#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:07 GMT TreeBASE (cc) 1994-2008 Study reference: Hywel-jones N., Laessoe T., Nakargiri A., Okane I., Potacharoen W., Sivicha S., Srikitikulchai P., Toyama K., Læssøe T., Sivichai S., Suzuki K. 2008. Study of endophytic Xylariaceae in Thailand: diversity and taxonomy inferred from rDNA sequence analyses with saprobes forming fruit bodies in the field. Mycoscience, 49. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2161] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=126; TAXLABELS Biscogniauxia_atropunctata_AJ390411 Biscogniauxia_atropunctata_AJ390412 Biscogniauxia_margina_AJ390417 Biscogniauxia_mediterranea_AF280624 Biscogniauxia_mediterranea_AF326479 Biscogniauxia_mediterranea_AJ390413 Biscogniauxia_mediterranea_AJ390414 Biscogniauxia_nummularia_AJ390415 Biscogniauxia_repanda_AJ390418 Camillea_obularia_AF201714 Camillea_obularia_AJ390423 Camillea_tinctor_AJ390421 Camillea_tinctor_AJ390422 Creosphaeria_sassafras_AJ390424 Creosphaeria_sassafras_AJ390425 Diatrype_disciformis_AJ390410 Entonaema_pallida_AM900591 Hypoxylon_annulatum_AJ390395 Hypoxylon_cinnabarinum_AJ39039 Hypoxylon_fragiforme_AF201709 Hypoxylon_fragiforme_AJ390401 Hypoxylon_fragiforme_AJ390402 Hypoxylon_fuscum_AF201715 Hypoxylon_fuscum_AJ390404 Hypoxylon_fuscum_AJ390405 Hypoxylon_intermedium_AJ390396 Hypoxylon_papillatum_AF201710 Hypoxylon_perforatum_AJ390407 Hypoxylon_rickii_AJ390408 Hypoxylon_subgilvum_AJ390400 Kretzschmaria_clavus_AJ390434 Kretzschmaria_deusta_AJ390435 Kretzschmaria_deusta_AJ390437 Nemania_aenea_AJ390426 Nemania_aenea_AJ390427 Nemania_bipapillata_AJ390429 Nemania_bipapillata_AY541610 Nemania_chestersii_AJ390430 Nemania_diffusa_DQ658238 Nemania_primolutea_EF026121 Nemania_serpens_AJ390431 Nemania_serpens_AJ390432 Nemania_serpens_AJ390436 Rosellinia_necatrix_AB017657 Whalleya_microplaca_AJ390419 Whalleya_microplaca_AJ390420 Xylaria_acuta_AF163026 Xylaria_apiculata_AF163027 Xylaria_arbuscula_AF163028 Xylaria_arbuscula_AF163029 Xylaria_cornudamae_AF163031 Xylaria_cubensis_AF163032 Xylaria_enteroleuca_AF163033 Xylaria_fioriana_AF163034 Xylaria_grammica_DQ322145 Xylaria_hypoxylon_AF201711 Xylaria_hypoxylon_DQ491487 Xylaria_longipes_AF163038 Xylaria_mali_AF163040 Xylaria_multiplex_AY909018 Xylaria_polymorpha_AB274817 Xylaria_polymorpha_AF163041 Xylaria_venosula_EF026149 Xylariaceae_BCC_18731 Xylariaceae_BCC_18734 Xylariaceae_BCC_18737 Xylariaceae_BCC_18738 Xylariaceae_BCC_18739 Xylariaceae_BCC_18741 Xylariaceae_BCC_18743 Xylariaceae_BCC_18747 Xylariaceae_BCC_18752 Xylariaceae_BCC_18756 Xylariaceae_BCC_18768 Xylariaceae_BCC_18771 Xylariaceae_BCC_18772 Xylariaceae_BCC_18777 Xylariaceae_BCC_18778 Xylariaceae_BCC_18786 Xylariaceae_BCC_18793 Xylariaceae_BCC_18796 Xylariaceae_BCC_18797 Xylariaceae_BCC_18798 Xylariaceae_BCC_18853 Xylariaceae_BCC_18861 Xylariaceae_BCC_18862 Xylariaceae_BCC_18863 Xylariaceae_BCC_18865 Xylariaceae_BCC_18869 Xylariaceae_BCC_18870 Xylariaceae_BCC_18873 Xylariaceae_BCC_18886 Xylariaceae_BCC_18902 Xylariaceae_BCC_18905 Xylariaceae_BCC_20842 Xylariaceae_BCC_20844 Xylariaceae_BCC_20845 Xylariaceae_BCC_20849 Xylariaceae_BCC_20850 Xylariaceae_BCC_20930 Xylariaceae_BCC_20932 Xylariaceae_BCC_20933 Xylariaceae_BCC_20936 Xylariaceae_BCC_20940 Xylariaceae_BCC_20943 Xylariaceae_BCC_20950 Xylariaceae_BCC_20951 Xylariaceae_BCC_20955 Xylariaceae_BCC_20960 Xylariaceae_BCC_20971 Xylariaceae_BCC_20973 Xylariaceae_BCC_20986 Xylariaceae_BCC_20987 Xylariaceae_BCC_20988 Xylariaceae_BCC_20989 Xylariaceae_BCC_20991 Xylariaceae_BCC_20992 Xylariaceae_BCC_20993 Xylariaceae_BCC_20995 Xylariaceae_BCC_20996 Xylariaceae_BCC_20997 Xylariaceae_BCC_20998 Xylariaceae_BCC_20999 Xylariaceae_BCC_21000 Xylariaceae_BCC_21001 Xylariaceae_BCC_21002 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=150; TAXLABELS Biscogniauxia_mediterranea_microspora_BCC_1 Biscogniauxia_nummularia_exutans_BCC_110 Biscogniauxia_nummularia_merrillii_BCC_121 Daldinia_bambusicola_BCC_1103 Daldinia_eschscholzii_BCC_1242 Daldinia_eschscholzii_BCC_1313 Daldinia_sabahense_BCC_21041 Hypoxylon_cf_fendleri_BCC_21050 Hypoxylon_cf_subgilvum_BCC_22995 Hypoxylon_cf_symphyon_BCC_20324 Hypoxylon_cf_trugodes_BCC_23010 Hypoxylon_crocopeplum_BCC_1114 Hypoxylon_dieckmannii_BCC_22982 Hypoxylon_duranii_BCC_22993 Hypoxylon_fendleri_BCC_1106 Hypoxylon_haematostroma_BCC_1252 Hypoxylon_haematostroma_BCC_1314 Hypoxylon_macrocarpum_BCC_2365 Hypoxylon_monticulosum_BCC_236 Hypoxylon_moriforme_BCC_1176 Hypoxylon_nitens_BCC_23565 Hypoxylon_perforatum_BCC_18288 Hypoxylon_rubiginosum_BCC_1109 Hypoxylon_sp_BCC_1308 Hypoxylon_sp_BCC_23642 Kretzschmaria_cf_lucidula_BCC_18212 Kretzschmaria_cf_macrosperma_BCC_22760 Nemania_cf_bipapillata_BCC_20327 Nemania_diffusa_BCC_23666 Pestalotiopsis_sp_BCC_1119 Pestalotiopsis_sp_BCC_18778 Pestalotiopsis_sp_BCC_18798 Whalleya_aff_microplaca_BCC_2123 Xylaria_allantoidea_BCC_1340 Xylaria_anisopleura_BCC_17352 Xylaria_apiculata_BCC_1136 Xylaria_arbuscula_BCC_1156 Xylaria_aristata_BCC_1229 Xylaria_aristata_BCC_1260 Xylaria_atrosphaerica_BCC_20656 Xylaria_badia_BCC_1171 Xylaria_badia_BCC_1190 Xylaria_bambusicola_BCC_22739 Xylaria_bambusicola_BCC_23659 Xylaria_cf_amphithele_BCC_20377 Xylaria_cf_bambusicola_BCC_23627 Xylaria_cf_bambusicola_BCC_23628 Xylaria_cf_obovata_BCC_18718 Xylaria_cf_piperifomis_BCC_22987 Xylaria_coccophora_BCC_1085 Xylaria_consocata_BCC_18196 Xylaria_cubensis_BCC_1027 Xylaria_cubensis_BCC_1144 Xylaria_cubensis_BCC_1219 Xylaria_cubensis_BCC_1303 Xylaria_cubensis_BCC_1321 Xylaria_curta_BCC_1007 Xylaria_curta_BCC_1151 Xylaria_escharoidea_BCC_23279 Xylaria_escharoidea_BCC_23634 Xylaria_feejeensis_BCC_1115 Xylaria_grammica_BCC_1002 Xylaria_grammica_BCC_1170 Xylaria_hypoerythra_BCC_22968 Xylaria_juruensis_BCC_1083 Xylaria_juruensis_var_mic_BCC_1086 Xylaria_juruensis_var_mic_BCC_1232 Xylaria_juruensis_var_mic_BCC_1233 Xylaria_juruensis_var_mic_BCC_1234 Xylaria_juruensis_var_mic_BCC_1263 Xylaria_laevis_BCC_1182 Xylaria_mellisii_BCC_1005 Xylaria_mellisii_BCC_1186 Xylaria_mellisii_BCC_20667 Xylaria_multiplex_BCC_1036 Xylaria_multiplex_BCC_1177 Xylaria_obovata_BCC_1053 Xylaria_obovata_BCC_1100 Xylaria_papulis_BCC_22966 Xylaria_phyllocharis_BCC_1065 Xylaria_phyllocharis_BCC_1352 Xylaria_psidii_BCC_1127 Xylaria_psidii_BCC_1199 Xylaria_schweinitzii_BCC_1001 Xylaria_schweinitzii_BCC_1013 Xylaria_sp_BCC_1133 Xylaria_sp_BCC_1181 Xylaria_sp_BCC_1288 Xylaria_sp._BCC_18797_E_AB376756 Xylaria_tuberoides_BCC_18361 Xylariaceae_BCC_18731 Xylariaceae_BCC_18734 Xylariaceae_BCC_18737 Xylariaceae_BCC_18738 Xylariaceae_BCC_18739 Xylariaceae_BCC_18741 Xylariaceae_BCC_18743 Xylariaceae_BCC_18747 Xylariaceae_BCC_18752 Xylariaceae_BCC_18756 Xylariaceae_BCC_18768 Xylariaceae_BCC_18771 Xylariaceae_BCC_18772 Xylariaceae_BCC_18777 Xylariaceae_BCC_18786 Xylariaceae_BCC_18793 Xylariaceae_BCC_18796 Xylariaceae_BCC_18853 Xylariaceae_BCC_18861 Xylariaceae_BCC_18862 Xylariaceae_BCC_18863 Xylariaceae_BCC_18865 Xylariaceae_BCC_18869 Xylariaceae_BCC_18870 Xylariaceae_BCC_18873 Xylariaceae_BCC_18886 Xylariaceae_BCC_18902 Xylariaceae_BCC_18905 Xylariaceae_BCC_20842 Xylariaceae_BCC_20844 Xylariaceae_BCC_20845 Xylariaceae_BCC_20849 Xylariaceae_BCC_20850 Xylariaceae_BCC_20930 Xylariaceae_BCC_20932 Xylariaceae_BCC_20933 Xylariaceae_BCC_20936 Xylariaceae_BCC_20940 Xylariaceae_BCC_20943 Xylariaceae_BCC_20950 Xylariaceae_BCC_20951 Xylariaceae_BCC_20955 Xylariaceae_BCC_20960 Xylariaceae_BCC_20971 Xylariaceae_BCC_20973 Xylariaceae_BCC_20986 Xylariaceae_BCC_20987 Xylariaceae_BCC_20988 Xylariaceae_BCC_20989 Xylariaceae_BCC_20991 Xylariaceae_BCC_20992 Xylariaceae_BCC_20993 Xylariaceae_BCC_20995 Xylariaceae_BCC_20996 Xylariaceae_BCC_20997 Xylariaceae_BCC_20998 Xylariaceae_BCC_20999 Xylariaceae_BCC_21000 Xylariaceae_BCC_21001 Xylariaceae_BCC_21002 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3834] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1447; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Biscogniauxia_atropunctata_AJ390411 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAA--CCC-A-T-GTG-AA-CATACC-TACTGTTGCC-T-CGGCAGG------------------------------------------------------CCGTGC-----------TGCGCGGCTGGATC--GCCT-----------CCCCCGCGT--------GGGCAG--------------------CTACCCT----------------------GGAGT----------------------------------------------AGCTACCCTGTAGC--G--------G-GAGCGG----CCCGCCCCG---------------------------CGGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCCAA-CAGGCCTGC-CGAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTTTC-------GCAC-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTT-------------------TATTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAATAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AGAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTGGGT-CGTGCT--CTAAGCGTAGTAA-------CCAAA---TTCTC-GCTTCT----GAGGCCGGCC----CGGG--TCCT-GCCG-TAAAA-----CCCCC-TATA-----TTTTTTTT---C--TGGTTGACC--------------------------------- Biscogniauxia_atropunctata_AJ390412 ATTA----GCGAGT----------TAATTATAAAC-TCC----AAA--CCC-A-T-GTG-AA-CGTACC-TACTGTTGCC-TTCGGCAGG------------------------------------------------------TCGTGG-----------TGCGCGGCGGGATC--GCCA------------ACCGGCGGC-------GGGCAG--------------------CTACCCT----------------------GGAGTGG------------------------------------------GCAGCTACCCCGCGGCCGG--------G-AGGCGG----CCTGCCCCG---------------------------CGCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTAAACAGGCCTGC-CGGA-GG---------------------------ACCACT------------AA--------------ACTCT----GTTTTT------ACGC-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTT-------------------TGCTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAACTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAACAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCATCAAGCCCTATCTTGCTTGACGTTGGGAGATT----ACGG---------AGAC-GTAACTCCTTAAATATAGT-GGCG-GAGCTGGGT-CGTGCT--CTAAGCGTAGTAA------CTTACAA--TTCTC-GCTTCT----GAGGGCGGCC----CGGG--TCTT-GCCG-TAAAA-----CCCCCCTATA-----TTTTATCA---C--TGGTTGACC--------------------------------- Biscogniauxia_margina_AJ390417 ATTA----GCGAGT----------TACTGGAAAAC-TCC----AAA--CCCC--T-GTG-AA-TATACC-TATTGTTGCC-T-CGGCAGG------------------------------------------------------CTGTGC-----------TGTCTGGTAGCT----CCTA------------CCCTGTA--------------------------------------------------------------------------------------------------------------------GTTACCCTGTAGCTG---------GTGGCTG------CTACCCCG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTT-GTAAGGCCTGC-CGGA-GG---------------------------ACCTCT------------AA--------------ACTCT----GAAT--------ATTA-----------------------CTGTATGT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------TATTTGAGAA-----------------------------ATT-GAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGCAGTACTCTGCTGGGCATGCCTGTTCGAGCGTCATTT-CGA-CCATCAAGCCCTG-TATGCTTGACGTTGGGAATTT----ACAG---------TG-CTGTAATTCCTTAAATCCAGT-GGCG-GAGCCGGGT-CATGCT--CTAGGCGTAGTAA-------TTATA---TCCTC-GCCTCT----GTAGCTGTCC---CTTA---TCCT-GCCG-TAAAG----CCCAC--TAAA-----TTATAAC-------TGGTTGACC--------------------------------- Biscogniauxia_mediterranea_AF280624 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAAA-CCCC--T-GTG-AA-CTTACC-TAT-GTTGCC-T-TGGCAGG------------------------------------------------------TCGTGG-----------TGTGTAGCG---------TG------------ATC------------------------------------------------------------------------------------------------------------------------GCTAT--------AAG--------G-GATCA-----CC-GCCTCG---------------------------CACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTGAAA-GACCTGT-CAAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTCTT-------ACAA-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------TATTATATAA-----------------------------AC--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGATAGTATTCTGTCAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTAATCTGCTTGACGTTGGGAGTTT----ACGG---------AGAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CCACA---CTCTC-GCTTCT----GCAGCCGGCC----TAGG--TCTT-GCCG-TAAAA-----CCCC--TATA-----TTTATTTTTTAC--TGGTTGACC--------------------------------- Biscogniauxia_mediterranea_AF326479 --------GCGAGT----------TAATTACAAAC-TCC----AAAA-CCCC--T-GTG-AA-CTTACC-TAT-GTTGCC-T-TGGCAGG------------------------------------------------------TCGTGG-----------TGTGTAGCG---------TG------------ATC------------------------------------------------------------------------------------------------------------------------GCTAT--------AAG--------G-GATCA-----CC-GCCTCG---------------------------CACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTGAAA-GACCTGT-CAAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTCTT-------ACAA-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------TATTATATAA-----------------------------AC--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGATAGTATTCTGTCAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTAATCTGCTTGACGTTGGGAGTTT----ACGG---------AGAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CCACA---CTCTC-GCTTCT----GCAGCCGGCC----TAGG--TCTT-GCCG-TAAAA-----CCCC--TATA-----TTTATTT------------------------------------------------- Biscogniauxia_mediterranea_AJ390413 ATTA----GCGAGT----------TAATCATAAAC-TCC----AAAA-CCCC--T-GTG-AA-CTTACC-TAT-GTTGCC-T-CGGCAGG------------------------------------------------------TCGTGG-----------TGTGTAGCGG--------TG------------ACC------------------------------------------------------------------------------------------------------------------------ACT---------------------G-GGTCG-----CTTGCCTCG---------------------------CACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTGAAAAGACCTGT-CAAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTTTTT------ACAA-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------TATTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGATAGTATTCTGTCAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AGAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CCACAA--TTCTC-GCTTCT----GCAGCCGGCT----TAGG--TCCT-GCCG-TAAAA-----CCCC--TATA-----TTTTTTT---AT--TGGTTGACC--------------------------------- Biscogniauxia_mediterranea_AJ390414 ATTA----GCGAGT----------TAATCATAAAC-TCC----AAAA-CCCC--T-GTG-AA-CTTACC-TAT-GTTGCC-T-CGGCAGG------------------------------------------------------TCGTGG-----------TGTGTAGCGG--------TG------------ACC------------------------------------------------------------------------------------------------------------------------ACT---------------------G-GGTCG-----CTTGCCTCG---------------------------CACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTGAAAAGACCTGT-CAAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTTTTT------ACAA-----------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------TATTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGATAGTATTCTGTCAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AGAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CCACAA--TTCTC-GCTTCT----GCAGCCGGCC----TAGG--TCTT-GCCG-TAAAA-----CCCC--TATA-----TTTTTTTT--AT--TGGTTGACC--------------------------------- Biscogniauxia_nummularia_AJ390415 ATTA----GCGAGT----------TAA--ACAAAC-TCC----AAA--CCC-A-T-GTG-AA-CATACC-TACTGTTGCC-T-CGGCAGG------------------------------------------------------TCGTGC-----------TGTGCGGTGGTGATA-CCTA------------CCCTGGAGT-------AGGAAC--------------------CTACCCT----------------------GTAGTG---------------------------------------------ACCTACCCT----------------G-GAGTGGA---GCTACCCTG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGC-AACCAGGCCTGC-CAAA-GG---------------------------ACCCCT------------AA--------------ACTCT----GTT---------ATAA-----------------------C-GTACCT--CT-------------------------------------------------------------------------------------------GA---GTC-------------------AACTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAATAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCGCTA-CTTGCTTGACGTTGGGAATTT----ACAG---------CTGCTGTAATTCCTCAAATTTAGT-GGCG-GAGCTAGGT-CATGCT--CTGAGCGTAGTAA-------TTCTG---TTCTC-GCTCCT----GAAGCTGCCC----TATA--TCCT-GCCG-TAAAA-----CCCC--TAAA-----TTATAAT----C--TGGTTGACC--------------------------------- Biscogniauxia_repanda_AJ390418 ATTA----GCGAGT----------TGTT--AAAAC-TCC----AAAA-CCC-A-T-GTG-AA-CATACC-GTCTGTTGCC-T-CGGCAGG------------------------------------------------------TCGTGC-----------CGCCGGGTGGTCTG--CCTA------------CCCTGTAACAGCTACCCGGTAG--------------------CTACCCT----------------------AGAGG----------------------------------------------AGCTACCCTGTAGCAGTTACCC--TGTAGGTG------CTACCCTG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGC--ACCCGGCCTGT-CGAA-GG---------------------------TCCCCTT------------A--------------ACTCT----GTTT--------AAT------------------------CTGTATCT--CT-------------------------------------------------------------------------------------------GA---GTC------------------CTATGTGGAA------------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGACAGTATTCTGTCGGGCATGCCTGTTCGAGCGTCATTT-CGA-CCATTAAGCCCTA-TTTGCTTAACGTTGGGAATTT----AC-G---------CC-CTGTAATTCCTCAAAACCAGT-GGCA-GAGCTGGGT-TATGCT--CTAAGCGTAGTAT-------TTATT---TCCTC-GCTTCT----GTAGCTAGCT----TAGG--TCCT-GCCG-TAAAA-----ACAG--TATA----TATCTAG--------TGGTTGACC--------------------------------- Camillea_obularia_AF201714 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAA--CCCC--T-GTG-AA-CATACC-TATTGTTGCC-T-CGGCAGG------------------------------------------------------TCGTGC-----------TGCGCGGTGAAGTCTCTCTA------------ATTCAG----------AGGTAG--------------------TTACCCT----------------------GGAGT----------------------------------------------AGCTACCCTGGAGAAGG--------G-AGGTG-----CTTACCCCG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AC-CCAACAAGACCTGT-CAGA-GG---------------------------ACCTTTA------------A--------------ACTCT----ATTTT-------ATAA-----------------------C-GTATCT--CT-------------------------------------------------------------------------------------------GA---ATC-------------------AACTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAATAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AAAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CTTAA---TTCTC-GCTTCT----GTAGCCGGCT----AAGG--TCCT-GCCG-TAAAA-----CCCC--TATA-----TTTTTCTG---C--TGGTTGACC--------------------------------- Camillea_obularia_AJ390423 