#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:22 GMT TreeBASE (cc) 1994-2008 Study reference: Bensch K., Groenewald J.Z., Meijer M., Dijksterhuis J., Jurjevic Z., Andersen B., Houbraken J., Crous P.W., & Samson R. 2018. Cladosporium species in indoor environments. Studies in Mycology, 89: 177-301. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21415] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=309; TAXLABELS Cercospora_beticola_CBS_116456 Cladosporium_aciculare_CBS_140488 Cladosporium_aphidis_CBS_132182 Cladosporium_austrohemisphaericum_CBS_140482 Cladosporium_austrohemisphaericum_CPC_16250 Cladosporium_austrohemisphaericum_CPC_17029 'Cladosporium austrohemisphaericum DTO 305-E8' Cladosporium_coloradense_CPC_22238 Cladosporium_cycadicola_CBS_137970 Cladosporium_domesticum_CPC_22225 Cladosporium_domesticum_CPC_22226 Cladosporium_domesticum_CPC_22307 Cladosporium_domesticum_CPC_22318 Cladosporium_domesticum_CPC_22402 Cladosporium_domesticum_CPC_22408 Cladosporium_domesticum_CPC_22413 'Cladosporium domesticum DTO 305-H2' 'Cladosporium domesticum DTO 306-B6' 'Cladosporium domesticum DTO 307-E8' 'Cladosporium domesticum DTO 307-H3' 'Cladosporium domesticum DTO 308-B1' Cladosporium_dominicanum_CBS_119415 Cladosporium_dominicanum_CPC_11683 Cladosporium_dominicanum_CPC_15932 Cladosporium_dominicanum_CPC_20109 Cladosporium_dominicanum_CPC_22240 Cladosporium_dominicanum_CPC_22241 Cladosporium_dominicanum_CPC_22244 Cladosporium_dominicanum_CPC_22319 'Cladosporium dominicanum EXF-696' 'Cladosporium dominicanum EXF-718' 'Cladosporium dominicanum EXF-720' 'Cladosporium dominicanum EXF-727' Cladosporium_fusiforme_CBS_119414 Cladosporium_fusiforme_CBS_452.71 'Cladosporium fusiforme EXF-397' Cladosporium_halotolerans_CBS_119416 Cladosporium_halotolerans_CPC_22275 Cladosporium_halotolerans_CPC_22278 Cladosporium_halotolerans_CPC_22281 Cladosporium_halotolerans_CPC_22293 Cladosporium_halotolerans_CPC_22308 Cladosporium_halotolerans_CPC_22335 Cladosporium_halotolerans_CPC_22337 Cladosporium_halotolerans_CPC_22360 Cladosporium_halotolerans_CPC_22366 Cladosporium_halotolerans_CPC_22372 Cladosporium_halotolerans_CPC_22381 Cladosporium_halotolerans_CPC_22390 Cladosporium_halotolerans_CPC_22397 Cladosporium_halotolerans_CPC_22401 Cladosporium_halotolerans_CPC_22411 Cladosporium_halotolerans_CPC_22412 Cladosporium_halotolerans_CPC_22414 'Cladosporium halotolerans DTO 036-G3' 'Cladosporium halotolerans DTO 049-E7' 'Cladosporium halotolerans DTO 049-E8' 'Cladosporium halotolerans DTO 102-A1' 'Cladosporium halotolerans DTO 102-A3' 'Cladosporium halotolerans DTO 108-F7' 'Cladosporium halotolerans DTO 109-D1' 'Cladosporium halotolerans DTO 109-D3' 'Cladosporium halotolerans DTO 114-H7' 'Cladosporium halotolerans DTO 114-I3' 'Cladosporium halotolerans DTO 117-H3' 'Cladosporium halotolerans DTO 127-E3' 'Cladosporium halotolerans DTO 127-E8' 'Cladosporium halotolerans DTO 130-C9' 'Cladosporium halotolerans DTO 147-B3' 'Cladosporium halotolerans DTO 147-B8' 'Cladosporium halotolerans DTO 147-B9' 'Cladosporium halotolerans DTO 153-C3' 'Cladosporium halotolerans DTO 153-C5' 'Cladosporium halotolerans DTO 160-I2' 'Cladosporium halotolerans DTO 160-I3' 'Cladosporium halotolerans DTO 160-I5' 'Cladosporium halotolerans DTO 161-D5' 'Cladosporium halotolerans DTO 305-E4' 'Cladosporium halotolerans DTO 305-E5' 'Cladosporium halotolerans DTO 305-E6' 'Cladosporium halotolerans DTO 305-E7' 'Cladosporium halotolerans DTO 305-E9' 'Cladosporium halotolerans DTO 305-F1' 'Cladosporium halotolerans DTO 305-F2' 'Cladosporium halotolerans DTO 305-F3' 'Cladosporium halotolerans DTO 305-F4' 'Cladosporium halotolerans DTO 305-F6' 'Cladosporium halotolerans DTO 305-F9' 'Cladosporium halotolerans DTO 305-G1' 'Cladosporium halotolerans DTO 305-G2' 'Cladosporium halotolerans DTO 305-G5' 'Cladosporium halotolerans DTO 305-G6' 'Cladosporium halotolerans DTO 305-G7' 'Cladosporium halotolerans DTO 305-G8' 'Cladosporium halotolerans DTO 305-G9' 'Cladosporium halotolerans DTO 305-H3' 'Cladosporium halotolerans DTO 305-H6' 'Cladosporium halotolerans DTO 305-I3' 'Cladosporium halotolerans DTO 305-I4' 'Cladosporium halotolerans DTO 305-I6' 'Cladosporium halotolerans DTO 305-I8' 'Cladosporium halotolerans DTO 306-A2' 'Cladosporium halotolerans DTO 306-A4' 'Cladosporium halotolerans DTO 306-A9' 'Cladosporium halotolerans DTO 306-B1' 'Cladosporium halotolerans DTO 306-B3' 'Cladosporium halotolerans DTO 306-B4' 'Cladosporium halotolerans DTO 306-B5' 'Cladosporium halotolerans DTO 306-B8' 'Cladosporium halotolerans DTO 306-B9' 'Cladosporium halotolerans DTO 306-C2' 'Cladosporium halotolerans DTO 306-C5' 'Cladosporium halotolerans DTO 306-C6' 'Cladosporium halotolerans DTO 306-C7' 'Cladosporium halotolerans DTO 306-C8' 'Cladosporium halotolerans DTO 306-C9' 'Cladosporium halotolerans DTO 306-D3' 'Cladosporium halotolerans DTO 306-D4' 'Cladosporium halotolerans DTO 306-D5' 'Cladosporium halotolerans DTO 306-D6' 'Cladosporium halotolerans DTO 306-D7' 'Cladosporium halotolerans DTO 306-D9' 'Cladosporium halotolerans DTO 306-E1' 'Cladosporium halotolerans DTO 306-E2' 'Cladosporium halotolerans DTO 306-E5' 'Cladosporium halotolerans DTO 306-E6' 'Cladosporium halotolerans DTO 306-E8' 'Cladosporium halotolerans DTO 306-E9' 'Cladosporium halotolerans DTO 306-F1' 'Cladosporium halotolerans DTO 306-F2' 'Cladosporium halotolerans DTO 306-F3' 'Cladosporium halotolerans DTO 306-F4' 'Cladosporium halotolerans DTO 307-E9' 'Cladosporium halotolerans DTO 307-F4' 'Cladosporium halotolerans DTO 307-F6' 'Cladosporium halotolerans DTO 307-F7' 'Cladosporium halotolerans DTO 307-F8' 'Cladosporium halotolerans DTO 307-F9' 'Cladosporium halotolerans DTO 307-G1' 'Cladosporium halotolerans DTO 307-G2' 'Cladosporium halotolerans DTO 307-G3' 'Cladosporium halotolerans DTO 307-G4' 'Cladosporium halotolerans DTO 307-G5' 'Cladosporium halotolerans DTO 307-G7' 'Cladosporium halotolerans DTO 307-G8' 'Cladosporium halotolerans DTO 307-H5' 'Cladosporium halotolerans DTO 307-H6' 'Cladosporium halotolerans DTO 307-H7' 'Cladosporium halotolerans DTO 307-H8' 'Cladosporium halotolerans DTO 307-H9' 'Cladosporium halotolerans DTO 307-I1' 'Cladosporium halotolerans DTO 307-I4' 'Cladosporium halotolerans DTO 307-I7' 'Cladosporium halotolerans DTO 307-I8' 'Cladosporium halotolerans DTO 308-A1' 'Cladosporium halotolerans DTO 308-A3' 'Cladosporium halotolerans DTO 308-A4' 'Cladosporium halotolerans DTO 308-A5' 'Cladosporium halotolerans DTO 308-A6' 'Cladosporium halotolerans DTO 308-A7' 'Cladosporium halotolerans DTO 308-A8' 'Cladosporium halotolerans DTO 308-A9' 'Cladosporium halotolerans DTO 308-B3' 'Cladosporium halotolerans DTO 308-B4' 'Cladosporium halotolerans DTO 308-B6' 'Cladosporium halotolerans DTO 308-B7' 'Cladosporium halotolerans DTO 323-C4' 'Cladosporium halotolerans DTO 323-F3' 'Cladosporium halotolerans DTO 323-F6' 'Cladosporium halotolerans DTO 323-F8' 'Cladosporium halotolerans DTO 323-F9' 'Cladosporium halotolerans DTO 323-G9' 'Cladosporium halotolerans DTO 323-H4' 'Cladosporium halotolerans DTO 323-I2' 'Cladosporium halotolerans DTO 323-I3' 'Cladosporium halotolerans DTO 323-I7' 'Cladosporium halotolerans DTO 324-B3' 'Cladosporium halotolerans DTO 324-B4' 'Cladosporium halotolerans DTO 324-B5' 'Cladosporium halotolerans DTO 324-B6' 'Cladosporium halotolerans DTO 324-C1' Cladosporium_halotolerans_dH_12862 Cladosporium_langeronii_CBS_101880 Cladosporium_langeronii_CBS_189.54 Cladosporium_langeronii_CBS_601.84 Cladosporium_langeronii_CPC_19121 Cladosporium_langeronii_CPC_22235 Cladosporium_langeronii_CPC_22261 Cladosporium_langeronii_CPC_22299 Cladosporium_langeronii_CPC_22325 Cladosporium_langeronii_CPC_22326 'Cladosporium langeronii DTO 004-C3' 'Cladosporium langeronii DTO 085-H6' 'Cladosporium langeronii DTO 124-D2' 'Cladosporium langeronii DTO 124-D5' Cladosporium_lebrasiae_CBS_138283 Cladosporium_longissimum_CBS_300.96 Cladosporium_neolangeronii_CBS_109868 Cladosporium_neolangeronii_CBS_797.97 Cladosporium_neolangeronii_CPC_22236 Cladosporium_neolangeronii_CPC_22262 Cladosporium_neolangeronii_CPC_22263 Cladosporium_neolangeronii_CPC_22266 Cladosporium_neolangeronii_CPC_22267 Cladosporium_neolangeronii_CPC_22314 'Cladosporium neolangeronii DTO 162-A4' Cladosporium_parahalotolerans_CBS_139585 Cladosporium_parahalotolerans_CPC_22280 Cladosporium_parahalotolerans_CPC_22330 Cladosporium_parahalotolerans_CPC_22336 Cladosporium_parahalotolerans_CPC_22342 Cladosporium_parahalotolerans_CPC_22373 Cladosporium_parahalotolerans_CPC_22376 'Cladosporium parahalotolerans DTO 161-D6' 'Cladosporium parahalotolerans DTO 305-F7' 'Cladosporium parahalotolerans DTO 305-F8' 'Cladosporium parahalotolerans DTO 305-I5' 'Cladosporium parahalotolerans DTO 306-C1' 'Cladosporium parahalotolerans DTO 306-E4' 'Cladosporium parahalotolerans DTO 307-H4' 'Cladosporium parahalotolerans DTO 323-B8' 'Cladosporium parahalotolerans DTO 323-C1' 'Cladosporium parahalotolerans DTO 323-C8' 'Cladosporium parahalotolerans DTO 323-F4' 'Cladosporium parahalotolerans DTO 323-H2' 'Cladosporium parahalotolerans DTO 323-H3' 'Cladosporium parahalotolerans DTO 324-A7' 'Cladosporium parahalotolerans DTO 324-B7' Cladosporium_penidielloides_CBS_140489 Cladosporium_psychrotolerans_CBS_119412 'Cladosporium psychrotolerans DTO 305-G3' 'Cladosporium psychrotolerans DTO 307-H2' 'Cladosporium psychrotolerans EXF-332' 'Cladosporium psychrotolerans EXF-714' Cladosporium_pulvericola_CBS_109788 Cladosporium_pulvericola_CPC_22403 'Cladosporium pulvericola DTO 130-D6' 'Cladosporium pulvericola DTO 249-F4' 'Cladosporium pulvericola DTO 255-F7' 'Cladosporium pulvericola DTO 255-H5' 'Cladosporium pulvericola DTO 305-H8' 'Cladosporium pulvericola DTO 307-E7' Cladosporium_ruguloflabelliforme_CBS_140494 Cladosporium_salinae_CBS_102047 Cladosporium_salinae_CBS_119413 'Cladosporium sloanii DTO 130-D5' Cladosporium_sphaerospermum_CBS_102045 Cladosporium_sphaerospermum_CBS_109.14 Cladosporium_sphaerospermum_CBS_117728 Cladosporium_sphaerospermum_CBS_193.54 Cladosporium_sphaerospermum_CPC_11822 Cladosporium_sphaerospermum_CPC_12476 Cladosporium_sphaerospermum_CPC_13368 Cladosporium_sphaerospermum_CPC_13995 Cladosporium_sphaerospermum_CPC_14016 Cladosporium_sphaerospermum_CPC_22270 Cladosporium_sphaerospermum_CPC_22301 Cladosporium_sphaerospermum_CPC_22302 Cladosporium_sphaerospermum_CPC_22317 Cladosporium_sphaerospermum_CPC_22339 Cladosporium_sphaerospermum_CPC_22357 Cladosporium_sphaerospermum_CPC_22361 Cladosporium_sphaerospermum_CPC_22379 'Cladosporium sphaerospermum DTO 017-C7' 'Cladosporium sphaerospermum DTO 049-H5' 'Cladosporium sphaerospermum DTO 084-F4' 'Cladosporium sphaerospermum DTO 086-E7' 'Cladosporium sphaerospermum DTO 086-E8' 'Cladosporium sphaerospermum DTO 089-E9' 'Cladosporium sphaerospermum DTO 090-A1' 'Cladosporium sphaerospermum DTO 090-H9' 'Cladosporium sphaerospermum DTO 090-I1' 'Cladosporium sphaerospermum DTO 106-D4' 'Cladosporium sphaerospermum DTO 117-G5' 'Cladosporium sphaerospermum DTO 117-H2' 'Cladosporium sphaerospermum DTO 127-E5' 'Cladosporium sphaerospermum DTO 150-H8' 'Cladosporium sphaerospermum DTO 150-I3' 'Cladosporium sphaerospermum DTO 150-I8' 'Cladosporium sphaerospermum DTO 153-B7' 'Cladosporium sphaerospermum DTO 153-C1' 'Cladosporium sphaerospermum DTO 160-I4' 'Cladosporium sphaerospermum DTO 161-D4' 'Cladosporium sphaerospermum DTO 161-D7' 'Cladosporium sphaerospermum DTO 161-D8' 'Cladosporium sphaerospermum DTO 161-D9' 'Cladosporium sphaerospermum DTO 161-E1' 'Cladosporium sphaerospermum DTO 194-A4' 'Cladosporium sphaerospermum DTO 244-C6' 'Cladosporium sphaerospermum DTO 305-F5' 'Cladosporium sphaerospermum DTO 306-D8' 'Cladosporium sphaerospermum DTO 306-E3' 'Cladosporium sphaerospermum DTO 307-G6' 'Cladosporium sphaerospermum DTO 307-H1' 'Cladosporium sphaerospermum DTO 307-I3' 'Cladosporium sphaerospermum EXF-1061' 'Cladosporium sphaerospermum EXF-455' 'Cladosporium sphaerospermum EXF-458' 'Cladosporium sphaerospermum EXF-738' 'Cladosporium sphaerospermum EXF-739' 'Cladosporium sphaerospermum EXF-962' Cladosporium_succulentum_CBS_140466 Cladosporium_velox_CBS_119417 Cladosporium_velox_CPC_18450 Cladosporium_velox_CPC_22359 'Cladosporium velox DTO 317-H1' 'Cladosporium velox DTO 323-H8' 'Cladosporium velox EXF-466' 'Cladosporium velox EXF-471' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=220; TAXLABELS Cercospora_beticola_CBS_116456 'Cladosporium aerium DTO 323-B4' 'Cladosporium aerium DTO 323-G6' 'Cladosporium aerium DTO 323-G7' Cladosporium_aggregatocicatricatum_CBS_113751 Cladosporium_aggregatocicatricatum_CBS_140493 Cladosporium_aggregatocicatricatum_CBS_284.84 Cladosporium_allicinum_CBS_110024 Cladosporium_allicinum_CBS_115683 Cladosporium_allicinum_CBS_121624 Cladosporium_allicinum_CBS_134.31 Cladosporium_allicinum_CBS_157.82 Cladosporium_allicinum_CBS_159.54 Cladosporium_allicinum_CBS_161.55 Cladosporium_allicinum_CBS_177.71 Cladosporium_allicinum_CBS_188.54 Cladosporium_allicinum_CBS_366.80 Cladosporium_allicinum_CBS_399.80 Cladosporium_allicinum_CBS_521.68 Cladosporium_allicinum_CBS_572.78 Cladosporium_allicinum_CBS_813.71 Cladosporium_allicinum_CPC_11386 Cladosporium_allicinum_CPC_11840 Cladosporium_allicinum_CPC_12042 Cladosporium_allicinum_CPC_12045 Cladosporium_allicinum_CPC_12046 Cladosporium_allicinum_CPC_12139 Cladosporium_allicinum_CPC_12212 Cladosporium_allicinum_CPC_12921 Cladosporium_allicinum_CPC_22268 Cladosporium_allicinum_CPC_22312 Cladosporium_allicinum_CPC_22313 Cladosporium_allicinum_CPC_22343 Cladosporium_allicinum_CPC_22349 Cladosporium_allicinum_CPC_22358 Cladosporium_allicinum_CPC_22377 'Cladosporium allicinum DTO 005-E8' 'Cladosporium allicinum DTO 084-F3' 'Cladosporium allicinum DTO 086-D5' 'Cladosporium allicinum DTO 089-B9' 'Cladosporium allicinum DTO 089-G4' 'Cladosporium allicinum DTO 089-G6' 'Cladosporium allicinum DTO 089-H3' 'Cladosporium allicinum DTO 090-D3' 'Cladosporium allicinum DTO 090-H4' 'Cladosporium allicinum DTO 101-A1' 'Cladosporium allicinum DTO 101-I8' 'Cladosporium allicinum DTO 106-C2' 'Cladosporium allicinum DTO 108-F9' 'Cladosporium allicinum DTO 109-E5' 'Cladosporium allicinum DTO 109-E6' 'Cladosporium allicinum DTO 109-F3' 'Cladosporium allicinum DTO 109-F5' 'Cladosporium allicinum DTO 109-I3' 'Cladosporium allicinum DTO 109-I5' 'Cladosporium allicinum DTO 110-B7' 'Cladosporium allicinum DTO 111-A5' 'Cladosporium allicinum DTO 127-E4' 'Cladosporium allicinum DTO 147-I6' 'Cladosporium allicinum DTO 323-C3' 'Cladosporium allicinum DTO 323-E1' 'Cladosporium allicinum DTO 323-G5' Cladosporium_allii_CBS_101.81 Cladosporium_angustiherbarum_CBS_140479 Cladosporium_antarcticum_CBS_690.92 Cladosporium_arthropodii_CBS_124043 Cladosporium_basiinflatum_CBS_822.84 Cladosporium_echinulatum_CBS_123191 Cladosporium_floccosum_CBS_140463 Cladosporium_floccosum_CPC_15522 Cladosporium_floccosum_CPC_17802 Cladosporium_floccosum_CPC_22260 Cladosporium_floccosum_CPC_22309 Cladosporium_floccosum_CPC_22354 Cladosporium_floccosum_CPC_22399 Cladosporium_floccosum_CPC_22968 'Cladosporium floccosum DTO 323-H6' Cladosporium_herbaroides_CBS_121626 Cladosporium_herbarum_CBS_111.82 Cladosporium_herbarum_CBS_121621 Cladosporium_herbarum_CBS_300.49 Cladosporium_herbarum_CPC_11600 Cladosporium_herbarum_CPC_11601 Cladosporium_herbarum_CPC_11602 Cladosporium_herbarum_CPC_11603 Cladosporium_herbarum_CPC_11604 Cladosporium_herbarum_CPC_12178 Cladosporium_herbarum_CPC_12179 Cladosporium_herbarum_CPC_12180 Cladosporium_herbarum_CPC_12181 Cladosporium_herbarum_CPC_12183 Cladosporium_iridis_CBS_107.20 Cladosporium_iridis_CBS_138.40 Cladosporium_limoniforme_CBS_113737 Cladosporium_limoniforme_CBS_140484 Cladosporium_limoniforme_CGMCC_3.18037 Cladosporium_limoniforme_CGMCC_3.18038 Cladosporium_limoniforme_CPC_12048 Cladosporium_limoniforme_CPC_12049 Cladosporium_limoniforme_CPC_12050 Cladosporium_limoniforme_CPC_13923 Cladosporium_limoniforme_CPC_18086 Cladosporium_limoniforme_CPC_22350 Cladosporium_limoniforme_CPC_22384 Cladosporium_limoniforme_CPC_22394 Cladosporium_limoniforme_CPC_22395 'Cladosporium limoniforme DTO 082-F2' 'Cladosporium limoniforme DTO 090-H8' 'Cladosporium limoniforme DTO 305-G4' Cladosporium_macrocarpum_CBS_121623 Cladosporium_macrocarpum_CBS_121811 Cladosporium_macrocarpum_CBS_175.82 Cladosporium_macrocarpum_CBS_223.31 Cladosporium_macrocarpum_CBS_299.67 Cladosporium_macrocarpum_CPC_11817 Cladosporium_macrocarpum_CPC_12054 Cladosporium_macrocarpum_CPC_12756 Cladosporium_macrocarpum_CPC_12757 Cladosporium_macrocarpum_CPC_12758 Cladosporium_macrocarpum_CPC_12759 Cladosporium_macrocarpum_CPC_14305 Cladosporium_ossifragi_CBS_842.91 Cladosporium_ossifragi_CBS_843.91 Cladosporium_paralimoniforme_CGMCC_3.18103 Cladosporium_paralimoniforme_CGMCC_3.18104 Cladosporium_parasubtilissimum_CPC_22332 Cladosporium_parasubtilissimum_CPC_22396 Cladosporium_phlei_CBS_358.69 Cladosporium_prolongatum_CGMCC_3.18035 Cladosporium_prolongatum_CGMCC_3.18036 Cladosporium_pseudiridis_CBS_116463 Cladosporium_puyae_CBS_274.80A Cladosporium_ramotenellum_ATCC_36970 Cladosporium_ramotenellum_ATCC_36972 Cladosporium_ramotenellum_CBS_109031 Cladosporium_ramotenellum_CBS_109501 Cladosporium_ramotenellum_CBS_121628 Cladosporium_ramotenellum_CBS_169.54 Cladosporium_ramotenellum_CBS_170.54 Cladosporium_ramotenellum_CBS_261.80 Cladosporium_ramotenellum_CPC_11395 Cladosporium_ramotenellum_CPC_11401 Cladosporium_ramotenellum_CPC_11826 Cladosporium_ramotenellum_CPC_11832 Cladosporium_ramotenellum_CPC_12047 Cladosporium_ramotenellum_CPC_12126 Cladosporium_ramotenellum_CPC_12313 Cladosporium_ramotenellum_CPC_12385 Cladosporium_ramotenellum_CPC_13407 Cladosporium_ramotenellum_CPC_13789 Cladosporium_ramotenellum_CPC_13792 Cladosporium_ramotenellum_CPC_13795 Cladosporium_ramotenellum_CPC_13798 Cladosporium_ramotenellum_CPC_13801 Cladosporium_ramotenellum_CPC_13943 Cladosporium_ramotenellum_CPC_14300 Cladosporium_ramotenellum_CPC_14306 Cladosporium_ramotenellum_CPC_18224 Cladosporium_ramotenellum_CPC_19119 Cladosporium_ramotenellum_CPC_22370 'Cladosporium ramotenellum DTO 084-F5' 'Cladosporium ramotenellum DTO 089-C1' 'Cladosporium ramotenellum DTO 097-H3' 'Cladosporium ramotenellum DTO 109-F4' 'Cladosporium ramotenellum DTO 150-F5' 'Cladosporium ramotenellum DTO 151-G3' 'Cladosporium ramotenellum DTO 151-G6' 'Cladosporium ramotenellum DTO 152-B3' 'Cladosporium ramotenellum DTO 152-D9' 'Cladosporium ramotenellum DTO 305-H1' 'Cladosporium ramotenellum DTO 305-I1' 'Cladosporium ramotenellum DTO 306-A3' 'Cladosporium ramotenellum DTO 306-B2' 'Cladosporium ramotenellum DTO 306-C4' 'Cladosporium ramotenellum DTO 306-D1' 'Cladosporium ramotenellum DTO 306-D2' 'Cladosporium ramotenellum DTO 306-E7' 'Cladosporium ramotenellum DTO 306-F5' 'Cladosporium ramotenellum DTO 307-F2' 'Cladosporium ramotenellum DTO 307-I2' 'Cladosporium ramotenellum DTO 323-B7' 'Cladosporium ramotenellum DTO 323-D4' 'Cladosporium ramotenellum DTO 323-D5' 'Cladosporium ramotenellum DTO 323-D6' Cladosporium_rhusicola_CBS_140492 'Cladosporium sinense DTO 324-D2' Cladosporium_sinuosum_ATCC_11285 Cladosporium_sinuosum_CBS_121629 Cladosporium_sinuosum_CBS_393.68 Cladosporium_sinuosum_CPC_14000 Cladosporium_sinuosum_CPC_15454 Cladosporium_sinuosum_CPC_17632 Cladosporium_sinuosum_CPC_18365 'Cladosporium sinuosum DTO 109-I2' Cladosporium_soldanellae_CBS_132186 Cladosporium_sp._CPC_12485 Cladosporium_spinulosum_CBS_119907 'Cladosporium spinulosum EXF-382' Cladosporium_subcinereum_CBS_140465 Cladosporium_subinflatum_CBS_121630 Cladosporium_subinflatum_CPC_22303 Cladosporium_subinflatum_CPC_22400 Cladosporium_subtilissimum_CBS_113753 Cladosporium_subtilissimum_CBS_113754 Cladosporium_subtilissimum_CPC_12044 Cladosporium_tenellum_CBS_121634 Cladosporium_tenellum_CPC_11813 Cladosporium_tenellum_CPC_12051 Cladosporium_tenellum_CPC_22290 Cladosporium_tenellum_CPC_22291 Cladosporium_tenellum_CPC_22410 'Cladosporium tenellum DTO 127-D7' Cladosporium_tuberosum_CBS_140693 Cladosporium_tuberosum_FMR_13332 Cladosporium_variabile_CBS_121635 Cladosporium_variabile_CBS_121636 Cladosporium_verruculosum_CGMCC_3.18099 Cladosporium_verruculosum_CGMCC_3.18100 Cladosporium_versiforme_CBS_140491 Cladosporium_wyomingense_CPC_22310 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=412; TAXLABELS Cercospora_beticola_CBS_116456 Cladosporium_acalyphae_CBS_125982 Cladosporium_alboflavescens_CBS_140690 Cladosporium_angulosum_CBS_140692 Cladosporium_angulosum_CPC_11526 Cladosporium_angulosum_CPC_14566 Cladosporium_angulosum_CPC_22271 Cladosporium_angustisporum_CBS_125983 Cladosporium_angustisporum_CPC_22345 Cladosporium_angustisporum_CPC_22371 'Cladosporium angustisporum DTO 127-E6' Cladosporium_angustiterminale_CBS_140480 Cladosporium_anthropophilum_CBS_117483 Cladosporium_anthropophilum_CBS_122130 Cladosporium_anthropophilum_CBS_132.29 Cladosporium_anthropophilum_CBS_140685 Cladosporium_anthropophilum_CBS_674.82 Cladosporium_anthropophilum_CPC_10142 Cladosporium_anthropophilum_CPC_11119 Cladosporium_anthropophilum_CPC_11122 Cladosporium_anthropophilum_CPC_11123 Cladosporium_anthropophilum_CPC_11131 Cladosporium_anthropophilum_CPC_11406 Cladosporium_anthropophilum_CPC_12852 Cladosporium_anthropophilum_CPC_13235 Cladosporium_anthropophilum_CPC_13734 Cladosporium_anthropophilum_CPC_14009 Cladosporium_anthropophilum_CPC_14356 Cladosporium_anthropophilum_CPC_14705 Cladosporium_anthropophilum_CPC_15038 Cladosporium_anthropophilum_CPC_22272 Cladosporium_anthropophilum_CPC_22315 Cladosporium_anthropophilum_CPC_22393 'Cladosporium anthropophilum DTO 127-E9' 'Cladosporium anthropophilum DTO 317-I7' 'Cladosporium anthropophilum DTO 318-E3' 'Cladosporium anthropophilum DTO 323-C2' 'Cladosporium anthropophilum DTO 323-C6' 'Cladosporium anthropophilum DTO 323-C7' 'Cladosporium anthropophilum DTO 323-D2' 'Cladosporium anthropophilum DTO 323-D8' 'Cladosporium anthropophilum DTO 323-D9' 'Cladosporium anthropophilum DTO 324-C4' 'Cladosporium anthropophilum DTO 324-D3' 'Cladosporium anthropophilum UTHSC DI-13-207' 'Cladosporium anthropophilum UTHSC DI-13-226' Cladosporium_asperulatum_CBS_126339 Cladosporium_asperulatum_CBS_126340 Cladosporium_asperulatum_CPC_22364 Cladosporium_australiense_CBS_125984 Cladosporium_austroafricanum_CBS_140481 Cladosporium_cf._pseudocladosporioides_CPC_22285 Cladosporium_cf._tenuissimum_CBS_117.79 Cladosporium_cf._tenuissimum_CBS_262.80 Cladosporium_cf._tenuissimum_CPC_11612 Cladosporium_cf._tenuissimum_CPC_12223 Cladosporium_cf._tenuissimum_CPC_14410 'Cladosporium cf. tenuissimum DTO 109-C4' Cladosporium_chalastosporoides_CBS_125985 Cladosporium_chubutense_CBS_124457 Cladosporium_cladosporioides_CBS_101367 Cladosporium_cladosporioides_CBS_112388 Cladosporium_cladosporioides_CBS_113738 Cladosporium_cladosporioides_CBS_113739 Cladosporium_cladosporioides_CBS_113740 Cladosporium_cladosporioides_CBS_143.35 Cladosporium_cladosporioides_CBS_144.35 Cladosporium_cladosporioides_CBS_145.35 Cladosporium_cladosporioides_CPC_11120 Cladosporium_cladosporioides_CPC_11121 Cladosporium_cladosporioides_CPC_11161 Cladosporium_cladosporioides_CPC_11393 Cladosporium_cladosporioides_CPC_11398 Cladosporium_cladosporioides_CPC_11404 Cladosporium_cladosporioides_CPC_12187 Cladosporium_cladosporioides_CPC_12214 Cladosporium_cladosporioides_CPC_12760 Cladosporium_cladosporioides_CPC_12762 Cladosporium_cladosporioides_CPC_12763 Cladosporium_cladosporioides_CPC_12764 Cladosporium_cladosporioides_CPC_13667 Cladosporium_cladosporioides_CPC_13669 