#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 09, 2020; 21:25 GMT TreeBASE (cc) 1994-2008 Study reference: Barrett R., Bayly M.J., Duretto M., Forster P.I., Ladiges P.Y., & Cantrill D.J. 2018. Phylogenetic analysis of Zieria (Rutaceae) in Australia and New Caledonia based on nuclear ribosomal DNA shows species polyphyly, divergent paralogues and incongruence with chloroplast DNA. Australian Systematic Botany, 31: 16-47. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21451] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=113; TAXLABELS Neobyrnesia_suberosa Zieria_adenodonta_MTM764 Zieria_adenophora_MJB2010 Zieria_alata_KM629212 Zieria_arborescens_DJO110 Zieria_arborescens_MBT270 Zieria_arborescens_MFD2035 Zieria_arborescens_MJB1868 Zieria_arborescens_MJB2251a Zieria_arborescens_RAB504 Zieria_arborescens_RAB512a Zieria_arborescens_glabrifolia_MTM213 Zieria_aspalathoides_Bean27984 Zieria_baeuerlenii_275527 Zieria_baeuerlenii_MJB2011 Zieria_bifida_MTM537 Zieria_boolbunda_KMS616 Zieria_buxijugum_RJ1897 Zieria_caducibracteata_745482 Zieria_caducibracteata_IRT9585 Zieria_cephalophila_TH339 Zieria_chevalieri_MJB2119 Zieria_citriodora_NGW2038 Zieria_collina_MJB2012 Zieria_collina_MTM507 Zieria_compacta_PIF34479 Zieria_covenyi_MJB2013 Zieria_cytisoides_AF5451 Zieria_cytisoides_DJO416 Zieria_distans_CMH157 Zieria_distans_MTM287 Zieria_eungellaensis_Bean4435 Zieria_exsul_2659_2691 Zieria_exsul_2661_2698 Zieria_formosa_MJB2014 Zieria_fraseri_fraseri_SPP1995 Zieria_fraseri_robusta_MTB3739 Zieria_furfuracea_euthadenia_MTM280 Zieria_furfuracea_furfuracea_466549 Zieria_furfuracea_gymnocarpa_PIF34232 Zieria_graniticola_MTM479 Zieria_granulata_MJB2016 Zieria_hindii_413359 Zieria_hydroscopica_PIF38247 Zieria_inexpectata_CMH201 Zieria_ingramii_759202 Zieria_ingramii_IRT613 Zieria_insularis_2653_2682 Zieria_insularis_2656_2681 Zieria_involucrata_506074 Zieria_involucrata_LMD143 Zieria_laevigata_MTM258 Zieria_laevigata_PIF34475 Zieria_lasiocaulis_492944 Zieria_lasiocaulisPG7908 Zieria_laxiflora_MTM385 Zieria_littoralis_MJB2017 Zieria_littoralis_RAB508 Zieria_madida_AF5320 Zieria_minutiflora_minutiflora_ABP2356 Zieria_minutiflora_minutiflora_PIF34313 Zieria_minutiflora_trichocarpa_KRM8283 Zieria_montana_PIF36219 Zieria_murphyi_440349 Zieria_murphyi_JA1356 Zieria_obcordata_RJC106 Zieria_obovata_KRM8071 Zieria_odorifera_2705_2679 Zieria_odorifera_2706_2678 Zieria_oreocena_DJO222 Zieria_oreocena_MJB1982 Zieria_oreocena_RAB580a Zieria_oreocena_RAB581 Zieria_parrisiae_RJ1899 Zieria_pilosa_MD2008 Zieria_pilosa_RAB502 Zieria_prostrata_2701_2667 Zieria_prostrata_2714_2668 Zieria_prostrata_758677 Zieria_rimulosa_JRC8002 Zieria_robertsiorum_AF5349 Zieria_robusta_DEA_s.n. Zieria_robusta_MFD2049 Zieria_scopulus_SPP1980 Zieria_smithii_AF5659 Zieria_smithii_DJO327 Zieria_smithii_KRM8282 Zieria_smithii_MJB2023 Zieria_smithii_MJB2029 Zieria_smithii_MJB2184 Zieria_smithii_MTM1127 Zieria_smithii_MTM275 Zieria_smithii_MTM303 Zieria_smithii_MTM926 Zieria_smithii_MTM929 Zieria_smithii_PIF33151 Zieria_smithii_PIF34139 Zieria_smithii_PIF36221 Zieria_smithii_PIF38231 Zieria_smithii_PIF38266 Zieria_smithii_PIF38276 Zieria_smithii_PIF38466 Zieria_smithii_RAB511 Zieria_smithii_RAB548 Zieria_smithii_SPP2032 Zieria_southwellii_MTM251 Zieria_tenuis_Bean4609 Zieria_tuberculata_RAB505 Zieria_vagans_PIF34832 Zieria_veronicea_insularis_WN14AE Zieria_veronicea_veronicea_MJB1980 Zieria_verrucosa_PIF34734 Zieria_whitei_AF5486 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42315] TITLE Zieria_ITS_ETS_data; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1342; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Neobyrnesia_suberosa ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACAACCTGTGAACTCTTGAAAACATTGGAGGGGTCATGCCTCGTGTGTGTCCCCCTCCCCTCTGCTGAAGCTGTGGGCTTGCGCCTGCGCTTTTTGCGGAACAACAAACCCCGGGCGCAGTGCGCGCCAAGGAATACTAAAAAAGGACAGGACAATCCCAGGCCCCGGACACGGTGCGCTTGGGGTGTGGTGCCTCGTTTTATAATATCTACAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTTGTGGCCTTGGTGGTGTCGGCGGAGAATGGCCTCCCGTGAGCTTGCGCTCGTGGTTGGCTCAAATATGAGTCCTCGGCGACGGGGGCCGCGACATTCGGTGGTGCAA-GCAT-GCCTTTCGAGATCGTGTTGCGTGCCCCTCGTTTC-GTCAAGGGATTGAAAGACCCTGATGCCCTGTGCAAGTGGAGCTCGCATTGCGACCCCAGGTCAGGCGGGATTACCCGCTGA???????????????????????????????????????????????????????????----------TGCAGGCTCCGTGCTGGTG-CATTGAACTGTCAATGCTCCATCCACTTCAATTCTATCCCCAAGCGAAGCTCTTT-CCTTGTGGGTTTGTGCGGTATCCTGTGTTGCTTACCAATGGAATGGAATTCAATGGTTTAGTCCCAAGGATCTGCCTTGTGCCTTTCAGAGGT-GCATGGCAGACATGAAGCAAGCATCGTGTTCCCAGCTTTTACCTA-TTGCACTTGCATATTGGTCGCTGTGGTCCATGGTGCCTTTGCTTGTTGTCTTGGATGCGGAAAGCTAAATGCTGGCGTGAGGTCTA-ATCCTCAAATCGTCCAAGCACATTGACCCTTGACTCGAATGACTGTCGCGCTTGTCTTGATCTCTCTGACCAAGGCCTCATCATGGGGCTT-CTGGACGAGGAGGGCTCTCATGCGGGTGTTGGCGTCTAAAAGGAA-GTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTC??? Zieria_adenodonta_MTM764 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAG????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-{AG}CGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCAC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_adenophora_MJB2010 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTTGTGTGCGC-----TCCCCTCTGCTTCAGGTTCGGGCTCATCCCCCTGCCTGTTGTGGAACAACAAACCCCGGGCGCAATGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTAGGATGCAGTGCCTTCTTTAAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCA-CCCCAACCCTTTAG-GGCCTTGTAGGTGTAGGCGGAGATTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------????????????????GTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCATGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACTTGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTTGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCTTTTGACTCGAATGACTGCTGCACCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGTGCTC--ACGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_alata_KM629212 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCAATGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GGGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGTCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTCTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGTTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTTGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_arborescens_DJO110 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACAC{CT}ACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_arborescens_MBT270 ???????????CTTATCATTTAGACCAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCAGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCTGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTA?????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCTCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_arborescens_MFD2035 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCGCTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTCACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_arborescens_MJB1868 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGG{GT}GCGTGCCTCGTGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACC?????????????????????????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTG????????????????????? Zieria_arborescens_MJB2251a ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCAGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTA???????????????????????????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCTCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_arborescens_RAB504 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCAGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTTTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-GCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCTCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_arborescens_RAB512a ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGTGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGA?????????????????? Zieria_arborescens_glabrifolia_MTM213 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGTGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGG??????????????????????????????????