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAA--CCCC--T-GTG-AA-CATACC-TATTGTTGCC-T-CGGCAGG------------------------------------------------------TCGTGC-----------TGCGCGGTGAAGTCTCTCTA------------ATTCAG----------AGGTAG--------------------TTACCCT----------------------GGAGT----------------------------------------------AGCTACCCTGGAGAAGG--------G-AGGTG-----CTTACCCCG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AC-CCAACAAGACCTGT-CAGA-GG---------------------------ACCTTTA------------A--------------ACTCT----ATTTT-------ATAA-----------------------C-GTATCT--CT-------------------------------------------------------------------------------------------GA---ATC-------------------AACTATACAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAATAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AAAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------CTTAA---TTCTC-GCTTCT----GTAGCCGGCT----AAGG--TCCT-GCCG-TAAAA-----CCCC--TATA-----TTTTTCT----C--TGGTTGACC--------------------------------- Camillea_tinctor_AJ390421 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAA--CCC-A-T-GTG-AA-CTTACC-TGCTGTTGCC-T-CGGCAGG------------------------------------------------------TTGCGC-----------TGCGGAGTGC-------CTA------------CCCTGG----------AGTGGC--------------------CTACCCT----------------------GGAGT----------------------------------------------AGCTACCCTGTAGTGCCTACCC--TG-GAGTA-----GGCACCCCG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGC-AACCAGACCTGC-CAGA-GG---------------------------ACCTCTG------------A--------------ACTCT----TTTTT-------ACA------------------------CTGGAACT--CT-------------------------------------------------------------------------------------------GA---AAC-------------------TATTATACAA-----------------------------AC--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAACAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AAAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------TTATA---TTCTC-GCTTCT----GCAGCCGGTC----TAGG--TCTT-GCCG-TAAA------GCCC--TATA-----TTTTTCT--------GGTTGACC--------------------------------- Camillea_tinctor_AJ390422 ATTA----GCGAGT----------TAATTACAAAC-TCC----AAA--CCC-A-T-GTG-AA-CTTACC-TGCTGTTGCC-T-CGGCAGG------------------------------------------------------TTGCGC-----------TGCGGAGTGC-------TTA------------CCCTGG----------AGTGGC--------------------CTACCCT----------------------GGAGT----------------------------------------------AGCTACCCTGTAGTGCCTACCC--TG-GAGTA-----GGCACCCCG---------------------------CAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGC-AACCAGACCTGC-CAGA-GG---------------------------ACCTCTG------------A--------------ACTCT----TTTTT-------ACA------------------------CTGGAACT--CT-------------------------------------------------------------------------------------------GA---AAC-------------------TATTATACAA-----------------------------AC--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTAACAGTATTCTGTTAGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCCCAAGCCCTA-TTTGCTTGACGTTGGGAGTTT----ACGG---------AAAC-GTAATTCCTCAAATATAGT-GGCG-GAGCTAGGT-CGTGCT--CTAAGCGTAGTAA-------TTATA---TTCTC-GCTTCT----GCAGCCGGTC----TAGG--TCTT-GCCG-TAAA------GCCC--TATA-----TTTTTCT--------GGTTGACC--------------------------------- Creosphaeria_sassafras_AJ390424 ATTA----CAGAGT----------TAT---CTAAC-TCCC---AAA--CCC-AAT-GTG-AA-CCTACC-TAT-GTTGCC-T-CGGCGGG---------------------------------------------A----------GAAGCC---------TACC-----------------------------------------------CGGT-----------------ACCTACCCT----------------------GTAGCT-------ACCCGGGAAC-------------------------------TACCCT----------------GTAG-----------TTGA-----------------------------TGGCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGC-CGGT-GG--------------------------ACATTTT----------AAAA--------------ACTCT---TGTTC------T-ACT------------------------GTGATACT--CT-------------------------------------------------------------------------------------------GA---GTA-------------------AT-AAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CTCTTAAGCCTTA-GTTGCTTAGCGTTGGGAGGTTG------------CCTCT---CGCAACTCCCTAAAATCAGT-GGCA-AGGACCACG-ACACCT--TGAAGTGTAGTAG-------TTTAA---TTCTC-ACTTTGG-------AGGACC-----GTAG-CCCA-GCCA-TAAA------CCAAC-TA-------TTTTTAATTA---TTGGTTGACC--------------------------------- Creosphaeria_sassafras_AJ390425 ATTA----CAGAGT----------TAT---CTAAC-TCCC---AAA--CCC-AAT-GTG-AA-CCTACC-TAT-GTTGCC-T-CGGCGGG---------------------------------------------A----------GAAGCC---------TACC-----------------------------------------------CGGT-----------------ACCTACCCT----------------------GTAGCT-------ACCCGGGAAC-------------------------------TACCCT----------------GTAG-----------TTGA-----------------------------TGGCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGC-CGGT-GG--------------------------ACATTTT----------AAAA--------------ACTCT---TGTTT------T-ATT------------------------GTGACACT--CT-------------------------------------------------------------------------------------------GA---GTA-------------------AC-AAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTTA-GTTGCTTAGCGTTGGGAGGTTG------------CCTCT---CGCAACTCCCTAAAATCAGT-GGCA-AGGACCACG-ACACCT--TGAAGTGTAGTAG-------TTTAA---TTCTC-ACTTTGG-------AGGATC-----GTAG-CCCA-GCCA-TAAA------CCAAC-TA-------TTTTTAATTA---TTGGTTGACC--------------------------------- Diatrype_disciformis_AJ390410 ATTA----CAGAGT----------TAC---CTAAC-TCC----AAA--CCC-A-T-GTG-AA-CTTACC-TAT-GTTGCC-T-CGGCGGG--------------------------------------------------------GAAGCC---------TACC-----------------------------------------------CGGT-----------------ACCTACCCT----------------------GTAGTT-------ACCCGGGAGCG---------------------------AGCTACCCT----------------GTAGCCCG-------CTGC-----------------------------AGGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGC-CGGT-GG--------------------------ACAGTT-------------AA--------------ACTCT---TGTTT------TTACA------------------------GTGAAACT-TCT-------------------------------------------------------------------------------------------GA--TAT--------------------TTTATACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CGA-CCATCAAGCCCCG-GTTGCTTGGTTTTGGGAGCCTA------------TCTCTAGGGATAGCTCCTTAAATAGAGT-GGCG-GAG-TCGTG-CCGACC--CCAAGCGTAGTAA------TTTC-----TTCTC-GCTTCAG-GTGCC-GGTGCT-----GACG-TCCT-GCCG-TTAAA-----CCCCC-TA-------TTTTTAAAA------GGTTGACC--------------------------------- Entonaema_pallida_AM900591 ATTA----AAGAGT----------TTT--TACTTC-TCCC---AAA--CCCC--T-GTG-AA-CGTACC-TCTTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-TCG-CC---------TACC-----------------------------CT-G--------------TAGCG---------------CCCCTACTCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGGA-----------GTGC-----------------------------GGGGGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCGCA------------AA--------------ACTCT----GTTT-----AGCAC--------------------------TGAATTT--CT-------------------------------------------------------------------------------------------GA---AT--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCCAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--ACCTC-GCCTGT--A-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTTTT--AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCC----------- Hypoxylon_annulatum_AJ390395 ATTA----CCGAGT----------TAT--CACAAC-TCC-----AA--CCCTT-T-GTG-AACCTTACC-GTC-GTTTCC-T-CGGC--G--------------------------------------------------------------------------------------CACTG--------------CTGT-----------GGGAGG-------------------CTACCCT----------------------GTAG----------------------------------------------CGGTTGTT-----------------------T---------ACCCTA---------------------------CAGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACCCTGCAGCGGCGC-CGAAAGG---------------------------ACTACCA-----------AA--------------ACTCT-----TTTATC----CA-A------------------------GT-TACCT--CG-------------------------------------------------------------------------------------------AAC-AATT-------------------TAC-TATACA-----------------------------AT---AGT--------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCC-T-GTTGCTTAGCGTTGGGAATCT----GC-TA-----GCCTCGGCGCAGTTCCTTAAATTCATT-GGCG-GAGCTGTGG-CACACT--CTAGGCGTAGTAG-------TTTAAC--ACCTC-GCCTCT----AGAGT-GGCCG---CGGTT-ACTG-GCCG-TAAAA-----CCCC--TATA-----TTTCTAG-------TGGTTGACC--------------------------------- Hypoxylon_cinnabarinum_AJ39039 ATTA----AAGGGTCGCGTGCC--TCGCACGCGGCATCCTGCCCAA--CCCTA-T-GTG-AA-CTTACC-ACT-GTTGCC-T-CGGC--G--------------------------------------------------------GCGC-----------CGCG-G-----------CTA-------------CCC-------------GGGAG--------------------CTACCCT----------------------GTAACCGC----CTACCCTGTAG--------------------------GCGGCTACCC----------------TGTAGCC---------ACCCTG---------------------------TAGCTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACGCAA-GGC-CCGC-CAGA-GG---------------------------ACCCC-------------AA--------------ACTCT---GATTAT-------ACC------------------------CTACAACT--CT-------------------------------------------------------------------------------------------GA---ATT-------------------AGCCAACGTA-----------------------------AT--ACG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGCATTCTGGTGGGCATGCCTATTCGAGCGTCATTG-CAACCCCTTAAGCCC-T-GTAGCTTAGCGTTGGGGGACC----ACGTC-----TCAGCGACGTGGCCCCTGAAATGTAGT-GGCG-GAGTTGGTG-AGCACT--CTCAGCGTAGTAA-------TTC-----TTCTC-GCTTCG----GGGGTCTGCCGC--TGGCT-GCTG-GCCG-TAAAAA--AACCCTA-TA-C-----TCT-TAG-------TGGTTGACC--------------------------------- Hypoxylon_fragiforme_AF201709 ATTAG--GAGGAAT----------ACCCAA-AACC-TCC----CAA--CCCC--T-GTG-AA-CTTACC-ACT-GTTTCC-T-CGGC--G------------------------------------------------------T-GCGCACCTGGTTGCCCGCGGGGGATCCGA-GCCTA-------------CCC-------------TGTAG--------------------CTACCCT----------------------GTAG-------------------------------------------------CTACCC----------------TGTAGCTACCCTGTAGACCCGGGTCCT----------------------CAGCACACGGCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCTCAAGGTC-CCGC-CGAA-GT---------------------------ACCCTG-------------A--------------ACTC-----GTTTA-------AC-------------------------GTGGAATT--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGTCT----AC-GG-----GTTACCCTGTAGTTCCTGAAAACCATT-GGCG-GAGTCAGGG-AGCACT--CTAAGCGTATTACACAA-TCTTTTT---GTCTC-GCTTTG----GATAT-TGCCC---CGCCT-CCAC-GCCG-TAAAA-----CCCCC-CATA-----T---CAA-------ATGTTGACC--------------------------------- Hypoxylon_fragiforme_AJ390401 ATTAG---AGGAAT----------ACCCAA-AACC-TCC----CAA--CCCC--T-GTG-AA-CTTACC-ACT-GTTTCC-T-CGGC--G------------------------------------------------------T-GCGCACCTGGTTGCCCGCGGGGGATCCGA-GCCTA-------------CCC-------------TGTAG--------------------CTACCCT----------------------GTAG-------------------------------------------------CTACCC----------------TGTAG-----------ACCCGGGTCCT----------------------CAGCACACGGCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCTCAAGGTC-CCGC-CGAA-GT---------------------------ACCCTG-------------A--------------ACTCT----GTTTA-------AC-------------------------GTGGAATT--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGTCT----AC-GG-----GTTACCCTGTAGTTCCTGAAAACCATT-GGCG-GAGTCAGGG-AGCACT--CTAAGCGTATTACACAA-TCTTTTT---GTCTC-GCTTTG----GATAT-TGCCC---CGCCT-CCAC-GCCG-TAAAA-----CCCCC-CATA-----T---CAA-------AGGTTGACC--------------------------------- Hypoxylon_fragiforme_AJ390402 ATTAG---AGGAAT----------ACCCAA-AACC-TCC----CAA--CCCC--T-GTG-AA-CTTACC-ACT-GTTTCC-T-CGGC--G------------------------------------------------------T-GCGCACCTGGTTGCCCGCGGGGGATCCGA-GCCTA-------------CCC-------------TGTAG--------------------CTACCCT----------------------GTAG-------------------------------------------------CTACCC----------------TGTAG-----------ACCCGGGTCCT----------------------CAGCACACGGCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCTCAAGGTC-CCGC-CGAA-GT---------------------------ACCCTG-------------A--------------ACTCT----GTTTA-------AC-------------------------GTGGAATT--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGTCT----AC-GG-----GTTACCCTGTAGTTCCTGAAAACCATT-GGCG-GAGTCAGGG-AGCACT--CTAAGCGTATTACACAA-TCTTTTT---GTCTC-GCTTTG----GATAT-TGCCC---CGCCT-CCAC-GCCG-TAAAA-----CCCCC-CATA-----T---CAA-------ATGTTGACC--------------------------------- Hypoxylon_fuscum_AF201715 ATTA----CTGAGT----------TCTTAC-AAAC-TCC-----AA--CCCTT-T-GTG-AACCATACC-AACTGTTGCC-T-CGGC--G------------------------------------------------------T-GAGC-----------TGCG-G-----------CTG-------------CGT-------------GGTAG--------------------CTACCCG----------------------GTAG---------------------------------------------TCACCTACCC----------------GGTACCT---------ACCCTG---------------------------TAGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGTATAAGC-CCGC-CGAA-GG---------------------------ACCACT------------AA--------------ACTCT----GTTTA-------ACA------------------------GTGTAT-T--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--A-G---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CGA-CCCTGAAGCCCTG-GTTGCTTCGCGTTGGGACTCT----ACTGG------CTACCCTGTAGTTCCCTAATGACAGT-GGCG-GAGTTCACG-TGTACT--CTCAGCGTAGTAA-------TTTC----TTCTC-GCTTTT----GCAGT-AGCC----TGGTC-ACCA-GCCG-TAAAA-----CCCCC-TATT-----TTC-TAG-------TGGTTGACC--------------------------------- Hypoxylon_fuscum_AJ390404 ATTA----CTGAGT----------TCTTAC-AAAC-TCC-----AA--CCCTC-T-GTG-AACCATACC-ATT-GTTGCC-T-CGGC--G------------------------------------------------------A-GAGC-----------TGTG-G-----------CTG-------------CCT-------------GGTAG--------------------TTGTCTT----------------------GTAG---------------------------------------------TTATCTACTC----------------GGCCCCT---------ATCCTG---------------------------TAGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGCGTACAAGC-TCGC-CGAA-GG---------------------------ACCGCT------------AA--------------ACTCT----GTCTG-------ACA------------------------GTGTAT-T--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--A-G---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CGA-CCCTGAAGCCCTA-GTTGCTTCGCGTTGGGACTCT----ACTGG------CTGCCCTGTAGTTCCCTAATGACAGT-GGCG-GAGTTCAGG-TGTACT--CTCAGCGTAGTAA-------TTTC----TTCTC-GCTTTT----GCAGT-AGCC----TGGTC-GCCG-GCCG-TAAAA-----CCCCC-TATT-----TTC-TAG-------TGGTTGACC--------------------------------- Hypoxylon_fuscum_AJ390405 ATTA----CTGAGT----------TCTTAC-AAAC-TCC-----AA--CCCTT-T-GTG-AACCATACC-AACTGTTGCC-T-CGGC--G------------------------------------------------------T-GAGC-----------TGCG-G-----------CTG-------------CGT-------------GGTAG--------------------CTACCCG----------------------GTAG---------------------------------------------TCACCTACCC----------------GGTACCT---------ACCCTG---------------------------TAGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGTATAAGC-CCGC-CGAA-GG---------------------------ACCACT------------AA--------------ACTCT----GTTTA-------ACA------------------------GTGTAT-T--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAA-----------------------------AT--A-G---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CGA-CCCTGAAGCCCTG-GTTGCTTCGCGTTGGGACTCT----ACTGG------CTACCCTGTAGTTCCCTAATGACAGT-GGCG-GAGTTCAGG-TGTACT--CTCAGCGTAGTAA-------TTTC----TTCTC-GCTTTT----GCAGT-AGCC----TGGTC-ACCA-GCCG-TAAAA-----CCCCC-TATT-----TTC-TAG-------TGGTTGACC--------------------------------- Hypoxylon_intermedium_AJ390396 ATTA----CTGAGT----------TCTTACCAAAC-TCC----TAA--CCCTT-T-GTG-AACCGTACT-GTC-GTTGCC-T-CGGC--G------------------------------------------------------T-GAGC-----------TGCGG------------CTA-------------CCC-------------GGTAG--------------------CTACCCG----------------------GTAGT---------------------------------------------TTCCTACCC----------------GGTAGCC---------ACCCGG---------------------------TAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCTCAAGG-C-CCGC-CGGT-GG---------------------------ACCGCCC------------A--------------ACTCT----GTTTT-------ATA------------------------GTGTATCT--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTGA----------------------------AAT--CAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGATTCT----ACAGG-----GCTGTCCTGTAGTTCCCTAAAATCAGT-GGCG-GAGTGGGAG-CTCACT--CGTAGCGTAGTAC------TTTTT----TTCTC-GCTTCG----GTAGT-GGCTC---TGACT-TTCG-GCCG-TAAAA-----CCCCC-TATA-----TTTTCAA-------AGGTTGACC--------------------------------- Hypoxylon_papillatum_AF201710 ATTA----GCGAGT----------TTA--CAAAAC-TCCCA--AAA--CCCTT-T-GTG-AACCTTACC-ATT-GTTGCC-T-CGGC--G------------------------------------------------------T-GAGC-----------CGCG-G-----------CTA-------------CCT-------------GGTAG--------------------CTACCCT----------------------GTAATTG-----TTACCCTGTAA--------------------------TGAT-TACCCG---------------GGGAGCT---------ACCCTG---------------------------TAG--T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCGTGAAGGC-CCGC-CGGT-GG---------------------------ACCACT------------AA--------------ACTCT----GTTTAT-----CATT------------------------GTGGAATT--CT-------------------------------------------------------------------------------------------GA---ATA-------------------CTT-AACTGA----------------------------AAT--ACG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTAACAA-CCCTTAAGCCCTT-GTTGCTTAGTGTTGGGACTCT----ACGGC-----CTTAGGGCGTAGTTCCTTAAAGTTAGT-GGCG-GAGTTAGGG-TACACT--CTCAGCGTAGTAG------TTATT----TTCTC-GCTTTT----GTAGT-GGTCC---TAACG-GCTA-GCCG-TAAAA-----CCCT--TATA-----TTC-TAG-------TGGTTGACC--------------------------------- Hypoxylon_perforatum_AJ390407 