Cladosporium_cladosporioides_CPC_14015 Cladosporium_cladosporioides_CPC_14017 Cladosporium_cladosporioides_CPC_14018 Cladosporium_cladosporioides_CPC_14019 Cladosporium_cladosporioides_CPC_14021 Cladosporium_cladosporioides_CPC_14024 Cladosporium_cladosporioides_CPC_14244 Cladosporium_cladosporioides_CPC_14271 Cladosporium_cladosporioides_CPC_14292 Cladosporium_cladosporioides_CPC_14293 Cladosporium_cladosporioides_CPC_14355 Cladosporium_cladosporioides_CPC_15167 Cladosporium_cladosporioides_CPC_18230 Cladosporium_cladosporioides_CPC_22264 Cladosporium_cladosporioides_CPC_22265 Cladosporium_cladosporioides_CPC_22347 Cladosporium_cladosporioides_CPC_22348 Cladosporium_cladosporioides_CPC_22365 Cladosporium_cladosporioides_CPC_22367 Cladosporium_cladosporioides_CPC_22380 'Cladosporium cladosporioides DTO 082-F1' 'Cladosporium cladosporioides DTO 090-C6' 'Cladosporium cladosporioides DTO 101-G2' 'Cladosporium cladosporioides DTO 101-H7' 'Cladosporium cladosporioides DTO 102-A4' 'Cladosporium cladosporioides DTO 109-I4' 'Cladosporium cladosporioides DTO 109-I6' 'Cladosporium cladosporioides DTO 127-D8' 'Cladosporium cladosporioides DTO 147-A9' Cladosporium_colocasiae_CBS_115191 Cladosporium_colocasiae_CBS_119542 Cladosporium_colocasiae_CBS_386.64 Cladosporium_colocasiae_CPC_5124 Cladosporium_colombiae_CBS_274.80B Cladosporium_crousii_CBS_140686 Cladosporium_cucumerinum_CBS_158.51 Cladosporium_cucumerinum_CBS_171.52 Cladosporium_cucumerinum_CBS_172.54 Cladosporium_delicatulum_CBS_126342 Cladosporium_delicatulum_CBS_126343 Cladosporium_delicatulum_CBS_126344 Cladosporium_delicatulum_CPC_14285 Cladosporium_delicatulum_CPC_14286 Cladosporium_delicatulum_CPC_14287 Cladosporium_delicatulum_CPC_14289 Cladosporium_delicatulum_CPC_14299 Cladosporium_delicatulum_CPC_14360 Cladosporium_delicatulum_CPC_14363 Cladosporium_delicatulum_CPC_14372 'Cladosporium delicatulum DTO 082-F3' 'Cladosporium delicatulum DTO 090-F4' 'Cladosporium delicatulum DTO 134-D3' 'Cladosporium delicatulum DTO 134-D4' 'Cladosporium delicatulum DTO 134-D5' 'Cladosporium delicatulum DTO 134-D6' 'Cladosporium delicatulum DTO 134-D7' 'Cladosporium delicatulum DTO 134-D8' 'Cladosporium delicatulum DTO 145-C4' 'Cladosporium delicatulum DTO 167-H5' 'Cladosporium delicatulum DTO 168-F8' 'Cladosporium delicatulum DTO 305-H7' 'Cladosporium delicatulum DTO 305-I9' Cladosporium_europaeum_CBS_116744 Cladosporium_europaeum_CBS_125.80 Cladosporium_europaeum_CPC_13220 Cladosporium_europaeum_CPC_14238 Cladosporium_europaeum_CPC_14296 'Cladosporium europaeum DTO 056-H7' 'Cladosporium europaeum DTO 072-E4' 'Cladosporium europaeum DTO 086-B3' 'Cladosporium europaeum DTO 109-E7' 'Cladosporium europaeum DTO 151-H5' Cladosporium_exasperatum_CBS_125986 Cladosporium_exile_CBS_125987 Cladosporium_flabelliforme_CBS_126345 Cladosporium_flavovirens_CBS_140462 Cladosporium_funiculosum_CBS_122128 Cladosporium_funiculosum_CBS_122129 Cladosporium_funiculosum_CPC_22247 Cladosporium_funiculosum_CPC_22282 Cladosporium_funiculosum_CPC_22298 Cladosporium_funiculosum_CPC_22391 'Cladosporium funiculosum DTO 127-E7' Cladosporium_gamsianum_CBS_125989 Cladosporium_globisporum_CBS_812.96 Cladosporium_globisporum_CPC_19124 Cladosporium_grevilleae_CBS_114271 Cladosporium_hillianum_CBS_125988 Cladosporium_hillianum_CPC_15458 Cladosporium_inversicolor_CBS_401.80 Cladosporium_inversicolor_CBS_484.80 Cladosporium_inversicolor_CPC_11818 Cladosporium_inversicolor_CPC_14190 Cladosporium_inversicolor_CPC_14191 Cladosporium_inversicolor_CPC_14241 Cladosporium_inversicolor_CPC_14368 Cladosporium_inversicolor_CPC_19108 Cladosporium_inversicolor_CPC_22287 Cladosporium_inversicolor_CPC_22289 Cladosporium_inversicolor_CPC_22300 Cladosporium_inversicolor_CPC_22385 'Cladosporium inversicolor DTO 072-C9' 'Cladosporium inversicolor DTO 108-F8' 'Cladosporium inversicolor DTO 109-E9' Cladosporium_ipereniae_CBS_140483 Cladosporium_ipereniae_CPC_16855 Cladosporium_iranicum_CBS_126346 Cladosporium_licheniphilum_CBS_125990 Cladosporium_longicatenatum_CBS_140485 Cladosporium_lycoperdinum_CBS_126347 Cladosporium_lycoperdinum_CBS_126348 Cladosporium_lycoperdinum_CBS_274.80C Cladosporium_lycoperdinum_CBS_574.78C Cladosporium_lycoperdinum_CPC_22256 Cladosporium_montecillanum_CBS_140486 Cladosporium_montecillanum_CPC_15605 Cladosporium_montecillanum_CPC_17804 Cladosporium_myrtacearum_CBS_126349 Cladosporium_myrtacearum_CBS_126350 Cladosporium_needhamense_CPC_22353 'Cladosporium neerlandicum DTO 086-C5' Cladosporium_neopsychrotolerans_CGMCC_3.18031 Cladosporium_neopsychrotolerans_CGMCC_3.18032 Cladosporium_oxysporum_CBS_125991 Cladosporium_oxysporum_CBS_126351 Cladosporium_paracladosporioides_CBS_171.54 Cladosporium_parapenidielloides_CBS_140487 Cladosporium_perangustum_CBS_125996 Cladosporium_perangustum_CPC_11663 Cladosporium_perangustum_CPC_11815 Cladosporium_perangustum_CPC_11819 Cladosporium_perangustum_CPC_11820 Cladosporium_perangustum_CPC_11821 Cladosporium_perangustum_CPC_11831 Cladosporium_perangustum_CPC_12216 Cladosporium_perangustum_CPC_13727 Cladosporium_perangustum_CPC_13730 Cladosporium_perangustum_CPC_13774 Cladosporium_perangustum_CPC_13870 Cladosporium_perangustum_CPC_14247 Cladosporium_perangustum_CPC_15192 Cladosporium_perangustum_CPC_22297 Cladosporium_perangustum_CPC_22327 Cladosporium_perangustum_CPC_22328 Cladosporium_perangustum_CPC_22329 Cladosporium_perangustum_CPC_22331 Cladosporium_perangustum_CPC_22375 Cladosporium_perangustum_CPC_22378 'Cladosporium perangustum DTO 127-E1' 'Cladosporium perangustum DTO 127-E2' 'Cladosporium perangustum DTO 323-E4' 'Cladosporium perangustum DTO 323-E8' 'Cladosporium perangustum DTO 323-E9' 'Cladosporium perangustum DTO 324-A2' 'Cladosporium perangustum DTO 324-A6' 'Cladosporium perangustum DTO 324-D1' Cladosporium_phaenocomae_CBS_128769 Cladosporium_phyllactiniicola_CBS_126352 Cladosporium_phyllactiniicola_CBS_126353 Cladosporium_phyllophilum_CBS_125992 Cladosporium_phyllophilum_CPC_13873 'Cladosporium pini-ponderosae CBS 124456' Cladosporium_pseudochalastosporoides_CBS_140490 Cladosporium_pseudocladosporioides_CBS_117134 Cladosporium_pseudocladosporioides_CBS_117153 Cladosporium_pseudocladosporioides_CBS_125993 Cladosporium_pseudocladosporioides_CBS_149.66 Cladosporium_pseudocladosporioides_CBS_176.82 Cladosporium_pseudocladosporioides_CBS_574.78A Cladosporium_pseudocladosporioides_CBS_667.80 Cladosporium_pseudocladosporioides_CBS_673.69 Cladosporium_pseudocladosporioides_CPC_11605 Cladosporium_pseudocladosporioides_CPC_12850 Cladosporium_pseudocladosporioides_CPC_13488 Cladosporium_pseudocladosporioides_CPC_13992 Cladosporium_pseudocladosporioides_CPC_13998 Cladosporium_pseudocladosporioides_CPC_14001 Cladosporium_pseudocladosporioides_CPC_14010 Cladosporium_pseudocladosporioides_CPC_14013 Cladosporium_pseudocladosporioides_CPC_14020 Cladosporium_pseudocladosporioides_CPC_14193 Cladosporium_pseudocladosporioides_CPC_22237 Cladosporium_pseudocladosporioides_CPC_22283 Cladosporium_pseudocladosporioides_CPC_22284 Cladosporium_pseudocladosporioides_CPC_22292 Cladosporium_pseudocladosporioides_CPC_22311 Cladosporium_pseudocladosporioides_CPC_22334 Cladosporium_pseudocladosporioides_CPC_22338 Cladosporium_pseudocladosporioides_CPC_22340 Cladosporium_pseudocladosporioides_CPC_22341 Cladosporium_pseudocladosporioides_CPC_22351 Cladosporium_pseudocladosporioides_CPC_22356 Cladosporium_pseudocladosporioides_CPC_22362 Cladosporium_pseudocladosporioides_CPC_22368 Cladosporium_pseudocladosporioides_CPC_22369 Cladosporium_pseudocladosporioides_CPC_22382 Cladosporium_pseudocladosporioides_CPC_22386 Cladosporium_pseudocladosporioides_CPC_22389 Cladosporium_pseudocladosporioides_CPC_22392 Cladosporium_pseudocladosporioides_CPC_22966 'Cladosporium pseudocladosporioides DTO 079-F4' 'Cladosporium pseudocladosporioides DTO 084-F1' 'Cladosporium pseudocladosporioides DTO 121-H1' 'Cladosporium pseudocladosporioides DTO 150-A7' 'Cladosporium pseudocladosporioides DTO 150-C1' 'Cladosporium pseudocladosporioides DTO 150-C7' 'Cladosporium pseudocladosporioides DTO 150-D1' 'Cladosporium pseudocladosporioides DTO 151-A4' 'Cladosporium pseudocladosporioides DTO 151-A8' 'Cladosporium pseudocladosporioides DTO 151-B7' 'Cladosporium pseudocladosporioides DTO 151-D1' 'Cladosporium pseudocladosporioides DTO 151-E7' 'Cladosporium pseudocladosporioides DTO 151-G7' 'Cladosporium pseudocladosporioides DTO 152-A5' 'Cladosporium pseudocladosporioides DTO 152-A6' 'Cladosporium pseudocladosporioides DTO 152-D6' 'Cladosporium pseudocladosporioides DTO 152-H5' 'Cladosporium pseudocladosporioides DTO 152-H6' 'Cladosporium pseudocladosporioides DTO 152-H7' 'Cladosporium pseudocladosporioides DTO 307-F3' 'Cladosporium pseudocladosporioides DTO 307-G9' 'Cladosporium pseudocladosporioides DTO 308-A2' 'Cladosporium pseudocladosporioides DTO 323-D3' Cladosporium_rectoides_CBS_125994 Cladosporium_rectoides_CBS_126357 Cladosporium_rugulovarians_CBS_140495 Cladosporium_scabrellum_CBS_126358 Cladosporium_silenes_CBS_109082 Cladosporium_sinuatum_CGMCC_3.18096 Cladosporium_sinuatum_CGMCC_3.18097 Cladosporium_sinuatum_CGMCC_3.18098 Cladosporium_subuliforme_CBS_126500 'Cladosporium subuliforme DTO 130-H8' 'Cladosporium subuliforme DTO 323-D1' 'Cladosporium subuliforme DTO 324-B8' 'Cladosporium subuliforme DTO 324-C7' Cladosporium_tenuissimum_CBS_125995 Cladosporium_tenuissimum_CBS_126359 Cladosporium_tenuissimum_CPC_10538 Cladosporium_tenuissimum_CPC_10882 Cladosporium_tenuissimum_CPC_12795 Cladosporium_tenuissimum_CPC_22398 'Cladosporium tenuissimum DTO 323-C5' 'Cladosporium tenuissimum DTO 323-C9' 'Cladosporium tenuissimum DTO 323-G2' 'Cladosporium tenuissimum DTO 323-G3' 'Cladosporium tenuissimum DTO 323-G8' 'Cladosporium tenuissimum DTO 323-I6' 'Cladosporium tenuissimum DTO 324-C3' 'Cladosporium tenuissimum DTO 324-C5' 'Cladosporium tenuissimum DTO 324-C6' 'Cladosporium tenuissimum DTO 324-C9' Cladosporium_tenuissimum_lineage_1_CPC_11521 Cladosporium_tenuissimum_lineage_1_CPC_11929 Cladosporium_tenuissimum_lineage_1_CPC_13252 Cladosporium_tenuissimum_lineage_1_CPC_13732 Cladosporium_tenuissimum_lineage_1_CPC_14196 Cladosporium_tenuissimum_lineage_1_CPC_14311 Cladosporium_tenuissimum_lineage_1_CPC_14370 Cladosporium_tenuissimum_lineage_1_CPC_22277 Cladosporium_tenuissimum_lineage_1_CPC_22320 Cladosporium_tenuissimum_lineage_1_CPC_22344 Cladosporium_tenuissimum_lineage_1_CPC_22383 'Cladosporium tenuissimum lineage 1 DTO 109-A1' 'Cladosporium tenuissimum lineage 1 DTO 109-C7' 'Cladosporium tenuissimum lineage 1 DTO 131-A4' 'Cladosporium tenuissimum lineage 1 DTO 323-G4' 'Cladosporium tenuissimum lineage 1 DTO 323-I4' 'Cladosporium tenuissimum lineage 1 DTO 323-I8' 'Cladosporium tenuissimum lineage 1 DTO 323-I9' 'Cladosporium tenuissimum lineage 1 DTO 324-A1' 'Cladosporium tenuissimum lineage 1 DTO 324-A3' 'Cladosporium tenuissimum lineage 1 DTO 324-C2' Cladosporium_tianshanense_CGMCC_3.18033 Cladosporium_tianshanense_CGMCC_3.18034 Cladosporium_uredinicola_ATCC_46649 Cladosporium_uwebraunianum_CBS_139572 'Cladosporium uwebraunianum DTO 072-D8' 'Cladosporium uwebraunianum DTO 082-E3' 'Cladosporium uwebraunianum DTO 090-D2' 'Cladosporium uwebraunianum DTO 109-E8' 'Cladosporium uwebraunianum DTO 305-H9' Cladosporium_varians_CBS_126360 Cladosporium_varians_CBS_126361 Cladosporium_varians_CBS_126362 Cladosporium_verrucocladosporioides_CBS_126363 Cladosporium_vicinum_CBS_306.84 Cladosporium_vicinum_CPC_11664 Cladosporium_vicinum_CPC_13867 Cladosporium_vicinum_CPC_15457 Cladosporium_vicinum_CPC_22316 'Cladosporium vicinum DTO 305-H5' Cladosporium_vignae_CBS_121.25 Cladosporium_westerdijkiae_CBS_113746 Cladosporium_westerdijkiae_CPC_10150 Cladosporium_westerdijkiae_CPC_13362 Cladosporium_westerdijkiae_CPC_13978 Cladosporium_westerdijkiae_CPC_14284 'Cladosporium westerdijkiae DTO 084-F2' 'Cladosporium westerdijkiae DTO 109-F2' 'Cladosporium westerdijkiae DTO 152-A9' 'Cladosporium westerdijkiae DTO 152-H9' Cladosporium_xanthochromaticum_CBS_126364 Cladosporium_xanthochromaticum_CBS_140691 Cladosporium_xanthochromaticum_CBS_167.54 Cladosporium_xanthochromaticum_CPC_11046 Cladosporium_xanthochromaticum_CPC_11133 Cladosporium_xanthochromaticum_CPC_11609 Cladosporium_xanthochromaticum_CPC_11806 Cladosporium_xanthochromaticum_CPC_11856 Cladosporium_xanthochromaticum_CPC_12792 Cladosporium_xanthochromaticum_CPC_12793 Cladosporium_xanthochromaticum_CPC_14004 Cladosporium_xanthochromaticum_CPC_14008 Cladosporium_xanthochromaticum_CPC_14256 Cladosporium_xanthochromaticum_CPC_14911 Cladosporium_xanthochromaticum_CPC_22239 Cladosporium_xanthochromaticum_CPC_22321 'Cladosporium xanthochromaticum DTO 108-G8' 'Cladosporium xanthochromaticum DTO 317-I2' 'Cladosporium xanthochromaticum DTO 323-E2' 'Cladosporium xanthochromaticum DTO 323-E3' 'Cladosporium xanthochromaticum DTO 323-E5' 'Cladosporium xanthochromaticum DTO 323-E6' 'Cladosporium xanthochromaticum DTO 323-E7' Cladosporium_xantochromaticum_CGMCC_3.18101 Cladosporium_xantochromaticum_CGMCC_3.18102 Cladosporium_xylophilum_CBS_113749 Cladosporium_xylophilum_CBS_113756 Cladosporium_xylophilum_CBS_125997 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=127; TAXLABELS Cercospora_beticola_AY840527.2 Cladosporium_acalyphae_HM147994.1 Cladosporium_aciculare_KT600411.1 'Cladosporium aerium DTO 323-B4' Cladosporium_aggregatocicatricatum_KT600448.1 Cladosporium_alboflavescens_LN834420 Cladosporium_allicinum_EF679350.1 Cladosporium_allii__JN906977.1 Cladosporium_angulosum_LN834425 Cladosporium_angustiherbarum_KT600378.1 Cladosporium_angustisporum_HM147995.1 Cladosporium_angustiterminale_KT600379.1 Cladosporium_antarcticum_EF679334.2 Cladosporium_anthropophilum_LN834437.1 Cladosporium_aphidis_JN906978.1 Cladosporium_arthropodii_JN906979.1 Cladosporium_asperulatum_HM147998.1 Cladosporium_australiense_HM147999.1 Cladosporium_austroafricanum_KT600381.1 Cladosporium_austrohemisphaericum_KT600382.1 Cladosporium_basiinflatum_HM148000.1 Cladosporium_chalastosporioides_HM148001.1 Cladosporium_chasmanthicola_KY646221.1 Cladosporium_chubutense_FJ936158.1 Cladosporium_cladosporioides_HM148003.1 Cladosporium_colocasiae_HM148067.1 Cladosporium_colombiae_FJ936159.1 Cladosporium_coloradense_CPC_22238 Cladosporium_crousii_LN834431.1 Cladosporium_cucumerinum_HM148072.1 Cladosporium_cycadicola_KJ869122.1 Cladosporium_delicatulum_HM148081.1 Cladosporium_domesticum_CPC_22307 Cladosporium_dominicanum_DQ780353.1 Cladosporium_echinulatum_JN906980.1 Cladosporium_europaeum_HM148056.1 Cladosporium_exasperatum_HM148090.1 Cladosporium_exile_HM148091.1 Cladosporium_flabelliforme_HM148092.1 Cladosporium_flavovirens_LN834440.1 Cladosporium_floccosum_LN834416.1 Cladosporium_funiculosum_HM148094.1 Cladosporium_fusiforme_DQ780388.1 Cladosporium_gamsianum_HM148095.1 Cladosporium_globisporum_HM148096.1 Cladosporium_grevilleae_JF770450.1 Cladosporium_halotolerans_DQ780364.1 Cladosporium_herbaroides_EF679357.1 Cladosporium_herbarum_EF679363.1 Cladosporium_hillianum_HM148097.1 Cladosporium_inversicolor_HM148101.1 Cladosporium_ipereniae_KT600394.1 Cladosporium_iranicum_HM148110.1 Cladosporium_iridis_EF679370.1 Cladosporium_kenpeggii_KY646222.1 Cladosporium_langeronii_DQ780379.1 Cladosporium_licheniphilum_HM148111.1 Cladosporium_limoniforme_KT600397.1 Cladosporium_longicatenatum_KT600403.1 Cladosporium_longissimum_DQ780352.2 Cladosporium_lycoperdinum_HM148115.1 Cladosporium_macrocarpum_EF679375.1 Cladosporium_montecillanum_KT600406.1 Cladosporium_myrtacearum_HM148117.1 Cladosporium_needhamense_CPC_22353 Cladosporium_neerlandicum_KP701887.1 Cladosporium_neolangeronii_CBS_797.97 Cladosporium_neopsychrotolerans_KX938383.1 Cladosporium_ossifragi_EF679381.2 Cladosporium_oxysporum_HM148118.1 Cladosporium_paracladosporioides_HM148120.1 Cladosporium_parahalotolerans_KP701955.1 Cladosporium_paralimoniforme_KX938392.1 Cladosporium_parapenidielloides_KT600410.1 Cladosporium_parasubtilissimum_CPC_22332 Cladosporium_penidielloides_KT600412.1 Cladosporium_perangustum_HM148121.1 Cladosporium_phaenocomae_JF499837.1 Cladosporium_phlei_JN906981.1 Cladosporium_phyllactiniicola_HM148153.1 Cladosporium_phyllophilum_HM148154.1 'Cladosporium pini-ponderosae FJ936160.1' Cladosporium_prolongatum_KX938394.1 Cladosporium_pseudiridis_EF679383.1 Cladosporium_pseudochalastosporoides_KT600415.1 Cladosporium_pseudocladosporioides_HM148158.1 Cladosporium_psychrotolerans_DQ780386.1 'Cladosporium pulvericola DTO 305-H8' Cladosporium_puyae_KT600418.1 Cladosporium_ramotenellum_EF679384.1 Cladosporium_rectoides_HM148193.1 Cladosporium_rhusicola_KT600440.1 Cladosporium_ruguloflabelliforme_KT600458.1 Cladosporium_rugulovarians_KT600459.1 Cladosporium_salinae_DQ780374.1 Cladosporium_scabrellum_HM148195.1 Cladosporium_silenes_EF679354.1 'Cladosporium sinense DTO 324-D2' Cladosporium_sinuatum_KX938385.1 Cladosporium_sinuosum_F679386.1 'Cladosporium sloanii DTO 130-D5' Cladosporium_soldanellae_JN906982.1 Cladosporium_sphaerospermum_DQ780343.1 Cladosporium_spinulosum_EF679388.1 Cladosporium_subcinereum_LN834433.1 Cladosporium_subinflatum_F679389.1 Cladosporium_subtilissimum_EF679397.1 Cladosporium_subuliforme_HM148196.1_ Cladosporium_succulentum_LN834434.1 Cladosporium_tenellum_EF679401.1 Cladosporium_tenuissimum_HM148197.1 Cladosporium_tianshanense_KX938381.1 Cladosporium_tuberosum_LN834417.1 Cladosporium_uredinicola_AY251071.2 'Cladosporium uwebraunianum DTO 072-D8' Cladosporium_variabile_EF679403.1 Cladosporium_varians_HM148224.1 Cladosporium_velox_CBS_119417 Cladosporium_verrucocladosporioides_HM148226.1 Cladosporium_verruculosum_KX938388.1 Cladosporium_versiforme_KT600417.1 Cladosporium_vicinum_CPC_22316 Cladosporium_welwitschiicola_KY646223.1 Cladosporium_westerdijkiae_HM148061.1 Cladosporium_wyomingense_CPC_22310 Cladosporium_xantochromaticum_LN834415.1 Cladosporium_xylophilum_HM148230.1 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M48762] TITLE Fig_1_Cladosporioides_complex_combined_ACT_and_TEF_alignment; LINK TAXA = Taxa3; DIMENSIONS NCHAR=2127; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Cercospora_beticola_CBS_116456 ---------------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGC-CA-CAATCAGA-----CGCAAAAGCTGGCAGGAAGGAGGAGCTGACATT-GGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCG----------ATCCGCCAT----CTCCGCCGCTGCAAATT----CCTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----CGAGAAGTTCGAGAAGGTGAGCAACTGCCAG--CACACAAATGCA-----TT-TTGTCGCACAAATTTTCGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTC--CAAAACTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGC----T--TGCGATGACTTC-----ATC---CGCTATGACTCCTCGCCCAC--------------------------------------------------------------------------------CGCTCAACGCATTG-GGCATACCGCCAG-CACACCACACATCTGCACGACCACACTTCGCATCAAGAATAGACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_acalyphae_CBS_125982 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTACGCA-CT--CCCCCTCTCCCGCG----TCTATT-CCCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCTCA-TGCCA-----CA-ATATCGCGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------TAACACTCAAACCG-AACCCATCACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTTTTTGCCCTGCCGCA--------------------------------------CCTGCCTTGAGTGTTATGGAATTCTTCGGA------------------------------------------------------------------------------------------------------------------------------------------ACCACAAGGGCACCAATACCCACGT---CGACGCCGTCAAGAACGGAGGCCCTATCGAGAAGACGCTGTCTTCCTCCTACCTTCGGAAGAAAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_alboflavescens_CBS_140690 ---------------------------------------------------GAG-CGTTTT-CGTAAGTTCTGAAGA-CACCCGTTT----CACCCACTTCTG----AACTCCAGGCTGACAGT-ACCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCAATT-------CTGTCCAAA----CCCTTTTTCCGCCCTCAA---ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CCTCACTCC--AGCACGATCTCT-----CT-CCGTCGCCTTGTT-------------------TATCCCTTTGCCCCGC--CACCGC---------GCG----CCCTGCC--------CTC-GTCGCAATCT---GCGATAAGAGTCGAGGGA----CGCCCTGGCTTGGCACGGACTTGCAC------------------------------------------------------------------------------CGACG------AAGACAGCATCGC-CACAT-----------------CATAACACCAGCAG-AGCACTTCACTGACAA----CCCTCATAGGAAGCCGCCGAACTCGGTAAGGG-TCCTTCAAGTA------------------A----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angulosum_CBS_140692 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCGAGCTTGG----AACATCCAGCTGACAGA-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TTTCGCAA-----TTCCGCCCTCGGATCAAA---ATGTCT-ACAGCCGCGCAGTATCATGATCGGTACGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAG-AAGTCGAGAAGGTAAG-CCTAACCAT--CAGGCGAAGGTG-----TCCTCTTTGCAGTG------------------TTTTGCCCCTCCG-CCCGC--CACC-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGGCTTGGCCGGGCACGGACTTCAC-----------------------------------------------------------------------------TGCACTGCATTG-AAGACATCATTGC-CACAC-----------------AACATCACCATCAC-AACACATTACTAACTA----CAACTACAGGAAGCCGCCGAACTCGGTAAGGG-TCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_angulosum_CPC_11526 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCGAGCTTGG----AACATCCAGCTGACAGA-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TTTCGTAAC----CTCCGCCCTCGGGGTCAAA--ATGTCTAACAGCCGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTAAG-CCTAACCAT--CAGGCGAAGGTG-----TCCTCTTTGCAGTG------------------TTTTGCCCCTCCG-CCCGC--CACC-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGGCTTGGCCGGGCACGGACTTCAC-----------------------------------------------------------------------------TGCACTGCATTG-AAGACATCATTGC-CACAC-----------------AACATCACCATCAC-AACACATTACTAACTA----CAACTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCACCTCACCCCCGCA--------------------------------------CCTGCCTTGGATGTCCTGGAACC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGAAGGAAGCAAAGCGCGACGCTGCTATCGCCAACAAGGAATTTTACTGCGACGCTTGCGCAAAGCCCTCCGGAGATCAGACTGCCCTTA--GCAGGCATAACAAGTAAAAGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angulosum_CPC_14566 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGATAGA-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CG----CC-TTCCGCAAA----CTCCGCCCTCGGGTTCCA---ACGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------AGAAGTTCGAGAAGGTAAG-CCTCACCAT--CAGGCGAAGGTG-----TCCTCTTTGCAGTG------------------TTTTACCCCTCCG-CCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---ACGATAAGAT--GTGGGACC--TGGCTTGGTCGGGCACGGACTTCAC-----------------------------------------------------------------------------TGCACCG----G-AAGACACCATCGC-CACAC-----------------ATCATCAACATCAC-AATGCATTGCTAACAA----TCACTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCACCTCACCCCCGCA--------------------------------------CCTGCCTTGGATGTCCTGGAACCT---GGACGACATGGGTCTT---------------------------------------------------------------------------------------------------------------------CCTGGACGACCACAAGACCTCCAAGGCCCACGC---CGACGTTGTCGAGAACGGTGGCCCTGTCGAGAAGATGGTGTCTGCCTTCTACCTTCGGAAGAAAGCAAAGCGCGACGCTGCTATCGCCAACAAGGAATTTTACTGCGACGCTTGCGCAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACAACAAGCAAAAGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angulosum_CPC_22271 