----------?????????CGTGCTGGTG-C{AT}TCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGAGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA?? Zieria_aspalathoides_Bean27984 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATACCCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCACCGGAAACGGTGCGCCTGGGGTGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCTTTTAG-GTCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CATATTATTGCCTCTCGAGATCATGTCGCGAGCCAA-AGTATCCGTTTAGGGACTCAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCG?????????????????????????????????????????????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTGGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGCGGATTCGCCTTGTGCCCTCT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTATATGCTCTGGCATAT-GGTTGTTATGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTTCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_baeuerlenii_275527 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGTGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGCGCTTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGTGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CCTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTG{AT}GTTGCTTACCATTGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTCGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTGTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_baeuerlenii_MJB2011 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGTGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGCGCTTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGTGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTG{AT}GTTGCTTACCATTGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTCGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTGTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_bifida_MTM537 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGTGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGC{CG}GCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_boolbunda_KMS616 ????????????????????????????????????????????????????????????????????AGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACTGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCT???????????----------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATTGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_buxijugum_RJ1897 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGTCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTTTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAG????????????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGC{AG}TGGTATCCTGTGTTGCTTACCAAAGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_caducibracteata_745482 ????????????????????????????????????????????????????????????????????AGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGGCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCTTCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCA??????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_caducibracteata_IRT9585 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGG{CG}CCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCTTCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCA?????????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATT{CT}GATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CC{AT}ACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTG????????????? Zieria_cephalophila_TH339 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTCTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTTCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_chevalieri_MJB2119 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAAAGACCTGTGAACTCTTCAAAACACCACTGGGGGCTTGCCTCGCGTGCGC-----TCCCATCTGCCTCAGGTGCGGGCTCAACCCCCCACCTGATGTGCAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAGACGGTGTGCCTGGGATGTAGTGCCTTCTTTCAAATTATGTATAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCAAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAATCATTGCCTCGCGAAATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGACGCTCTGCGCAAG{CT}GGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------??????????GTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTCTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTTGTGCTCTTT-TTGGCCACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGGCCATGGTGTCTTTGCCTGTTATCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTGTA-GGCCTCAAATCGTTGATGCACACTATCCATTGACTCGAATGACTGCTG{CT}GCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCAGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_citriodora_NGW2038 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTTAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATCCCCCC{GT}CCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGTT-CAGTG{CT}CTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCTAAATATGAGTCCTTGGCGACGAAAGCCACGACAATCGGTGGT-AAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTATCCGTTTATGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGA??????????????????????????????????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCCATCCGCTTCAAT-CTTCCCCCAAGTGAAGCTCATT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTAAATGTTTTTGTTTTGTGGATTCGCCTTGTGC-CTTT-TGGGT-GCGGGGTGGACGTGAGGTGAGAACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCACTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGCCGAAGCACACTAACCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTTATGGGGCTTACTGGATGAGGAGGGCTC--AT-CGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTG????????????? Zieria_collina_MJB2012 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGT{CT}GAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACC?????????????????????????????????????????????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCG{CT}GTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGA{CG}TGACTGC{GT}G{CT}GCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_collina_MTM507 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGC{CT}TCGTGTGCGC-----TCCCCTCT{AT}CCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATT{CT}GCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTG{AG}TGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_compacta_PIF34479 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGTGCGCCTCGCGTGCGC-----TCTCCTCTGCCTCAGGTGTGGGCTCATCCCCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCAGAAATGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-TCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-GAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTT-GGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCTTTGTGCTCTTT-TGGGC-ATAGGGTGAACGTGAGGTGAGAATTGTGTTCCCAACATG--CCTACATGGTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCATGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTGAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_covenyi_MJB2013 ????????????????????????????????????????????GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGG{CT}GTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCTTCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGTTCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAG?????????????????????????????????????????????????????????????????????????????????