ATTA----CTGAGT----------TCTA-CAAAAC-TCCC----AA--CCCTT-T-GTG-AATTATACC-TTA-GTTGCC-T-CGGC--G------------------------------------------------------TCGAGCGAGTCAACCTACCCGGGAGCT---A-CACTGGAGTCACCTA--CCCTGT-----------AGAAC--------------------CTACCCT----------------------GTAGA---------------------------------------------CGGCTACCC----------------TGGAGCT---------ACCCTG---------------------------TAGT-T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACTTTC--GCGTCGC-CGGT-GG---------------------------ACTACC------------AA--------------ACTCT-----TATATG----TATA------------------------GTGTATCT--CT-------------------------------------------------------------------------------------------GA---ATT-------------------CTT-AACAAA-----------------------------AT--TAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCAGTAGTATTCTACTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTACGCCC-T-GTAGCGTAGTGTTAGGACTCT----AC-TC-----TTTAGAGAGCAGTTCCCTAAAACCAGT-GGCA-GTGTTCTG--TACACT--CATAGCGTAGTAA-------TTC-----TTCTC-GCTTCT----GCAGT-GGCCC---GTACT-ATTC-GCCG-TAAAA-----CCCCC-TAT------TTTCTAA-------TGGTTGACC--------------------------------- Hypoxylon_rickii_AJ390408 ATTA----AAGGGTCGCGTGCA--TTGCTCGCGGCTTACTGCCAAA--CCCTA-T-GTG-AA-CTTACC-ACT-GTTGCC-T-CGGC--G--------------------------------------------------------GCGC-----------CGCG-G-----------CTA-------------CCCTG-----------GAGAG--------------------CTACCCT----------------------GTAGCCAT----TTACCCTGTAG--------------------------ATGGCTACCC----------------TGTAGCT---------ACCCTG---------------------------TAGCTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACGTAAAGGC-CCGT-CAAA-GG---------------------------ACCCTA-------------A--------------ACTCT----ATTTTG------ACT------------------------TGGTATCT--CT-------------------------------------------------------------------------------------------GA---GTA-------------------AATCAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAACCCCTTAAGCCC-T-GTTGCTTAGCGTTGGGGGCCT----GCGCC-----T-GGCGGCGTAGCCCCTGAAAGATAGT-GGCG-GAGTCAGTG-AGCACT--CTGAGCGTAGTAA-------CTT-----TTCTC-GCTCCG----GTAGCTTGCCCC--TGGCT-GCTG-GCCG-TTAAA---CCCCCCCATATC-----TTC-TAG-------TGGTTGACC--------------------------------- Hypoxylon_subgilvum_AJ390400 ATTA----CAGAGT----------TAATCCAAAAC-TCC-A--AAA--CCCTTAT-GTG-AA-CTTACC-GCT-GTTGCC-T-CGGC--G------------------------------------------------------T-GTGC-----------CGCGAG-----------CTA-------------CCC-------------TGTAG--------------------CTACCCA----------------------GTAGGTGA----CTACCCTGTAG--------------------------TCACCTACCCT---------------GG-AGCT---------ACCCTG---------------------------TAG--T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCATTAAGGC-CCGT-CGAA-GG---------------------------ACCACT------------AA--------------ACTCT---TGTTTTTA----TACT------------------------GTGGATAT--CT-------------------------------------------------------------------------------------------GA---ATG-------------------CTTCAACTAT---------------------------AAAT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTCGCTTAGCGTTGGGAATCT----ACG--------TTACGGCGTAGTTCCTCAAATTTAGT-GGCG-GAGTTGTAG-CACACT--CTAAGCGTAGTAG-------AATC----TTCTC-GCTTCT----GTAGT-TACTG---TGACT-TTTT-GCCG-TAAAA-----CCCTC-TATT-----TTC-TAG-------TGGTTGACC--------------------------------- Kretzschmaria_clavus_AJ390434 ATTA----ACGAGT----------TTA-T-ATAAC-TCCT---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG---------------------------------------------CAGA----TCCGCACCTC-------TTAC------------------------------CCTG--------------TAGT----------------ACCTTACCCGGAAC-GAACCTGCTATTACATAGTAATAGAATTCCAACCGGGATAGAT-----------------------AGGCCTACGTGGTA------------ATAAA-----------GTGC------------------------------GCTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------ACCATG--------AAATAA--------------ACTCT----GTTT-----AATAG-------------------------CTGGTATT--CT-------------------------------------------------------------------------------------------GA----T--A----------------ATTATATGGAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTTT-GTTGCTTAGTGTTGGGAGCCT----ACGGC----TTTCTCGCCGTAGCTCCTTAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGGCGTAGTAA------ATATT----TTCTC-GCCTAC--G-GA--TGGACC-----GGTC-CCCT-GCCG-TAAAAA--AAAACA--AAATATA-TTTTATA-TCA-----GGTTGACC--------------------------------- Kretzschmaria_deusta_AJ390435 ATTA----AAGAGT----------TTG-TTACAAC-TCCT---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG---------------------------------------------CAGG-----TCGCATCTTG------CTAC------------------------------CCTG--------------TAGG----------------ACCCTATCCTATA--GTACCT-----TACAGGGGAA---GGTACTACCCGGAG----------------------------AGACCTACCCGGTA------------GAGAG-----------ATGC------------------------------GGTGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACCTGC-CGGT-GG---------------------------ACTGAA--------AAACAA--------------ATTCT----GTTT-----AGTAA-------------------------ATGGTATT--CT-------------------------------------------------------------------------------------------GA---AT--C----------------ATTATATGGAA-----------------------------ATT-AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACCGCA---TTCTTTGCTGTAGCTCCTTAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGGCGTAGTAA------AGATTTTA-TTCTC-GCCTGTA-GAGA--TGAGCC-----GGTC-CCCT-GCCG-TAAAA-----CACCCC---CCTA-TTTTTTA-TAA-----GGTTGACC--------------------------------- Kretzschmaria_deusta_AJ390437 ATTA----AAGAGT----------TTG-TTACAAC-TCCT---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG---------------------------------------------CAGG-----TCGCATCTTG------CTAC------------------------------CCTG--------------TAGG----------------ACCCTATCCTATA--GTACCT-----TACAGGGGAA---GGTACTACCCGGAG----------------------------AGACCTACCCGGTA------------GAGAG-----------ATGC------------------------------GGTGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACCTGC-CGGT-GG---------------------------ACTGAA--------AAACAA--------------ATTCT----GTTT-----AGTAA-------------------------ATGGTATT--CT-------------------------------------------------------------------------------------------GA---AT--C----------------ATTATATGGAA-----------------------------ATT-AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACCGCA---TTCTTTGCTGTAGCTCCTTAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGGCGTAGTAA------AGATTTTA-TTCTC-GCCTGTA-GAGA--TGAGCC-----GGTC-CCCT-GCCG-TAAAA-----CACCCC---CCTA-TTTTTTA-TAA-----GGTTGACC--------------------------------- Nemania_aenea_AJ390426 ATTA----CAGAGT----------TTT--TCAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CCTACC-TCACGTTGCC-T-CGGCAGG-----------------------------------------------------TG----------------------------------------------------A--------------AAGC-------------------C-GTCCT-------------------------------------------------------------------------------------------------------------------AGC----------------------------TGGCGGTC--------------------------------GAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAC-GG--------------------------ACCCCT-------------AA--------------ACTCT----GTTTTTTACAGCAT--------------------------TAGACCT--CT-------------------------------------------------------------------------------------------GA---A--------------------AAAATAACTAA-----------------------------ATC--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTAGGAGACT----ACTGGCA--AG---TCCTGTAGCTCCCGAAATTTAGT-GGCG-GAGCCGGTT-CGCACT--CCAGACGTAGTAG------CTTATT---ACCTC-GCCTGC--A-GCG-TGTGCC-----TGTC-CCCT-GCCG-TAAAA-----CCACA-AA-A-----ACATTA-TA------GGTTGACC--------------------------------- Nemania_aenea_AJ390427 ATTA----CAGAGT----------TAC--CAAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCGCGTTGCC-T-CGGCAGG-----------------------------------------------------TGGCGT-CC---------TACCC---------------------------CGTGA--------------GA-C-------------------CTACCCT----------------------GTA----------------G-------------------------------------------------------GACCT-------------ACC----------------------------CGGTAGGC--------------------------------GAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAC-GG---------------------------CCCCCG------------AA--------------ACTCT----GTTTTT-ATAGCAT--------------------------TGGACTT--CT-------------------------------------------------------------------------------------------GA---A--------------------AAGATAACTAA-----------------------------ATA--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACTGGA---AC-TCTCCTGTAGCTCTCCAAAGTCAGT-GGCG-GAGCCGGTT-CGCACT--CCAGACGTAGTAG------CTTTTAC--ATATC-GCCTGT--A-GCT-TGGACCC----GGTC-CCCT-GCCG-TAAAA-----CACCC-CA-A-----ATCTTC-TA------GGTTGACC--------------------------------- Nemania_bipapillata_AJ390429 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CCACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAAA----CCCC--CAGA-----CTTTT--TAGT----GTTTGACC--------------------------------- Nemania_bipapillata_AY541610 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACC--------------------------------- Nemania_chestersii_AJ390430 ATTA----CAGAGT----------TAC--TAAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCGCGTTGCC-T-CGGCAGG-----------------------------------------------------TCGCGT-CC---------TACCC---------------------------TGT-A--------------CATC-------------------CTACCCT----------------------GGA----------------T-------------------------------------------------------AGACT------------TGCC----------------------------CGGTGGTC--------------------------------GACTCTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAT-GG---------------------------CTCATG------------CA--------------ACTCT----GTTTCT-CCAGCAT--------------------------TGGACTT--CT-------------------------------------------------------------------------------------------GA---A--------------------AAGTAAACTAA-----------------------------ATC--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTC-GTCGCTTAGCGTTGGGAGCCT----ACTGGA---ACCTCTCCTGTAGCTCCCCAAAGTCAGT-GGCG-GAGCCGGCT-CGCACT--CCAGACGTAGTAG------CTTTTAC--CTATC-GCCTGT--A-GCG-TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CCCCC-CA-A-----TTCTTA-TA------GGTTGACC--------------------------------- Nemania_diffusa_DQ658238 ATTA----GTGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CCCG--------------CAG-----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGAAG-----------GCGC-----------------------------GGGTAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTTA----GT-AT--------------------------TG-AATT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG------CA----CTGTAGCTCCCCGAAGTTAGT-GGCG-GAGTCGGCT-CACACT--CTAGACGTAGTAA------ATCTTTC--ACCTC-GTCTGT--A-GT--TGGGCC-----GGTC-CCCT-GCCG-TAAAA---------------------------------------------------------------------------- Nemania_primolutea_EF026121 ATTA----AAGAGT----------TTTCT-ACAAC-TCCC---AAA--CCCC--T-GTG-AA-CATACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-TCG-CC---------TACC-----------------------------CTCG--------------TAGC----------------CCCCTACACC----------------------GT-A--------------GG-------------------------------GCCTACGCC---------------GGGTG-----------GTGC-----------------------------GCGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCGCG------------AA--------------ACTCT----GTTT-----AGCAC--------------------------TG-AATC-TCT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCCAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--GTCTC-GCCTGT--A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTCTA--AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Nemania_serpens_AJ390431 ATTA----CAGAGT----------TAT--CAAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCGCGTTGCC-T-CGGCAGG-----------------------------------------------------TGGCGT-CC---------TACCC---------------------------CGTGA--------------GAAC-------------------CTACCCC----------------------GCA----------------A-------------------------------------------------------GGCCT-------------ACC----------------------------CTGTAGGCCTTGCCCGGTGAGAACTTACCCGGTGGCGGCTGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAC-GG---------------------------CCCCCG------------AA--------------ACTCT----GTTTTTTATAGCAT--------------------------TGGACTT--CT-------------------------------------------------------------------------------------------GA---A--------------------AAGATAACTAA-----------------------------ATC--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACTGGAG--ACACCTCCTGTAGCTCCCCAAAGTCAGT-GGCG-GAGCCGGTT-CGCACT--CCAGACGTAGTAG------CTTTTAC--ACATC-GCCTGT--A-GCG-TGGACCC----GGCC-CCCT-GCCG-TAAAA-----CACCC-CA-A-----TTTTTA-TA------GGTTGACC--------------------------------- Nemania_serpens_AJ390432 ATTA----CAGAGT----------TAT--CAAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCGCGTTGCC-T-CGGCAGG-----------------------------------------------------TGGCGT-CT---------CGCCC---------------------------CGTAA--------------GAAC-------------------CTACCCT----------------------GTA----------------G-------------------------------------------------------GAACG------------TACC----------------------------CGGTAGAC--------------------------------GAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAC-GG---------------------------CCCCCG------------AA--------------ACTCT----GTTTT--ATAGCAT--------------------------TAAACTT--CT-------------------------------------------------------------------------------------------GA---A--------------------AACATAACTAA-----------------------------ATA--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTAGGAGCCT----ACCGGA---AC-TCTCTGGTAGCTCCCCAAAGTCAGT-GGCG-GAGCCGGTT-CGCACT--CCAGACGTAGTAG------CTTTTAC--ACGTC-GCCTGT--A-GCG-CGGGCC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CA-A-----TTTTTA-TA------GGTTGACC--------------------------------- Nemania_serpens_AJ390436 ATTA----CAGAGT----------TAT--CAAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCGCGTTGCC-T-CGGCAGG-----------------------------------------------------TGGCGC-CC---------CGCCC---------------------------TGTGA--------------GGAC-------------------CTACCCT----------------------GTA----------------G-------------------------------------------------------GAGCT------------CACC----------------------------CGGTGGTC--------------------------------GCC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGAC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTTTTTATAGCAT--------------------------TAGACCT--CT-------------------------------------------------------------------------------------------GA---A--------------------AAGATAACTAA-----------------------------ATA--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACCGGAA--AC-CGTCCGGTAGCTCCCCAAAGTCAGT-GGCG-GAGCCGGTT-CGCACT--CCAGACGTAGTAG------CTTTTAC--ACGTC-GCCTGT--A-GCG-CGGGCC-----GGTC-CCCT-GCCG-TAAAA-----CCCCC-AA-A-----TTCTTA-TA------GGTTGACC--------------------------------- Rosellinia_necatrix_AB017657 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAAA-CCC-A-T-GTG-AA-CATACC-ACACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGTCC---------TAC------------------------------CCCG--------------AAGT----------------GCCCTACCCT----------------------GTTA--------------GG-------------------------------GCCTACCC----------------GGTGG-----------GCGC-----------------------------GGGCCAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTTA----GC-AT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ACATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGGGCCT----GCAG------CGCCTGCTGCAGCCCCTCGAAGTCAGT-GGCG-GAGTCGGTCACACACT--CTAGACGTAGTAG------ATTTCTC--ATCTC-GCCTAT--G-GT--TGTGCC-----GGTC-CCCT-GCCG-TAAAA---CACCCCCCTA-------TACC---AAA-----GGTTGACC--------------------------------- Whalleya_microplaca_AJ390419 ATTA----ATGAGT----------TAA---AAAAC-TCCT---AAA--CCC-ACT-GTG-AA-CATACCATTTTGTTGCC-T-CGGCAGG------------------------------------------------------TTGTGTTT----------GC------------------------------CCTG--------------TAGC-----------------TGCTACCCT----------------------GGACCT-------ACCCTGG-------------------------------ACCTACCCT----------------GTAG-----------CTACC----------------------------TGGTAACACGTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCCTGC-CGGT-GG---------------------------TCTTCT------------AA--------------ACTCT---TGCTAT-----ACGT--------------------------TGCGAATT-CT-------------------------------------------------------------------------------------------GA---ACA------------------AGTAAAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTACTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CGA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG-----TTATA--GCGTAGCTCCTTAAAGTTAGTTGGCG-GAGTTAGGG-TACACT--CTCAGCGTAGTAA------ACATTT---TTCTC-GCTGTT----GTAGTTGCCTT----AGCT--GTT-GCCA-TTAAA-----CCTGTCTAT------TATTTAGTAA-----GGTTGACC--------------------------------- Whalleya_microplaca_AJ390420 ATTA----ATGAGT----------TAA---AAAAC-TCCT---AAA--CCC-ACT-GTG-AA-CATACCATTTTGTTGCC-T-CGGCAGG------------------------------------------------------TTGTGTTT----------GC------------------------------CCTG--------------TAGC-----------------TGCTACCCT----------------------GGACCT-------ACCCTGG-------------------------------ACCTACCCT----------------GTAG-----------CTACC----------------------------TGGTAACACGTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCCTGC-CGGT-GG---------------------------TCTTCT------------AA--------------ACTCT---TGCTAT-----ATAT--------------------------TGCGAATTTCT-------------------------------------------------------------------------------------------GA---ACA------------------AGTAAAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTACTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CGA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG-----TTATA--GCGTAGCTCCTTAAAGTTAGTTGGCG-GAGTTAGGG-TACACT--CTCAGCGTAGTAA------ACATTT---TTCTC-GCTGTT----GTAGTTGCCTT----AGCT--GTT-GCCA-TTAAA-----CCTGTCTAT------TATTTAGTAA-----GGTTGACC--------------------------------- Xylaria_acuta_AF163026 