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCGAGCTTGG----AACATCCAGCTGACAGA-CGCTTAGCTTCCATTGTCGGTCGCCCCCGTCACCATGGGTATGCA-CT----CC-TTCCGCAAA----CTCCGCCCTCGCGGTCAC---ATGTCTAACCCCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CCTGATCAT--TAGGTCAAGGTG-----TCCTCTTTGCAGTG------------------TTCTACCCCTCTG-CCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACG--CGGCTTGGCCGGGCACGGACTTCAC-----------------------------------------------------------------------------TGCTTTG------AAGACA--GTTAC-CACAC-----------------AACATGACCATCAC-AACACATTACTGACTA----CGACTCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGACGCTGCTATCGCCAGCAAGGAACTTTACTGCGACGCTTGCGCAAAGCCCTTCAGAGATCCGATTGCGCTTA--ACAGACACAACAACCAAAGGCATACACGCTAACCTATTCACCTACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angustisporum_CBS_125983 --------------------AAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCAG----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCTATCGCGCGCTGCC-AGATCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATAACTCG--GGCATAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CAACCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT-TTGCGATAAGGAT-GTGGGC----CGTCTTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------GCACGACA-------AGACAGCATTGC-CACTC---------------ATCACCAC-CTCGCGA-AACCCATTGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angustisporum_CPC_22345 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCAG----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCTATCGCGCGCAGCC-AGATCTAATTCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATAACTCG--GGCATGATGCCA-----CC-TTGTCGCGATGG-----------------CA-GATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT-TTGCGATAAGGAT-GTGGGC----CGCCTTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------GCACGACA-------AGACAGCATTGC-CACTC---------------ATCACCAC-CTCGCGA-AACCCATTGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angustisporum_CPC_22371 TCGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----TT-CCCTGCGAT----CCCCTCTATCGCGCGCGGCC-AATCCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATAACTCG--GGCATGATGCCA-----CC-TTGTCGCGATGG-----------------CA-GATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT-TTGCGATAAGGAT-GTGGGC----CGCCTTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------GCACGACA-------AGACAGCATTGC-CACTC---------------ATCACCAC-CTCGCGA-AACCCATTGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium angustisporum DTO 127-E6' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCAG----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCTATCGCGCGCTGCC-AGATCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT-TTGCGATAAGGAT-GTGGGC----CGCCTTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------GCACGACA-------AGACAGCATTGC-CACTC---------------ATCACCAC-CTCGCGA-AACCCATTGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_angustiterminale_CBS_140480 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCACGAGCTGATACCCATACTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCTCTCTCCCGCG----TCCATT-CTCGCGCACACTCAATATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------AGAAGTTCGAGAAGGTGAG-CACCGCTCC--GGCACCATGCTA-----TC-TCTTCGCGATGT-----------------TT-CATCCCTCTGCCCCGC--CACG-----------TCA----CCCCAC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CACCCTGGCTTGGCATGAATGTGC{AC}CCAC------------------------------------------------------------------------CCACGAG--------AGATGGCATCGC-CACAC-----------------CCCAGCGCTTGTCG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CBS_117483 --------------------AAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTCCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCAACGC-CACTC---------------A-ATACGC-CTCGCTG-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTG--ACAGACACAACAAGCAGAAGCACATCAGCTAACCT---CACTCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CBS_122130 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGTTG-AGCACACCACTGACAA----TCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACTATC-GATATCGCCC-TCTGGAAGTTCGAAACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CBS_132.29 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CBS_140685 -----------------TGCAAGGCCGGGTTCCATGGTGACGATGCGCCCAGAGCGGTTTTCGGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTCCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTACAATTCGGGCACCGTACGGAAC----------------------------------------------------------------------------------------TCTACCAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAG-TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCAACGC-CACTC---------------A-ATACGC-CTCGCTG-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGTAAGGG-GCCTTCAAGTA-------------------AGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CBS_674.82 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_10142 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-TTACGC-CTCACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_11119 ----------------GGGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-TTACGC-CTCACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_11122 ----------------GTGCAAGGCCGGTTTCCCTGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_11123 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_anthropophilum_CPC_11131 ------------------------------TCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTTGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGTACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATTGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_anthropophilum_CPC_11406 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGT???????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-TTACGC-CTCACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_12852 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCGTCTCGC----AATCCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTATTAT-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_13235 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----TC-CTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACG-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTGCCTTCTTACCCTGCCGC--------------------------------------ACCTGCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACGCTTGCAAAAAGCCCTTCGGAGATTAGACTGCCCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCATCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_13734 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAATGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------------AAGGTGAG-CATCACTCG--GGCACAATGCTG-----TC-TTGTTACGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTACCTTCTTACCCTGCCAC--------------------------------------ACCTGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTATTGCGACGCTTGCAAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_anthropophilum_CPC_14009 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGT???????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCTG-----TC-TTGTTACGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGCTACCTTCTTACCCTGCCAC--------------------------------------ACCTGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTATTGCGACGGTTGCAAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_14356 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTTCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----TC-CTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACG-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTGCCTTCTTACCCTGCCGC--------------------------------------ACCTGCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACGCTTGCAAAAAGCCCTTCGGAGATTAGACTGCCCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCATCGTGATTTCATCAAGAACATGATGACTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_14705 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCGTCTCGC----AATCCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTATTAT-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_15038 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCGTCTCGC----AATCCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCGTCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCGTTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTATCAT-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_anthropophilum_CPC_22272 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTCCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCAACGC-CACTC---------------A-ATACGC-CTCGCTG-AGCACATCACTGACGA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTG--ACAGACACAACAAGCAGAAGCACATCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_anthropophilum_CPC_22315 ------------------------CCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCAAG----CCACCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGCTG-----TC-TTGTTACGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAACTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTACCTTCTTACCCTGCCAC--------------------------------------ACCTGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTATTGCGACGCTTGCAAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_anthropophilum_CPC_22393 --------------------AAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGACGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 127-E9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-ATAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAT----CCCCTCTATCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATTGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACACA---------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CATCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACATCATTGC-CACTC---------------A-ACCCAC-CTCACAA-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 317-I7' ---------------------------GTTTCGCTGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------GTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 318-E3' ---------------------------GTTTCGCTGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium anthropophilum DTO 323-C2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGTTG-AGCACACCACTGACAA----TCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACTATC-GATATCGCCC-TCTGGAAGTTCGAAACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 323-C6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTTCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACAATGCTG-----TC-TTGTTACGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTACCTTCTTACCCTGCCAC--------------------------------------ACCTGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTATTGCGACGCTTGCAAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 323-C7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 323-D2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 323-D8' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTTCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACAATGCTG-----TC-TTGTTACGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTACCTTCTTACCCTGCCAC--------------------------------------ACCTGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCACAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTATTGCGACGCTTGCAAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGGCAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium anthropophilum DTO 323-D9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-TTACGC-CTCACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 324-C4' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CTTCCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGTTG-AGCACACCACTGACAA----TCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACTATC-GATATCGCCC-TCTGGAAGTTCGAAACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum DTO 324-D3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGCC----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-TTACGC-CTCACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium anthropophilum UTHSC DI-13-207' --------------------------------------------------------GTTTTCCGTA-GT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CGTCGAGAAGTT-GAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGGCCTGGCTTGGCATGGAGATGCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATCGC-CACTC---------------A-ATACGC-CTCGCAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGTAAGGGC-CCTTCAAGTACGACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium anthropophilum UTHSC DI-13-226' ---------------TGTGCAAGGCCGGTTTCCACGGTGACGATGCGCCCAGAGAGGTTTTTGGTAAGT-CCAAAGA-CACCTGTTT----CGCCCATCTCGC----AATCCCAAGCTGACACTCTTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCCATCGCGCACAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAAATTTTGCCCGCCGTACCAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????TCATCGAGAAGT-CGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----TC-CTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCATGGAGGCGTC----------------------------------------------------------------------------TCGCGACG-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCACAG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGTAAGGGT-CCTTCAAGTAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_asperulatum_CBS_126339 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTGCCTA----AATTCCGAGCTGACACC-ATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-TC----CTCCTCACCTCG----CCCGTT-TCCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTC--GGCACCATGTCA-----TC-TCTTCGCGATGT-----------------TT-CATCTCTCTGCCCCGC--CACG-----------TCA----CCCCAC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CACCCTGGCTTGGCATGGATGTGCA----------------------------------------------------------------------------CCACGAG--------AGAAGGCATCGC-CACAC-----------------AACAGCGCTCGTCG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTACG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACT----CCAGACACGATCAGCAGAAGCATTCTCGCTAACCTATTTACCCACCACAGGTACAACGTCACTGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_asperulatum_CBS_126340 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTGCCAG----AATTCCGAGCTGACACC-ATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-TC----CTCCTCACCTCG----CCCGTT-TCCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTC--GGCACCATGTCA-----TC-TCTTCGCGATGT-----------------TT-CATCCCTCTGCCCCGC--CACG-----------TCA----CCCCAC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CACCCTGGCTTGGCATGGATGTGCA----------------------------------------------------------------------------CCACGAG--------AGAAGGCATCGC-CACAC-----------------AACAGCGCTCGTCG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACT----CCAGACACGATCAGCAGAAGCATTCTCGCTAACCTATTCACCCACCACAGGTACAACGTCACTGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_asperulatum_CPC_22364 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTGCCAG----AATTCCGAGCTGACACC-ATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-TC----CTCCTCACCTCG----CCCGTT-TCCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????????????ACG-----------TCA----CCCCAC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CACCCTGGCTTGGCATGGATGTGCA----------------------------------------------------------------------------CCACGAG--------AGAAGGCATCGC-CACAC-----------------AACAGCGCTCGTCG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACT----CCAGACACGATCAGCAGAAGCATTCTCGCTAACCTATTCACCCACCACAGGTACAACGTCACTGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_australiense_CBS_125984 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACATGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACGCCCATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCGTTC-ATTTCTAACTCCGGCGCAGTATCATGATCGGAATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----TC-TCATCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACACACA----------------------------------------------------------------------------TCGCGACG-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACGCGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_austroafricanum_CBS_140481 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCGC----ATTTCACAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCT-CTTCCCACG----CCCAACCCTCCCGCTCAGTC-GTGTCTAACCCGGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACCA-ACTA-----TC-TTGTCGCGATGA-----------------CT-TGTCCCTCCGCCCCGC--CACC-----------ACA----CCCCAC---------CTT-GACGCAAATT-TCGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACTTGCA----------------------------------------------------------------------------TTGCGACG-------AGACAGCATTGC-CAGCC-----------------CACAGTATACACCG-AACACATTACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCGGAGCGTGAGCGCGGTATCACCATT-GACATTGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGCCTC--ACAGACACAACAAGCAGAAGCACACTCGCTAATCC--------ACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cf._pseudocladosporioides_CPC_22285 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCCGTCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGACGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----GAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACTAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cf._tenuissimum_CBS_117.79 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGCCC-------AGACAGCATTGC-CACTC---------------A-AAACAA-TTTACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGC--A--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cf._tenuissimum_CBS_262.80 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCCGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACC-------AGGCAGCACTGC-CACTC---------------A-AAACAA-CTTACAG-AGCACATCACTGACAA----CCATAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAATACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACGACAAGCAAATGCATACTCGCTAACCTATCCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cf._tenuissimum_CPC_11612 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CACCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AACTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGTGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACC-------AGACAGCATTGC-CACTC---------------A-AAACAA-GTTACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cf._tenuissimum_CPC_12223 --------------------------------------------GCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGTGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACC-------AGACAGCATTGC-CACTC---------------A-AAACAA-GTTACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cf._tenuissimum_CPC_14410 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGTGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACC-------AGACAGCATTGC-CACTC---------------A-AAACAA-GTTACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cf. tenuissimum DTO 109-C4' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGTGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACC-------AGACAGCATTGC-CACTC---------------A-AAACAA-GTTACAG-AGCACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_chalastosporoides_CBS_125985 --------------TTGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTCCAC-TATACATGGTAG----GGTTCCGAGCTGACAGT-ATCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-TT-------CCTCCTCAG----CACCATTCTCGCGCTCA----ATGTCTAACATGAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGGG-CATTCCCCG--AGCATATTGCTG-----CT-TTGTCGCGATGT-----------------TT-CCTCTCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGA---------TGGCTTGGCACTGGCTGGCA----------------------------------------------------------------------------TCGCAACA-------AAACAGCATCGC-CAC-------------------CATATCACGTCCAG-AACGCCTTACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_chubutense_CBS_124457 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTGCCAG----AACTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCTCTCTCCCACG----CCCATT-GGCGCGCTCATCC-ATGTCTAACTCGAACGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACCA-ACTA-----TC-TTGTCGCGATGA-----------------CT-TGTCCCTTCGCCCCGC--CACC-----------ACA----CCCCAC---------CTT-GACGCAAATT-TCGCGATAAGGAT-GTGGGA----CG-CCTGGCTTGGCACGGACTTGCA----------------------------------------------------------------------------TTGCGACG-------AGACAGCAATGC-CACTT-----------------CACAGCATCCACGG-AATACATTACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATTGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGCCTC--ACAGACACGACAAGCAGAAGCACACTCGCTAACCC--------ACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_101367 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_112388 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AATAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CBS_113738 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_113739 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTGACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_113740 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_143.35 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CBS_144.35 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CBS_145.35 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_11120 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------GAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGA--CGACAAGCAGAAGCACACCAGCTAATCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_11121 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------AGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_11161 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGTTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CCTCCCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTT-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_11393 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTT-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_11398 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTT-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_11404 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_12187 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CGCT-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_12214 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_12760 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CTCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_12762 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_12763 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAG----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_12764 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_13667 --------------TTGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_13669 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14015 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_14017 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAG????????