#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:33 GMT TreeBASE (cc) 1994-2008 Study reference: Collado J., Platas G., Bills G., Basilio A., Vicente M., Tormo J., Hernández P., Díez M., & Peláez F. 2005. Studies on Morinia. Recognition of Morinia longiappendiculata sp. nov. as a new endophytic fungus, and a new circumscription of Morinia pestalozzioides. Mycologia, 98: 616-627. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2140] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=7; TAXLABELS Morinia_longiappendiculata_F048003_AY929323 Morinia_longiappendiculata_F048007_AY929320 Morinia_longiappendiculata_F048041_AY929321 Morinia_longiappendiculata_F048079_AY929322 Morinia_longiappendiculata_F095552_AY929324 Morinia_pestalozzioides_F090354_AY929325 Truncatella_angustata_F110564_AY929326 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=20; TAXLABELS Amphisphaeria_sp._AF346545 Amphisphaeria_sp._AF375998 Bartalinia_laurina_AF405302 Bartalinia_robillardoides_AF405301 Discostroma_fuscellum_AF377284 Discostroma_tricellulare_AF377285 Morinia_longiappendiculata_F048003_AY929323 Morinia_longiappendiculata_F048007_AY929320 Morinia_longiappendiculata_F048041_AY929321 Morinia_longiappendiculata_F048079_AY929322 Morinia_longiappendiculata_F095552_AY929324 Morinia_pestalozzioides_F090354_AY929325 Pestalotiopsis_maculans_AF405296 Pestalotiopsis_neglecta_AY682935 Pestalotiopsis_sp._AF405295 Pestalotiopsis_virginiana_AF409959 Seiridium_ceratosporum_AY687314 Seiridium_sp._AF377297 Truncatella_angustata_AF405306 Truncatella_angustata_F110564_AY929326 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3355] TITLE Fig._14; LINK TAXA = Taxa2; DIMENSIONS NCHAR=528; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amphisphaeria_sp._AF346545 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCATTTGTTGCCTCGGCAGAGCCTACCTGGT--A-TCTACTCTGGAGCGGC-TACCCTGTAGC----TACCCTGGAGCGGGTTACCCTGTAACG---TCCTGCCGGTGGACCTTTAAACTCTTGTTATTATATAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGA----ATCTACTGTATT----GTAGTTCCTGAAATATAACGGCGGATCTGCAATATCCTCTGAGCGTAGTAA-TTTTTTT-CTCGCTTTGGTTAGGTGTTGTAGC-TCTC--AGCCGC-TAAA-CCCCCCAATTTTA Amphisphaeria_sp._AF375998 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCATTTGTTGCCTCGGCAGAGCCTACCTGGT--A-TCTACTCTGGAGCGGC-TACCCTGTAGC----TACCCTGGAGCGGGTTACCCTGTAACG---TCCTGCCGGTGGACCTTTAAACTCTTGTTATTATATAGTAATCTGAGCCTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGA----ATCTACTGTATT----GTAGTTCCTGAAATATAACGGCGGATCTGCAATATCCTCTGAGCGTAGTAA-TTTTTTT-CTCGCTTTGGTTAGGTGTTGTAGC-TCTC--AGCCGC-TAAA-CCCCCCAATTTTA Bartalinia_laurina_AF405302 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACC-TTTGTTGCCTCGGCAGTAGTTGCTGGGCG-AGCCTACCCGGGAACGAGCTACCCTGTAGCGAGTTACCCTGGAACGACTTACCCTGGAACG----CCTGCCGGTGGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ATCGACTTTACT----GTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTT-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-TAAA-CCCCC-AATTTCT Bartalinia_robillardoides_AF405301 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACC-TTTGTTGCCTCGGCAGTAGTTGCTGGGCG-AGCCTACCCGGGAACGAGCTACCCTGTAGCGAGTTACCCTGGAACGACTTACCCTGTAACG----CCTGCCGGTGGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ATCGACTTTACT----GTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTC-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-TAAA-CCCCC-AATTTTT Discostroma_fuscellum_AF377284 