ATTA----AAGAGT----------TCT---ATAAC-TCCCTA-AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CCCG--------------TAAC----------------GTCCTACCCT----------------------GT-A--------------GGC------------------------------ACCTACCC----------------GGTAG-----------GCGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGAC-G----------------------------CC-ACG------------AA--------------ACTCT----GTTT-----AGTAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAT-AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGTATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG------TA----TAGTAGCTCCTCAAAGTTAGT-GGCA-GAGTCGGTT-CACACT--CTAGACGTAGTAG------ATTTT----ATTTC-GCCTATT-A-GT--TGGACT-----GGCC-TCTT-GCCA-TAAAA-----CCCCC-TAAACT---TTTTTA--AA-----GGTTGACC--------------------------------- Xylaria_apiculata_AF163027 ATTA----AAGAGT----------TATT--ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTCTGTTGCC-T-CGGCAGG----------------------------------------------------TCT-GCAGCC---------TAC------------------------------CCTG--------------TAAG----------------CCCCTACCCT----------------------GTAG--------------GGA------------------------------CCTTACCC----------------GGTAG-----------TTGC-----------------------------GGGTAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCTGC-CGGT-GG---------------------------TCTACT------------CA--------------ACTCT----GTTT-----ATT-A--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---ATA-------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAGTAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGAGCCT----ACTGAAGACCCTT---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTTTCACACT--CTAGACGTAGTAA------CTTTT----ATCTC-GCCTAT--A-GA--TGCGCC-----GGTC-CCCT-GCCG-TAAAA-----CCCCC-TAAT-----TTCT-A--AA-----GGTTGACC--------------------------------- Xylaria_arbuscula_AF163028 ATTA----AAGAGT----------TAATT-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GTG-TT---------TAC------------------------------CCTG--------------TGAG----------------GTCCTACCCT----------------------GTAG--------------GA-------------------------------CCCTACCT----------------GGTAG-----------ACAC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTA-----ATTCTA-------------------------TGTT-AT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----AC-G-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGT--CACACT--CTAGACGTAGTAG------ATCT-----ATCTC-GTCTGT--A-GT--GAGGCC-----GGTC-CCCT-GCCG-TAAAA-----CCCCCCTAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylaria_arbuscula_AF163029 ATTA----AAGAGT----------TAATT-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGC--T-CGGCAGG-----------------------------------------------------TC-GTG-TT---------TAC------------------------------CCTG--------------TGAG----------------GTCCTACCCT----------------------GTAG--------------GA-------------------------------CCCTACCT----------------GGTAG-----------ACAC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTA-----AT-CTA-------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAG------ATTCT----ATCTC-GTCTGT--A-GT--GAGGCC-----GGTC-CCCT-GCCG-TAAAA-----CCCCCCTAA------TTTTTA--AA-----GGTTGACC--------------------------------- Xylaria_cornudamae_AF163031 ATTA----AAGAGT----------TAT-TATAAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-CTTTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CT---------TAC------------------------------CCCG--------------TGAG----------------ACCTTACCCT----------------------GTAA--------------GG-------------------------------TCCTACCC----------------GGTAG-----------GCGC-----------------------------GGGTAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----AGTAT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTTT-GTTGCTTAGCGTTGGGAGCCT----ACG-------CTT---CTGTAGCTCCTTAAAGTTAGT-GGCG-GAGTTAGTATCACACT--CTAGACGTAGTAA------ATTT-----ATCTC-GCCTAT--A-GT--TGTACT-----GGTC-CCTT-GCCA-TAAAA-----CACCCCTAA------TTTTTA--AA-----GGTTGACC--------------------------------- Xylaria_cubensis_AF163032 ATTA----CAGAGT----------TAT---CTAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TAC-GTTGCC-T-CGGCGGG--------------------------------------------------------GAAGCC---------TACC-----------------------------------------------CGGT-----------------ACCTACCCT----------------------GTAGTT-------ACCCGGGAGCG---------------------------AGCTACCCT----------------GTAGCCCG-------CTGC-----------------------------AGGCCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGC-CGGT-GG--------------------------ACATCT-------------AA--------------ACTCT---TGTTT------TTA--------------------------GTGATTAT--CT-------------------------------------------------------------------------------------------GA---GTG-------------------TTTATACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAT-AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTCAAGCCCTA-GCTGCTTGGTATTGGGAGCTTG------------TCTGC--GGACAACTCCTCAAAAGCATT-GGCG--AG-TCGCG-GTGACC--CCAAGCGTAGTAA-------TTC-----TTCTC-GCTTAGGTGTGTT-AACGCT-----GGCG-TTCG-GCCA-CTAA------CCCCC-TA-------TTTTCTAGT------GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylaria_enteroleuca_AF163033 ----------------------------------C-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTAG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG--------------------------------CCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-G----------------------------CCCACG------------AA--------------ACTCT----GTTT-----AATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT-GAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGCCT----ACAG------CAC---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-TCCC-GCCG-TAAAA-----CCCC--TA-------TTTTTA--AA-----GGTTGACC--------------------------------- Xylaria_fioriana_AF163034 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CCCG--------------TAGC----------------GCCCTACCCT----------------------GT----------------AG-------------------------------GCCTACCC----------------GG-AA-----------GTGC-----------------------------GGGTAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-G----------------------------CCCACG------------AA--------------ACTCTT---GTTTA----ACCATC-------------------------TGCA-TC-TCT-------------------------------------------------------------------------------------------GA---AA--------------------ACATAACTAA-----------------------------AT--ACG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAT-AAGAACGGAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT--ACGCAG------AAAGCGCT--AGCTCCTCAAAACCAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATCTC----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CCCCCCTA-------TTCTTA-AAA-----GGTTGACC--------------------------------- Xylaria_grammica_DQ322145 --------AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCTTACCCT----------------------GTAG--------------GG-------------------------------CCCTACTT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTCAGTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-CAA------TTTTTA--AA---------------------------------------------- Xylaria_hypoxylon_AF201711 ATTA----AAGAGT----------GTA-ATAAAAC-TCCT---AAA--CCC-C-T-GTGGAA-CTTATA-TTGGTTTGAC-G-CAGCAGA-----------------------------------------------------TA-GCG-TC---------TAC------------------------------CTCG--------------CGGG----------------CTCCTACCTT---------------------GGTA---------------GGA------------------------------GCTTGCAA----------------GGTGG-----------GCGC-----------------------------AGGTCTGTTTTTCCATATTCGTAAGGCTCTCTCTTTTATTAGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCGGTCTGCGCAGT-GGACGCAGTTAGTTA--------------CTTACGTTGCGACATCGCAA--------------GCGTTAT-TGTACAA-ATACTGTGGAGGTCACATAAACCG----TTTACTGTTATAATCT-------------------------------------------------------------------------------------------GA--AAT--------------------ATATAA---A-----------------------------AC--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTG---CTGTAGCTCCTTAAAGGTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-----AATCTTT---ATCTC-GCCTAT--G-GA--TGAGCC-----GGCG-CCTT-GCCG-TAAAA-----CCCC--TAATC-----TTTCA-CAA-----GGTTGACC--------------------------------- Xylaria_hypoxylon_DQ491487 ATTA----AAGAGT----------TAATT-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GTG-TT---------TAC------------------------------CCTG--------------TGAG----------------GTCCTACCCT----------------------GTAG--------------GA-------------------------------CCCTACCT----------------GGTAG-----------ACAC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTA-----ATT{CG}TA-------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAG------ATTCT----ATCTC-GTCTGT--A-GT--GAGGCC-----GGTC-CCCT-GCCG-TAAAA-----CCCC{CG}CTAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylaria_longipes_AF163038 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACATTGCC-T-CGGCAGG-----------------------------------------------------TC-GTG-CC---------TAC------------------------------CCCG--------------TAGC----------------GTCCTACCCT----------------------GT-A--------------GG-------------------------------ACCTACCC----------------GGTAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-G----------------------------CCCACG------------AA--------------ACTCT----GTTT-----AGTAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGAGCCT----ACGG------TAA---TAGTAGCTCCTGAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAG------ATTTT----ATCTC-GCCTATC-A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CCACC-TAA------TTTCTA--AA-----GGTTGACC--------------------------------- Xylaria_mali_AF163040 ATTA----AAGAGT----------TTT-G-ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-TC---------TAC------------------------------CCTG--------------TGG-----------------CACCTACCCT---------------------G-TA---------------GGA------------------------------CCCGACCT----------------GGTGG-----------TCGC-----------------------------GG---------------------------------TCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGT-GGCC-------------------------CTT--------------TAA--------------ACTTT--------------CTGTG-------TAT----------TCTA-TGTTATT--CT-------------------------------------------------------------------------------------------GA--GTTGG-----------------CAACTAA---A-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTCGCTTAGTGTTGGGAGCCT----ACAG-----TCTT---CTGTAGCTCCCTAAAGTTAGT-GGCG-GAGTCGGTT-CA--CT--CTAGACGTAGTAG------ATCT-----ATCTC-GTCTAT--A-GT--TAAGCC-----GGTC-TCTT-GCCG-TAAAA-----CCCCC-TAAT-------TTCT-CAA-----GGTTGACC--------------------------------- Xylaria_multiplex_AY909018 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTTTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCT---------TAC------------------------------CCTG--------------TGAG----------------ACCCTACCCT----------------------GTAG--------------GG-------------------------------TCTTACCC----------------GGTAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCCTGC-CGGC-GG---------------------------CCCATC------------AA--------------ACTCT----GTTT-----CCTGA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TTCT---CTGTAGCTCTCTAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAC------ATTATG---ATCTC-GCCTAT--A-GA--TGGACC-----GGCG-TCTT-GCCG-TAAAA-----CCCCC-TAAT-----TTCTCA--A------GGTTGACCTC------------------------------- Xylaria_polymorpha_AB274817 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCCCT-CGGCAGG-----------------------------------------------------TC-GCG-C----------TAT------------------------------CCCG--------------TAGC----------------GTCCTACCCT----------------------GT-A--------------GG-------------------------------ACCTACCC----------------GGTAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACA------------AA--------------ACTCT----GTTT-----AATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG------CAC---CCGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTTT---ATCTC-GCCTATC-A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CCCC--CCA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylaria_polymorpha_AF163041 ATTA----AAGAGT----------TTT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-GTACGTTGCC-T-CGGCG--------------------------------------------------------CTGCGTCT-----------C------------------------------CCCG--------------TGAG----------------GACCTACCCTGTA--GGACGC-----TACGCTGTAA----GTT---ATCGGGA---------------------------------------------------------AG-----------ATGC------------------------------ACTAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCTGC-CGGC-GG---------------------------CCCAT------------TAA--------------ACTCT----GTTT-----ATT--------------------------TTTGAA-TT--CT-------------------------------------------------------------------------------------------GA-------G----------------GCTATAA-TAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTAGTGGGGAT-CCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGAGC-T----ACGG---------TCAC-GTAGCTCCTCAAATGTAGTTGGCG-GAGTTGGTT-CACACT--CTAGACGTAGTAA------TTTTT----ATCTC-GCCTGTG-A-GT--TGGACC-----GGTC-CCCTCGCCG-TAAAA-----CCCCCCTAA------ATTCTA--AA-----GGTT------------------------------------- Xylaria_venosula_EF026149 ATTA----AAGAGT----------TAAA--ACAAC-TCCT---AAA--CCC-A-T-GTG-AA-CCTACC-ATT-GTTGCC-T-CGGCAGG----------------------------------------------------TCT-GCAACT---------TAC------------------------------CCTG---------------AGGG---------------GACCTACCCT----------------------GTAG--------------GGA------------------------------CCTTACCC----------------GGTAG-----------TTGC-----------------------------CGGCAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTGC-CGGT-GG---------------------------TCTACT------------AA--------------ACTCT----GTTT-----ACT-A--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---ATA-------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCC-T-GTTGCTTAGCGTTGGGAGCCT----ACAGATA--CCCT---CTGTAGTTCCTTAAAGTTAGT-GGCG-GAGTCGGTTTCACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GCCTAT--A-GA--TGAGCC-----GGTC-CCTT-GCCG-TAAAAA----CCCC--TAAT-----TTCT-A--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18731 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18734 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18737 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CCCG--------------TAGC----------------CTCCTACCCT----------------------GT-A--------------GG-------------------------------ACCTACCC----------------GGTAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCAAG------------AA--------------ACTCT----GTTT-----AGTAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG------CAC---CCGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATC-A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CAA------TTTCTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18738 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18739 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18741 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18743 ATTA----AAGAGT----------GTA---ACAAC-TCCCT--AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCC---------TAC------------------------------CCTG--------------TAAG----------------ACCCTACCCT----------------------GTAG--------------AG-------------------------------TCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCCTGC-CGGC-GG---------------------------CCTACA------------AA--------------ACTCT----GTTT-----ACTCA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TCCC---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATTTTT---ATCTC-GCCTAC--A-GA--TGGACC-----GGCG-CCCT-GCCG-TAAAA----CCCCCCCTAAT-----TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18747 -TTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGGGG-----------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18752 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18756 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGT--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18768 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-CAACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTCG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------GTGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACT------------AA--------------ACTCT----GTTT-----GATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCAGGACCGTTCGAGCGTCATTT-CGA-CCCTTAAGCCTCG-GTTGCTTAGTGTTGGGAGCCT----ACGG------TAA---ACGTAGCTCCTCAAAGTTAGT-GGCG-GAGTTGGTT-CACACTT-CTAGACGTAGTAA------TTTTTT---ATCTC-GCCTACC-A-GT--TGGACC-----GATC-CCCT-GCCG-TAAAAA----CCCCC--AA------CTTCT--CAA-----GGTTGACCTCGAATCGGTTCAGACAAACTCGCTAAATTGAA Xylariaceae_BCC_18771 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTCG--------------TAGC----------------ACCCTACCCTA-----------------CCCTGT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTT-----AGCAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-TAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAG------CAC---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CCCCC-TA-------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18772 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAAA-CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCCCAGACG---------CGCC-----------------------------------------------TAGC--------------GCGCGCACCCCC----------------------A---------------GGGG-------------------------------------------------------GGG--------------CGC-----------------------------GGCTGGGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------CGTCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGCCGGCC-CGCACC--CCAGGCGTAGTAG------TTCAGTC--AGCTC-GCCCGC--G-GT--CGGACC-----AGTC-CCCT-GCCG-TAAAA-----CACCC-CA-------TTCTCG-CAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18777 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGGGG-----------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18778 