----------??????????????????G-CATCGAACTGTTGACGCTCTGTCCGCTTC{CT}{CG}T-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTTGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCTAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAA{GT}GCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_cytisoides_AF5451 ???????????????????????????????????????????????????????????????????AAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAGACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCC????????????????????????????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGTGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_cytisoides_DJO416 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAATGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTATGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTACTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTACTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCCC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_distans_CMH157 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCCACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGCGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCT{CG}GCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTTAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCA??????????? Zieria_distans_MTM287 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCCACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACA{AT}CAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTTAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------??????????????????G-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTTAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTG{CT}AAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_eungellaensis_Bean4435 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCTCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCTGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_exsul_2659_2691 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGA-----TCCCCTCTGCCTCAAGTGCGGGCTCAACACCCCACCTGATGTGGAACAAAAAACCCCGGGCGCAACGTGCGCCAAGGAAAACTAACAA--GATTGCACGATCACAGGCCCCGGACACGGAGTGCCTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGTGGTGTAGGCGGAGAGTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATACAAGTCCTCGGCGACAAAAGCCGCGACAATCGGTGGT-CAAAGCGTTGCCTCACGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCTTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGATGCTCTATCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTAGTTTTGCGGATTCGCCTTGTGCTCTTTCTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCGGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGTGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_exsul_2661_2698 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCCCTCCCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGGGATGTAGTGCCTTCTTTCAAA-TATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGTGATACTTG-TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCAAAATACGAGTCCTCGGCGACAAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGT?TCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGAGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTTAAATCGTTGATGCACACTATCCTTTGACTCGAAT?ACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_formosa_MJB2014 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGTCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTTTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGA???????????????????????????????????????????????????????????----------????????????????????CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAAGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATT???????????????????????????? Zieria_fraseri_fraseri_SPP1995 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGA-----TCCCCTCTGCCTCAAGTGCGGGCTCAACACCCCACCTGATGTGGAACAAAAAACCCCGGGCGCAACGTGCGCCAAGGAAAACTAACAA--GATTGCACGATCACAGGCCCCGGACACGGAGTGCCTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAGTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATACAAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCGTTGCCTCACGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCTTGATGCTCTGCGCAAGTGGAGCTTGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------??????????????????G-CATCGAACTGTTGATGCTCTATCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTAGTTTTGCGGATTCGCCTTGTGCTCTTTCTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCGGCCCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_fraseri_robusta_MTB3739 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGA-----TCCCCTCTGCCTCAAGTGCGGGCTCAACACCCCACCTGATGTGGAACAAAAAACCCCGGGCGCAACGTGCGCCAAGGAAAACTAACAA--GATTGCACGATCACAGGCCCCGGACACGGAGTGCCTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAGTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATACAAGTCCTCAGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCGTTGCCTCACGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCTTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTA??????????????????????????????????????????????????????----------????????????????????CATCGAACTGTTGATGCTCTATCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTAGTTTTGCGGATTCGCCTTGTGCTCTTTCTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCGGTGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_furfuracea_euthadenia_MTM280 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAATGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_furfuracea_furfuracea_466549 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGGTCACAGGCCCCGGAAACGGTGCGCTTGGGATGCAGTGCCTTCTTTGAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATT{AC}AATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCT{AG}GCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCG{CT}GAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_furfuracea_gymnocarpa_PIF34232 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGACTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------?????????CGTGCTGGTGTCATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_graniticola_MTM479 ???????????????????????????????????????????????????GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC------CCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCACGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCC????????????????????????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACGGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_granulata_MJB2016 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCC{AT}A-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGAGTCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTTTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAAT???????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAAGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-A{CT}GGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_hindii_413359 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGACGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCAAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTTGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTTACTCAAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_hydroscopica_PIF38247 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCAA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTATGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGG{AG}TTCGCCTACTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTACTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_inexpectata_CMH201 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCC-TCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCACGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGATCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCCAATCGTTGATGCACACTATCCTTTGACTCGAATGACGGCTGCGCTTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTT--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_ingramii_759202 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTTCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATCCCCCTGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATGACAGGCCCCGGAAACGGTGCGCCTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGG-ATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGATGAAAGCCGCGACAATCGGTGGT-CATATTATTGCCTCTCGAGATCATGTCGCGAGCCAA-AGTATCCGTTTAGGGACTCAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTTGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGCGGATTCGCCTTGTGCCCTCT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTTTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATTCTTTGACTCGAATGACTTCTGCGCCCGTCTTGATCTCTCTGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGAGCTC--ATGCGGGCGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_ingramii_IRT613 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTTCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATCCCCCTGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATGACAGGCCCCGGAAACGGTGCGCCTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGG-ATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGATGAAAGCCGCGACAATCGGTGGT-CATATTATTGCCTCTCGAGATCATGTCGCGAGCCAA-AGTATCCGTTTAGGGACTCAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAA?????