleospora herbarum CBS_191.86', 162 'Pleospora tarda CBS_714.68', 163 'Pyrenochaeta cava CBS_257.68', 164 'Pyrenochaeta nobilis AFTOL_ID_1856', 165 'Pyrenophora phaeocomes AFTOL_ID_283', 166 'Shiraia bambusicola NBRC_30753', 167 'Shiraia bambusicola NBRC_30754', 168 'Shiraia bambusicola NBRC_30771', 169 'Shiraia bambusicola NBRC_30772', 170 'Subplenodomus valerianae CBS_630.68', 171 'Subplenodomus violicola CBS_306.68', 172 Elaeagnus_sp._T_1186, 173 Bassia_sp._T_1189, 174 Morus_sp._T_1233, 175 Robinia_sp._T_1303, 176 Robinia_sp._T_1305, 177 Morus_sp._T_1332, 178 Morus_sp._T_1345, 179 Lycium_sp._T_1346, 180 Lycium_sp._T_1347, 181 Robinia_sp._T_1370, 182 Morus_sp._T_1476, 183 Elaeagnus_sp._T_1488, 184 Spiraea_sp._T_193, 185 Gleditsia_sp._T_205, 186 Artemisia_sp._T_220, 187 Prunus_sp._T_224, 188 Morus_sp._T_232, 189 Morus_sp._T_239, 190 Morus_sp._T_265, 191 Caragana_sp._T_318, 192 Acer_sp._T_332, 193 Morus_sp._T_371, 194 Robinia_sp._G_T_403, 195 Halimodendron_sp._T_468, 196 Colutea_sp._T_477, 197 Elaeagnus_sp._T_511, 198 Morus_sp._T_518, 199 Morus_sp._T_519, 200 Caragana_sp._T_538, 201 Ailanthus_sp._T_767, 202 Caragana_sp._T_810, 203 Laburnum_sp._T_811, 204 Elaeagnus_sp._T_813, 205 Elaeagnus_sp._T_815, 206 Elaeagnus_sp._T_819, 207 Laburnum_sp._T_838, 208 Morus_sp._T_856, 209 Rhamnus_sp._YG_S4_4D, 210 Rhamnus_sp._YG_S4_5, 211 Salsola_sp._YG_S6_1, 212 Salsola_sp._YG_S6_2; TREE PAUP_1 = [&R] ((84:0.0,85:0.0):0.0619985,((112:0.018741,(113:0.0,114:0.0):0.0):0.181634,((11:0.0,12:0.0):0.038648,((1:0.01608,(2:0.005799,(3:0.0,4:0.0):0.023146):0.013788):0.072158,((119:0.04357,(87:0.01269,((13:0.01761,(10:0.007787,152:0.011022):0.004162):0.005572,(116:0.012127,(86:0.005771,153:0.003125):0.005047):0.006508):0.002258):7.62E-4):0.036377,((94:0.008301,(90:0.0,(92:0.002464,(91:0.0,93:0.0):0.002465):0.002467):0.017265):0.01658,(((167:0.001801,(169:0.0,(166:0.001821,168:9.73E-4):0.004944):0.002893):0.091072,((9:0.033076,120:0.006161):0.009723,((150:0.02054,151:0.016014):0.046494,(148:5.02E-4,(147:0.011237,149:0.001368):0.001759):0.024489):0.011384):0.014148):0.009822,(((50:0.033711,(71:0.0,(62:7.64E-4,73:0.0):3.82E-4):0.047907):0.010638,(((145:0.007009,146:0.016301):0.006054,(170:0.024541,171:0.012259):0.007804):0.009206,((7:0.010314,8:0.006286):0.029289,(115:0.042502,(154:0.018669,155:0.032709):0.003334):0.00435):0.010849):0.011114):0.007983,(((48:0.002135,49:2.32E-4):0.031547,(((138:0.017662,(117:0.036733,(47:0.011648,118:0.015483):0.008447):0.007263):0.020668,(165:0.052514,((5:0.016905,6:0.0207):0.011882,(51:0.031057,(144:0.009058,(161:0.001669,162:0.0):0.005663):0.008666):0.009361):0.008714):0.031904):0.012606,((56:0.01426,((88:0.006212,132:0.007013):9.03E-4,((127:0.0,128:0.0):0.015782,(65:0.004947,(131:0.001831,(125:0.0,130:0.004149):0.001292