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCA-TTGTTGCCTCGGCAGAACCTACCCGGT--A-CCTACCCTGTAACGACCTACCCTGTAGCGAGTTACCTGGGAACGGCTTACCCTGTAG---TGCGCTGCCGGCGGACCTCTTAACTCTTGTTATTTTATAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCC----TACTGTATT----GTAGCTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTAT-CTCGCTTTTGTTAGGTGCCGCAGC-TCTC--AGCCGC-TAAA-CCCCCCAATTTTT Discostroma_tricellulare_AF377285 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCATTTGTTGCCTCGGCAGAGGCTACCCGGT--A-CCTACCCTGGAGCAGC-TACCCTGTAGC----TACCCTGGAACGGCCTACCCTGTAGCGC-ATCCTGCCGGTGGACCTTTAAACTCTTGTTATTTTAAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGA----ATCTACTGTATT----GTAGTTCCTGAAATATAACGGCGGATCTGTAATGTCCTCTGAGCGTAGTAA-TTTTTTTCCTCGCTTTGGTTAGGTGTTGCAGC-TCTC--AGCCGC-TAAA-CCCCCCAATTTTA Morinia_longiappendiculata_F048003_AY929323 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCAG---TT--TGGGCG-AGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-TCTC--AGCCGC-AAAA-CCCCC-AATTTTT Morinia_longiappendiculata_F048007_AY929320 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCAG---TT--TGGGCG-AGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-TCTC--AACCGC-AAAA-CCCCC-AATTTTT Morinia_longiappendiculata_F048041_AY929321 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCAG---TT--TGGGCG-AGCCTACCCTGTAGCAAGTTACCCCGTAACGAATTACCCTGTAGCTGCTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-AAAA-CCCCC-AATTTTT Morinia_longiappendiculata_F048079_AY929322 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCAG---TT--TGGGCG-AGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTACTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTTACTCCTTAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-AAAA-CCCCC-AATTTTT Morinia_longiappendiculata_F095552_AY929324 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCAG---TT--TGGGCG-AGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTACTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTTACTCCTTAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-AAAA-CCCCC-AATTTTT Morinia_pestalozzioides_F090354_AY929325 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTAC-TTTTGTTGCCTCGGCA---GTT--TGGGCG-AGCCTACCCTGTAGCGAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACG----GCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----GCTGACTTTACT----GTCACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTAT-CTCGTTTTTG--AAATACTATAAA-CCTC--AGCCGC-AAAA-CCCCCCAATTTTT Pestalotiopsis_maculans_AF405296 CATTATAGAGTTTTCTAAACTCCC-AACCCATGTGAACTTACCA-TTGTTGCCTCGGCAGAAGCTACCCGGT--ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACG----GCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTT-AGCCGC-TAAATCCCCC-AATTTTT Pestalotiopsis_neglecta_AY682935 CATTACAGAGTTTTCTAAACTCCC-AACCCATGTGAACTTACCA-TTGTTGCCTCGGCAGAAGCTGCTCGGTGCACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCG----GCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTTAGCCGCTTAAATCCCCCCAAATTTT Pestalotiopsis_sp._AF405295 CATTATAGAGTTTTCTAAACTCCC-AACCCATGTGAACTTACCA-TTGTTGCCTCGGCAGAAGCTGCTCGGTATACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACG----GCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGCTTTTGTTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGTGATATCCTCTGAGCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTT-AGCCGC-TAAA-CCCCCCAATTTTT Pestalotiopsis_virginiana_AF409959 CATTATAGAGTTTTCTAAACTCCC-AACCCATGTGAACTTACCA-TTGTTGCCTCGGCAGAAGCTGCTCGGCGCGCCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACG----GCTGCCGGTGGACTACCAAACTCTTGTTATTTTATAGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTT-AGCCGC-TAAA-CCCCCCAATTTT- Seiridium_ceratosporum_AY687314 