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTTGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGCGGATTCGCCTTGTGCCCTCT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTTTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATTCTTTGACTCGAATGACTTCTGCGCCCGTCTTGATCTCTCTGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGAGCTC--ATGCGGGCGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTG????????????? Zieria_insularis_2653_2682 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATACCCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGCGCCTGGGATGCAGTGCCTTCTTTCAAATTATCTATAATG-CTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTG-CACGCATCGTTG-CCCCA-CCCCAACCTTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CATATTATTGCCTCTCGAGATCATGTCGCGAGCCAA-AGTATCCGTTTAGGGACTCAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTGGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGCGGATTCGCCTTGTGCCCTCT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCC?ACATG--CTTATATGCTCTGGCATAT-GGTTGTTATGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTTCTGCGCCAGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_insularis_2656_2681 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGTAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCTGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTG?CTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTC?GACTGTGAAACTGCGAATGGCTCA-- Zieria_involucrata_506074 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCCC{AG}CCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCG{AC}AAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGTCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTT{AG}TTGTGGCACATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGAGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGC{AG}CCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_involucrata_LMD143 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGAAAGTGGAGCTCGCATCGCGACCCCAGGTCA?????????????????????????????????????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGTCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCACATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGAGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCACCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_laevigata_MTM258 ???????????????????????????????????????????????????GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTTGTGTGCGC-----TCCCTTCTGCCTCAGGTGCGGGATCAAC-CCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCCTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGTTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTTCGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTTGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAG????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTG?-TTGCGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCATTGTGTTCCCAACATG--CCTACATGCT{CT}TGGCATTT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCTAAGCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCTCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_laevigata_PIF34475 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTTGTGTGCGC-----TCCCTTCTGCCTCAGGTGCGGGATCAAC-CCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCGCGATCACAGGCCCCGGACACGGTGCGCCTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGTTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTTCGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTTGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTG?-TTGCGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCATTGTGTTCCCAACATG--CCTACATGCTCTGGCATTT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCTAAGCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCTCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_lasiocaulis_492944 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTTATCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTACAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--C{CG}TACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATC{AG}TTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_lasiocaulisPG7908 ????????????????????????????????????????????????????????????CCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTTATCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTACAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTAATTAACGGC----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_laxiflora_MTM385 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGA-----TCCCCTCTGCCTCAAGTGCGGGCTCAACACCCCACCTGATGTGGAACAAAAAACCCCGGGCGCAACGTGCGCCAAGGAAAACTAACAA--GATTGCACGATCACAGGCCCCGGACACGGAGTGCCTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAGTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATACAAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCGTTGCCTCACGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAACCATATCAATAAGC???????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGATGCTCTATCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTAGTTTTGCGGATTCGCCTTGTGCTCTTTCTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCGGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATG{CT}GGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_littoralis_MJB2017 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGCGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTTGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCG{CT}GACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTTGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCA{AC}TGGTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACTTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_littoralis_RAB508 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAA{CT}GACCTGCGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTTGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTTGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCACTGGTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACTTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_madida_AF5320 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTTAAAACACCAATGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GGGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGTCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCTCTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGTTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCA?????????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTTGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_minutiflora_minutiflora_ABP2356 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCCCTCCCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCAAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGA????????????????????????????????????