ATTA----TAGAGT----------TTT--CTAAAC-TCCC----AA--CCC-A-T-GTG-AA-CTTACC-ATT-GTTGCC-T-CGGCAG-----------------------------------------------------------AAGC---------TGCTCGGTGCACCCTACCTTGGAACGGCCT-ACCCTG--------------TAGC---------------------GCCTTACC--------------CTGGAACGGCTTA-------------------------------------------CCCTGT--------------------------------------------------------------------AACGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGC-CGGT-GG---------------------------ACTACC------------AA--------------ACTCT---TGTTAT-----TT-T------------------------ATTGTAAT---CT-------------------------------------------------------------------------------------------GA---GC-------------------GTCTTATTTTA-----------------------------AT--AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCC-----TAGCTTAGTGTTGGGAGCCT----ACTGCTT--TTGCTAGCTGTAGCTCCTGAAATACAAC-GGCG-GATCTGCGA-TATCCT--CTGAGCGTAGTAA------ATTTTT---ATCTC-GCTTTTG-ACTGG-AGTTGC-----AGCGTCTTTGGCCGCTAAAT-----CCCC--CA-A-----TTTTTA--AT-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18786 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTAG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTT-----AATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGCCT----ACAG------CAC---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-TCCC-GCCG-TAAAA-----CCCC--TA-------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18793 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CTCT-----------------------------CTCG--------------TAGG-----------------TCCTACGC--------------------------------------------------------------------------------------------------GGAAG-----------GCGC-----------------------------GGGTACC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CCATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTC-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCG-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAC--A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CGCCC-CAG------TCTTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18796 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAA--CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCTCATACG---------TGCCC---------------------------CCTCA--------------TGGCGT-------GCCCGGCGCGCAGCCCC----------------------GCAAGG---------GGGGG-------------------------------------------------------GGG-------------CCGC-----------------------------GGGTGAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGT-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------TATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGCC-CGTACC--CCAGGCGTAGTAG------TTCATTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CA-------TTTTT--TAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18797 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGT--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18798 ATTA----TAGAGT----------TTT--CTAAAC-TCCC----AA--CCC-A-T-GTG-AA-CTTACC-TTTTGTTGCC-T-CGGCAG-----------------------------------------------------------GAGT---------TA-------------------------------------------------TAG----------------------GTCTT--------------------------------------------------------------------------CTTAT--------------------------------------------------------------------AGCTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGC-CGGT-GG---------------------------ACCATT------------AA--------------ACTCT---TGTTAT-----TT-T-------------------------ATGTAA-T--CT-------------------------------------------------------------------------------------------GA---GC-------------------GTCTTATTTTA-----------------------------AT--AAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCC-----TAGCTTAGTGTTGGGAATCT----ACTTCTT--T--ATAGTTGTAGTTCCTGAAATACAAC-GGCG-GATTTGTAG-TATCCT--CTGAGCGTAGTAA-------TTTTT---TTCTC-GCTTTTG-TTAGG-TGCTAT-----AAC--TCCCAGCCGCTAAA------CCCC--CA-A-----TTTTTT--GT-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18853 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CCC------------------------------CTCG--------------TAGG-----------------CCCTACCCT----------------------GT-A--------------AG-------------------------------GCTTACCC----------------GGAAG-----------GCGC-----------------------------GGGTACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCA-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAT--A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CGCCC-TAA------TTTTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18861 ATTA----AAGAGT----------TCT---ATAAC-TCCT---AAA--CCC-A-T-GTG-TA-CATACC-TTTTGTTGCC-T-CGGCAGG-----------------------------------------------------TG-GCG-CC---------TAC------------------------------CCGG--------------TGGT----------------GCCCTACCCTGTA--------GGACCTACCCGGT-A--------------GG-------------------------------ACCTACCC----------------GGTAG-----------ACACCAGCCTCGGTTCCAAGAG----------GGGATAATGCTTTACGAACGTACCTCCTATGCGAGTGCTACAACTGACTGCATTATCCCCTTGTGAGGTTAAAAGCTTTAAGACCGTACCTCCTATGCGAGTGTTACAACTTTACTGCATAATACCCTTGCGGGAACCGAGGACTTACCCGGTAGATAACAGCCTCGGTTCCAAGAGAGGAGAAAAGCATGATGAACGTACCCTCCTATGCGAGTGTTACAAGTGACTGCGTAATCCCCTTGTGAGGTTAAAAGCTTTAAGACCGTACCTCCTATGCGAGTGTTACAACTTTACTGCATAATACCCTTGCGGGGACCGAGGAC-GCCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA--CA---------------------GTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGGGCCT----ACAG------CAC----TGTAGCCCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAG------ATTTT----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-CCCT-GCCA-TAAAA-----CCCC--TAC------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18862 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CCCG--------------TAGC----------------CTCCTACCCT----------------------GT-A--------------GG-------------------------------ACCTACCC----------------GGTAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCAAG------------AA--------------ACTCT----GTTT-----AGTAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACGG------CAC---CCGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATC-A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACAC-CAA------TTTCTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18863 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CCC------------------------------CTCG--------------TAGG-----------------CCCTACCCT----------------------GT-A--------------AG-------------------------------GCTTACCC----------------GGAAG-----------GCGC-----------------------------GGGTACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCA-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAT--A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CGCCC-TAA------TTTTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18865 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-CAACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTCG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------GTGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACT------------AA--------------ACTCT----GTTT-----GATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCAGGACCGTTCGAGCGTCATTT-CGA-CCCTTAAGCCTCG-GTTGCTTAGTGTTGGGAGCCT----ATGG------TAA---ACGTAGCTCCTCAAAGTTAGT-GGCG-GAGTTGGTT-CACACTT-CTAGACGTAGTAA------TTTTTT---ATCTC-GCCTACC-A-GT--TGGACT-----GATC-CCCT-GCCG-TAAAAA----CCCC---AA------CTTCT--CAA-----GGTTGACCTCGAATCGGTTCAGACAAACTCGCTAAATTGAA Xylariaceae_BCC_18869 ATTA----AAGAGT----------GTA---ACAAC-TCCCT--AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCC---------TAC------------------------------CCTG--------------TAAG----------------ACCCTACCCT----------------------GTAG--------------AG-------------------------------TCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCTGC-CGGC-GG---------------------------CCTACC------------AA--------------ACTCT----GTTT-----ACTCA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TCCC---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATTTTT---ATCTC-GCCTAC--A-GA--TGGACC-----GGCG-CCCT-GCCG-TAAAA-----CCCCCCTAAT-----TTTTTA--AT-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18870 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTAG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTTT-----AATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGCGTTGGGAGCCT----ACAG------CAC---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA-------TTTT----ATCTC-GCCTATT-A-GT--TGGACC-----GGTC-TCCC-GCCG-TAAAA-----CCCC--TA-------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18873 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_18886 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT------TT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGT--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18902 ATTA----AAGAGT----------TTTCT-ACAAC-TCCC---AAA--CCCC--T-GTG-AA-CATACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-TCG-CC---------TACC-----------------------------CTCG--------------TAGC----------------CCCTTACACC----------------------GT-A--------------GG-------------------------------GCCTACGCC---------------GGGTG-----------GTGC-----------------------------GCGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCGCG------------AA--------------ACTCT----GTTT-----AGCAC--------------------------TGAA-TC-TCT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCCAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--GTCTC-GCCTGT--A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTCTA--AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_18905 ATTA----AAGAGT----------TTTCT-ACAAC-TCCC---AAA--CCCC--T-GTG-AA-CGTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-TCG-CC---------TACC-----------------------------CTCG--------------TAGC----------------CCCCTACACC----------------------GT-A--------------GG-------------------------------GCCTACGC----------------GGGGG-----------GTGC-----------------------------GGGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCGCA------------AA--------------ACTCT----GTTT-----AGCAC--------------------------TGAA-TC-TCT-------------------------------------------------------------------------------------------GA---AC--------------------ATGCAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCCAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--GTCTC-GCCTGT--A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTCTG--AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20842 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CCC------------------------------CTCG--------------TAGG-----------------CCCTACCCT----------------------GT-A--------------AG-------------------------------GCTTACCC----------------GGAAG-----------GCGC-----------------------------GGGTACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCA-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAT--A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CGCCC-TAA------TTCTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20844 ATTA----CTGAGT----------TCTA-AAAAAC-TCC-----AA--CCC--TTTGTG-AA-CCTACC-TCT-GTTTCC-TCCGGCGTACAGCGCCCTGGCCTACCTACAGGGCCTCCCCCCCCTAAGGGGGGTTGACCTGCTAGGGAGG----------TGCCTAGCTGATCAGTACCTAATCCTTCGG-GCTCTGGG------------TAGCTGTGATA--GGTGCCGACCAAGGCCTCGGT-------------AGCGCGCCGAGAGGACCGCTCGAAGCTCTTTTTCTCCAACTCTTGCTAGAACAAACCCTTATCGAAGGAACTATTCCAATAAAAA-----------CCACTCGAAAAAAATATCGAAGAAAATTATC-GAAGTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAT-CGAA-GAAATTATCGAAGATTCCTTTTTTTAC-GGCTATT------------AATGATTTATGACT-TACTGC---TGTTTC-----TTTTCGCTCGAAGGTCTTTCCCGGTTGGAATTGTATT--CTCGTAGTGCAATTTTTACCCTATAGGCGTTCGTGTTTTAGGGAGGCTGTAGTGTGTTTTTATTTCCTTTAGCTCAAACGTGTTTCCCGGTTGGA---ATTAAATCTCGACAA-GAACTGTTCTAGTTTAGGGTCTGAATAACCTTAAACTTTTTTTGCAT--AAAAACAAAATTTTACT-TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATAA-CAA-CCCTTAAGCCCT--GTAGCTTAGCGTTGGGAACCT----ACCGCTT------AGGCGGTAGCTCCTTAAATTTAGT-GGCG-GAGTTACAG-CACACC--CTAAGCGTAGTAA------AACT-----ACCTC-GCTTTCA-GGGAG-C-CTGT-----AGCG-GCCT-GCCGTTAAAAAA---CCCCC-TATA-----ATTCTA--GT-----GTTTGACCTCGGATTAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20845 ATTA----AAGAGT----------GTA---ACAAC-TCCCT--AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCC---------TAC------------------------------CCTG--------------TAAG----------------ACCCTACCCT----------------------GTAG--------------AG-------------------------------TCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCCTGC-CGGC-GG---------------------------CCTACA------------AA--------------ACTCT----GTTT-----ACTCA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TCCC---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATTTTT---ATCTC-GCCTAC--A-GA--TGGACC-----GGCG-CCCT-GCCG-TAAAA----CCCCCCCTAAT-----TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20849 ATTA----AAGAGT----------TAAAA-ACAAC-TCCT---AAA--CCC-A-T-GTG-AAACCTACC-TTT-GTTGCC-T-CGGCAGG----------------------------------------------------TCT-GCAACT---------TAC------------------------------CCTG---------------AGGG---------------GACCTACCCT----------------------GTAG--------------GTA------------------------------CCTTACCC----------------GGTAG-----------TTGC-----------------------------GGGCAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTGC-CGGT-GG---------------------------TCTACT------------AA--------------ACTCT----GTTT-----ACT-A--------------------------TGTCATT--CT-------------------------------------------------------------------------------------------GA---ATA-------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCC-T-GTTGCTTAGCGTTGGGAGCCT----ACAGATA--CCCT---CTGTAGTTCCTTAAAGTTAGT-GGCG-GAGTCGGTTTCACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GCCTAT--A-GA--TGAGCC-----GGTC-CCTT-GCCG-TAAAA-----CCCCC-TAAT-----TTCT-A--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20850 ATTA--AAGAGAGC----------CTA--AAAAAC-TCCCGC-AAAA-CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAGG-----------------------------------------------------CCCCAGACG---------CGCC-----------------------------------------------TAGC--------------GCGCGCACCCCC----------------------A---------------GGGG-------------------------------------------------------GGG--------------CGC-----------------------------GGCTGGGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------CGTCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CATGTAGGAA-----------------------------ATT-AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTTAGT-GGCG-GAGCCGGCC-CGCACC--CCAGGCGTAGTAG------TTCAGTC--AGCTC-GCCCGC--G-GT--CGGACC-----AGTC-CCCT-GCCG-TAAAA-----CACCC-CA-------TTCTCG-CAA-----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_20930 ATTA--GAGAGAGC----------CTA--AGAAAC-TCCCGCAAAAA-CCCCA-T-GTG-AA-CATACC-ATACGTTGCC-T-CGGCAAG-----------------------------------------------------CCCCGGACG---------CGCC-----------------------------------------------CGGC--------------GCGGGC------------------------------------------------------------------------------------------------------------------------------------------------------------GGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCAAG------------CA-------------AACCC----TGT------CATCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCG-----------------CACGTAGGAA-----------------------------AATGAAG---------------TC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT-CAACCCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGGCCC--GC------CGTAGCTCCTCAAAGTCAGT-GGCG-GAGTCGGCC-CGCACC--CCAGGCGTAGTAG------TTCACTC--AGCTC-GCCCGC--G-GT--CGGACC-----GGTC-CCCT-GCCG-TAAAA-----CGCCC-CA-------CTCTCG-CAAA----GGTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_20932 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-CAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20933 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TTACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG-CC---------TAC------------------------------CTCG--------------TAGC----------------GCCTTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----GATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-AAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAGAAC---CAC---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA-------TTTTT---ATCTC-GCCTATC-A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CCCT--TC-------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20936 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGT--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20940 ATTA----CTGAGT----------TAT--CTAAAC-TCCC----AA--CCC-TAT-GTG-AACCTTACC-GTC-GTTGCC-T-CGGCGG---------------------------------------------GTTG--------GGGAGC---------TAC------------------------------CCTG--------------TAGT--------------------AGCCCC-------------------------------------------------------------------------CCGTAC--------------------------------------------------------------------GGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGC-CGGT-GG---------------------------ACTGT-------------AA--------------ACTCT---TGTTTT-----TTGT-------------------------ATGGAATT--CT-------------------------------------------------------------------------------------------GA---AT-------------------GCTTCAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCCA-GTTGCTTAGCGTTGGGAGTCT---GAGCCCT---TCAGGGGGCTCAGTTCCTCAAAGTCATC-GGCG-GAGTCGGAT-CGTGCT--CTGAGCGTAGTAA-------TTTT----CTCTC-GCTTCTG-A-GGC-CGTTCC-----GGTG-ACTG-GCCG-TAAAA-----CCCC--TATA-----CTTCTA--GT-----GGTTGACCTCGGATTAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20943 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CCC------------------------------CTCG--------------TAGG-----------------CCCTACCCT----------------------GT-A--------------AG-------------------------------GCTTACCC----------------GGAAG-----------GCGC-----------------------------GGGTACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCA-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAT--A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CGCCC-TAA------TTTTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20950 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_20951 