):0.001413):0.001705):0.002271):0.009301):0.001237,(((75:0.003504,(76:0.001004,129:1.28E-4):0.011158):0.003285,(126:0.002012,(211:5.02E-4,212:0.001177):0.001181):0.007835):0.002747,((124:0.0,(159:0.0,160:0.0):0.0):0.012594,(123:0.0,((157:0.0,158:0.0):0.003419,(122:0.010169,(134:0.001682,(133:0.00905,156:0.0):6.21468E-7):0.004291):0.002507):0.003206):0.004427):0.002086):0.004844):0.00934):0.009577):0.011004,(((135:5.66E-4,(136:0.0,137:0.0):0.010462):0.039829,(164:0.020795,(163:0.031009,(80:0.0,(79:0.0,83:0.0):0.0):0.017855):0.012114):0.017126):0.003257,(((57:0.0,58:0.0):0.043073,(((59:0.0,60:0.0):0.003528,(142:6.78E-4,143:0.00437):0.009423):0.011581,(((52:6.4E-4,53:0.0):0.006099,(54:0.002164,55:0.008232):0.016134):0.004305,(107:0.010973,((68:6.24E-4,69:0.0):0.006363,(108:0.011384,((209:3.68E-4,210:0.0):0.002462,((109:0.0,110:0.0):0.00109,(179:0.0,180:0.0):0.001191):0.00376):0.0):7.81E-4):0.002695):0.007031):0.004631):0.006718):0.006186,(((36:3.95E-4,(196:0.001109,(111:3.58E-4,141:0.0):0.0):0.0):0.003251,(23:0.00153,(37:0.001615,(14:0.001449,(20:0.0,(24:3.6E-4,(72:0.0,100:0.0):7.23E-4):3.62E-4):7.21E-4):4.04E-4):7.76E-4):0.003568):0.001309,(((61:0.001021,(30:5.76E-4,((46:0.0,(102:3.54E-4,173:0.001817):0.0):0.001073,((19:0.001449,33:0.0):3.61E-4,(82:0.0,(40:0.001248,(81:0.0,((25:3.74E-4,203:0.0):7.16E-4,((26:0.0,27:0.0):0.0,(78:0.0,(77:0.0,207:0.0):0.001078):3.58E-4):0.0):0.001741):0.0):0.0):0.001299):3.95E-4):5.49E-4):7.46E-4):0.002453,((66:0.0,(67:0.0,(38:0.0,((45:0.0,194:0.0):0.00144,((89:3.58E-4,175:0.0):0.0,((34:0.0,35:0.0):0.0,(103:0.0,105:0.001445):0.002905):7.21E-4):7.09E-4):0.0):0.0):0.0):0.003416,((31:0.0,32:0.0):7.2E-4,(188:0.0,208:0.0,(174:0.0,((178:0.0,(42:0.0,43:0.0,44:0.0):5.59E-4):3.57E-4,(199:3.58E-4,(182:3.57E-4,(190:0.0,(193:0.0,(177:7.13E-4,198:0.0):8.93E-4):4.46E-4):4.45E-4):0.0):0.0):0.0):0.0):0.0):0.00187):0.001634):0.001805,(((202:0.0,(28:0.001258,(29:4.17E-4,(63:7.84E-4,64:0.0):0.0):8.3E-4):0.001826):0.001454,(41:0.002213,(70:0.0,(197:0.0,206:0.0,((96:0.0,97:0.0,98:0.0):3.61E-4,(204:0.0,(172:0.0,186:0.0,(140:0.0,205:0.0):3.57E-4):0.0):4.68674E-6):3.53E-4):1.11281E-8):1.28E-4):0.003886):4.25E-4,(((95:7.25E-4,185:3.61E-4):3.6E-4,(176:0.0,181:3.57E-4):3.58E-4):0.001369,((191:0.001058,(183:0.0,(200:0.001073,(39:4.46E-4,(15:0.0,16:7.25E-4):3.61E-4):0.00146):0.0):0.003283):0.002268,(((22:3.61E-4,106:0.0):0.0,(195:3.59E-4,(21:0.001437,(99:3.59E-4,101:0.0):3.61E-4):3.56E-4):3.58E-4):0.001015,((184:3.59E-4,192:0.0):0.0,((187:3.59E-4,189:0.0,201:0.0):0.0,((104:0.0,139:7.17E-4):3.58E-4,(74:0.0,(18:0.0,(17:0.0,121:0.0):3.62E-4):0.0):3.62E-4):0.0):3.58E-4):0.002234):7.27E-4):3.54E-4):0.0):0.0):9.07E-4):0.028632):0.008569):0.004029):0.001819):0.011781):0.015174):0.003483):0.028804):0.010443):0.023413):0.0619985); END;