----------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTAACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGAGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTTAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_minutiflora_minutiflora_PIF34313 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCCCTCCCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGGGATGTAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCAAAATACGAGTCCTCGGCGACAAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGG?????????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGAGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTTAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_minutiflora_trichocarpa_KRM8283 ??????????????????????????????????????????????????????????????????GAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGCGCGC-----TCCCCCCTCCCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG?-CCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGAGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTGAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCTGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_montana_PIF36219 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTTATCAAAACACCACTGGGGGCGTGCCTCG{CT}GTGCGC-----TCCCCTCTGCTACAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACT{AG}A{AT}GGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAA??????????????????????????????????????????????????????????----------????????????????GTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTTGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_murphyi_440349 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAATGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CATTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTCACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_murphyi_JA1356 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAAC{AG}ACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATC{AG}CTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ATGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTCACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_obcordata_RJC106 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCCTGCCTGTTGTGGAACAACAAACCCCGGGCGCAATGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCATGGGATGCAGTGCCTTCTTTAAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGTTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGTGGTGTAGGCGGAGATTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTATTTTGCGTATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACTTGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGTGCTC--ACGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_obovata_KRM8071 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGCGCGC-----TCCCCCCTCCCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG?-CCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------???????????????????????????CTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGAGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTGAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCAAGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCTGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_odorifera_2705_2679 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTC?TGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCCTGCCTGTTGTGGAACAACAAACCCCGGGCGCAATGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCATGGGATGCAGTGCCTTCTTTAAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGA?GAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGTGGTGTAGGTGGAGATTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTATTTTGCGTATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACTTGCTTTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGA?TGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGTGCTC--ACGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTC--- Zieria_odorifera_2706_2678 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATCCCCCCGCCTGTTGTGGAACAACAAAACCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGGTCACAGGCCCCAGAAACGGTGCACCTGAGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGTGGTGTAGGTGGAGATTGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGCGGATTCGCCTTGTGCCCTCT-TGGGCCACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGTGCTC--ACGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_oreocena_DJO222 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTT{CG}{AC}GGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTCGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTTACTCGAAAGACTGTTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_oreocena_MJB1982 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTCGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTTACTCGAAAGACTGTTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_oreocena_RAB580a ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?GCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTCGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTTACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA?? Zieria_oreocena_RAB581 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCTTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGTGATGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCAA-CGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA?????????????????????????????????----------?GCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAT-AAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTTTGGCATAT-GGTTGTTGTCGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCATATCGTTGATGCACACTATCCTTTTACTCGAAAGACTGTTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA?? Zieria_parrisiae_RJ1899 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGTCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGC{AT}TGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTTTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAAAGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGCGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_pilosa_MD2008 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA?????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAATTGGAATTCAATGTTTTTGTTTTGTGGATTCGGCTTGTGCCCTTT-TGGGC-ACAAGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTATGGCCTCAAATCGTTGATGCACACTATTCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTTATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_pilosa_RAB502 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAATTGGAATTCAATGTTTTTGTTTTGTGGATTCGGCTTGTGCCCTTT-TGGGC-ACAAGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATTCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTTATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_prostrata_2701_2667 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCC?GGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCACG?CAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGTGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTAGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_prostrata_2714_2668 ------------------------GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTTATCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTACAGGTGCGGGCTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGTAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA------------------------------------------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CT?TCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTTGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA-- Zieria_prostrata_758677 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGTGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTAGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGC{AG}GATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAA????????? Zieria_rimulosa_JRC8002 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAAGCAGAACGACTTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCTACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATCCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGTTATCACTTGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAGGCATTGCCTCTGGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTTGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGTGTCTAAGAGGAATACTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_robertsiorum_AF5349 ????????????????????????????????????????????????????????????????????????????????GAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGA{CT}GAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------????????????GCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGA?????????????????? Zieria_robusta_DEA_s.n. ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGT{AG}TGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGTCACGGTGCGCTTGGGATGCAGTGCCTTCTTTGAAATTATATATAA{CT}GACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATC{AC}TGTCGCGAGCCTA-TGTTTCCGTTTTTGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTTTCCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGT{GT}TTTGTTTTGTGGATTCGCCTTGTGC-CTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTT{GT}GACTCGAAAGACTGCTGTGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_robusta_MFD2049 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTTCAGGTGCGGGCTCATCCCCTCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTGAAATTATATATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGTGGTGTAGGCGGAGAATGGCCTCCCGTGCGGCATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-TGTTTCCGTTTAGGGACTGAAGGACCCTGATGCTCTGTGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCATA???????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTTTCCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGT{AG}C-CTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTC{AT}AGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGTGCCCGTCTTGATCTCTCCGACCAAGGCCTCT{GT}{AT}ATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGT{AT}GG{CT}GTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_scopulus_SPP1980 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCA{CT}AGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAA?????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTT{GT}GATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCC{CG}GTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_AF5659 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTT-TTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCACGGTTGGCCAAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_DJO327 ????????????????????????????????????????????????????????????????????AGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTAA????????----------TGCAGGCTCCGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_KRM8282 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGT{CG}CGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTC{AG}CGGTTGGCC{AG}AAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_smithii_MJB2023 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGACTTGTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATA????????????????????????????????????????????????----------?????????C?TGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_MJB2029 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTG{CT}GCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------???????????TGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGTGGGTTCGCGTGGTATCCTGTGTTGCTTACCATTGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTTTTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATT--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTACTGCGCCCGTCTTGATCTCTCCGACCAAAGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_MJB2184 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTGTAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTTTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGTCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_smithii_MTM1127 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACTAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATACAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGACGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCAGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGATGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAAC??????????????? Zieria_smithii_MTM275 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTT{CG}AAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCAC{CT}AGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGAT{AG}CAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGA{CG}GTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGC{AG}GATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGG{CT}CTCTTAATGTGGCTTACTGGA{CT}GAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_MTM303 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????C?TGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_MTM926 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGACTTGTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_MTM929 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGACTTGTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_PIF33151 ????????????????????????????????????????????????????????????????????AGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACCAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCA??????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCTCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_PIF34139 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGATATGGTGTGCTTGGGATGCAGTGACTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACCGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGATGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_PIF36221 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGATATGGTGTGCTTGGGATGCAGTGACTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGGGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTAAGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGATGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_PIF38231 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTAAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGTAGTGCCTTCTTTCAAATTATCAATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCGTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATAACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-C{AG}AAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTAACCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------???????????TGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTATTT-TGGGC-AC-GGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCTGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_smithii_PIF38266 ???????????????????????TGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGC{CG}TTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTAT{CG}CGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAG?-CTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGACCTA-GAACTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC???????????? Zieria_smithii_PIF38276 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTGAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAATGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGTCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_PIF38466 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTTATCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTACAGGTGCGGGGTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????????CTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_smithii_RAB511 ????????????????????????????????????TGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCCGTGAACTCTTGTAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATC??????????????????????????????????????????????