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14018 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14019 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTGAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-GTTTCTAACCCCTCCACAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCTCTCTGCCCCGC--CACT-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCAACAG-AACGGTTAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14021 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTT--GGCACACTGTCG-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCATCAGAAACAGATAATTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTCA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cladosporioides_CPC_14024 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTT--GGCACACTGTCG-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCATCAGAAACAGATAATTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTCA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14244 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGATACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14271 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTT--GGCACACTGTCG-----CC-TTGTTGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACG-------AGGCAGCATTGC-CACAC---------------A-AACCATACCATCAGAAACAGATAATTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTCA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14292 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14293 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_14355 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_15167 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTGACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_18230 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTA--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGA--CGACAAGCAGAAGCACACCAGCTAATCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCTAAGGACGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTACCAGGAGATCATCAAGGAGACCTCCGGTTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACCCTTCTCGAGGCCATTGACGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTG Cladosporium_cladosporioides_CPC_22264 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCCGCGAG----CCTCTTTATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAT----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCCCAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22265 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------------GAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATTCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGA--TGACAAGCAGAAGCACACCAGCTAATCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22347 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGATACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------------GAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22348 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTCTCGC----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCGGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22365 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------TGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATTCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAGCTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGA--TGACAAGCAGAAGCACACCAGCTAATCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22367 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATCGTCA-----CC-TTGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTA--ACAGA--CGACAAGCAGAAGCACACCAGCTAATCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CPC_22380 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 082-F1' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGATACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 090-C6' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 101-G2' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAC-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 101-H7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTG--GGCACATTGTCA-----CC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 102-A4' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAA----TCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 109-I4' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAG----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 109-I6' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CGCCTGTTT----CGCCCATCCCAG----AATCCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCA-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACGTCTA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CAA-----------------A-AATCATACCATCAG-AACAGATAACTGACAG----TCACCATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 127-D8' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGACACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium cladosporioides DTO 147-A9' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCTCGC----AATTCCGAGCTGATACTCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTC-------------------------------------------------------------------------------CACGACA-------AGGCAACATTGC-CACAC---------------A-AATCATGCCAATAG-AACAGATAACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_colocasiae_CBS_115191 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCCGTTTCGCCCGCCCGCCCATG----AATCCCGAGCTGACTCCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCTTCCTTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCAATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACTA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CATCT---------------A-AAATCA-CCCGCAG-AGCACAACACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCCT--ACAGACACAACAAGCAAATGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_colocasiae_CBS_119542 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCCGTTTCGCCCGCCCGCCCATG----AATCCCGAGCTGACTCCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCTTCCTTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCAATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACTA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CATCT---------------A-AAATCA-CCCGCAG-AGCACAACACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCCT--ACAGACACAACAAGCAAATGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_colocasiae_CBS_386.64 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCCGTTTCGCCCGCCCGCCCATG----AATCCCGAGCTGACTCCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCTTCCTTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CTCCACTCG--GGCACACTGCCA-----TC-TTGTCGCAATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACTA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CATCT---------------A-AAATCA-CCCGCAG-AGCACAACACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCCT--ACAGACACAACAAGCAAATGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_colocasiae_CPC_5124 ---------------TGTGCAAGGCCGGTTTTGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCCGTTTCGCCCGCCCGCCCATG----AATCCCGAGCTGACTCCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCTTCCTTCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CACCACTCG--GGCACACTGCCA-----TC-TTGTCGCAATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACTA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CATCT---------------A-AAATCA-CCCGCAG-AGCACAACACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCCT--ACAGACACAACAAGCAAATGCATACTTGCTAACCTGTTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_colombiae_CBS_274.80B ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTGCCAG----AACTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCTCTCTCCCACG----CCCATT-GGCGCGCTCATCC-ATGTCTAACTCGAACGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACCA-ACTA-----TC-TTGTCGCGATGA-----------------CT-TGTCCCTTCGCCCCGC--CACC-----------ACA----CCCCAC---------CTT-GACGCAAATT-TCGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCAAGGACTTGCA----------------------------------------------------------------------------TCGCGATG-------AGACAGCAATGC-CACTT-----------------CACAGCATCCACGG-AATACATTACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATTGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGCCTC--ACAGACACAACAAGCAGAAGCACACTCGCTAACCC--------ACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_crousii_CBS_140686 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGCTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCACAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCAAAGATT---------------------------------------------------------------------------TTGCCTCTCGAGGGA----CAGACAACACGCCACCCACT--------------------GC-TACCATGCAACACATCACTGACAA-----CATGACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cucumerinum_CBS_158.51 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----GATTCCGAGCTGACACCAATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCTGCGAA----CCCCTCTATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCG-----CC-TCGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTTCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACCC---------------T-CCACCA-CACGCTG-GACAGATTACTGACAA----TTACTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cucumerinum_CBS_171.52 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----GATTCCGAGCTGACACCAATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCTGCGAA----CCCCTCTATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCG-----CC-TCGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTTCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACCC---------------T-CCACCA-CACGCTG-GACAGATTACTGACAA----TTACTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_cucumerinum_CBS_172.54 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----GATTCCGAGCTGACACCAATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CC-CCCTGCGAA----CCCCTCTATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCG-----CC-TCGTCGCGATGG-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGTTCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACCC---------------T-CCACCA-CACGCTG-GACAGATTACTGACAA----TTACTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_delicatulum_CBS_126342 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_delicatulum_CBS_126343 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATGAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_delicatulum_CBS_126344 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14285 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14286 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATGAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14287 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14289 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14299 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATGAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14360 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14363 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_delicatulum_CPC_14372 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 082-F3' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 090-F4' ----------------------------TTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium delicatulum DTO 134-D3' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 134-D4' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 134-D5' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 134-D6' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 134-D7' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 134-D8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 145-C4' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 167-H5' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 168-F8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 305-H7' ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCTCGCG----CCCATT-TCCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????TCATCGAGAAAGTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTAACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium delicatulum DTO 305-I9' --------------ATGTGCAAGG-CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATACCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAAGTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCGAACCG-AACTCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGCTTA--ACAGACACGACAAGCAGAAGCACACTGGCTAACCC---CATCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_europaeum_CBS_116744 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAACCCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_europaeum_CBS_125.80 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_europaeum_CPC_13220 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_europaeum_CPC_14238 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_europaeum_CPC_14296 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium europaeum DTO 056-H7' --------------------------GGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAACCCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium europaeum DTO 072-E4' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium europaeum DTO 086-B3' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAACCCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium europaeum DTO 109-E7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAACCCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium europaeum DTO 151-H5' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----T--TTGTTGTGATGC-----------------CT-CATCCCACTGCCCCGC--CACG-----------ACA----CCCCGCC-------TCTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CAC-T-----------------CAA-CCTCAAACCG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAAGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_exasperatum_CBS_125986 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGGACA-CACCTGTTT----CGCCCACCGCAG----AACCCCGAGCTGACAGC-AATCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT------CTCTCCCACG----CCCATT-CTCGCGCAGA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCT--GGCATGGTGCTA-----TC-TGTCCGCGATGA-----------------AT-CATCCCTCTGCCCCGC--CACG-----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGA----CACCCTGGCTTGGCACGGAC-------------------------------------------------------------------------------AACATCAAGG-------ACATGGCATCGC-CACAC-----------------AATAACGCCTGCAG-AATACATCGCTAACAA----TCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGATGCCCCCGGTCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_exile_CBS_125987 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTC----CACCCCGCCTGAG---AACCGCGAGCTGACAGC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----AA-TCCCACA------CCCATTTGCCGCGCTCAA---ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CACCACTCC--AACACAATCCGT-----CC-TCGTCGCAGTGT-----------------TT-CATCCCTCTGCCCCGC--CACC-----------ACG----CCCCGCT--------CTC-GTCGCAATCT-CTGCGATAAGACT-GTGGGA----CGCCCTGGCTTGGCATGGACATGCAC------------------------------------------------------------------------------CGACG------AGGACCGGGTTGC-CACAC-----------------AAT-ACCCTCATCG-AACACCTCACTGACAA----CCCCCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCCCTGCCGCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGGACTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAACAGAAACACACTAGCTAACGT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_flabelliforme_CBS_126345 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCTGATCTGAC---CACGCAGAGCTGACATTCATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT---CCATTTCCCC-------GCTCACTATCGAGCCCAAT--GTGTCTAACCGCGATGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CCTCACTTG--GGCACACAACCAT----CTTTCGTCGCAATGT-----------------TTTTGCCCCTCTGCCCCGC--CACG-----------TCA----CCCCGC---------TTC-GTCGCAATTT---GCGATAAGAT--GTGGGA----TGCCCTGGCTTGGCACGGACACGCAT--------------------------------------------------------------------------CGACAGAGA----------CGGC-TTGC-CACACA----------------ACATGCACCCAGCG-AACACTTCACTGACTC----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACACGCAAAAGTATACTCGCTAACATATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_flavovirens_CBS_140462 -------------------------------------------------------CGTTTT-CGT-AGT-CTGACGA-CACCTGTCT----CACCCGAGCTACCACAACGCATAGACTGACAACCATCACAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-CTGAA-CCCCTTGCGC---TTCCGCTCTCGAGCCCGTT--ATGTCTAACCGCAAAACAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTAAG-ACTCACTCCCAGGCATATCGTCGT----CGCTTGTTGCAGCGT-----------------TTTTGCTCTGTTGCCCCGC--CACG-----------CCA----CCCCAC---------TTC-GTCGCAATTT---ACGATAAGAT--GTGGGA----CGCCCTGGCTTGGCACAGACAAAGAC-------------------------------------------------------------------------ACCCCAGAGA----------CGGC-TTGC-CACAC-----------------AACGTCACCTCACG-AACATGCCGCTGACTC----CTGCCATAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTA------------------A----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_funiculosum_CBS_122128 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCCGTCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_funiculosum_CBS_122129 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCCGTCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_funiculosum_CPC_22247 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCCGTCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGACGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_funiculosum_CPC_22282 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------GAGAAGGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_funiculosum_CPC_22298 -----------GGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------GGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_funiculosum_CPC_22391 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCCGTCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGACGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CAACACTTC--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACG----------------------------------------------------------------------------TCGCGATA-------CCACAGCATTGC-CACTC---------------A-TACCAT-CTCTTCG-AGCACATTACTAACAA----TCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium funiculosum DTO 127-E7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCATAGA-CACCTGTTT----CGCCCGCGCCGG----AATCCCGAGCTGACACCCTTTCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCC???????????????????????????????????????????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGATA-------CGACAGCATTGC-CACTC---------------A-TACCAC-CTCTCCG-AGCACAT{CT}ACT{AG}ACA{AG}----{CT}CGCAA{CT}AGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGT{CT}CTCGACAAGCTGAAGTCCGAGCGTGAGCG{CT}GGTATCACCATCTGATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACG{GT}{CT}AC{CT}GTCAT{CT}GACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_gamsianum_CBS_125989 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-TCCTGCGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCACAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGA-----------------CT-TGTTCCTTTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGATAACCA----------------------------------------------------------------------------TCGCGACA-------AGCCAGCATTGC-CACTC---------------A-AAACGC---CTCTG-AACACATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_globisporum_CBS_812.96 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CACCCACCGCAAA---ACCCCCAAGCTGACAGC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-------CCTTCCGAG----GCCTTT-TTCCCGCTCA----ATGTCTAATCGCACCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CCTTACTCT--GGCACAATTTGC-----CT-CCGTCGCGATGC-----------------TT-CATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGTGGGA----CGCACTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CCATG------CAGACGGCATTGC-CACCC-------------------CAACACCAACAG-AACACATCACTGACAA----CCATTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_globisporum_CPC_19124 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CACCCACCGCAAA---ACCCCCAAGCTGACAGC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-------CCTTCCGAG----GCCTTT-TTCCCGCTCA----ATGTCTAATCGCACCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAGAGCAAGCGTGGTATCCTCACCCTGAGGTACCCCATTGAGCACGGTGTTGTCACCAACTGGGACGACATGGAGAAGATTTGG{CG}ACC{AC}CACCTTCTACAACGAGCTCCGTGTCGCTCCTGAGGAGCACCCCGTCCTCCTCACTGAGGCTCCCATCAACCCCAAGAGCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCTGCCTTCTACGTCTCCATCCAGGCCGTCCTCTCTCTATACGCCTCCGGTCGTACCACCGG------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CCTTACTCT--GGCACAATTTGC-----CT-CCGTCGCGATGC-----------------TT-CATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGTGGGA----CGCACTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CCATG------CAGACGGCATTGC-CACCC-------------------CAACACCAACAG-AACACATCACTGAC{AC}A----CCATTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_grevilleae_CBS_114271 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTCTTCCGTAAGT-CTGAAGAACACCTGTCT----CACGCATAACGG----GAACCCCAGCTGACAGC-ATCCCAGCTTCCATTGTCGGTAGACCCCGTCACCATGGGTAGGCA-CT-------CCTTCCAC-----TCCCATCCTCGCCCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-AATCCCCCC--AATACAATATG---------TCGCCGCAATGTG-------------------TTAGGCTTTGCCCGGT--CATC-----------CCA----CCCCGC---------CTC-GTCGCAATCT-GCGCGATAAGCATGGTGGG-----CTTTCTGGCTTGGCATGGGCATCCAA-------------------------------------------------------------------------------------------------------CATACCG----------------------ACAACTG-AATACATTACTGACAA----TCATCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_hillianum_CBS_125988 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TGATAGA-CACCTGTTCCAA-TATACATGGTAG----GGCTCCGAGCTGACAGT-ATCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-TT-------CCTCCTCAG----CACCATTCTCGCGCTCA----ACGTCTAACATGAGCGTAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTAGGTTATCCCTCG--AGCATAATGCTG-----CC-TTGTCGTGATGT-----------------TTTTCTCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGA---------TGGCTTGGCATGGACTGACA----------------------------------------------------------------------------TCGCAACA-------AGGCAGCTTCGC-CAC-------------------CATATCATATCCAG-AACGCCTGACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_hillianum_CPC_15458 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TGATAGA-CACCTGTTCCAA-TATACATGGTAG----GGCTCCGAGCTGACAGT-ATCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-TT-------CCTCCTCAG----CACCATTCTCGCGCTCA----ACGTCTAACATGAGCGTAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAGGTTATCCCTCG--AGCATAATGCTG-----CC-TTGTCGTGATGT-----------------TTTTCTCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGA---------TGGCTTGGCATGGACTGACA----------------------------------------------------------------------------TCGCAACA-------AGGCAGCTTCGC-CAC-------------------CATATCATATCCAG-AACGCCTGACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CBS_401.80 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CBS_484.80 --------------------AAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_11818 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TTATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCTAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAATCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_14190 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_14191 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTCTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CATCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_14241 --------------------------------------------GCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_14368 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTCTGCCCTGCCGCACCTGCTTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_19108 --------------------------------------------------------?????????????????????????????????????????TGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAGAGCAAGCGTGGTATCCTCACCCTGAGGTACCCCATCGAGCACGGTGTTGTCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTCCGTGTCGCTCCCGAGGAGCACCCCGTCCTCCTCACCGAGGCTCCCATCAACCCCAAGAGCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCGGCCTTCTACGTCTCCATCCAGGCCGTCCTCTCCCTCTACGCTTCCGGTCGTACCACCGGTATCGTCCTCGACTCCGGTGACGGTGTCACTCACGTTGTCCCCATCTACGAGGGTTTCGCCCTTCCCCACG-------------------------?????