CATTACAGAGTTTTCTAA-CTCCCAAACCCATGTGAACTTACC-TTTGTTGCCTCGGCAGAAGCTACCCGGT--A-CCTACCCTGTAAC-AGTTACCCTGTATCGCAC------GGCTCGGGTTACCCTGTAGCAATATTCTGCCGGTGGACTATTCAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ATCTACTATATT----GTAGTTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAATTTTTAT-CTCGCTTTTGTTAGGTGCTGCAGC-TCCC--AGCCGC-TAAA-CCCCC-AATTTTT Seiridium_sp._AF377297 ------AGAGTTTTCTAA-CTCCCAAACCCATGTGAACTTACC-TTTGTTGCCTCGGCAGAAGCTACCCTGT--A-CCTACCCTGGAACGAGTTACCCTGTAACGAATT-CTTGTG--TAGCCTACCCTGTAGCAATATTCTGCCGGTGGACTATTCAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ATCTACTGTATT----GTAGTTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAATTTTTAT-CTCGCTTTTGTTAGGTGCTGCAGC-TCCC--AGCCGC-TAAA-CCCCCCAATTTTT Truncatella_angustata_AF405306 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCAC-TGTTGCCTCGGCAGATGTTGCTGGGCG-AACCTACCCTGTAGCGAGCTACTCTGTAGCGACCTACCCGGGAACGGCTTACCCTGTAGCG----CCTGCCGGTGGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ACTGGCTTTACT----GCCATTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTTT-CTCGTTTTTG--AAATACTGTAAA-CCTC--AGCCGC-TAAA-CCCCCCAATTTTT Truncatella_angustata_F110564_AY929326 CATTACAGAGTTATCTAA-CTCCCAAACCCATGTGAACTTACCAC-TGTTGCCTCGGCAGATGTTGCTGGGCG-AACCTACCCTGTAGCGAGCTACTCTGTAGCGACCTACCCGGGAACGGCTTACCCTGTAGCG----CCTGCCGGTGGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGA----ACTGGCTTTACT----GCCATTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAA-TTTTTTT-CTCGTTTTTG--AAATACTGTAAA-CCTC--AGCCGC-TAAA-CCCCCCAATTTTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Fig._14) = N: 1-528; CODONPOSSET CodonPositions (CHARACTERS = Fig._14) = N: 1-528; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3356] TITLE Fig._13; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1431; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Morinia_longiappendiculata_F048003_AY929323 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGGTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATTCTGCTTCGACGAGCCCGA-CCTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGTGCCAAGATCAATCCCCG-AACGAGAGC-TTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACAACTCAAGTGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCGAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGCATCATCAT---CATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATTCTTGCATTCTTCCTCACATCCTTAACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCCCGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAATGTCGATCCCCACCACAGC-TGTTGCATTAAAATGCATAACTTCAATCGAAACCATGATAACTAACTCCTGCT--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAATCTCAGCCGCAAAACCCCC-AATTTTT Morinia_longiappendiculata_F048007_AY929320 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGGTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATTCTGCTTCGACGAGCCCGA-CCTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGCGCCAAGATCAATCCCCG-AACGAGAGC-TTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACAACTCAAGTGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCGAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGCATCATCAT---CATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATTCTTGCATTCTTCCTCACATCCTTAACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCCCGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAATGTCGATCCCCACCACAGC-TGTTGCATTAAAATGCATAACTTCAATCGAAACCATGATAACTAACTCCTGCT--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAATCTCAACCGCAAAACCCCC-AATTTTT Morinia_longiappendiculata_F048041_AY929321 