----------??????????????TGGTG-CATCGAACTGTTGACGCTTTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGTCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_smithii_RAB548 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTG{CT}GCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGTGGGTTCGCGTGGTATCCTGTGTTGCTTACCATTGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTTTTGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATT--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTACTGCGCCCGTCTTGATCTCTCCGACCAAAGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_smithii_SPP2032 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GTAGAACGACCCGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACTAGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCTGGAAACGGTGTGCTTGCGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTTGAGATCATGTCACGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTAGCAGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGTGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_southwellii_MTM251 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTTA{AT}CAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTGCTACAGGTGCGGGGTCATC-CCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGTAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATTG-CCCCA-CCCCAACCCCTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTAACACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGTATTGTCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAAGGACTGAAGGACCCTGATGCTCTGCGCAAGTAGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCA?????????????????????????????????????????????----------??????????????????G-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CT{CG}TCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCGATGTTTTTGTTTTGTGGATTCGCCTTGTGCCCTTT-TGGGC-ACGGGGTGGACATGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCCCTGGCATAT-GGTTGTT{AG}TGGCCCATGGTGTCTTC{AG}CTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGGGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCA?? Zieria_tenuis_Bean4609 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCATTGGGGGCGTGCCTCGTGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCTCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTACACGATCACAGGCACTGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGTGACAATCGGTGGT-GAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-TGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTACGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTCAGGGTTTGCGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAATGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCACCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGAGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_tuberculata_RAB505 ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTATTCAAAACACCACTGGGGTCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCG{AG}AAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTTTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATA??????????????????????????????????????????----------?????????CGTGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAA{CG}GAAATGGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTG{CT}GGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACT?????????????? Zieria_vagans_PIF34832 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGAAAACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCTTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAA-GGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? Zieria_veronicea_insularis_WN14AE ???????????????????????????????????TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCATTGGGGGCGTGCCTCGTGCGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCAC{CT}CCCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGACACGGTGCGCTTGTGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-GAAAGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAA??????????????????????????????????????????????????????????----------???????????TGCTGGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATAAAATGGAATTCAATGTTTT-GTTTTGTGGATTCGCCTTGTGCCCTT?-TCGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTTTTGATCTCTCCGACCAAGGCCTCTTAATGGGGTTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCATCTAAGAGGAATGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_veronicea_veronicea_MJB1980 ?????????????????????????????????AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGTGCGCGC-----TCCCCTCTGCCTCAGGTGCGGGCTCATCCCCCCGCCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACGA--GAGTGCACGATCACAGGCCCCGGTCACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGCGGTATCACTCGCGGTTGGCCGAAATATGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAACGTATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAGCG??????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAAGCTCTTT-CCTTGAGGGTTCGTGTGGTATCCTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTT-GTTTTGTGGATTCGCCTTGTGCCCTT?-TCGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAGATCGTTGATGCACACTATCCTTTGACTCGAAAGACTGCTGCGCCCGTCTTGATCTCTCTGACCAAGGCCTCTTAATGGGGTTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCATCTAAGAGGAATGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGA?????????? Zieria_verrucosa_PIF34734 ????????????????????????GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGG-CGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTG{AT}TGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGAAAACGGTGCGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCTTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCAATAAG????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCCTGTGTTGCTTACCAATGAAA-GGAATTCAATGTTTTTGTTTTGCGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTAGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCGCTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGCGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTG????????????? Zieria_whitei_AF5486 ?????????????????????????????????????GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTA-GCAGAACGACCTGTGAACTCTTCAAAACACCACTGGGGGCGTGCCTCGCGTGCGC-----TCCCCTCTACCTCAGGTGCGGGCTCAACACCCCACCTGTTGTGGAACAACAAACCCCGGGCGCAGTGTGCGCCAAGGAAAACTAACAA--GAGTGCACGATCACAGGCCCCGGAAACGGTGTGCTTGGGATGCAGTGCCTTCTTTCAAATTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCTGTTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTG-CCCCA-CCCCAACCCTTTAG-GGCCTTGGAGGTGTAGGCGGAGAATGGCCTCCCGTGAGGTATCACTCGCGGTTGGCCGAAATACGAGTCCTCGGCGACGAAAGCCGCGACAATCGGTGGT-CAAAGCATTGCCTCTCGAGATCATGTCGCGAGCCTA-CGTATCCGTTTAGGGACTGAAGGACCCTGATGCTCTGCGCAAGTGGAGCTCGCATCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAAGCATATCA?????????????????????????????????????????????