ATTA----AAGAGT----------TTT--TACAAC-TCCC---AAA--CCC-C-T-GTG-AA-CATACC-TTTTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-CTGGCC---------TACC-----------------------------CT-G--------------TAGCG---------------CCCCTACACT----------------------GT-A--------------GG-------------------------------GCTTGCTTTAG-------------GGGGA-----------GCGCT----------------------------GGGGGCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CTCGCA------------AA--------------ACTCT----GTTT-----AGCAT--------------------------TGA--CT-TCT-------------------------------------------------------------------------------------------GA---AT--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCTAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--ACCTC-GCCTGT--A-GC--TGGATC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTTTTT-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20955 ATTA----AAGAGT----------TTTCT-ACAAC-TCCC---AAA--CCC-C-T-GTG-AA-CATACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------CC-TCG-CC---------TACC-----------------------------CTCG--------------TAGC----------------CCCCTACACC----------------------GT-A--------------GG-------------------------------GCCTACGCC---------------GGGTG-----------GTGC-----------------------------GCGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCGCG------------AA--------------ACTCT----GTTT-----AGCAC--------------------------TGAA-TC-TCT-------------------------------------------------------------------------------------------GA---AC--------------------ATATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTCGCTTAGCGTTGGGAGCCT----ACGG------CA----GCGTAGCTCCCCAAAGTTAGT-GGCG-TGGTCGGTT-CACACT--CCAGACGTAGTAG------ATTTT-C--GTCTC-GCCTGT--A-GT--TGGACC-----GGTC-CCCT-GCCG-TAAAA-----CACCC-CAA------TTCTA--AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20960 ATTA----AAGAGT----------GTA---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TCATGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCG--C---------CCC------------------------------CTCG--------------TAGG-----------------CCCTACCCT----------------------GT-A--------------AG-------------------------------GCTTACCC----------------GGAAG-----------GCGC-----------------------------GGGTACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT----GTCTC----ATCGT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCTT-GTTGCTTAGCGTTGGGAGCCT----ACGG------CA----CCGTAGCTCCCCAAAGTCAGT-GGCA-GAGTCGGCT-CACACT--CTAGACGTAGTAA-------TTTCTC--ACCTC-GCCTAT--A-GT--TGGACC-----GGTC-CCTT-GCCG-TAAAA-----CGCCC-TAA------TTTTTA-AAA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20971 ATTA----AAGAGT----------GTA---ACAAC-TCCCT--AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCC---------TAC------------------------------CCTG--------------GAAG----------------ACCCTACCCT----------------------GTAG--------------AG-------------------------------TCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCTGC-CGGC-GG---------------------------CCTACA------------AA--------------ACTCT----GTTT-----ACTCA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TCCC---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATTTTT---ATCTC-GCCTAC--A-GA--TGGACC-----GGCG-CCCT-GCCG-TAAAA-----CCCCCCTAAA-----TTTTTA--AT-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20973 ATTA----AAGAGT----------GTA---ACAAC-TCCCT--AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GC-GCC---------TAC------------------------------CCTG--------------TAAG----------------ACCCTACCCT----------------------GTAG--------------AG-------------------------------TCCTACCC----------------GGGAG-----------ACGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCTGC-CGGC-GG---------------------------CCTACA------------AA--------------ACTCT----GTTT-----ACTCA--------------------------TGTTATT-TCT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGTGTTGGGAGCCT----ACAG-----TCCC---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-CACACT--CTAGACGTAGTAA------ATTTTT---ATCTC-GCCTAC--A-GA--TGGACC-----GGCG-CCCT-GCCG-TAAAA-----CCCCCCTATT-----TTTTTA--AT-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20986 ATTA----AAGAGT----------TTTG--ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTTTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GTG-TC---------TAT------------------------------CTTG--------------CGGC----------------CTCCTACCCT----------------------GTAG--------------GA-------------------------------GACTGCCC----------------GGTAG-----------TCAC-----------------------------GGGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCTGT-CAGT-GG---------------------------CCCGTT------------AA--------------ACTCT----GTTA-----ATCATA-------------------------CGCCATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------TATCAAGTAA-----------------------------AT--AAG---------------TTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCCTGTTGCTTAGTGTTGGGAGCCT----ACGG-----CCTT---CTGTAGCTCCCTAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTGG------ATTCTTT--ATCTC-GTCTGT--A-GT--TGGGCC-----GGTC-TCTT-GCCG-TAAAA-----CCCCCCCGATCTT-TTTTTTC--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20987 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---TTGTAGCTCCCTAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20988 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TAACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCA-CC---------TAC------------------------------CTTG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------GTGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACC------------AA--------------ACTCT----GTTT-----GATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCATTAGTATTCTAGTGGGCAGGACCGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTTC-GTTGCTTAGTGTTGGGAGCCT----ACGG------CAA----CGTAGCTCCTCAAAGTTAGT-GGCG-GAGTTGGTT-CACACT--CTAGACGTAGTAA------TTTTTT---ATCTC-GCCTATT-A-GT--TGGACT-----AATC-CCCT-GCCG-TAAAA-----CCCCC--AA------TTTAT--CAA-----GGTTGACCTCGAATCGGTTCAGACAAACTCGCTAAATTGAA Xylariaceae_BCC_20989 ATTA----CTGAGT----------TAT--CTAAAC-TCCC----AA--CCC-TAT-GTG-AACCTTACC-GTC-{CG}TTGCC-T-CGGCGG---------------------------------------------GTTG--------GGGAGC---------TAC------------------------------CCTG--------------TAGT--------------------AGCCCC-------------------------------------------------------------------------CCGTAC--------------------------------------------------------------------GGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGC-CGGT-GG---------------------------ACTGT-------------AA--------------ACTCT---TGTTTT-----TTGT-------------------------ATGGAATT--CT-------------------------------------------------------------------------------------------GA---AT-------------------GCTTCAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCCA-GTTGCTTAGCGTTGGGAGTCT---GAGCCCT---TCAGGGGGCTCAGTTCCTCAAAGTCATC-GGCG-GAGTCGGAT-CGTGCT--CTGAGCGTAGTAA-------TTTT----CTCTC-GCTTCTG-A-GGC-CGTTCC-----GGTG-ACTG-GCCG-TAAAA-----CCCC--TATA-----CTTCTA--GT-----GGTTGACCTCGGATTAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20991 ATTA----AAGAGT----------TCT---ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CATACC-TAACGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCA-CC---------TAC------------------------------CTTG--------------TAGC----------------ACCCTACCCT----------------------GT-A--------------GG-------------------------------GCCTACCC----------------GGGAG-----------GTGC-----------------------------GGGTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTGC-CGGC-GG---------------------------CCCACC------------AA--------------ACTCT----GTTT-----GATAT--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---AC--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCATTAGTATTCTAGTGGGCAGGACCGTTCGAGCGTCATTT-CAA-CCCTTAAGCCTTC-GTTGCTTAGTGTTGGGAGCCT----ACGG------CAA----CGTAGCTCCTTAAAGTTAGT-GGCG-GAGTTGGTT-CACACT--CTAGACGTAGTAA------TTTTTT---ATCTC-GCCTATT-A-GT--TGGACT-----AATC-CCCT-GCCG-TAAAA-----CCCCC--AA------TTTATATCAA-----GGTTGACCTCGAATCGGTTCAGACAAACTCGCTAAATTGAA Xylariaceae_BCC_20992 ATTA----CTGAGT----------TAT--CTAAAC-TCCC----AA--CCC-TAT-GTG-AACCTTACC-GTC-GTTGCC-T-CGGCGGG---------------------------------------------TTG--------GGGAGC---------TAC------------------------------CCTG--------------TAGT--------------------AGCCCC-------------------------------------------------------------------------CCGTAC--------------------------------------------------------------------GGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGC-CGGT-GG---------------------------ACTGT-------------AA--------------ACTCT---TGTTTT-----TTGT-------------------------ATGGAATT--CT-------------------------------------------------------------------------------------------GA---AT-------------------GCTTCAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCTA-GTCGCTTAGCGTTGGGAGTCT---GAGCCCT---TCAGGGG-CTCAGTTCCTCAAAGTCATC-GGCG-GAGTCGGAT-CGTGCT--CTGAGCGTAGTAA-------TTTT----CTCTC-GCTTCTG-A-GGC-CGTTCC-----GGTG-ACTG-GCCG-TAAAA-----CCCC--TATA-----CTTCTA--GT-----GGTTGACCTCGGATTAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20993 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_20995 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-CAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20996 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_20997 ATTA----AAGAGT----------TTTG--ATAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTTTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GTG-TC---------TAT------------------------------CTTG--------------CGGC----------------CTCCTACCCT----------------------GTAG--------------GA-------------------------------GACTGCCC----------------GGTAG-----------TCAC-----------------------------GGGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCTGT-CAGT-GG---------------------------CCCGTT------------AA--------------ACTCT----GTTA-----ATCATA-------------------------CGCCATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------TATCAAGTAA-----------------------------AT--AAG---------------TTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCCTGTTGCTTAGTGTTGGGAGCCT----ACGG-----CCTT---CTGTAGCTCCCTAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTGG------ATTCTTT--ATCTC-GTCTGT--A-GT--TGGGCC-----GGTC-TCTT-GCCG-TAAAA-----CCCCCCCGATCTT-TTTTTTC--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20998 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCATTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCTCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGT--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-TAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_20999 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-CAA------TTTTTA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_21000 ATTA----AAGAGT----------TAT-T-ACAAC-TCCC---AAA--CCC-A-T-GTG-AA-CTTACC-TTCTGTTGCC-T-CGGCAGG-----------------------------------------------------TC-GCGACC---------TAC------------------------------CCTG--------------TGAG----------------GCCCTACCCT----------------------GTAG--------------GG-------------------------------CCCTACCT----------------GGTAG-----------TCGC-----------------------------GGGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTGC-CGGT-GG---------------------------CCCATG------------AA--------------ACTCT----GTTT-----ATTCT--------------------------TGTTATT--CT-------------------------------------------------------------------------------------------GA---AT--------------------CTATAACTAA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-CAA-CCCTTAAGCCCCT-GTTGCTTAGCGTTGGGAGCCT----ACAG-----CCTT---CTGTAGCTCCCCAAAGTTAGT-GGCG-GAGTCGGTT-TACACT--CTAGACGTAGTAA------ATTTT----ATCTC-GTCTGC--A-GT--TAGGCC-----GGTC-CCTC-GCCG-TAAAA-----CCCCC-CAA------TTTTCA--AA-----GGTTGACCTCGGATCAGGT-AGGAATACCCGCTGAACTTAA Xylariaceae_BCC_21001 ATTA----GAGAGT----------CTA--AACAAC-TCCC---AAA--CCC-ACT-GTG-AA-CATACC-CTACGTTGCC-T-CGGCAGG------------------------------------------------------C-----------------GCC-----------------------------------------------CGGC---------------TCCGCGACCCC----------------------TC-----------------G-------------------------------------------------------GGG-------------CTGC----------------------------GGGGTGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGC-CGGC-GG---------------------------CCCACG------------AA--------------ACTCT---TGTC-----TAGCAC--------------------------TGAA-TT--CT-------------------------------------------------------------------------------------------GA---GCCCGA----------GAGGGATAAAAACAAA-----------------------------ATT--AG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTT-CAAACCCTCAAGCCTC--GTTGCTTGGTGTTGGGAGCCT----ACG------GC------TGTAGCTCCTCAAAGTCAGT-GGCGTGGGCTGGCT-CGCACC--CCAGATGTAGTAG-------TTATTT--CTCTC-ACCTGT--G-GT--CGGGCT-----AGTC-CCCT-GCCG-TAAAA-----CCCCC-CAGA-----CTTTT--TAGT----GTTTGACCTCGGATCAGGT-AGGGATACCCGCTGAACTTAA Xylariaceae_BCC_21002 ATTA----CTGAGT----------TAT--CTAAAC-TCCC----AA--CCC-TAT-GTG-AACCTTACC-GTC-GTTGCC-T-CGGCGGG---------------------------------------------TTG--------GGGAGC---------TAC------------------------------CCTG--------------TAGT--------------------AGCCCC-------------------------------------------------------------------------CCGTAC--------------------------------------------------------------------GGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGC-CGGT-GG---------------------------ACTGT-------------AA--------------ACTCT---TGTTTT-----TTGT-------------------------ATGGAATT--CT-------------------------------------------------------------------------------------------GA---AT-------------------GCTTCAACTTA-----------------------------AT--AAG---------------TT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTT-CAA-CCCTTAAGCCCTA-GTCGCTTAGCGTTGGGAGTCT---GAGCCCT---TCAGGGG-CTCAGTTCCTCAAAGTCATC-GGCG-GAGTCGGAT-CGTGCT--CTGAGCGTAGTAA-------TTTT----CTCTC-GCTTCTG-A-GGC-CGTTCC-----GGTG-ACTG-GCCG-TAAAA-----CCCC--TATA-----CTTCTA--GT-----GGTTGACCTCGGATTAGGT-AGGAATACCCGCTGAACTTAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-1447; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-1447; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3835] TITLE '28S rDNA D1-D2'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=575; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Biscogniauxia_mediterranea_microspora_BCC_1 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC-TGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCTACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGGCCAGACCTTCTCCTGGCGGATCATCCGGCGTTCT-CTCGCCGGTGCACTTCGCCAGGTCT-AGGCCAGCATCGGCTCCCGT-AGGGGGACAA-AAGCAGTGGGAAAGTAGCTCCCCC--GGGAGTGTTATAGCCCTAAGCATAATATCCTTACGGGGGCCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Biscogniauxia_nummularia_exutans_BCC_110 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTAGGGGGATCATCTGGTGTTTT-CACC--GGTGCACTCCCCGTAGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCCTGGCATAATACCCCTCGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Biscogniauxia_nummularia_merrillii_BCC_121 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAATTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGGCCAGACCTTTTCCTAGCGGATCATCTAGTGTTCT-CACT--GGTGCACTTCGTTAGGTTT-AGGCCAGCATCGGCTTCTGT-AGAGGGATAA-AAGCAGTGGGAAAGTAGCTCTCTC--GGGAGTGTTATAGCCCTAAGCATAATACCTTTACGGGGGCCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Daldinia_bambusicola_BCC_1103 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCAAACCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGATCATCCGGCGTTCT-CGCC--GGTGCACTCCGCCTGGTTG-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCCTGGCGCAATACCCCTCGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Daldinia_eschscholzii_BCC_1242 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCAAACCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCGTTCT-CGCC--GGTGCACTCCGCCTGGTTG-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCCTGGCGTAATACCCCTCGGGGGACCGAGGAACGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Daldinia_eschscholzii_BCC_1313 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCAAACCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCGTTCT-CGCC--GGTGCACTCCGCCTGGTTG-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCCTGGCGTAATACCCCTCGGGGGACCGAGGAACGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Daldinia_sabahense_BCC_21041 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTTAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGTTG-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTCGGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGAACGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_cf_fendleri_BCC_21050 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGCCGCCGAACCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCTCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTCCGCCGGGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCCTTGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCCTGGCGTAATACCCTTCGGGGGACCGAGGATCGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_cf_subgilvum_BCC_22995 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GTGGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGCACGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTATACATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGCTT-AGGCCAGCATCGGTTCTCTT-AGGGGGATAA-AGGCCGGGGGAACGTAGCTCTCTA--GGGAGTGTTATAGCCCCCAGCGTAATACCCTTCGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_cf_symphyon_BCC_20324 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGCGCCTTCCAAGTTCCCTAGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGATCATCCGGCGTTCT-CGCC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTTTCCC-AGGGGGATAA-AGGCGGCGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCGCCGCGTAATACCCTTGGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_cf_trugodes_BCC_23010 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGAC-CCAGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATCTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGGG-ATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTTCCCC-CGGGGGATAA-AGGCTTAAGGCATGTAGCTCTTTC--GGGAGTGTTATAGCCCTCTGCGTAATACCCTGGGGGGGACCGAGGATCGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_crocopeplum_BCC_1114 