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGGTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATTCTGCTTCGACGAGCCCGA-CCTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGTGCCAAGATCAATCCCCG-AACGAGAGC-TTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACCACTCAAGTGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCGAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGCATCATCAT---CATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATTCTTGCATTCTTCCTCACATCCTTAACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCCCGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAATGTCGATCCCCACCACAGC-TGTTGCATTAAAATGCATAACTTCAATCGAAACCATGATAACTAACTCCTGCT--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCAAGTTACCCCGTAACGAATTACCCTGTAGCTGCTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTTACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAACCTCAGCCGCAAAACCCCC-AATTTTT Morinia_longiappendiculata_F048079_AY929322 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGGTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATTCTGCTTCGACGAGCCCGA-CCTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGTGCCAAGATCAATCCCCG-AACGAGAGC-TTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACAACTCAAGTGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCGAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGCATCATCAT---CATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATTCTTGCATTCTTCCTCACATCCTTAACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCCCGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAATGTCGATCCCCACCACAGC-TGTTGCATTAAAATGCATAACTTCAATCGAAACCATGATAACTAACTCCTGCT--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTACTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTTACTCCTTAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAACCTCAGCCGCAAAACCCCC-AATTTTT Morinia_longiappendiculata_F095552_AY929324 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGGTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATTCTGCTTCGACGAGCCCGA-CCTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGTGCCAAGATCAATCCCCG-AACGAGAGC-TTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACAACTCAAGCGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCGAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGCATCATCAT---CATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATTCTTGCATTCTTCCTCACATCCTTAACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCCCGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAATGTCGATCCCCACCACAGC-TGTTGCATTAAAATGCATAACTTCAATCGAAACCATGATAACTAACTCCTGCT--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCAAGTTACCCCGTAACGAGTTACCCTGTAGCTACTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGCAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTTACTCCTTAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAACCTCAGCCGCAAAACCCCC-AATTTTT Morinia_pestalozzioides_F090354_AY929325 CTGTTTTCCGTAAGTTCTGACC-T-GACTTCTATAT--CACCCCGCTTCAAGGCGCTATTGCGGTGACGACCC-----GGTGCTATACCACACAGCATCAATTCGCTAACTACTTTGTACTAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGTACACATACTGCTTCGACGAGCCCGAACTTTTTTTG--------------CGCATCGGAATAATCTCTAACACGATGGTAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGCGTTGTTAGCGATGGTCGTGCCAAGATCCATCCCCGGAATGATAGAATTTATTAGCTGGTATGGGTGTGTACCAAGACGGTATTGCCAAGCAACAAGTGAACGGCAAGGACGTGACATCGCATATCTACGAATACACAACTCAAGTGGGCATGACGATCAAGAATGATGTTGTCCAGCTCATTCCCAAAAAGCAGCCTGTCCAAATGCTCTTCTGCTTGAAAGAGAAGAACCAGAAGAAAATCAACTCTCACAGAGTTCAAGAAGGTTAGTAACCACCCCCAAGCAAATATCTTCACACAATATCCGGTATCATCATCATCATTGCCCTCC-CATCGCTACCATTTTCTTGCGATATTTCTGGCTTTCTGCTTTGTGGTGCAAATCCTTGCATTCTTCCTCACATCCTTGACAATCACCTTCCACACATTACCCCGCCGAAACGGCAGGGCACCACGACCCCGCGGTCCCCTCGCAAAATTTTCTTATCGCGCCCCACCAAACGTCAATCCCCACCACAGCTTGTTGCATTATAATGCATAACTTTAATCGAAACCATGATAACTAACTCCTGCA--------------------------------------ACAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACTTTTGTTGCCTCGGCA---GTT--TGGGCGAGCCTACCCTGTAGCGAGTTACCCCGTAACGAGTTACCCTGTAGCTGCTTACCCTGTAACGGCTGCCGATGGACCACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGACTTTACTGTCACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTATCTCGTTTTTGAAATACTATAAACCTCAGCCGCAAAACCCCCCAATTTTT Truncatella_angustata_F110564_AY929326 CTGTTTTCCGTAAGTTCTGACCCTCGACA-CTTTGTGCCACCCCGCTTCATGGCGCTATTGCCGTGGCGGGCCCCAGTGGCAAGGTCATGGT-AGCATCAATTTACTGACCCGTTTCCAC-AGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTGAGT----ATTCTTGTCCCGTCTGTTCGGGCTCAGATCTCGAGCTCGTTCGTGGCCCCCCAAGTGGTCTCTAACAATGCGGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTGAAGAAGATCGTTGTTTGTGTTGTTAGCGACGGTCGTGCTAAGATTAACCCCCGG-ACGAGAGC-TCTTCTGGCCGGTATGGGCGTCTATCAGGACGGCATCGCCAAGCAACAGGTTAACGGAAAGGACGTGACGGCGCACATATATGAGTATACCACACAAGTTGGCATGACCATCAAGAACGACGTTGTCCAGCTCATTCCTAAGAAGCAGCCTGTTCAGATGCTCTTCTGCTTGAAGGAAAAGAATCAGAAGAAGATCAACTCTCACAGAGTT--GGAAGGTTAGTACATGTCTTCCAACCCAT--CATCAACAACATTATGACCGTCA-----------CCCTCCGCATCATCCCGATTTTCGGTGATGCAGATCTCTTTTTTTGCGTGCCACACGCACTTCCTTCACTTTTGCTTCTGACACAATTACCCCGCCGACATGCAACCATATCAC-----------AACCCCGCGGACCCC-T--CCT-G-AAAATTT-CTTATCGTGCGCAAATAATCCACGATAATTGGCCTGCCCCCCATCCCACCCAAACTCTACCCCCATTCCAATTCATCTGTTGCACAATTATGCCGATCTCGACGCAATGCAAAGATGACTGACCAATTCGATAGGAAGCCGCCGAGCTCGGTAACATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCACTGTTGCCTCGGCAGATGTTGCTGGGCGAACCTACCCTGTAGCGAGCTACTCTGTAGCGACCTACCCGGGAACGGCTTACCCTGTAGCGCCTGCCGGTGGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAACTGGCTTTACTGCCATTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTCTCGTTTTTGAAATACTGTAAACCTCAGCCGCTAAACCCCCCAATTTTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Fig._13) = N: 1-1431; CODONPOSSET CodonPositions (CHARACTERS = Fig._13) = N: 1-1431; END; BEGIN TREES; TITLE Tb9237; LINK TAXA = Taxa1; TRANSLATE 1 Morinia_pestalozzioides_F090354_AY929325, 2 Morinia_longiappendiculata_F048003_AY929323, 3 Morinia_longiappendiculata_F048007_AY929320, 4 Morinia_longiappendiculata_F048041_AY929321, 5 Morinia_longiappendiculata_F048079_AY929322, 6 Morinia_longiappendiculata_F095552_AY929324, 7 Truncatella_angustata_F110564_AY929326; TREE Fig._7 = [&R] ((1,(4,(2,3),(5,6))),7); END; BEGIN TREES; TITLE Tb9238; LINK TAXA = Taxa2; TRANSLATE 1 Pestalotiopsis_maculans_AF405296, 2 Pestalotiopsis_neglecta_AY682935, 3 Pestalotiopsis_sp._AF405295, 4 Pestalotiopsis_virginiana_AF409959, 5 Truncatella_angustata_F110564_AY929326, 6 Truncatella_angustata_AF405306, 7 Morinia_longiappendiculata_F048007_AY929320, 8 Morinia_longiappendiculata_F048003_AY929323, 9 Morinia_longiappendiculata_F048079_AY929322, 10 Morinia_longiappendiculata_F095552_AY929324, 11 Morinia_longiappendiculata_F048041_AY929321, 12 Morinia_pestalozzioides_F090354_AY929325, 13 Bartalinia_laurina_AF405302, 14 Bartalinia_robillardoides_AF405301, 15 Seiridium_ceratosporum_AY687314, 16 Seiridium_sp._AF377297, 17 Discostroma_fuscellum_AF377284, 18 Amphisphaeria_sp._AF375998, 19 Amphisphaeria_sp._AF346545, 20 Discostroma_tricellulare_AF377285; TREE Fig._8 = [&R] (((((1,4),3),2),((17,(15,16)),(20,(18,19)))),(((5,6),(12,(11,(7,8),(9,10)))),(13,14))); END;