-------------CGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TAATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTCTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_inversicolor_CPC_22287 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_22289 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cladosporium_inversicolor_CPC_22300 --------------------------GGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TTATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCTAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAATCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_inversicolor_CPC_22385 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CATCACTTT--GGCACATTGCCA-----CC-TTATCGCGATGC-----------------CT-CGTCCCTCTACCCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTGTTTTTTGCTTTC--------------------CCTTTTTGCCCTGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTCCTTCCTTGGTCCAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium inversicolor DTO 072-C9' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium inversicolor DTO 108-F8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium inversicolor DTO 109-E9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCCC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCCCCTCTGCCGCGC---CCCATT-CTCGCGCGCACTCGATATCTAACTCCGGCGCAGTATCATGATCGGCATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACC-----------ACA----CCCCGC---------CTA-GTCGCAAATT--TGCGATATGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAAAACTCACACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_ipereniae_CBS_140483 --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCCGCCT----CATCCTCTCCAG----AACTCTGAGCTGACAGC-ATCTTAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA----------TTCTCCTAA----CCCCGT-CTCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CCTCACTCC--GACACAATCTGC-----TC-TCGTCGCAATGTG---------------GTT-TATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACTCGTGGGA----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATG------AAGACAGCATTGC-CACCT-------------------CAACACAAGCAG-AACATATCACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_ipereniae_CPC_16855 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCCGTCT----CATCCTCTCCAG----ACCTCTGAGCTGACAGC-ATCTTAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA----------TTCTCCTAA----CCCCGT-CTTGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CCTCACTCC--GACACAATCTGC-----TC-TCGTCGCAATGTG---------------GTT-TATACCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACTCGTGGGA----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATG------AAGACAGCATTGC-CACCC-------------------TAACACAAGCAG-AACATATCACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_iranicum_CBS_126346 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCCGCTTCTG----AACTCCAAGCTGACAGC-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT-------CTTTCCAAG----CCCTTTCCTGGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTCACTCC--AGTATGAGCTGC-----CT-TCGTCGCAGTG------------------TT-CATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGAGTTGTGGGA----CGCCCTGGCTTGGCACGGACATACAC------------------------------------------------------------------------------CGATG------AAGATAGCATCGC-CACAC-----------------CCCGATACCAGCCG-AACACATCACTGACAA----CCCTCGTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_licheniphilum_CBS_125990 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCC-CTCCAG----AACTCTGAGCTGACAGC-ATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA----------TTCTCCCAA----TCCCGT-TTCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CCTCACTCT--GACACAATCTGC-----TC-TCATCGCAATGTG---------------TTT-TATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGAGGGG----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATG------AAGACAGCATTGC-CACTC-------------------CAACACCAGCTG-AACACATCATTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_longicatenatum_CBS_140485 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCACACCAG----AAACACGAGCTGACAAC-AATCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC------CTCTCCCACG----CCCAAT-CTCGCGCAAA----ATGTCTAACCGCAGCACAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????C--GGCACGATGTTGTCT-CTC-TCTCCGCGGTGTT-------------------CATCCCTCTGCCCCGC--CACGACGCACG----ACG----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGAC-----------------------------------------------------------------------------AACATTGCGAAG--------ACTCGCATCGC-CACAC-----------------AACACAACTCCAAG-GACTCATTACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_lycoperdinum_CBS_126347 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TTCCCCCCCTCTCCAGCG----CCTATT-CTCGCGCGCACTCAATGTCTAACTTCGGCGCAGTATCATGATCGGTATGGGCCAGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACAATGTCA-----CC-TCGTCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGTGCA----------------------------------------------------------------------------ACGCGACA-------AGATGGCATCGC-CAC-C-----------------CAACACTGAAACCG-AACACATGACTGACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_lycoperdinum_CBS_126348 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATTCCGAGCTGACACCCCTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-CCCCCCTCTCCAGCG----CCTGTT-CTCGCGCGCACTCAATGTCTAACTTCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTTG--GGCACAATGTCT-----CC-TCGTCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGTGCA----------------------------------------------------------------------------ACGCGACA-------AGATGGCATCGC-CAC-C-----------------CAACACTGAAACCG-AACACATGACTGACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_lycoperdinum_CBS_274.80C ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-CCCCCCTTTCCAGCG----CCTATT-CTCGCGCGCACTCAATGTCTAACTTCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTTAG-CATCACTCG--AGCACAATGTCA-----CT-TCGTCGCGATGC-----------------TT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCAC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGTGCA----------------------------------------------------------------------------ACGCGACA-------AGATGACATCGC-CAC-------------------CGACACTGAAACCG-AACACATCACTGACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_lycoperdinum_CBS_574.78C ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCAGCGCCAG----AATTCCGAGCTGACACCCCTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-CCCCCCTCTCCAGCG----CCTGTT-CTCGCGCGCACTCAATGTCTAACTTCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTG--GGCACAATGTCT-----CC-TCGTCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGTGCA----------------------------------------------------------------------------ACGCGACA-------AGATGGCATCGC-CAC-C-----------------CAACACTGAAACCG-AACACATGACTGACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_lycoperdinum_CPC_22256 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-CCCCCCTCTCCAGCG----CCTATT-CTCGCGCGCACTCAATGTCTAACTTCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGACGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTG--GGCACAATGTCA-----CC-TCGTCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGTGCA----------------------------------------------------------------------------ACGCGACA-------AGATGGCATCGC-CAC-C-----------------CAACACTGAAACCG-AACACATGACTGACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_montecillanum_CBS_140486 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCCTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC--CCCCCTCTCCCGCG----TCCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCTCATTGCCA-----CG-ACATCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCAAACCG-AACCCATTACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTTTTTGCCCCGCCGCACCCCCCTTGGGTGTTAGTGTCCTTTTTTCCCCGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTTCTTACTTGGGCTGGCTCCCATGATGAAGAAGTACAACCGGCTGGCTCCATCCTCTGGAATGCTTCCTCTCCGTCGTCCCGAGTCAGCTGCCCTCACCGCTATTTTACGTCGCAATATGGCTTGGACGAGCACATGGGCCCCAAGGCCCACGTCGACGACGCCGCCAAGAACGG-GGCCCCGTTGAGAAGACGCTGTCTTCCTCCCATCTTCGGAAGAAAGCACAGCGCGCGGCTGCCATCGTCAACAAGGACTTCTACTGCGACGCTTGCGAAAAGCCCTTTGGAGATCAAACTGCGCTTA--ACAGACACGAAAAGCAGAAGCACACTAGCTAACCT---CTCCCACCCCAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_montecillanum_CPC_15605 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCCTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC--CCCCCTCTCCCGCG----TCCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCTCATTGCCA-----CG-ACATCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCAAACCG-AACCCATTACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTTTTTGCCCCGCCGCA-CCCCCTTGGGTGTTAGTGTCCTTTTTTCCCCGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTTCTTACTTGGGCTGGCTCCCATGATGAAGAAGTACAACCGGCTGGCTCCATCCTCTGGAATGCTTCCTCTCTGTCGTCCCGAGTCAGCTGCCCTCACCGCTATTTTACGTCGCAATATGGCTTGGACGAGCACATGGGCCCCAAGGCCCACGTCGACGACGCCGCCAAGAACGG-GGCCCCGTTGAGAAGACGCTGTCTTCCTCCCATCTTCGGAAGAAAGCACAGCGCGCGGCTGCCATCGTCAACAAGGACTTCTACTGCGACGCTCGCGAAAAGCCCTTTGGAGATCAAACTGCGCTTA--ACAGACACGAAAAGCAGAAGCACACTAGCTAACCT---CTCCCACCCCAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_montecillanum_CPC_17804 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCCTCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC--CCCCCTCTCCCGCG----TCCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCTCATTGCCA-----CG-ACATCACGATGC-----------------CT-CATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------CAACACTCAAACCG-AACCCATTACTGACAA----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTTTTTGCCCCGCCGCA-CCCCCTTGGGTGTTAGTGTCCTTTTTTCCCCGCCGCACCTGCCTTGGGTGTTATGGAATCCTTTGGACGACATGGCTTCTTACTTGGGCTGGCTCCCATGATGAAGAAGTACAACCGGCTGGCTCCATCCTCTGGAATGCTTCCTCTCCGTCGTCCCGAGTCAGCTGCCCTCACCGCTATTTTACGTCGCAATATGGCTTGGACGAGCACATGGGCCCCAAGGCCCACGTCGGCGACGCCGCCAAGAACGG-GGCCCCGTTGAGAAGACGCTGTCTTCCTCCCATCTTCGGAAGAAAGCACAGCGCGCGGCTGCCATCGTCAACAAGGACTTCTACTGCGACGCTTGCGAAAAACCCTTTGGAGATCAAACTGCGCTTA--ACAGACACGAAAAGCAGAAGCACACTAGCTAACCT---CTCCCACCCCAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_myrtacearum_CBS_126349 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCTGTGCCAGA---AATTCCGAGCTGACAAC-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC----CTCCCTAGAACA----CCAATT-GTCGCGCTCA----ATGTCTAAC-CCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CATCTCTCT--GGCACAACACCA-----TC-TTGTTGCGACAA-----------------CT-CATCCCTCTGCCCCGC--CGCC-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----AACCCTGGCTTGGCGTGAGCGAGTG----------------------------------------------------------------------------TCGCGACA------AACATGGCATCGC-CACAC---------------A-ACACCAACTCATGG-AACACGCCACTGACAA----TCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_myrtacearum_CBS_126350 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCTGTGCCAG----AATTAAGAGCTGACACC-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC----CTCCCTTGAACA----CCAATT-ATCGCGCTCA----ATGTCTAAC-GCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACT----GGCACAACACCA-----TT-TCGTCGCGACAT-----------------CT-CATCCCTCCGCCCCGC--CACC-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----AACCCTGGCTTGGCGTGAGCGAGTG----------------------------------------------------------------------------TCGCGACG------CACATGGCATTGC-CACAC---------------A-ACACCAACGCGTGG-AACACACCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACTTTCCCCTCACACGACAAGCAGAAGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_needhamense_CPC_22353 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGTACCAG----AATCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCGTTC-ATCTCTAACTCTGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CT-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACCAACA----------------------------------------------------------------------------CCGCGACG-------AGACAGCATTGC-CACTC---------------A-ACACGC-CTCAAAG-AACGCATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CGCCCACCAAAGATACAACGTCACCGTCATCGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium neerlandicum DTO 086-C5' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCCTCATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT--CCCCCTCTCCCGCG----TCTCTT-CCCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACG----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C-----------------TAACACTCAAACCG-AACCCATCACTGACAA----CTACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_neopsychrotolerans_CGMCC_3.18031 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT--CCCCCTCTCCCGCG----TCTATT-CCCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--GACACATTTCCA-----TC-TTATCGCGATGC-----------------CT-CATCCCTCTGCCACGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTTGCAACGC-CAC-C-----------------CTACACTGAAACCG-AACCCTTCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_neopsychrotolerans_CGMCC_3.18032 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT--CCCCCTCTCCCGCG----TCTATT-CCCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--GACACATTTTCA-----TC-TTATCGCGATGC-----------------CT-CATCCCTCTGCCACGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTTGCAACGC-CAC-C-----------------CTACACTGAAACCG-AACCCTTCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_oxysporum_CBS_125991 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACACATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----GT-CCCCGCGAG----CCCCTCTATCGCGCGCCTCC-CATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????ACACTGCCA-----TC-TCGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTT-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACCC--------------AA-AAACCA-CTTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--AAAGACACATCAAGCAAATGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_oxysporum_CBS_126351 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACACATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----GT-CCCCGCGAG----CCCCTCTATCGCGCGCCTCC-CATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACCCA--GACACACTGGCC-----TC-TCGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCT--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACCC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--AAAGACACAACAAGCAAATGCATACTTGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_paracladosporioides_CBS_171.54 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCCATCTCGAG---AATTCCGAGCTGACACC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT-------CCCCCCAAA----CCCATT-CTCGCGCTCAA---ATCTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTCATTCC--GACACAATTCTG-----TC-CTGTCGCGGTGT-----------------TT-CGTCCCTTTGCCCCGC--CACC-----------TAG----CCCTAC---------CTC-GTCGCAATCT-GTGCGATAAGACT---AGGA----CGTCCTGGCTTGGCAT-GACATGCAC------------------------------------------------------------------------------CGACG------AAGACAGCATTGT-CATGC-----------------AATACACCTAACAA-AACTCATTACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_parapenidielloides_CBS_140487 ---------------TGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAAG-CACCCGTTT----CGCCAACGCCAG----AACCCCGAGCTGACAAT-CATCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC------CTCCCTCACG----CCCAAT-CTCGCTCAAA----ATGTCTAACCGCAGCACAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTTC--GGCACAATGTTA-----TC-TCTCCGCGGTGTT-------------------CATCCCTCTGCCCCGC--CACG-----------ACG----CCCCGCC-------TCTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGAT-----------------------------------------------------------------------------AACATTGCGAAG--------ACAAGCATCGC-CACAC-----------------AACATCACCCCCAG-AACTCATTATTGACAA----ACGTAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGCAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCTA--ATAGACACGATAAGCAGAAGCACAGTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CBS_125996 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGCTCAG---ATATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACTATTCC--C--GTGGTGC-------TCTTCCCCATCGCGGT---------------GTTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GTGATAAGGT--GCGGGACAC-CGGCTCGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCCGTCCCATCAC-AACACATTGCTAACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAAAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_11663 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_11815 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_11819 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_11820 ---------------TGTGCATGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_11821 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_11831 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_perangustum_CPC_12216 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_13727 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTGG----AACTTGCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-CT----CT-TCCCGCAGT----TTCCGCCGTCGAGTCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACCACTCT--C--GCAGTGGTC-----TCTTCGTCGCAGT-------------------TTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCATTCACACCAC-AACACATGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_13730 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTGG----AACTTGCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-CT----CT-TCCCGCAGT----TTCCGCCGTCGAGTCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACCACTCT--C--GCAGTGGTC-----TCTTCGTCGCAGT-------------------TTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCATTCACACCAC-AACACATGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_13774 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTGG----AACTTGCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-CT----CT-TCCCGCAGT----TTCCGCCGTCGAGTCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACCACTCT--C--GCAGTGGTC-----TCTTCGTCGCAGT-------------------TTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCATTCACACCAC-AACACATGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_13870 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGCTCAG---ATATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTAAG-CACTATTCC--C--GTGGTGCTC-----TCTTCCCCATCGCGGT---------------GTTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GTGATAAGGT--GCGGGACAC-CGGCTCGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCCGTCCCATCAC-AACACATTGCTAACAA----CCACTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_14247 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_15192 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTGG----AACTTGCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCT-CT----CT-TCCCGCAGT----TTCCGCCGTCGAGTCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACCACTCT--C--GCAGTGGTC-----TCTTCATCGCAGT-------------------TTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCATTCATACCAC-AACACATGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22297 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACACT-ACCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-TCCCGCAAA----ATCCGCCGTCGAGTTCAG---ATGTCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22327 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cladosporium_perangustum_CPC_22328 -------------------------CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTCCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22329 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22331 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-ATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAC----TTCCGCCGTCGAGTCCAG---ATGTCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22375 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACTTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-ACCTTAGCTTCCATTGTCGGCAGACCCCGCCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCACTGTCGAGTT-AG---ATATCTAACAATGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTAGG-CACTATTCC--C--ATGGTGGT------TTTGCTCCATGGCGAT---------------GTTTGGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGCACAC-CGGCTCGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGACACCATCGC-CACGC-----------------ATCCACCACACCAC-ACCACGTTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_perangustum_CPC_22378 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTCCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCTGTCGAGTTCAA---ATGTCTAACAACAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACCACTGC--C--AGGGTGGTT-----TCTTCTCCACGACAGT---------------GTTTTGCCCCTCCGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAATTATACAAC-AACAGACGGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTACGACGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTCCACAACAAGCAAAAGCAAATTCGCTAACGT-TCTACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 127-E1' --------------------------------------------------------GTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCCCGCTTAG----AACTTGCAGCTGACAGT-AACTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAGT----TTCCGCCATCGAGGTCAA---ATGTCTAACAGCAGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGTACTGCCATG------GAGATACCATCGC-CACGC-----------------ATCAGTTATACAAC-AATAGACCGCTAACAA----CCATCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 127-E2' --------------------------------------------------------GTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 323-E4' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTAAG-CACTACTCC--C--GTGGTGCTC-----TCTTCCCCATCGCGGT---------------TTTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GCGGTACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCGC-CACTC-----------------ATCCGCCACACAAC-AACTCATTGCTAACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAATTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 323-E8' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 323-E9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 324-A2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 324-A6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTCTTCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium perangustum DTO 324-D1' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGAAGA-CACCTGTTT----CGCCCCGCCTAG----AACTTCCAGCTGACAGT-AACATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCC-CT----CT-TCCCGCAAT----TTCCGCCGTCGAGTTCAG---AGATCTAACAATGGCGCAGTATCATGATCGGTATGGGCCAA-AGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTAAG-CACTACTCT--T----GGTGG-------CCCTCATCGCAGT-------------------GTTTGCCCCTCTGTCCCGC--CACG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GGGGGACAC-CGGCTTGGCTTGGCATGGGC-----------------------------------------------------------------------------TGCACTGCCATG------GAGATACCATCCG-C---------------------------CACACAAC-AACTCATTGCTAACAA----CCACCACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_phaenocomae_CBS_128769 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AACTCCGAGCTGACATCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-GTTTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------GGTGAG-CATCACTCG--GGCACGATGCCA-----CC-TTGTCGCGATGC-----------------CTTTATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----TGCCCTGGCTTGGCATGGACAGCCA----------------------------------------------------------------------------TAGCGACG-------AGGCAGCATCGC-CACTC---------------ATACACACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTA--ACAGACACGACGAGCAGAAGCACATTAGCTAACCT---CATCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_phyllactiniicola_CBS_126352 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCC-CTCCAG----AACTCTGAGCTGACAGC-ATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA----------CTCTCCCAA----TCCCGT-TTCGCACTCA----ATGTCTAACCGCAACGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CCTCACTCC--GACACAATCTGC-----TC-TCATCGCAATGTG---------------TTT-TATCCCTCTGCCCCGC--CACC-----------GCT----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGAGGGG----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATA------AAGACAGCATTGC-CACTC-------------------CAACACCAGCCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTCA--ACAGACACAACAAGCAAAAGCATACTCGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_phyllactiniicola_CBS_126353 