#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 9:49 GMT TreeBASE (cc) 1994-2008 Study reference: Abasova L., Aghayeva D., & Takamatsu S. 2018. Erysiphe azerbaijanica and E. linderae: two new powdery mildew species (Erysiphales) belonging to the Microsphaera lineage of Erysiphe. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21667] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=18; TAXLABELS 'Erysiphe baptisiae Ex._Baptisia_australis_LC009988' 'Erysiphe blasti Ex._Lindera_praecox_LC010067' 'Erysiphe blasti Ex._Lindera_umbellata_LC009905' 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235964' 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235965' 'Erysiphe magnoliae Ex._Magnolia_obovata_LC009900' Erysiphe_sp._Ex._Baptisia_australis_LC009967 Erysiphe_sp._Ex._Lindera_praecox_MUMH4379 Erysiphe_sp._Ex._Lindera_praecox_MUMH4612 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4014 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4055 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4487 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4517 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4568 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4867 Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH4948 Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH5046 Erysiphe_sp._Ex._Sophora_flavescens_LC009919 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45894] TITLE Erysiphe_azerbaijanica_and_E._linderae_ITS_28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1297; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Erysiphe baptisiae Ex._Baptisia_australis_LC009988' ----------------------------------TGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGGACA-TGCC-TCGGCCGCCCACCGGTTTCGAACTGGAGCGCGCCCGCCAAAGACCCAACC-AAAACTCATGTTGTCTGTGTCGTCTCAGC-TTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCCCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CGGTGGCTTGCCAGAACAACCCTCTTTTGCTCCAGTCACAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe blasti Ex._Lindera_praecox_LC010067' CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTCGTCGCTGCCCGCAAGGACA-TGCG-TCGGCCGCCCACCGGCTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACC-CAAACTCATGTTGTCTTTGCAGTCTCAGCTTTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCAGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCTTGCCAAAAG----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCG?????????????????????????????????ACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe blasti Ex._Lindera_umbellata_LC009905' CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCCTGCCAAAAC----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTAGCTCCTTTCGGGGAGTATTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235964' CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACGTCGTCGCTGTCCGCAAGGACA-TGCG-TCGAGTGCCCACCGGCTTCG-GCTGGAGCGCGTTCGCCAAAGACCCAACC-AAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCGGCCCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CAGTGGCTTGCCAAAAG----CCCGTTTGTTCCAGTCACAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGAGGAAAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235965' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCGGCCCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CAGTGGCTTGCCAAAAG----CCCGTTTGTTCCAGTCACAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTGGAAATGTAGCTCCTCTCGGGGAGTGTTATAGTCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe magnoliae Ex._Magnolia_obovata_LC009900' CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGTCGCTGCCCGCAAGGACA-TGCGATCGAGTGCCCACCGGCTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATC-AAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGATGACCAGTGGCTTGCCAAAA-----CCCGTTTGTTCCAGTCACAT-GGATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Erysiphe_sp._Ex._Baptisia_australis_LC009967 CAGAGCGTGAGGCTCAGGCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCGGGCTCCGTCGTCGCGCGCCGTCAGGCCGCCGCG-ACGGCCGCCCACCGGCTTCG-GCTGGAACGCGCCCGCCAGAGACCTAACCAAAAACTCCAGTTGTCTTTGCCGTCTCAGC-TTTATGATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCTCTCCAGCTGCCGTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGTTGCGGCAGCCCTTAAAGACAGTGGCGGTCCGGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CCGTGGCTTGCCAAAACG---CCTGTTTGTTCCAGTCACATGGGATCACTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_sp._Ex._Lindera_praecox_MUMH4379 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTCGTCGCTGCCCGCAAGGACA-TGCG-TCGGCCGCCCACCGGCTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACC-CAAACTCATGTTGTCTTTGCAGTCTCAGCTTTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCAGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCTTGCCAAAAG----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_praecox_MUMH4612 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTCGTCGCTGCCCGCAAGGACA-TGCG-TCGGCCGCCCACCGGCTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACC-CAAACTCATGTTGTCTTTGCAGTCTCAGCTTTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCAGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCTTGCCAAAAG----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_umbellata_MUMH4014 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_sp._Ex._Lindera_umbellata_MUMH4055 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_sp._Ex._Lindera_umbellata_MUMH4487 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCCTGCCAAAAC----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTAGCTCCTTTCGGGGAGTATTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_umbellata_MUMH4517 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCCTGCCAAAAC----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTAGCTCCTTTCGGGGAGTATTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_umbellata_MUMH4568 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCCTGCCAAAAC----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTAGCTCCTTTCGGGGAGTATTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_umbellata_MUMH4867 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH4948 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGA-CAGTGGCCTGCCAAAAC----CCCGTTTGTTCCAGTCATAT-GGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTAGCTCCTTTCGGGGAGTATTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH5046 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTGGACGCTGCCCGTAAGGATA-TGCG-TCGGCTGCCCACCGGTTTCG-GCTGGAGCGCGTCCGCCAAAGACCCAACCAAAAACTCATGTTGTCTTTGCAGTCTCAGC-TTTATTATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_sp._Ex._Sophora_flavescens_LC009919 CAGAGCGTGAGGCTCAGGCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCGGGCTCCGTCGTCGCGCGCCGTCAGGCCGCCGCG-ACGGCCGCCCACCGGCTTCG-GCTGGAACGCGCCCGCCAGAGACCTAACCAAAAACTCCAGTTGTCTTTGCCGTCTCAGC-TTTATGATT-GAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCTCTCCAGCTGCCGTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGTTGCGGCAGCCCTTAAAGACAGTGGCGGTCCGGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CCGTGGCTTGCCAAAACG---CCTGTTTGTTCCAGTCACATGGGATCACTGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGGCCCGCGCCTCTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCTCT-CGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGGAGGAATGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGCGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGT--------- ; END; BEGIN TREES; TITLE Erysiphe_azerbaijanica_and_E._linderae_ITS_28S; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH5046, 2 Erysiphe_sp._Ex._Lindera_umbellata_var._membranacea_MUMH4948, 3 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4867, 4 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4568, 5 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4517, 6 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4487, 7 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4055, 8 Erysiphe_sp._Ex._Lindera_umbellata_MUMH4014, 9 Erysiphe_sp._Ex._Lindera_praecox_MUMH4379, 10 Erysiphe_sp._Ex._Lindera_praecox_MUMH4612, 11 'Erysiphe blasti Ex._Lindera_umbellata_LC009905', 12 'Erysiphe blasti Ex._Lindera_praecox_LC010067', 13 'Erysiphe baptisiae Ex._Baptisia_australis_LC009988', 14 Erysiphe_sp._Ex._Baptisia_australis_LC009967, 15 Erysiphe_sp._Ex._Sophora_flavescens_LC009919, 16 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235964', 17 'Erysiphe magnoliae Ex._Magnolia_obovata_LC009900', 18 'Erysiphe magnoliae Ex._Magnolia_obovata_JX235965'; TREE 'PAUP_1' = [&R] (13,((14,15),((17,(16,18)),((9,10,12),(1,(8,(3,(2,4,5,6,7,11)))))))); END;