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAATTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGGCCAGACCTTTTCCTAGCGGATCATCTAGTGTTCT-CACT--GGTGCACTTCGTTAGGTTT-AGGCCAGCATCGGCTTCTGT-AGAGGGATAA-AAGCAGTGGGAAAGTAGCTCTCTC--GGGAGTGTTATAGCCCTAAGCATAATACCTTTACGGGGGCCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_dieckmannii_BCC_22982 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCCGGCCCCTGGCGGCCTGAGTTGTAATTTGTAGAGGAAGCTTTAGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATGTATGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGTCCAGAGCTAGGCCTGGCGGATCCCACGGCGATCGCCGCC--GATGGTACTCCGCCGGCCT-AGGCCAGCATCGGTTCTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCCCTA--GGGAGTGT-ATAGCCCCTCGCGTAATACCCCTCGGGGGACCGAGGACCGCGCATTC---GCAAGGATGCTGGCGTAATGGAGGTCAACGAC Hypoxylon_duranii_BCC_22993 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTTAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGCCACCAAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTCTCCAGGCGGATCATCCGGGGTTCT-CCCC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTCTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCCTGGCGTAATACCCTTCAGGGGACCGAGGACCGCGC-TTCG--GCTAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_fendleri_BCC_1106 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGGGAATCATCCGGTGTTCT-CACC--GGTGCACTTCCCCTGGTTT-AGGCCAGCGTCGGTTCTCTT-AGGGGGATAA-AGGCTTGGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCCTCGCGTAATACCCTTCGGGGGACCGAGGATCGCGC-TCT---GCAAGGACGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_haematostroma_BCC_1252 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGGGAATCATCCGGTGTTCT-CACC--GGTGCACTTCCCCTGGTTT-AGGCCAGCGTCGGTTCTCTT-AGGGGGATAA-AGGCTTGGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCCTCGCGTAATACCCTTCGGGGGACCGAGGATCGCGC-TCT---GCAAGGACGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_haematostroma_BCC_1314 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGGGAATCATCCGGTGTTCT-CACC--GGTGCACTTCCCCTGGTTT-AGGCCAGCGTCGGTTCTCTT-AGGGGGATAA-AGGCTTGGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCCTCGCGTAATACCCTTCGGGGGACCGAGGATCGCGC-TCT---GCAAGGACGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_macrocarpum_BCC_2365 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTACCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGAACATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCCTTGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCTTGGCGCAATACCCCTCGGGGGACCGAGGACCGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_monticulosum_BCC_236 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAATTGTAATTTGTAGAGGATGCTTTGGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGATACCAAGCCTATGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGTTTAGGGCACGTAGCTCCTTC--GGGAGTGTTATAGCCCTTTACGTAATACCCTTCGGGGGACCGAGGACCGCGCATT----GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_moriforme_BCC_1176 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTAGGGGGATCATCTGGTGTTCT-CACC--GGTGCACTCCCCGTAGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCCTGGCATAATACCCCTCGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_nitens_BCC_23565 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTACCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCTGGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCCTCGCGTAATACCCCTCGGGGGACCGAGGACCGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_perforatum_BCC_18288 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTT-GCGGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGTCTGGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCTTGGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGAACGCGC-TCT---GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_rubiginosum_BCC_1109 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTACCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGACCAGACCTTTTCTAGGCGGATCATCCGGTGTTTT-CACC--GGTGCACTCCGTTTAGTTT-AGGCCAGCATCGGTTTTTGT-AGGGGGATAA-AAACCTGGGGAATGTGGCTCCCTC--GGGAGTGTTATAGCCCTTCGTATAATACCCCTCCAGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Hypoxylon_sp_BCC_1308 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCATTTT-TGCC--GGTGCACTTCGCCTGGTCT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGATCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Hypoxylon_sp_BCC_23642 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTTG-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Kretzschmaria_cf_lucidula_BCC_18212 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCACCCGGTGTTCT-CACC--GGTGCACTTTGCCAGGTTG-AGGCCAGCATCGGTTTTCGT-ACGGGGGAGAAAAGCCTGGGGAACGTAGCTCTCTC--GAGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Kretzschmaria_cf_macrosperma_BCC_22760 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTAAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCCAGGTCG-AGGCCAGCATCGGTTTTCCGCAGGGGGATAA-AAGCTTGGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCCTCGCACAATACCTTTGCGAGGACCGAGGACCGCGCCTCCGG-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Nemania_cf_bipapillata_BCC_20327 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGCCCGAGTTGTAATTTGTAGAGGACGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCATCCGGTGTTCTTCACT--GGTGCACTTCGCCGGGGCAGAGGCCAGCATCGGTTTCCGC-GGGGGGACAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATGCCCCCGCGGGGACCGAGGACCGCGCCCCCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Nemania_diffusa_BCC_23666 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCGCC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Pestalotiopsis_sp_BCC_1119 AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCT-CTCC--GGTGCACTTTGCCCAGTAA-AGGCCAGCATCGATTTTCGG-CGGCGGATAA-AAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGC-TTCT--GCAAGGATGCTGGCGTAATGGTTATCAATCAC Pestalotiopsis_sp_BCC_18778 AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCT-CTCC--GGTGCACTTTGCCCAGTAA-AGGCCAGCATCGATTTTCGG-CGGCGGATAA-AAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGC-TTCT--GCAAGGATGCTGGCGTAATGGTTATCAATCAC Pestalotiopsis_sp_BCC_18798 AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTT--GGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCT-CTCC--GGTGCACTTCGCCCAGTAA-AGGCCAGCATCGGTTTTCGG-CGTGGGATAA-AAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGC-TTCT--GCAAGGATGCTGGCGTAATGGTTATCAATCAC Whalleya_aff_microplaca_BCC_2123 AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCAAGTTCCCTGGAACGGGAC-CCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCTGGGCGGATCACCCGGTGTTCT-CACC--GGTGCACTTCGCCTAGTTT-AGGCCAGCATCGGTTTTTAT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTTTGCGTAATACCCTTATAGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_allantoidea_BCC_1340 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCCCTGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_anisopleura_BCC_17352 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACTAGACCTTTTCCTAGCGGATCAGCCGGTGTTTT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCCGT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGTATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_apiculata_BCC_1136 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTT-AGGCCAGCATCGGTTTCCGC-AGAGGGATAA-AAGCTCTGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTGTGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_arbuscula_BCC_1156 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_aristata_BCC_1229 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTTGGGGATCATCCGGTGTTCT-CACC--GGTGCACTTCCCTTGGTTT-AGGCCAGCATCGGTTTTTGC-AGGGGGATAA-AAACTTGAGGAATGTAGCTCCTTC--GGGAGTGTTATAGCCTCTTGTATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_aristata_BCC_1260 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTTGGGGATCATCCGGTGTTCT-CACC--GGTGCACTTCCCTTGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAACTTGAGGAATGTAGCTCTTTC--GGGAGTGTTATAGCCTCTTGTATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_atrosphaerica_BCC_20656 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAACTCTGGGTTAATCTGCGAGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCCGT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_badia_BCC_1171 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTG-AGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCTGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_badia_BCC_1190 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTG-AGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCTGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_bambusicola_BCC_22739 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_bambusicola_BCC_23659 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTT-T-GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_cf_amphithele_BCC_20377 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCCGGCGGATCACCCGGTGTTAT-CACC--GGTGCACTTCGCTGGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TACG--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_cf_bambusicola_BCC_23627 AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGAC-CCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTGA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCTTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_cf_bambusicola_BCC_23628 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_cf_obovata_BCC_18718 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTTGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAGCTTGTGTTCATCACT--GGTGTACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTAT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTATGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_cf_piperifomis_BCC_22987 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGAC-CCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGCGTTCT-CGCC--GGTGCACTTCGCCAGGTTG-AGGCCAGCATCGGTTCTCGC-AGGGGGATAA-AAGTTCGGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCCGGGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_coccophora_BCC_1085 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_consocata_BCC_18196 AAACC-ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTAGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCTTTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_cubensis_BCC_1027 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_cubensis_BCC_1144 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_cubensis_BCC_1219 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_cubensis_BCC_1303 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_cubensis_BCC_1321 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_curta_BCC_1007 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTTG-AGGCCAGCATCGGTTTTTGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_curta_BCC_1151 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCTCTGGAACGAGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCCGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTTA-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_escharoidea_BCC_23279 AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTT-AGGCCAGCATCGGTTCTCGC-AGGGGGATAA-AAGCTTGGGGAACGTGGCTCCTTC--TGGAGTGTTATAGCCCCTTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_escharoidea_BCC_23634 AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTT-AGGCCAGCATCGGTTCTCGC-AGGGGGATAA-AAGCTTGGGGAACGTGGCTCCTTC--TGGAGTGTTATAGCCCCTTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_feejeensis_BCC_1115 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCTCTGGAACGAGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTTA-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_grammica_BCC_1002 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_grammica_BCC_1170 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_hypoerythra_BCC_22968 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACATTAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTCG-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCCTTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_juruensis_BCC_1083 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTCCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGTATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_juruensis_var_mic_BCC_1086 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_juruensis_var_mic_BCC_1232 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_juruensis_var_mic_BCC_1233 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCCAGGTGG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCACAATACCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_juruensis_var_mic_BCC_1234 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCCAGGTGG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCACAATACCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_juruensis_var_mic_BCC_1263 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCCAGGTGG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCACAATACCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylaria_laevis_BCC_1182 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTTC--GGGAGTGTTATAGACCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_mellisii_BCC_1005 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_mellisii_BCC_1186 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTGCGTCAGGTTT-AGGCCAGCATCGGTTTTCGC-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_mellisii_BCC_20667 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_multiplex_BCC_1036 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TCTAT-GCAAGGATGCTGGCATAATGGTTGTCAACGAC Xylaria_multiplex_BCC_1177 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylaria_obovata_BCC_1053 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_obovata_BCC_1100 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAGCTTGTGTTCATCACT--GGTGTACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTAT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTATGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_papulis_BCC_22966 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACATTAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTCG-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCCTTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_phyllocharis_BCC_1065 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTCGCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGCCT-AGGCCAGCATCGGTTTCCGC-GGGGGGACAA-AAGCGGGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTCGCGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_phyllocharis_BCC_1352 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAGCTTGTGTTCGTCACT--GGTGTACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTAT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTATGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_psidii_BCC_1127 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGACGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTCG-AGGCCAGCATCGGTTTCCGC-AGGGGGACAA-AAGCTCGGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTGCGGGGACCGAGGACCGCGC-CTTCGGGCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_psidii_BCC_1199 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCAGGTTG-AGGCCAGCATCGGTTTTCGC-AGGGGGATAA-AAGCCCGGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTTGGCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_schweinitzii_BCC_1001 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAGCTTGTGTTCATCACT--GGTGTACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTAT-AGGGGGATAA-AAGCTCTGGGAATGTGGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTATGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_schweinitzii_BCC_1013 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTATGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_sp_BCC_1133 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTTG-AGGCCAGCATCGGTTTTTGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_sp_BCC_1181 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTTA-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCTCTCGCATAATACCCTTATGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_sp_BCC_1288 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAACCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_sp._BCC_18797_E_AB376756 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylaria_tuberoides_BCC_18361 AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCGTCAGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCCAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTTGGATGCGGTGCCTATATAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAGCCCGTGTTCT-CACT--GGTGCACTTCGCTAGGTGG-AGGCCAGCATCGGTTTTCGC-GGGGGGATAA-AGGCGGGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGTAGAATACCCCCGCGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18731 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCACCTGGTGTTCTTCACC--AGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18734 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCACCTGGTGTTCTTCACC--AGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18737 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18738 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCACCTGGTGTTCTTCACC--AGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18739 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATGCCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18741 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCACCTGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18743 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylariaceae_BCC_18747 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCACCTGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18752 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCACCTGGTGTTCTTCACC--AGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18756 