----------???????????????GGTG-CATCGAACTGTTGACGCTCTGTCCGCTTCAAT-CTTTCCCCAAGTGAATCTCTTT-CCTTGAGGGTTCGCGTGGTATCTTGTGTTGCTTACCAATGAAATGGAATTCAATGTTTTTGTTTTGTGGATTCGCCTAGTGCTCTTT-TGGGC-ACGGGGTGGACGTGAGGTGAGCACTGTGTTCCCAACATG--CCTACATGCTCTGGCATAT-GGTTGTTGTGGCCCATGGTGTCTTCACTTGTTCTCTTGGATGCGGAAAGCTATGTGTGGGCGTGAGGTCTA-GGCCTCAAATCGTTGATGCACACTATCCTTTGACTCGAATGACTGCTGTGCCCGTCTTGATCTCTCCGACCAAGGCCTCTTAATGTGGCTTACTGGACGAGGAGGGCTC--ATGCGGGTGTTGGCGTCTAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCG??????????? ; END; BEGIN ASSUMPTIONS; WTSET untitled = 1: 1-1342 ; WTSET * untitled = 1: 1-1342 ; END; BEGIN TREES; TITLE Zieria_ITS_ETS_data; LINK TAXA = Taxa1; TRANSLATE 1 Neobyrnesia_suberosa, 2 Zieria_adenodonta_MTM764, 3 Zieria_adenophora_MJB2010, 4 Zieria_alata_KM629212, 5 Zieria_arborescens_DJO110, 6 Zieria_arborescens_MFD2035, 7 Zieria_arborescens_MJB1868, 8 Zieria_arborescens_MJB2251a, 9 Zieria_arborescens_glabrifolia_MTM213, 10 Zieria_arborescens_MBT270, 11 Zieria_arborescens_RAB504, 12 Zieria_arborescens_RAB512a, 13 Zieria_aspalathoides_Bean27984, 14 Zieria_baeuerlenii_MJB2011, 15 Zieria_baeuerlenii_275527, 16 Zieria_bifida_MTM537, 17 Zieria_boolbunda_KMS616, 18 Zieria_buxijugum_RJ1897, 19 Zieria_caducibracteata_745482, 20 Zieria_caducibracteata_IRT9585, 21 Zieria_cephalophila_TH339, 22 Zieria_chevalieri_MJB2119, 23 Zieria_citriodora_NGW2038, 24 Zieria_collina_MJB2012, 25 Zieria_collina_MTM507, 26 Zieria_compacta_PIF34479, 27 Zieria_covenyi_MJB2013, 28 Zieria_cytisoides_DJO416, 29 Zieria_cytisoides_AF5451, 30 Zieria_distans_MTM287, 31 Zieria_distans_CMH157, 32 Zieria_eungellaensis_Bean4435, 33 Zieria_formosa_MJB2014, 34 Zieria_fraseri_fraseri_SPP1995, 35 Zieria_fraseri_robusta_MTB3739, 36 Zieria_furfuracea_euthadenia_MTM280, 37 Zieria_furfuracea_furfuracea_466549, 38 Zieria_furfuracea_gymnocarpa_PIF34232, 39 Zieria_graniticola_MTM479, 40 Zieria_granulata_MJB2016, 41 Zieria_hindii_413359, 42 Zieria_hydroscopica_PIF38247, 43 Zieria_inexpectata_CMH201, 44 Zieria_ingramii_759202, 45 Zieria_ingramii_IRT613, 46 Zieria_involucrata_506074, 47 Zieria_involucrata_LMD143, 48 Zieria_laevigata_PIF34475, 49 Zieria_laevigata_MTM258, 50 Zieria_lasiocaulis_492944, 51 Zieria_lasiocaulisPG7908, 52 Zieria_laxiflora_MTM385, 53 Zieria_littoralis_RAB508, 54 Zieria_littoralis_MJB2017, 55 Zieria_madida_AF5320, 56 Zieria_minutiflora_minutiflora_ABP2356, 57 Zieria_minutiflora_minutiflora_PIF34313, 58 Zieria_minutiflora_trichocarpa_KRM8283, 59 Zieria_montana_PIF36219, 60 Zieria_murphyi_440349, 61 Zieria_murphyi_JA1356, 62 Zieria_obcordata_RJC106, 63 Zieria_obovata_KRM8071, 64 Zieria_oreocena_DJO222, 65 Zieria_oreocena_MJB1982, 66 Zieria_oreocena_RAB580a, 67 Zieria_oreocena_RAB581, 68 Zieria_parrisiae_RJ1899, 69 Zieria_pilosa_RAB502, 70 Zieria_pilosa_MD2008, 71 Zieria_prostrata_758677, 72 Zieria_rimulosa_JRC8002, 73 Zieria_robertsiorum_AF5349, 74 Zieria_robusta_DEA_s.n., 75 Zieria_robusta_MFD2049, 76 Zieria_scopulus_SPP1980, 77 Zieria_smithii_AF5659, 78 Zieria_smithii_DJO327, 79 Zieria_smithii_KRM8282, 80 Zieria_smithii_MJB2184, 81 Zieria_smithii_MJB2023, 82 Zieria_smithii_MJB2029, 83 Zieria_smithii_MTM275, 84 Zieria_smithii_MTM303, 85 Zieria_smithii_MTM926, 86 Zieria_smithii_MTM929, 87 Zieria_smithii_MTM1127, 88 Zieria_smithii_PIF33151, 89 Zieria_smithii_PIF34139, 90 Zieria_smithii_PIF36221, 91 Zieria_smithii_PIF38231, 92 Zieria_smithii_PIF38266, 93 Zieria_smithii_PIF38276, 94 Zieria_smithii_PIF38466, 95 Zieria_smithii_RAB511, 96 Zieria_smithii_RAB548, 97 Zieria_smithii_SPP2032, 98 Zieria_southwellii_MTM251, 99 Zieria_tenuis_Bean4609, 100 Zieria_tuberculata_RAB505, 101 Zieria_vagans_PIF34832, 102 Zieria_veronicea_insularis_WN14AE, 103 Zieria_veronicea_veronicea_MJB1980, 104 Zieria_verrucosa_PIF34734, 105 Zieria_whitei_AF5486, 106 Zieria_insularis_2656_2681, 107 Zieria_insularis_2653_2682, 108 Zieria_exsul_2661_2698, 109 Zieria_exsul_2659_2691, 110 Zieria_prostrata_2701_2667, 111 Zieria_prostrata_2714_2668, 112 Zieria_odorifera_2705_2679, 113 Zieria_odorifera_2706_2678; TREE Bayes_con_50_majrule = [&R] (1:4.12404688332894,23:0.4146747272520409,(((((((2:0.04376699797420096,(24:0.04416893190170285,25:0.0353044855375516,((36:0.04037784669512474,(71:0.01816507337949292,110:0.04137094961794698):0.06807664830443445,78:0.01617672888928874,84:0.01725623827520326,88:0.09048795914072438,92:0.01660847617476968):0.1136821046660378,((80:0.01711309597540838,95:0.01807347375769832):0.09245355989029365,93:0.04254065261266365):0.06289672473203684,(83:0.01631306776018675,(87:0.08033415488026689,97:0.09265911169703023):0.05913409869956921):0.0579700556804434):0.06499971663509929):0.09243980760396997):0.04579514713624314,(((4:0.01648449672079707,55:0.0705466863403848):0.1419261356568559,21:0.06691128117892206):0.03995320828284246,((16:0.1157039517212566,(17:0.06877820063447516,(32:0.06938512143438745,73:0.01728045737066725,76:0.04159484838112718,77:0.06114514750724983,79:0.01749881040641048,91:0.06879146993942581,106:0.06540642304601334):0.04468668975323085):0.04130511270291512):0.0938033697062492,((56:0.04240054800912978,(57:0.01724204809833868,108:0.04023974338885498):0.06353713033128695):0.09109863229450071,(58:0.01683683367250029,63:0.04048703255103576):0.1200239272346668):0.08926328027044675):0.06905482554429855):0.0431740929497752,(14:0.01850229716126325,15:0.01695487544452621):0.2310766352308116,(18:0.01566037151164482,33:0.01721016348110967,40:0.04040387919086979,68:0.01549124546364646,100:0.06209983535641268):0.1103099269857821,(28:0.09502668489762577,42:0.04243694944333206):0.08924898817754573,(29:0.05052522289439702,105:0.09748090574792158):0.04371662558335398,(30:0.06692592951565983,31:0.03980990704713909):0.07800221013986706,(37:0.06669775966227337,(39:0.01798385886008899,43:0.1094980210146271):0.08660253561375239,(101:0.01701051841005983,104:0.01825428958145304):0.06620071013573876):0.03928375173514487,(38:0.01582843685842453,(81:0.01622317465389073,85:0.01618790186479575,86:0.01693953661521502):0.04110715370633844,(89:0.04253565671224373,90:0.01661798791050147):0.09015615672634755):0.09048923295507456,41:0.1410349748347189,(53:0.02007859745538966,54:0.01545190590001333):0.1881257303596816,72:0.2765861953595213,(82:0.01554429665361553,96:0.01654952247611406):0.1447960504286118,99:0.3629595194405416):0.1319051326650441,(22:0.5972108920657085,((34:0.0598764253934778,35:0.05929839820646465,109:0.1127350899046241):0.03974303808541143,52:0.0171805530530531):0.544273605366081):0.08173263406175775,(48:0.04011062815505944,49:0.01690945033539155):0.3785325246682321):0.08022719174651288,26:0.5494107086688745):0.09317205282789312,(((13:0.09392637000179828,107:0.1172869066887438):0.1623417099344724,(44:0.01613228853048938,45:0.01779409353755416):0.2896619873873252):0.1712113390560954,113:0.3112761594470044):0.08273547792885202):0.08355231962123784,(3:0.26835873628455,(62:0.04949439605420229,112:0.05516727694544724):0.1413814060155411):0.2762711685383659):0.09294769298102631,(((((5:0.01900966019887698,((6:0.03528868803328144,60:0.06960130147472782,61:0.01762721069212418):0.04182517878909279,(8:0.0159987756474348,10:0.04156553098863867,11:0.06385455369295664):0.09002939441715943,(9:0.03804008129773131,12:0.01609293336885121):0.03936850818594827,(19:0.0361376497343252,20:0.0179176418876704,27:0.1353894217500551):0.03876838247821675):0.04246658853018492,7:0.03997690504781683,((64:0.01869399119090497,65:0.04012578597065069):0.0409120141936555,66:0.01634978253429786,67:0.01773810739592833):0.0615439715189854):0.2192362538571093,(74:0.09073158916724597,75:0.03984594933621378):0.196301011760603):0.03915624133874106,(46:0.01731267301703344,47:0.02607802644860091):0.1841398990445161):0.1005524938510557,((50:0.01786272310357064,51:0.01751694503460491,59:0.04313317587878979,(94:0.01738699937400987,98:0.06568078431480187):0.04073962277708712,111:0.189243707628389):0.2077755046675333,(69:0.01607728575219347,70:0.01632387336200272):0.2354909355304659):0.0903397472113866):0.06337966389681646,(102:0.1375086136693707,103:0.1392161512174736):0.215427821691443):0.04139610290570586):0.2873243711537987); TREE MP_Strict = [&R] (1,(((((2,(((4,55),21),((16,(17,(32,73,76,77,79,91,106))),((56,(57,108)),(58,63)))),(14,15),(18,33,40,68,100),(24,25,((36,(71,110),78,84,88,92),(80,95),83,87,93,97)),(28,42),(29,105),((30,31),72),37,(38,(81,85,86),(89,90)),(39,43),41,(53,54),(82,96),99,(101,104)),(22,((34,35,109),52)),26,(48,49)),(((13,107),(44,45)),113)),(3,(62,112))),((((5,((6,60,61),(8,10,11),(9,12),(19,20,27)),7,((64,65),66,67)),(74,75)),(46,47)),((50,51,59,(94,98),111),(69,70)),(102,103))),23); END;