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCC-CTCCAG----AACTCTGAGCTGACAGC-ATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA----------CTCTCCCAA----TCCCGT-TTCGCACTCA----ATGTCTAACCGCAACGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CCTCACTCC--GACACAATCTGC-----TC-TCATCGCAATGTG---------------TTT-TATCCCTCTGCCCCGC--CACC-----------GCT----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGAGGGG----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATA------AAGACAGCATTGC-CACTC-------------------CAACACCAGCCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTCA--ACAGACACAACAAGCAAAAGCATACTCGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_phyllophilum_CBS_125992 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTCT----CACCCACTCCAG----AATTGTGAGCTGACAGC-ATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA----------TTCTCCCAG----TCCCGT-CTCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CCTCACTCC--GACACAATCTGC-----TC-TCGTCGCAAGGTG---------------TTT-CATCCCTCTGCCCCGC--CACC-----------GCG----CCCCGCC--------CTC-GTCGCAATCT---GCGATAAGACCCGAGGGG----CGCTCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATG------AAGACAGCATTGC-CACTC-------------------CAACATCAGCCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_phyllophilum_CPC_13873 -------------CATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTCT----CACCCACTCCAG----AACTGTGAGCTGACAGC-ATTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA----------TTCTCCCAG----TCCCGT-CTCGCGCTCC----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-C----CTCC--GACACAATCTGC-----TC-TCGTCGCGATGTG---------------TTT-AATCCCTCTGCCCCGC--CACC-----------GCG----CCCCACC--------CTC-GTCGCAATCT---GCGATAAGACCCGAGAGG----CGCCCTGGCTTGGCATGGATCTGCAC------------------------------------------------------------------------------CGATG------AAGACAGCATTGC-CACTC-------------------CAACAACAACCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pini-ponderosae CBS 124456' -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCTGGTGGCAG----AACTCCGAGCTGACACCCATCCTAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TTCCCTCTCTCTCCCACG----CCCGTT-GTCGCGCTCAGCC-ATGTCTAACTCCAACGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACCA-ACTA-----TC-TTGTCGCGATGA-----------------CT-TGTCCCTCCGCCCCGC--CACC-----------ACA----CCCCAC---------CTT-GACGCAAATT-TCGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACTTGCA----------------------------------------------------------------------------TTGCGACG-------AGACAGCATTGC-CAGCC-----------------CACAGTATACACCG-AACACATTACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCGGAGCGTGAGCGCGGTATCACCATT-GACATTGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGCCTC--ACAGACACAACAAGCAGAAGCACACTCGCTAATCC--------ACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudochalastosporoides_CBS_140490 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTGTTCCGTAAGT-CTGAAGA-CACCTGTTCCAC-CGCGCATGGTAG----GACGCCCAGCTGACAGC-ATTCTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-TT-------CCTCCTTCG----CCCACTCCCCGCGCTCC----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CACTACTCC--GGCATCTCGCTGTC---TC-TTGTTGTGGTGT-----------------TT-CCTCCCTCTGCCCCGC--TACAA----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGC---------AGGCTTGGCATGGACGAACA----------------------------------------------------------------------------TTGCGACA-------ACATGGCATCGC-CACAC---------------C-ACATTTCTCTCCCA-AACACATTGCTGACAA----CCGCAACAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTACAACGGTTGGTCTTCCCGTTCCT--------------------------------------TTTGCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTTTGCCG---------------------------------TATGCTAA-------------------------------------------------CGATTCTGCAGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CBS_117134 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------GT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGT-CACTC---------------A-ACACAT-CTCTCCG--GCATATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CBS_117153 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CBS_125993 -------------TTTGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------GTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CBS_149.66 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CBS_176.82 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACATGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CBS_574.78A ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CBS_667.80 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCCGCGAG----CCTCCTTATCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CBS_673.69 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACATGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGGTACCTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_11605 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCTTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCCTTCGCGCTCATTA-A---CTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_12850 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGCTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCACAGTATCATGATCGGTATGGGCCAGAAGGACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_13488 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_13992 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAGAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCTTATCGCGCTCATT--AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAC-CTCTTCG-AGCACATCACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_13998 ------------CCATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCCTCTTATCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTTA--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CATTC---------------A-ACACAT-CTCTCCG--GCACATTGCTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CPC_14001 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CPC_14010 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_14013 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_14020 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_pseudocladosporioides_CPC_14193 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------AGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22237 ----------------------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACATGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGACGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22283 ------------------------CCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCTTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCCTTCGCGCTCATTA-A---CTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22284 -----------GGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACTAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22292 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAAAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACTAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22311 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAAAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACTAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22334 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACTAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22338 ----------------------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22340 ------------------------CCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGCATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GCCACATTGCCA-----CC-TTGTTGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22341 -----------GGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22351 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GCCACATTGCCA-----CC-TTGTTGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22356 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGCTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCACAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22362 ----------------------------TTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAAGTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGCCAC-------------------------------CAAGACCCACCTCGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCACGAACGGCGGCCCTGTCGAGAAGGAGTTGTCCGCCTCCTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGA{CG}TAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCATCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22368 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAG----CCTCCCATGCGCGCTCATTC-AAATCTAACCTCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GCCACATTGCCA-----CC-TTGTTGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22369 --------------ATGTGCAAAGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCACGAG----CCTCCCATTCGCGCTCATTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCATTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22382 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCCTCTTATCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTA--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATTGCTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22386 -----------GGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22389 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACATCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCCATCGCGCTCATTC-AGTTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------?????????????????????????????????????????????????????????????T-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22392 ATGCCAGTTCTGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------?????????????????????????????????????????????????????????????????????????????????CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_pseudocladosporioides_CPC_22966 ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCACGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCTTATCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------?????????????????????????????????????????????????????????????T-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAATCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 079-F4' -------------------------------CGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------GTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCA---------------CC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 084-F1' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 121-H1' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCACTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 150-A7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 150-C1' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 150-C7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 150-D1' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-A4' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGCTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCATTCGCGCTCATTC-AAATCTAACCCCGGCACAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GCCACATTGCCA-----CC-TTGTTGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-A8' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------GT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGT-CACTC---------------A-ACACAT-CTCTCCG--GCATATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-B7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACATCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCCATCGCGCTCATTC-AGTTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-D1' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-E7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 151-G7' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-A5' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG-AGCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-A6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACATCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCCATCGCGCTCATTC-AGTTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-D6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CTCA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAACCG----------------------------------------------------------------------------TTGCGACA-------AGACAGCAACGC-CACTC---------------A-ACCCAC-CTCTCCG-AGCACATCACTGACAG----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTTACTGTCATCGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-H5' --------------------------------------------------------GTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-H6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 152-H7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCACCAG----AATCCCGAGCTGACACCCTCTGTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-AT----CT-CCCTACGAA----CCTCCAATGCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GCCACATTGCCA-----CC-TTGTTGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACATGACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 307-F3' --------------ATGTGCAAGG-CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium pseudocladosporioides DTO 307-G9' ---------------TGTGCAAGG-CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA--ACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCCTCTTATCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTTA--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGT--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATCGC-CACTC---------------A-ACACAT-CTCTCCG--GCACGTTGCTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium pseudocladosporioides DTO 308-A2' ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGGG----CCTCCTTGTCGCGCTCATTC-AAGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCAGCCCCGC--CAAA-----------TCA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACTG----------------------------------------------------------------------------TCGCGACA-------AGATAGCATCGC-CACTC---------------A-ATACAT-CTCTCCG--GCACATCACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAGTAAGTTCCCCT-TTGCCCTGCCGC--------------------------------------ACCTGCCTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTACCTTCGGAAGAAAGCAAAGCGCGCCGCTGCCATCGCCAACAAGGACTTCTACTGCGACTCTTGCGACAAGCCCTTCGGAGACCAGACCAAGCTTA--ACAGACACAACCAGCAGAAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium pseudocladosporioides DTO 323-D3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCGCGCCAG----AACCCCGAGCTGACACCCTCTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCTTATCGCGCTCATTC-AAATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTTA--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------TT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAACCG----------------------------------------------------------------------------TCGCGACA-------AGACAGCATAGC-CACTC---------------A-ACACAT-CTCTCCG--GCACGTTGCTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACTGTCATCGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_rectoides_CBS_125994 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCGAGCTGACACCCATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT---TCC-CCCTGCGAA----CCTCCCTATCGCGCTCAACC-ATGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACAATGCCA-----CC-TTGTCGCGATGA-----------------AT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------GTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACCAGCA----------------------------------------------------------------------------CCGCGACA-------AGA--GCTTCGC-CACAA-----------------CACTGTTCACAATG-ACCACATCACTGACAT----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_rectoides_CBS_126357 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCGAGCTGACACCCATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT---TCC-CCCTGCGAA----CCTCCCTATCGCGCTCAACC-ATGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--GGCACAATGCCA-----CC-TTGTCGCGATGA-----------------GT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACCAGCA----------------------------------------------------------------------------CCGCGACG-------AGATGGCATCGC-CACAA-----------------CACTGTTCACAATG-ACCACATCACTGACAT----CTACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGGTACTTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_rugulovarians_CBS_140495 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CCAAAGA-CTCCTGTTT----TGCCCACCTCGA----GATGTCCAGCTGACAGC-ATCTTAGCTTCCATTGTCGGCCGTCCCCGCCACCATGGGTATGCA-CT-------CTCTCCAGC----ACCCGTCGTCGAGCTCAAA--ATGTCTAACCCCAGAATAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAGAGCAAGCGTGGTATCCTCACTCTGAGGTACCCCATCGAGCACGGTGTTGTCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTCCGTGTTGCCCCCGAGGAGCACCCCGTCCTCCTCACCGAGGCTCCCATCAACCCCAAGAGCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCGGCCTTCTACGTTTCCATCCAGGCCGTCCTCTCTCTTTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTCACCCACGTTGTCCCCATCTACGAAGGTTTCGCCCTTCCCCACGCTATCTCGCGTGTTGACATGGCCGG?????-CATCGAGAAGTTCGAGAAGGTAAG-----------------------------CC-TATCCGGCATGTCTT----------TGGCGAGTTTTTCTACGCCCCGC--CGTT-----------TCA----CCCCGC---------CTC-GTCGCAATCT---GCGATAAGGC--ATGGAC----TGCAC-GGCTTGGCGTGGAACAAAC------------------------------------------------------------------------------AACCAGC-----AAGACAACATCGC-CACAC-----------------ATCCAGGGCATCAG-AACACATCACTGACAC----CCACAACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------CA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGACACGACAAGCAAAAGCATACTCGCTAACCTATCCACCCACCTCAGGTACAATGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_scabrellum_CBS_126358 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTACAGA-CACCTGTCC----CACCAACCACAG----AATTCCGAGCTGACAAC-CTCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-CT-------CTCCCCACG----CCTATT-GTCGCGCTCA----GTCTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGCCCCTAAG-CCTCACTCC--AGTACAGCGATA-----TC-TCATCGCGATGT-----------------TT-CCTCCCTCTGCCCCGC--CATG-----------ACA----CCCCGC---------CTC-GTCGCAATTT---GCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCATGGACCACCA----------------------------------------------------------------------------TCGCGACA-------AGACATCATTGT-CAACC-----------------AACATGACTTCAAG-AACACATGGCTGACAG----TCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCTTCGGAAGAAAGCAAAGCGCGACACTGCGCTCGCCAACAAGGAATTTTACTGCGACGCTTGCACAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACAACAAGCAAAAGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGACTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_silenes_CBS_109082 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----CTTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA--T--CCCCCTCTCCCGCG----CCCATT-CTCACGCGAACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACCTCGTCA-----CC-TTGTCGCGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGGCA----------------------------------------------------------------------------TGGCGAGA-------AGCTGGCAACGC-CAC-T-----------------CGACACTCAAACTG-AACACCT-ACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTTTTTGTCCTGCCGCA--------------------------------------CCTGCCTTGGGTGTTATGGAATCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGTCAAGAACGGCGGCCCTGTCGAGAAGACGCTGTCTTCCTCCCACCTTCGGAAGAAAGCACAGCGCGCCGCTGCCATCGCCAACAGAGACTTTTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATCAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_sinuatum_CGMCC_3.18096 --------------TTGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATCTCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT---CCCCTCTCCCGCG----CTCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--GGCTCACTGCCA-----CC-ATATCGCGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C----------------CAAACACTCAAACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_sinuatum_CGMCC_3.18097 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATCTCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT---CCCCTCTCCCGCG----CTCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--GGCTCACTGCCA-----CC-ATATCGCGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C----------------CAAACACTCAAACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_sinuatum_CGMCC_3.18098 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATCTCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT---CCCCTCTCCCGCG----CTCATT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--GGCTCACTGCCA-----CC-ATATCGCGATGC-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGACA----------------------------------------------------------------------------TCGCGAGA-------AGCTGGCAACGC-CAC-C----------------CAAACACTCAAACCG-AACCCATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_subuliforme_CBS_126500 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----TT-CCCTGCGAT----CCCCTCTATCGCGCGCGGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCATTCG--GGCACAATGCCA-----CC-TTGTCGCGATGC-----------------CA-CATCCCTCTGCCCCGC--CACGAC---------ACA----CCCCGC---------CTT-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CAC-C---------------ATCACCAC-ACCGCGA-AACAAATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTA--ACAGACACGACAAGCAGAAGCACACCAGCTAACCT---CACCCACTACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium subuliforme DTO 130-H8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----TT-CCCTGCGAT----CCCCTCTATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACGAC---------ACA----CCCCGC---------CTT-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCACGGACGTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CAC-C---------------ATCACCAC-ACCGCGA-AACAAATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium subuliforme DTO 323-D1' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----GGCCCATCTCGC----AATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTACGCA-TT----CT-CCCTGCGAT----CCCCTCTATCGCGCGCGGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGC-----------------CA-CATCCCTCTGCCCCGC--CACGAC---------ACA----CCCCGC---------CAC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCACGGACGTCCG----------------------------------------------------------------------------TCATGACA-------AGACAGCATTGC-CAC-C---------------ATCACCAC-ACCGCGA-AACAAATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTA--ACAGACACGACAAGCAGAAGCATACCAGCTAACCT---CACCCACTACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium subuliforme DTO 324-B8' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTACAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCGAGCTGACGCCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCCGCGAG----CCTCCCTGTCGCGCGCAGCC-AGTTCTAACGCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCCCTCG--GGCGCAGTGTCG-----CC-TTGTCCCGATGG-----------------CA-CATCCCCCTGCCCCGC--CACGAC---------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCACGGACCTCCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CAC-C---------------ATCACCAC-TCCGCGA-AACAAATCACTGACGA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGACTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium subuliforme DTO 324-C7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----GGCCCATCTCGC----AATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAT----CCCCTCTATCGCGCGCGGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATGC-----------------CA-CATCCCTCTGCCCCGC--CACGAC---------ACA----CCCCGC---------CAC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----CGTCCTGGCTTGGCACGGACGTCCG----------------------------------------------------------------------------TCATGACA-------AGACAGCATTGC-CAC-C---------------ATCACCAC-ACCGCGA-AACAAATCACTGACAA----CCACAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTA--ACAGACACGACAAGCAGAAGCATACCAGCTAACCT---CACCCACTACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_tenuissimum_CBS_125995 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCTTG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_tenuissimum_CBS_126359 ------------------------CCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_CPC_10538 