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18768 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18771 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGATCAGACCTTTTCTTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAAGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18772 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGACGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGGTCACCTGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCAGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCCCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18777 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCACCTGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18786 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAACCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18793 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCGCC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18796 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCTCCGGCGGATCACCTGGTGTTCTTCACC--AGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18853 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18861 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCCAC-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTGTGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18862 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18863 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18865 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18869 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylariaceae_BCC_18870 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCAACCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18873 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATGCCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_18886 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18902 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTTA-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_18905 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTTG-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20842 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20844 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GCGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTAGGGGGATCATCTGGTGTTTT-CACC--GGTGCACTCCCCGTAGTTT-AGGCCAGCATCGGTTTTCTT-AGGGGGATAA-AGGCCTGGGGAACGTAGCTCTTTA--GGGAGTGTTATAGCCCCTGGCATAATACCCCTCGGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20845 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylariaceae_BCC_20849 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTTT-CACC--GGTGCACTTTGCTAGGTTA-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCTCTTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTTGTCAACGAC Xylariaceae_BCC_20850 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGACGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGGTCACCTGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCAGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATACCCCTGCGGGGACCGAGGACCGCGCCCCCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_20930 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGACGCCTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTGAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAGGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGGTCACCCGGTGTTCTTCACC--GGGGCACTTCGCCGGGGCGGAGGCCAGCATCGGTTTCCGC-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCCGCACAATGCCCCTGCGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_20932 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20933 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20936 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCTTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20940 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCATTTT-TGCC--GGTGCACTTCGCCTGGTCT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGATCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20943 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCTAAGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20950 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCACAATGCCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_20951 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTTT-AGGCCAGCATCGGTTTCTAT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCTTTACAGGGACCGAGGACCGCGC-TTTTA-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20955 AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTTA-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20960 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCACC--GGTGCACTTCGCTAGGTCG-AGGCCAGCATCGGTTTCTGC-AGGGGGATAA-AAGCCCAGGGAACGTAGCTCTTTC--GGGAGTGTTATAGCCCTCCGCATAATACCCTTGCGGGGACCGAGGACCGCGC-TTTTT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20971 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylariaceae_BCC_20973 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTTGCTAGGTTG-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCATAATGGTCGTCAACGAC Xylariaceae_BCC_20986 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTTA-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCTCTCGCATAATACCCTTATGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20987 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20988 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20989 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCATTTT-TGCC--GGTGCACTTCGCCTGGTCT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGATCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20991 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGCTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTAGGTCT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTCTGGGAACGTAGCTCCTCC--GGGAGTGTTATAGCCCTCTGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTCG--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20992 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCATTTT-TGCC--GGTGCACTTCGCCTGGTCT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGATCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20993 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATGCCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_20995 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20996 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATGCCCTTACGGGGACCGAGGACCGCGCCTTCGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_20997 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTAT-CACC--GGTGCACTTCGCCAAGTTA-AGGCCAGCATCGGTTTTCGT-AGGGGGATAA-AAGCCTGGGGAATGTGGCTCCTTC--GGGAGTGTTATAGCCTCTCGCATAATACCCTTATGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20998 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_20999 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_21000 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTT--CGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCGTAGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCTTCGTTT-AGGCCAGCATCGGTTTCTGT-AGGGGGATAA-AAGCTTGGGGAACGTAGCTCCCTC--GGGAGTGTTATAGCCCCTCGCATAATACCCTTACGGGGACCGAGGACCGCGC-TTTAT-GCAAGGATGCTGGCGTAATGGTCGTCAACGAC Xylariaceae_BCC_21001 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--CGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTCT-CACC--GGTGCACTTCGCCGGGTCG-AGGCCAGCATCGGTCTCTGT-AGGGGGATAA-AAGCTCAGGGAACGTAGCTCCTTC--GGGAGTGTTATAGCCCTCTGCATAATGCCCTTACGGGGACCGAGGACCGCGCCTTTGG-GCAAGGATGCTGGCGTAATGGTCGCCAACGAC Xylariaceae_BCC_21002 AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC-GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGCGGATCATCCGGCATTTT-TGCC--GGTGCACTTCGCCTGGTCT-AGGCCAGCATCGGTTTCCTT-AGGGGGATAA-AGGCTTGGGGAATGTAGCTCCCTC--GGGAGTGTTATAGCCCCTTGCGTAATACCCCTCGGGGGACCGAGGATCGCGC-TTTT--GCAAGGATGCTGGCGTAATGGTCGTCAACGAC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = '28S rDNA D1-D2') = N: 1-575; CODONPOSSET CodonPositions (CHARACTERS = '28S rDNA D1-D2') = N: 1-575; END; BEGIN TREES; TITLE Tb9286; LINK TAXA = Taxa2; TRANSLATE 1 Biscogniauxia_mediterranea_microspora_BCC_1, 2 Biscogniauxia_nummularia_exutans_BCC_110, 3 Biscogniauxia_nummularia_merrillii_BCC_121, 4 Daldinia_bambusicola_BCC_1103, 5 Daldinia_eschscholzii_BCC_1242, 6 Daldinia_eschscholzii_BCC_1313, 7 Daldinia_sabahense_BCC_21041, 8 Hypoxylon_cf_fendleri_BCC_21050, 9 Hypoxylon_cf_subgilvum_BCC_22995, 10 Hypoxylon_cf_symphyon_BCC_20324, 11 Hypoxylon_cf_trugodes_BCC_23010, 12 Hypoxylon_crocopeplum_BCC_1114, 13 Hypoxylon_dieckmannii_BCC_22982, 14 Hypoxylon_duranii_BCC_22993, 15 Hypoxylon_fendleri_BCC_1106, 16 Hypoxylon_haematostroma_BCC_1252, 17 Hypoxylon_haematostroma_BCC_1314, 18 Hypoxylon_macrocarpum_BCC_2365, 19 Hypoxylon_monticulosum_BCC_236, 20 Hypoxylon_moriforme_BCC_1176, 21 Hypoxylon_nitens_BCC_23565, 22 Hypoxylon_perforatum_BCC_18288, 23 Hypoxylon_rubiginosum_BCC_1109, 24 Hypoxylon_sp_BCC_1308, 25 Hypoxylon_sp_BCC_23642, 26 Kretzschmaria_cf_lucidula_BCC_18212, 27 Kretzschmaria_cf_macrosperma_BCC_22760, 28 Nemania_cf_bipapillata_BCC_20327, 29 Nemania_diffusa_BCC_23666, 30 Pestalotiopsis_sp_BCC_1119, 31 Pestalotiopsis_sp_BCC_18778, 32 Pestalotiopsis_sp_BCC_18798, 33 Whalleya_aff_microplaca_BCC_2123, 34 Xylaria_allantoidea_BCC_1340, 35 Xylaria_anisopleura_BCC_17352, 36 Xylaria_apiculata_BCC_1136, 37 Xylaria_arbuscula_BCC_1156, 38 Xylaria_aristata_BCC_1229, 39 Xylaria_aristata_BCC_1260, 40 Xylaria_atrosphaerica_BCC_20656, 41 Xylaria_badia_BCC_1171, 42 Xylaria_badia_BCC_1190, 43 Xylaria_bambusicola_BCC_22739, 44 Xylaria_bambusicola_BCC_23659, 45 Xylaria_cf_amphithele_BCC_20377, 46 Xylaria_cf_bambusicola_BCC_23627, 47 Xylaria_cf_bambusicola_BCC_23628, 48 Xylaria_cf_obovata_BCC_18718, 49 Xylaria_cf_piperifomis_BCC_22987, 50 Xylaria_coccophora_BCC_1085, 51 Xylaria_consocata_BCC_18196, 52 Xylaria_cubensis_BCC_1027, 53 Xylaria_cubensis_BCC_1144, 54 Xylaria_cubensis_BCC_1219, 55 Xylaria_cubensis_BCC_1303, 56 Xylaria_cubensis_BCC_1321, 57 Xylaria_curta_BCC_1007, 58 Xylaria_curta_BCC_1151, 59 Xylaria_escharoidea_BCC_23279, 60 Xylaria_escharoidea_BCC_23634, 61 Xylaria_feejeensis_BCC_1115, 62 Xylaria_grammica_BCC_1002, 63 Xylaria_grammica_BCC_1170, 64 Xylaria_hypoerythra_BCC_22968, 65 Xylaria_juruensis_BCC_1083, 66 Xylaria_juruensis_var_mic_BCC_1086, 67 Xylaria_juruensis_var_mic_BCC_1232, 68 Xylaria_juruensis_var_mic_BCC_1233, 69 Xylaria_juruensis_var_mic_BCC_1234, 70 Xylaria_juruensis_var_mic_BCC_1263, 71 Xylaria_laevis_BCC_1182, 72 Xylaria_mellisii_BCC_1005, 73 Xylaria_mellisii_BCC_1186, 74 Xylaria_mellisii_BCC_20667, 75 Xylaria_multiplex_BCC_1036, 76 Xylaria_multiplex_BCC_1177, 77 Xylaria_obovata_BCC_1053, 78 Xylaria_obovata_BCC_1100, 79 Xylaria_papulis_BCC_22966, 80 Xylaria_phyllocharis_BCC_1065, 81 Xylaria_phyllocharis_BCC_1352, 82 Xylaria_psidii_BCC_1127, 83 Xylaria_psidii_BCC_1199, 84 Xylaria_schweinitzii_BCC_1001, 85 Xylaria_schweinitzii_BCC_1013, 86 Xylaria_sp_BCC_1133, 87 Xylaria_sp_BCC_1181, 88 Xylaria_sp_BCC_1288, 89 Xylaria_sp._BCC_18797_E_AB376756, 90 Xylaria_tuberoides_BCC_18361, 91 Xylariaceae_BCC_18731, 92 Xylariaceae_BCC_18734, 93 Xylariaceae_BCC_18737, 94 Xylariaceae_BCC_18738, 95 Xylariaceae_BCC_18739, 96 Xylariaceae_BCC_18741, 97 Xylariaceae_BCC_18743, 98 Xylariaceae_BCC_18747, 99 Xylariaceae_BCC_18752, 100 Xylariaceae_BCC_18756, 101 Xylariaceae_BCC_18768, 102 Xylariaceae_BCC_18771, 103 Xylariaceae_BCC_18772, 104 Xylariaceae_BCC_18777, 105 Xylariaceae_BCC_18786, 106 Xylariaceae_BCC_18793, 107 Xylariaceae_BCC_18796, 108 Xylariaceae_BCC_18853, 109 Xylariaceae_BCC_18861, 110 Xylariaceae_BCC_18862, 111 Xylariaceae_BCC_18863, 112 Xylariaceae_BCC_18865, 113 Xylariaceae_BCC_18869, 114 Xylariaceae_BCC_18870, 115 Xylariaceae_BCC_18873, 116 Xylariaceae_BCC_18886, 117 Xylariaceae_BCC_18902, 118 Xylariaceae_BCC_18905, 119 Xylariaceae_BCC_20842, 120 Xylariaceae_BCC_20844, 121 Xylariaceae_BCC_20845, 122 Xylariaceae_BCC_20849, 123 Xylariaceae_BCC_20850, 124 Xylariaceae_BCC_20930, 125 Xylariaceae_BCC_20932, 126 Xylariaceae_BCC_20933, 127 Xylariaceae_BCC_20936, 128 Xylariaceae_BCC_20940, 129 Xylariaceae_BCC_20943, 130 Xylariaceae_BCC_20950, 131 Xylariaceae_BCC_20951, 132 Xylariaceae_BCC_20955, 133 Xylariaceae_BCC_20960, 134 Xylariaceae_BCC_20971, 135 Xylariaceae_BCC_20973, 136 Xylariaceae_BCC_20986, 137 Xylariaceae_BCC_20987, 138 Xylariaceae_BCC_20988, 139 Xylariaceae_BCC_20989, 140 Xylariaceae_BCC_20991, 141 Xylariaceae_BCC_20992, 142 Xylariaceae_BCC_20993, 143 Xylariaceae_BCC_20995, 144 Xylariaceae_BCC_20996, 145 Xylariaceae_BCC_20997, 146 Xylariaceae_BCC_20998, 147 Xylariaceae_BCC_20999, 148 Xylariaceae_BCC_21000, 149 Xylariaceae_BCC_21001, 150 Xylariaceae_BCC_21002; TREE Fig._2 = [&R] (55,54,(138,(140,(52,(53,(((((((((((33,(23,(19,(((13,((((8,(18,21)),(22,(16,(17,15)))),(20,(120,2))),(9,14))),((7,(24,(128,(139,(150,141))))),(4,(6,5)))),(11,10))))),(32,(31,30))),(90,80)),(((64,79),(86,57)),(87,(145,136)))),((49,(60,59)),(27,83))),(((45,(51,(46,(65,((66,(43,(44,47))),(72,(37,(76,(67,(122,74)))))))))),((63,((85,(56,(62,(77,(137,(143,(146,(148,147)))))))),(100,(89,(116,(127,125)))))),(75,(((50,(135,(121,97))),(134,113)),(26,(68,(70,69))))))),(39,38))),((82,((130,(95,(115,(142,(149,144))))),(28,((124,(123,103)),(96,(98,(104,(91,(92,(94,(107,99))))))))))),(73,(36,(42,41))))),(109,((29,106),(129,((133,111),(119,108)))))),((25,118),(132,117))),((126,((131,(58,61)),((35,(40,(81,(84,(48,78))))),(88,(114,105))))),(102,((71,(110,93)),(34,(1,(3,12))))))),(112,101))))))); END; BEGIN TREES; TITLE Tb9287; LINK TAXA = Taxa1; TRANSLATE 1 Biscogniauxia_atropunctata_AJ390411, 2 Biscogniauxia_atropunctata_AJ390412, 3 Biscogniauxia_margina_AJ390417, 4 Biscogniauxia_mediterranea_AF280624, 5 Biscogniauxia_mediterranea_AF326479, 6 Biscogniauxia_mediterranea_AJ390413, 7 Biscogniauxia_mediterranea_AJ390414, 8 Biscogniauxia_nummularia_AJ390415, 9 Biscogniauxia_repanda_AJ390418, 10 Camillea_obularia_AF201714, 11 Camillea_obularia_AJ390423, 12 Camillea_tinctor_AJ390421, 13 Camillea_tinctor_AJ390422, 14 Creosphaeria_sassafras_AJ390424, 15 Creosphaeria_sassafras_AJ390425, 16 Diatrype_disciformis_AJ390410, 17 Entonaema_pallida_AM900591, 18 Hypoxylon_annulatum_AJ390395, 19 Hypoxylon_cinnabarinum_AJ39039, 20 Hypoxylon_fragiforme_AF201709, 21 Hypoxylon_fragiforme_AJ390401, 22 Hypoxylon_fragiforme_AJ390402, 23 Hypoxylon_fuscum_AF201715, 24 Hypoxylon_fuscum_AJ390404, 25 Hypoxylon_fuscum_AJ390405, 26 Hypoxylon_intermedium_AJ390396, 27 Hypoxylon_papillatum_AF201710, 28 Hypoxylon_perforatum_AJ390407, 29 Hypoxylon_rickii_AJ390408, 30 Hypoxylon_subgilvum_AJ390400, 31 Kretzschmaria_clavus_AJ390434, 32 Kretzschmaria_deusta_AJ390435, 33 Kretzschmaria_deusta_AJ390437, 34 Nemania_aenea_AJ390426, 35 Nemania_aenea_AJ390427, 36 Nemania_bipapillata_AJ390429, 37 Nemania_bipapillata_AY541610, 38 Nemania_chestersii_AJ390430, 39 Nemania_diffusa_DQ658238, 40 Nemania_primolutea_EF026121, 41 Nemania_serpens_AJ390431, 42 Nemania_serpens_AJ390432, 43 Nemania_serpens_AJ390436, 44 Rosellinia_necatrix_AB017657, 45 Whalleya_microplaca_AJ390419, 46 Whalleya_microplaca_AJ390420, 47 Xylaria_acuta_AF163026, 48 Xylaria_apiculata_AF163027, 49 Xylaria_arbuscula_AF163028, 50 Xylaria_arbuscula_AF163029, 51 Xylaria_cornudamae_AF163031, 52 Xylaria_cubensis_AF163032, 53 Xylaria_enteroleuca_AF163033, 54 Xylaria_fioriana_AF163034, 55 Xylaria_grammica_DQ322145, 56 Xylaria_hypoxylon_AF201711, 57 Xylaria_hypoxylon_DQ491487, 58 Xylaria_longipes_AF163038, 59 Xylaria_mali_AF163040, 60 Xylaria_multiplex_AY909018, 61 Xylaria_polymorpha_AB274817, 62 Xylaria_polymorpha_AF163041, 63 Xylaria_venosula_EF026149, 64 Xylariaceae_BCC_18731, 65 Xylariaceae_BCC_18734, 66 Xylariaceae_BCC_18737, 67 Xylariaceae_BCC_18738, 68 Xylariaceae_BCC_18739, 69 Xylariaceae_BCC_18741, 70 Xylariaceae_BCC_18743, 71 Xylariaceae_BCC_18747, 72 Xylariaceae_BCC_18752, 73 Xylariaceae_BCC_18756, 74 Xylariaceae_BCC_18768, 75 Xylariaceae_BCC_18771, 76 Xylariaceae_BCC_18772, 77 Xylariaceae_BCC_18777, 78 Xylariaceae_BCC_18778, 79 Xylariaceae_BCC_18786, 80 Xylariaceae_BCC_18793, 81 Xylariaceae_BCC_18796, 82 Xylariaceae_BCC_18797, 83 Xylariaceae_BCC_18798, 84 Xylariaceae_BCC_18853, 85 Xylariaceae_BCC_18861, 86 Xylariaceae_BCC_18862, 87 Xylariaceae_BCC_18863, 88 Xylariaceae_BCC_18865, 89 Xylariaceae_BCC_18869, 90 Xylariaceae_BCC_18870, 91 Xylariaceae_BCC_18873, 92 Xylariaceae_BCC_18886, 93 Xylariaceae_BCC_18902, 94 Xylariaceae_BCC_18905, 95 Xylariaceae_BCC_20842, 96 Xylariaceae_BCC_20844, 97 Xylariaceae_BCC_20845, 98 Xylariaceae_BCC_20849, 99 Xylariaceae_BCC_20850, 100 Xylariaceae_BCC_20930, 101 Xylariaceae_BCC_20932, 102 Xylariaceae_BCC_20933, 103 Xylariaceae_BCC_20936, 104 Xylariaceae_BCC_20940, 105 Xylariaceae_BCC_20943, 106 Xylariaceae_BCC_20950, 107 Xylariaceae_BCC_20951, 108 Xylariaceae_BCC_20955, 109 Xylariaceae_BCC_20960, 110 Xylariaceae_BCC_20971, 111 Xylariaceae_BCC_20973, 112 Xylariaceae_BCC_20986, 113 Xylariaceae_BCC_20987, 114 Xylariaceae_BCC_20988, 115 Xylariaceae_BCC_20989, 116 Xylariaceae_BCC_20991, 117 Xylariaceae_BCC_20992, 118 Xylariaceae_BCC_20993, 119 Xylariaceae_BCC_20995, 120 Xylariaceae_BCC_20996, 121 Xylariaceae_BCC_20997, 122 Xylariaceae_BCC_20998, 123 Xylariaceae_BCC_20999, 124 Xylariaceae_BCC_21000, 125 Xylariaceae_BCC_21001, 126 Xylariaceae_BCC_21002; TREE Fig._3 = [&R] (86,61,(66,((((((48,(((((((52,16),(14,15)),((((78,83),(96,30)),(18,(((104,(115,(117,126))),((19,29),(21,(20,22)))),(26,(27,(28,(24,(23,25)))))))),((2,(8,(1,(((6,(7,(4,5))),(10,11)),(12,13))))),(3,9)))),(45,46)),(31,(32,33))),(63,98)),(((122,((103,(82,(73,92))),(113,(124,(123,(119,(55,101))))))),(49,(57,50))),((112,121),(56,59))))),(60,((110,(70,97)),(89,111)))),(58,(47,51))),(((54,(53,(79,90))),((((17,107),(94,(40,(93,108)))),((34,(((100,(77,(71,(81,(72,(69,(67,(64,65)))))))),(76,99)),(36,(37,(106,(125,(120,(118,(68,91))))))))),((35,(41,38)),(42,43)))),(39,(80,((105,(84,87)),(109,95)))))),(85,44))),(75,102)),(62,((74,88),(114,116)))))); END;