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------AAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_CPC_10882 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_CPC_12795 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_tenuissimum_CPC_22398 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CATA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 323-C5' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------------AAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium tenuissimum DTO 323-C9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 323-G2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 323-G3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 323-G8' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 323-I6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 324-C3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 324-C5' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum DTO 324-C6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium tenuissimum DTO 324-C9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------------GAAGGTGAG-TATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATGAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTCA-------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_11521 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGTGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---TCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCTTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-CGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACGACAAGCAAATGCGTACTCGCTAACCTATCCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_11929 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCTTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-CGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACGACAAGCAAATGCGTACTCGCTAACCTATCCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_13252 ----------------------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGTATTGC-CACTC--------------AA-AAACAA-CTTACAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTTTTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_tenuissimum_lineage_1_CPC_13732 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAACGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_tenuissimum_lineage_1_CPC_14196 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAACGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_14311 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-AGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACGACAAGCAAATGCGTACTCGCTAACCTATCCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_14370 ---------------TGTGCAAGTCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAACGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_22277 --------------------------GGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAGCGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_22320 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_22344 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------GA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGTACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAACGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTGTTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tenuissimum_lineage_1_CPC_22383 ATGCCAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 109-A1' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCTTCCCAGCTTCCATTGTTGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGCC--------CTCAGTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-CGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 109-C7' --------------------------------------------------------GTTTTCCGTAAGT-TCTCACCACCCACGCTC----TTCACGCACCGG----ACCACTCGGCTGACCGC-CTCTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TC----CT-CCCCGC-------GCCCGCCGCCGAGGCCACCC-CGTTCTAACCGCAGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCGAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-CGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 131-A4' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CACCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AACTCTAACCCCTCCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACAACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------G-AAACAA-CGTGCAG-AGCACATCGCTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--ACAGACACGACAAGCAAATGCGTACTCGCTAACCTATCCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 323-G4' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 323-I4' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------------AAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 323-I8' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TTAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 323-I9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCACCGCGCGCAGCC-AATTCTAATTCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCATTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CACCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC---------------A-AAACGA-CTTGCAG-AGCACATCGCTGACAA----CCACGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCA--ACAGACACAACAAGCAAATGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium tenuissimum lineage 1 DTO 324-A1' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium tenuissimum lineage 1 DTO 324-A3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium tenuissimum lineage 1 DTO 324-C2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCCCATG----AATCCCGAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCCTTCATCGCGCGCAGCC-AATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CATTCCTCG--GGCACACTGCCA-----TC-TTGTCGCGATGG-----------------CA-CACCCCTCTGCCCCGC--CACA-----------ACA----CCCCGCC--------CTC-GTCGCAAATT--CGCGATAAGGAT-GTGGGC----CGCCCTGGCTTGGCACGGACGACCA----------------------------------------------------------------------------TCACGACA-------AGACAGCATTGC-CACTC--------------AA-AAACAA-CTTGCAG-AGCACATCGCTGACAA----CGACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTA--TCAGACACAACAAGCAAATGCACACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tianshanense_CGMCC_3.18033 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTC----CACCCCTCTCAG----AACTCCGAGCTGACAGT-GTCTTAGCTTCCATTGTCGGACGTCCCCGTCACCATGGGTATGCA-GT-------ATTCCCACA----CCTATT-GGCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--CACACTTTTTTC-----TCAATGGTGACAAC------------------GCATGCACTGGCAGTGCTC-GAGCG-----------CGG---CGCCTTTCTGGGG---CTT-ATCGCTTGAAGAGGGGCATTTTTG-GTGGGGT-TGTGCGAGCTTTTCGCGCATTTGCGCTAGTCCATTTCGGGCGCTCGCCAACTTCAACACCATGCCCCACACTGCATTTTGCATCGC----------AGCTTTTTGACTTCG-----GTCAAGGGCTTTGA-CACCTTT---------TACCACTTGTTTCCTCATTG-TATATGATGCTAACAA----CCTATCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATC-GATATTGCTC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_tianshanense_CGMCC_3.18034 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTC----CACCCCTCTCAG----AACTCCGAGCTGACAGT-GTCTTAGCTTCCATTGTCGGACGTCCCCGTCACCATGGGTATGCA-GT-------ATTCCCACA----CCTATT-GGCGCGCTCA----ATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????G--CACACTTTTTTC-----TCAATGGTGACAAC------------------GCATGCACTGGCAGTGCTC-GAGCG-----------CGG---CGCCTTTCTGGGG---CTT-ATCGCTTGAAGAGGGGCATTTTTG-GTGGGGT-TGTGCGAGCTTTTCGCGCATTTGCGCTAGTCCATTTCGGGCGCTCGCCAACTTCAACACCATGCCCCACACTGCATTTTGCATCGC----------AGCTTTTTGACTTCG-----GTCAAGGGCTTTGA-CACCTTT---------TACCACTTGTTTCCTCATTG-TATATGATGCTAACAA----CCTATCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATC-GATATTGCTC-TCTGGAAGTTCGAGACTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_uredinicola_ATCC_46649 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCCGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCTATCGCGCTCAGTC-ATGTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--CGCGATAAGGGT-G--------------TGGCTTGGCATGGACAACCA----------------------------------------------------------------------------TCGCGACA-------AGACAGCATTGC-CACTC---------------A-ATACAC-CTTTCTG-AGCACATTACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_uwebraunianum_CBS_139572 --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium uwebraunianum DTO 072-D8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----TC-TAATCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTA--ACAGACACGACAAGCAGAAGAACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium uwebraunianum DTO 082-E3' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium uwebraunianum DTO 090-D2' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium uwebraunianum DTO 109-E8' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium uwebraunianum DTO 305-H9' ---------------TGTGCAAGG-CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----ATTCCCGAGCTGACACCCACTCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATTCGCGCTCATCC-ATTTCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----TC-TAATCGCGATGC-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGTGACA-------AGGCAGCATCGC-CACTC---------------ATACATACACTCGCGG-AACACATTACTGACAA----CCACCTCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_varians_CBS_126360 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCCGTCTCGAG---AATTCCGAGCTGACACC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--------TCCCCAAGC---CCCATTGTTCGCGCTCAA---TCCTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTCACTCC--ATGGCAATACTG-----TC-TTGTCGCGGTGT-----------------TT-CCTCCCTCTGCCCCGC--CACT-----------CCG---CCCCCAC---------TCC-GTCGCAATCT-TCGCGATAAGACT---GGGA----CGTCCAGGCTTGGCATGGATTTGCAT------------------------------------------------------------------------------CGACA-------AGACAGCATCGC-CACAC-----------------AACGTT-CTCACTG-GACACATCACTGACAA----CCAC-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTGTATTCCCATACT-----------CTTC---------ACTGTATTAT--ACCGATACTA-----------ATCCTTGTGTA------------------GTACAACGTTACTGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_varians_CBS_126361 ----------------GGGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCCGTCTCGAC---AATTCCGAGCTGACACC-ACCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--------TCCCCAAGC---CCCACTGTTCGCGCTCAA---TCCTCTAACCCCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTAAG-CCTCACTCT--ATGACAATACTG-----CC-TTGTCGCGATGT-----------------TT-CCTCCTTCTGCCCCGC--CACT-----------TCG----CCCCAC---------CTC-GTCGCAATCT-TTGCGATAAGACT---GGGA----CGTCCTGGCTTGGCATGGATTTGCAT------------------------------------------------------------------------------CGACG-------AGGCAGCATTGC-CACCC-----------------AACACA-CTCTCCGCGGCACATCACTGACAA----CCACCATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTGTACCCCCATGCT-----------CTTC---------ACTG--TTAT--ACCGATGCTA-----------ATTTGAATGCA------------------GTACAACGTCACTGTTATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_varians_CBS_126362 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTCT----CACCCGTCTCGAG---AATTCCGAGCTGACACC-ATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--------TCCCCAAGC---CCCATTGTTCGCGCTCAA---TCCTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CCTCACTCC--ATGGCAATACTG-----TC-TTGTCGCGGTGT-----------------TT-CCTCCCTCTGCCCCGC--CACT-----------CCG---CCCCCAC---------TCC-GTCGCAATCT-TCGCGATAAGACT---GGGA----CGTCCAGGCTTGGCATGGATTTGCAT------------------------------------------------------------------------------CGACA-------AGACAGCATCGC-CACAC-----------------AACGTT-CTCACTG-GACACATCACTGACAA----CCAC-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTGTATTCCCATACT-----------CTTC---------ACTGTATTAT--ACCGATACTA-----------ATCCTTGTGTA------------------GTACAACGTTACTGTTATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_verrucocladosporioides_CBS_126363 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCGCGCCAG----AATCCCGAGCTGACACCCATTCTAGCTTCCATCGTCGGCAGGCCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCATCCGCGCTCACTC-GTATCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACACG--GGCACATTGCCA-----CC-TTGCCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACAGCCA----------------------------------------------------------------------------TCGCGACA-------AGCGAGCATTGC-CACCCT----------------ACACAC-TCCACAG-AACACATTACTGACAA----CCGCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GACATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTCCCTCTTTGCCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCGAGAAGACGCTGTCTT-CTTCTACCTTCGGAAGAAAGCGCAGCGCGCCGCTGCCATCGTCAATAAGGACTTCTACTGCGACGCTTGCGAAAAGCCCTTCGGAGATTAGACTGCGCTTA--ACAGACACGACAAGCAGAAGCACACTAGCTGACCT---TACACACCACAGATACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_vicinum_CBS_306.84 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CT-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGATA----------------------------------------------------------------------------TTGCGACA-------AGCTGGCAACGC-CAC-T-----------------CTATACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAGGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_vicinum_CPC_11664 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCTCCCCTCCCGCG----CCCATC-ATCGCGCGCACTCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CT-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGATA----------------------------------------------------------------------------TTGCGACA-------AGCTGGCAACGC-CAC-T-----------------CTATACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAGGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_vicinum_CPC_13867 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCTCCCCTCCCGCG----CCCATC-ATCGCGCGCACTCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CT-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGATA----------------------------------------------------------------------------TTGCGACA-------AGCTGGCAACGC-CAC-T-----------------CTATACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAGGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_vicinum_CPC_15457 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------GAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CAGCCTGGCTTGGCATGGACAG--A----------------------------------------------------------------------------TTGCGACC-------AGCTGGCAACGC-CAC-T-----------------CTACACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACCAGCAAAAGCACACCGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_vicinum_CPC_22316 -----------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--CCTCCCCTCCCGCG----CCCATC-ATCGCGCGCACTCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CT-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGATA----------------------------------------------------------------------------TTGCGACA-------AGCTGGCAACGC-CAC-T-----------------CTATACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAGGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium vicinum DTO 305-H5' ---------------TGTGCAAGG-CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATTATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT--TCTCCTCTCCCGCG----CCTGTT-CTCGCGCGCACTCAATATCTAACTCCGGCGCAGTATCATGATCGGTATGGGCCAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????CCATCGAG-AAGTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CT-TCGTCGCGATGT-----------------AT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAGATA----------------------------------------------------------------------------TTGCGACA-------AGCTGGCAACGC-CAC-T-----------------CTATACTCAAATCG-AACACATCACTGACAA----CCACAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGCTTC--ACAGACACGACAAGCAGGAGCACACTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_vignae_CBS_121.25 --------------------AAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCAG----AATTCCGAGCTGACACCCCTCCCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAA----CCCTTCCATCGCGCGCAGCC-AGTTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------GTTCGAGAAGGTGAG-CATCACTCG--GGCATAACGCCA-----CT-TTGTCGCGATGA-----------------CT-TGTCCTTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGC----AGCCCTGGCTTGGCACGGACTTACA----------------------------------------------------------------------------TCACGACA-------AGGCAGCATCGC-CACTC---------------A-TAACGA--CTTCAG-AGCACATCACTGACAA----CCGCCCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_westerdijkiae_CBS_113746 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----GCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_westerdijkiae_CPC_10150 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----GCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_westerdijkiae_CPC_13362 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTTCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_westerdijkiae_CPC_13978 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----CGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_westerdijkiae_CPC_14284 ----------------GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----GCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium westerdijkiae DTO 084-F2' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTTCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGCTAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGAACA----------------------------------------------------------------------------TCGCGAGA-------ATTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium westerdijkiae DTO 109-F2' --------------------------------------------------------GTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----GCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium westerdijkiae DTO 152-A9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACGAACA----------------------------------------------------------------------------TCGCGAGA-------ATTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium westerdijkiae DTO 152-H9' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTGAAGA-CACCTGTTT----CGCCCATGCCAC----ATTTTCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-GT--CCCCCTCTCCCGCG----CCCATT-CTCGCGCGCACGCAATATCTAACTCTGGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------CGAGAAGGTGAG-CATCACTCG--GGCACATTGCCA-----TC-TTATCGCGATGT-----------------CT-CATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAATTT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCATGGACAAACA----------------------------------------------------------------------------TCGCGAGA-------AGTTGGCAACGC-CAC-C-----------------CAATGCTCAAACCG-AACACATCACTGACAA----CTGCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGACAAGCAGAAGCACATTGGCTAACCT---CACCCACCACAGGTACAACGTCACCGTTATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CBS_126364 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCACCTTCGAGCTCAG---ACGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTG--ATGACAATGGTG-----TCCTCTGTGCAGTG------------------TTTTACCCCTCCGCCCCGCCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------ACCATGAACATCAC-AACACATTGCTAACAA----CCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAATTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATGACTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_xanthochromaticum_CBS_140691 -------------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAAT-T---GCGATAAGAT--GTGGGA-A--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCCCCATCAC-AATACATCGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGTAAGGGTCCCTTCAAGTACGAACTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CBS_167.54 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----TGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-----------TTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGATG-----TCCTCTTCGCAGTG------------------TTTCATCCCTCCGCCCCGCCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATCACATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCGCCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCGCCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_xanthochromaticum_CPC_11046 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACTTGTTT----TGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CATCATTTC--ATGGCGACGCTG-----TCCTTGTTGCAGTG------------------TTTTACCCCTCTGTCCCGC--CGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATCACATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCGCCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCGCCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_11133 ---------------TGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACTATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_11609 -------------TATGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTTC--ATGACAATGGTG-----TCCTCTGTGCAGTG------------------TTTTACCCCTCCGCCCCGCCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGACAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------ACCATGAACATCAC-AACACATTGCTAACAA----CCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_11806 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_11856 ---------------TGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--ATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AACACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_12792 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_12793 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----TGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------AGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGATG-----TCCTCTTCGCAGTG------------------TTTCATCCCTCCGCCCCGCCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATCACATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTACTCTCGCCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCGCCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_14004 ------------------GCAAGGCCGGTTTCGCCGGTGATGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTCACTTC--ATGGCGACGTTG-----TCCTTTTTGCAGTG------------------TTTTACCCCTCCGTCCCGC--CGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATTGCATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTGCTCTCACCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_14008 -----------------TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CA-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CCTCACTTC--ATGGCGACGTTG-----TCCTTTTTGCAGTG------------------TTTTACCCCTCCGTCCCGC--CGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATTGCATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTGCTCTCACCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_14256 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_14911 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CT-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTCACTTC--ATGGCGACGTTG-----TCCTTTTTGCAGTG------------------TTTTACCCCTCCGTCCCGC--CGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCAATG------AAGACTTCATTGC-CACCA-----------------ACCATCAACATCAC-ATTGCATTGCTAACAA----TCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTAAGTGCTCTCACCTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAGCAAAAGCATACTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_22239 --------------------------GGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xanthochromaticum_CPC_22321 --------------------------GGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AGCATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGAATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCTCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CCTTGCTTT--ATGGCAATGGTG-----TCCTCTTCGCAGTG------------------TTTTACCCCTCTGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTTCCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATAGC-CACAC-----------------ACCATCAACATCAG-AAAACATTGCTAACAA----CCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACTCCCAAGTATGTAATCTGACCTCACCTCCACA--------------------------------------CCTGCCTTGGATGTCCGGGAACTC---GGACGACATGGCTCCTTCCTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTCCTCGCTAACCTATTCACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium xanthochromaticum DTO 108-G8' --------------------------------------------------------GTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCACCCTCGAGCTCAG---ACGTCTAACAGCAGCGCAGTATCATGATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------??????????????????????????????????????????????????????????????????????????CCCGCCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGGT--GTGGGACA--CAGCTTGGCCGAGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------ACCATGAACATCAC-AACACATTACTAACAA----CCCTCACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium xanthochromaticum DTO 317-I2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGC-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCACCCTCGAGCTCAG---ACGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium xanthochromaticum DTO 323-E2' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCCCCATCAC-AATACATCGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATT-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium xanthochromaticum DTO 323-E3' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium xanthochromaticum DTO 323-E5' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium xanthochromaticum DTO 323-E6' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------GAGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAAAAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium xanthochromaticum DTO 323-E7' ---------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------AGAAGGTGAG-CCTTACTTC--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAACAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCCCAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAACGTCACCGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xantochromaticum_CGMCC_3.18101 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????C--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAAAAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xantochromaticum_CGMCC_3.18102 --------------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-TTGCAGA-CACCTGTTT----CGCCGAGCTCAG----AACATCCAGCTGACAGT-CTCTTAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTATGCA-CT----CC-TCCCGCAAG----CTCCGCCCTCGAGCCCAG---ATGTCTAACAGCAGCGCAGTATCATGATCGGTATGGGCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------????????C--ACGGCAATGGCG-----TCCTCTTCGCAGTG------------------TTGTACCCCTCCGCCCCACCGCGCG-----------CCA----CCCCAC---------CTC-GTCGCAATCT---GCGATAAGAT--GTGGGACA--CGACTTGGCCGGGCACGGAC-----------------------------------------------------------------------------AACACTGCGATG------AAGACTTCATCGC-CACAC-----------------GCCATCACCATCAC-AATACATTGCTAAAAA----CCCTCCCAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGTCCGAGCGTGAGCGTGGTATCACCATC-GATATCGCCC-TCTGGAAGTTCGAGACCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xylophilum_CBS_113749 ------------------GCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGT-CTAAAGA-CACCTGTTT----CGCCCATCCCGC----ATTTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTCCCTATCGCGCAAAGTC-ATGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATAA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CACAA-----------------TACCACTCACATTG-AACGCATTACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGCACCTG-------------------AAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cladosporium_xylophilum_CBS_113756 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGGGCCGTTTTCCGTAAGT-ATCAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTTCCTATCGCGCAAAGTC-ATGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-CATCGAGAAGTTCGAGAAGGTGAG-CATCACTCG--GGCACAATGTCA-----CC-TTGTCGCGATGA-----------------CT-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT-TTGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CACAA-----------------CAACACTCACAATG-AACACATCACTGACAA----CCACATCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_xylophilum_CBS_125997 ---------------TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGGGCCGTTTTCCGTAAGT-ATCAAGA-CACCTGTTT----CGCCCATCCCGC----AATTCCGAGCTGACACCCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCA-TT----CT-CCCTGCGAG----CCTTCCTATCGCGCAAAGTC-ATGTCTAACCCCGGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------TCGAGAAGGTGAG-CATCACTCG--GGCACAATGCCA-----CC-TTGTCGCGATAA-----------------CA-TATCCCTCTGCCCCGC--CACA-----------ACA----CCCCGC---------CTC-GTCGCAAATT--TGCGATAAGGAT-GTGGGA----CGCCCTGGCTTGGCACGGACCTGCA----------------------------------------------------------------------------CCGCGACA-------AGATGGCATCGC-CACAA-----------------TACCACTCACATCG-AACGCATTACTGACAA----CCGCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATC-GATATCGCTC-TCTGGAAGTTCGAGACTCCCAAGTAAGTTTCCTTTTTGCCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGCACCTG-------------------AAGCACACTAACTAACCT---CACCCACCACAGGTACAACGTCACCGTCATCGACGCCCCCGGTCACCGTGATTTCATCAAGAACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET excludedchars (CHARACTERS = Fig_1_Cladosporioides_complex_combined_ACT_and_TEF_alignment) = 1-56 246-684 729-744 868-942 977-990 1059-2127; CHARSET locus1 (CHARACTERS = Fig_1_Cladosporioides_complex_combined_ACT_and_TEF_alignment) = 1-656; CHARSET locus2 (CHARACTERS = Fig_1_Cladosporioides_complex_combined_ACT_and_TEF_alignment) = 657-2127; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M48763] TITLE Fig_2_Herbarum_complex_combined_ACT_and_TEF_alignment; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1535; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cercospora_beticola_CBS_116456 ------------------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTG---CTGCCA-CAATCAGACG-CAAAAGCTG-GCAGGAAGGAGGAGCTGACAT-TGGG-ACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA---TC---------TCCGCCGCTGCAAATTCCTCCTAACAAGAGCACAGTATCATGATTGGTATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????----------C------------GAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAATGCATTTTGTCGCACAAATTTTCGCC-GCTTGTCGCCTCTGC-GCTGGTGCCCCTCCAAAACTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCAT-----CCGCTATGACTCCTCGCCCACCGCTCAACGCATTGGGCATACCGCCAGCACACCACACATCTG-----------------CACGACCACA---------------CTTCGCATCAAGAATAGACTGCTGACAATGGCTCCTC-ACAGGAAGCAGCTGAACTCGGTAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cladosporium aerium DTO 323-B4' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTTCAACAAAAA-CACCCGCTTC----ACTCCC-AGCCAGACGGCCAGCTGACAA-CACT-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCT-----CCTCCCTA----ACCACCGCCGGATCCCATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------AGAAGGTGAGCACTCTCCTG---------GCGACTC--------GTTGTCTGCC-CTTCGCTGCAATCTC----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGT---------CAGCTTGGCTTGGCGAGGAT---TTTGC-CTCTCGAGGGACAGACAACGCGCCACCAGCTAC--------------------------------------------TACCATC--GAGCACATCACTGACAA-----TCAT-TCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGGTAAGACAACA-TCCTTCA--------------------------------CAACA-AC-AACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATGTACACGA-ACTGACAGCA-------TGACAAGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-------------- 'Cladosporium aerium DTO 323-G6' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTTCAACAAAAA-CACCCGCTTC----ACTCCC-AGCCAGACGGCCAGCTGACAA-CACT-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCT-----CCTCCCTA----ACCACCGCCGGATCCCATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------AGAAGGTGAGCACTCTCCTG---------GCGACTC--------GTTGTCTGCC-CTTCGCTGCAATCTC----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGT---------CAGCTTGGCTTGGCGAGGAT---TTTGC-CTCTCGAGGGACAGACAACGCGCCACCAGCTAC--------------------------------------------TACCATC--GAGCACATCACTGACAA-----TCGT-TCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGGTAAGACAACA-TCCTTCA--------------------------------CAACA-AC-AACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATGTACACGA-ACTGACAGCA-------TGACAAGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-------------- 'Cladosporium aerium DTO 323-G7' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTTCAACAAAAA-CACCCGCTTC----ACTCCC-AGCCAGACGGCCAGCTGACAA-CACT-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCT-----CCTCCCTA----ACCACCGCCGGATCCCATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------AGAAGGTGAGCACTCTCCTG---------GCGACTC--------GTTGTCTGCC-CTTCGCTGCAATCTC----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGT---------CAGCTTGGCTTGGCGAGGAT---TTTGC-CTCTCGAGGGACAGACAACGCGCCACCAGCTAC--------------------------------------------TACCATC--GAGCACATCACTGACAA-----TCAT-TCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGGTAAGACAACA-TCCTTCA--------------------------------CAACA-AC-AACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATGTACACGA-ACTGACAGCA-------TGACAAGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATG--------------- Cladosporium_aggregatocicatricatum_CBS_113751 -----------------------AG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CACAAA-CACATGTTCC----ACGTCC-TGCCCGACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCTCC---AAACCCTC----ATCCTGCCCGGATTCAATGTCTAATCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------------------------CG---------GCACCAC--------GTTGTCTTCT-CGTCGATGCA-TCCC-TT-CACGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCAGCGATAAGGTGGC-----ACTCCTTGGCTTGGCGCAGGC---CTTG---CTTCGACG--ATGACAGCACGCCACCCACAATGTCTTGGACATCGTTTCGACGATGACAGAACGCCATCCATGGCATCTCGT--TGGATACATTACTGACAA----ATGC--ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTATGCCTGGGTCCTCGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATCGCCCTCTGGAAGTTCGAGACCCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_aggregatocicatricatum_CBS_140493 -----------------TGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CACAAA-CACATGTTCC----GCGTCC-TGCCCGACGGCCAGCTGACAA-CATC-ATAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCTCC---AAACCCTC----TCCATCCCCGGATTCAATGTCTAATCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------------------------CG---------GCACCAC--------GCTGTCTTCT-CATCGCTGCAAACTC-TTCAACGCCCCACCAAG------------------ACACCCCGCCTCG----TCGCAATCAGCGATAAGAT------------GTTGGCTTGGCGTGGAC---TTTG---CTACGACG--ACGACAGCACGCCACCGACAGT-------------------------------------------ATCCCAC--TGGACACATCACTGACAA----TCAT--ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTATGCCTGGGTTCTTGACAAGCTGAAGTCTGAGCGTGAGCGCGGTATCACCATTGACATTGCCCTCTGGAAGTTCGAGACTCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_aggregatocicatricatum_CBS_284.84 -----------------TGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CACAAA-CACATGTTCC----GCGTCC-TGCCCAACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCTCC---AAACCCTC----TCCATCCCCGGATTCAATGTCTAATCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????---------------------------------------------------CG---------GCACCAC--------GTTGTCTTCT-CGTCGATGCAATCCC-TTCAACGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCAGCGATAAGGT------------GTTGGCTTGGCGCGGAC---TTTG---CTTGGA-----CGACAGCACGCAACCAACAGT-------------------------------------------ATCTCAC--TGGACACATCACTGACAA----TCAT--ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTATGCCTGGGTTCTTGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATTGCCCTCTGGAAGTTCGAGACTCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_allicinum_CBS_110024 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_115683 --------------------GCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTCG----ATCACCACCGAATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------ATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_121624 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_134.31 ---------------TATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_157.82 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_159.54 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTC--------GTTGCCTGCC-CTTCGCTGCAATCTC-TTTGTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTCT------GACGCTTGGCTTGGCGAAGAA---CTTG---TCTCGAGGGACAAACAGCACGCCACCCACTAC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCATC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTTCG--------------------------------ACACA-AC-TCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_161.55 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_177.71 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTC--------GTTGCCTGCC-CTTCGCTGCAATCTC-TTCGTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGAAATCTGCGATAAGGTCT------GACGCTTGGCTTGGCGAAGAA---CTTG---TCTCGAGGGACAAACAGCACGCCACCCACTAC--------------------------------------------TACC----TGAACACATCACTGACAGT---TCATC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTCCG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_188.54 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCGACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------????????????????TTGCCTGCC-CTTCGCTGCAATCTC-TTTGTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTCT------GACGCTTGGCTTGGCGAAGAA---CTTG---TCTCGAGGGACAAACAGCACGCCACCCACTAC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCATC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_allicinum_CBS_366.80 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAT-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCAT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGTTG--------------------------------AACAA-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGCACGGAA-ACTAACAGTG-------A-CAAGGTACAATGTTACAGTTATCGACGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_399.80 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTC--------GTTGCCTGCC-CTTCGCTGCAATCTC-TTCGTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGAAATCTGCGATAAGGTCT------GACGCTTGGCTTGGCGAAGAA---CTTG---TCTCGAGGGACAAACAGCACGCCACCCACTAC--------------------------------------------TACC----TGAACACATCACTGACAGT---TCATC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTCCG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_521.68 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTC--------GTTGCCTGCC-CTTCGCTGCAATCTC-TTCGTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGAAATCTGCGATAAGGTCT------GACGCTTGGCTTGGCGAAGAA---CTTG---TCTCGAGGGACAAACAGCACGCCACCCACTAC--------------------------------------------TACC----TGAACACATCACTGACAGT---TCATC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTCCG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CBS_572.78 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CBS_813.71 ---------------TATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATTCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCAT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGTTG--------------------------------AACAA-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGCACGGAA-ACTAACAGTG-------A-CAAGGTACAATGTTACAGTTATCGACGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_11386 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_11840 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTACC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_12042 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_12045 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTTCC-AGCCAGACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTCCCG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCGATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_12046 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_12139 ------------------GTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CGTCTTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGTGCACTCTCCCG---------GCACCTC--------ACTGTCTGCT-CCTCGCTGCGATCTT----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGCCT------GACGCTTGGCTTGGCGAGGAA---CTTG---TCTCGAGGGACATGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCCTC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTTAG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACAGTTATCGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_12212 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_12921 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACAT---------------- Cladosporium_allicinum_CPC_22268 ---------------------------CCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CGTCTTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------------------TCGAGAAGGTGTGCACTCTCCCG---------GCACCTC--------ACTGTCTGCT-CCTCGCTGCGATCTT----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGCCT------GACGCTTGGCTTGGCGAGGAA---CTTG---TCTCGAGGGACATGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCCTC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTTAG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACAGTTATCGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22312 --------------------------GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------------------TCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCCTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22313 ----------------ATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTCG----ATCACCACCGAATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------------------TCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22343 ----------------------------CGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22349 --ATGCCAGTTCTGGTATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAAACACCTTTCCT----GCGCCC-TGCCAGACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCACCACT--CTCCCTTC----GACGCCATCAGTTCCAATGTCTAACCGCAGCACAGTATCATGATCGGTATGGGTCAGAAGGACTCGTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????------------------CATC-GAGAAGTTCGAGAAGGTGAGCACTCTTCCG---------GCGCCAT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTTGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22358 --ATGCCAGTTCTGGTATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------------GGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- Cladosporium_allicinum_CPC_22377 ---------------TATGTGCAAG-GCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGAT------------- 'Cladosporium allicinum DTO 005-E8' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CGTCTTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------GAGAAGGTGTGCACTCTCCCG---------GCACCTC--------ACTGTCTGCT-CCTCGCTGCGATCTT----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGCCT------GACGCTTGGCTTGGCGAGGAA---CTTG---TCTCGAGGGACATGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCCTC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTTAG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACAGTTATCGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATC------------ 'Cladosporium allicinum DTO 084-F3' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 086-D5' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 089-B9' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTACC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 089-G4' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CGTCTTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGCCT------GACGCTTGGCTTGGCGAGGAA---CTTG---TCTCGAGGGACATGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCCTC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 089-G6' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCA-AGCCAGACGCCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 089-H3' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 090-D3' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 090-H4' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------GAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATCA----------- 'Cladosporium allicinum DTO 101-A1' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCA-AGCCAGACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------------GGTGAGCACTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAA------------------------------------------------------------------------- 'Cladosporium allicinum DTO 101-I8' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCACTCTTCCG---------GCGCCTT--------GTTGTCTGGT-CATCGATGCAATCTC----TTCGCCCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCACAC-CGCGCTG--------------------------------AACAG-AC-ACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTCAACAGAA-ACTAATTAAA-------T-GCAGATACAACGTCACTGTCATTGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATC------------ 'Cladosporium allicinum DTO 106-C2' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 108-F9' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-TACCCGCAAC----CCTCCA-AGCCAGACGGCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGAGCATTCTCCTG---------GCGTCTT--------GCTTTCTGCC-CATCGCTGCAATCTC-TTCCTCGCCCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCCAAAC-CGCCTTC--------------------------------AACTC-ACAACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGCACAAAA-GCTAACTACC-------CAATCGGTACAACGTCACCGTTATTGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGAT------------- 'Cladosporium allicinum DTO 109-E5' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTACC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGACGAA---CTTG---TCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------CATC----TGAACACATCACTGACAAT---TCAAC-GCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 109-E6' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 109-F3' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCAAG------------------CCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCACC-ACAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 109-F5' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAACCCTGCCTGCC-AGCCAGACGGCCAGCTGACAA-CATC-TTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cladosporium allicinum DTO 109-I3' ------------------------------GTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCC-AGCCAGACGGCCAGCTGACAA-CGTCTTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCT--CCTCCTTG----ATCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????-------------------------------CGAGAAGGTGTGCACTCTCCCG---------GCACCTC--------ACTGTCTGCT-CCTCGCTGCGATCTT----TTCGCCCCACCAAG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGCCT------GACGCTTGGCTTGGCGAGGAA---CTTG---TCTCGAGGGACATGCAGCACGCCACCCACTCC--------------------------------------------TACC----TGAACACATCACTGACAAT---TCCTC-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTAAGTCAAACA-TCCTTAG--------------------------------ACACA-AC-TCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----CCCAACA-ACTAACACACC-----ATGAAAGGTACAACGTCACAGTTATCGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCA----------- 'Cladosporium allicinum DTO 109-I5' -----------------------------------------------------------GTTTTCCGTAAGTC---CAAAAA-CACCCGCAAC----CCTCCA-AGCCAGACGCCCAGCTGACAA-CATC-CTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTACTCCTCT--CCTCCCTGA---ACCACCACCGGATCCAATGTCTAACCGCAGCGCAGTATCATGATCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------??????????????????????????????????????????????????CCCACCATG------------------TCACCCCGCCTCG----TCGCAATCTGCGATAAGGTGTC----TGACGCCTGGCTTGGCGAAGAA---CTTGT-CTCTCGAGGGACAGACAGCACGCCACCCACTCC--------------------------------------------TATC----TGAACACATCACTGACAAT---TCATC-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCTTGGACAAGCTGAAGTCCGAGCGTGAGCGCGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACTCCCAA--------------------------------------------------------