#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 05, 2020; 17:27 GMT TreeBASE (cc) 1994-2008 Study reference: Abasova L., Aghayeva D., & Takamatsu S. 2018. Notes on powdery mildews of the genus Erysiphe from Azerbaijan. Current Research in Environmental & Applied Mycology, 8(1): 50-53 . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21704] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=63; TAXLABELS Arthrocladiella_mougeotii_AB329690 'Erysiphe alphitoides Ex_Quercus_macranthera_MUMH7008' 'Erysiphe alphitoides Ex_Quercus_petrea_AB257435' 'Erysiphe alphitoides Ex_Quercus_robur_AB292710' 'Erysiphe alphitoides Ex_Quercus_serrata_AB292695' 'Erysiphe arcuata Ex_Carpinus_betulus_AB252459' 'Erysiphe arcuata Ex_Carpinus_betulus_AB252463' 'Erysiphe arcuata Ex_Carpinus_orinetalis_MUMH7010' 'Erysiphe berberidicola Ex_Berberis_vulgaris_LC009951' 'Erysiphe berberidis Ex_Berberis_vulgaris_LC010057' 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7005' 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7022' 'Erysiphe convolvuli Ex_Calystegia_sepium_MUMH7001' 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7030' 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7048' 'Erysiphe convolvuli Ex_Ipomoea_aquatica_KJ885178' 'Erysiphe corylacearum Ex_Corylus_avellana_MUMH7047' 'Erysiphe corylacearum Ex_Corylus_heterophylla_KR048061' 'Erysiphe corylacearum Ex_Corylus_sieboldiana_LC009928' 'Erysiphe cruciferarum Ex_Brassica_juncea_KM260718' 'Erysiphe cruciferarum Ex_Brassica_juncea_MUMH7034' 'Erysiphe cruciferarum Ex_Brassica_rapa_EU140958' 'Erysiphe euonymi Ex_Euonymus_europeae_LC010050' 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250228' 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250229' 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH6999' 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH7012' 'Erysiphe heraclei Ex_Conium_maculatum_LC010021' 'Erysiphe heraclei Ex_Torilis_arvensis_MUMH7041' 'Erysiphe multappendicis Ex_Berberis_vulgaris_AB104520' 'Erysiphe necator Ex_Vitis_vinifera_LC028996' 'Erysiphe necator Ex_Vitis_vinifera_MUMH7026' 'Erysiphe necator Ex_Vitis_vinifera_MUMH7027' 'Erysiphe pisi Ex_Lathyrus_latifolium_AF011306' 'Erysiphe platani Ex_Platanus_orientalis_JQ365943' 'Erysiphe platani Ex_Platanus_orientalis_MUMH7006' 'Erysiphe platani Ex_Platanus_orientalis_MUMH7050' 'Erysiphe polygoni Ex_Polygonum_arenastrum_AF011307' 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7036' 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7045' 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7028' 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7029' 'Erysiphe quercicola Ex_Quercus_crispula_AB292691' 'Erysiphe syringae Ex_Syringa_vulgaris_LC015612' 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7018' 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7019' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_AB295458' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7013' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7014' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7015' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7016' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7017' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7020' 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7021' 'Erysiphe trifoliorum Ex_Medicago_sativa_MUMH7038' 'Erysiphe trifoliorum Ex_Medicago_sp._FJ378877' 'Erysiphe trifoliorum Ex_Trifolium_arvense_LC009955' 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7031' 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7046' 'Erysiphe viciae-unijugae Ex_Lathyrus_odorathus_MUMH7040' 'Erysiphe viciae-unijugae Ex_Vicia_angustifolia_LC009962' 'Erysiphe viciae-unijugae Ex_Vicia_bifolia_LC009977' Golovinomyces_ambrosiae_AB769419 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45899] TITLE Erysiphe_ITS_28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1337; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii_AB329690 CAGAGC-GTGAGACTCTGC-CCGGGCGTGC-CCCGCGCG-CAGAGTCGACCCT-CCACCCGTGTTGA-CTTATCTCGTGTTGCTTTGGCGGGCCGGG------CTTCG------------------------------CGTCC---GCCGGCC----------CTGCG--GCTGGAGCGTGTCCGCCAAAGACCCA-ACC--TAACTCGTGGTATCGTG---TGTCTGAGGAAAGAA-TATTG-AATCATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCAC-A--CTCCCTCACGCCGCACCGTGT-GTGTGGCGTGGTGTTGGGGCTCGCC---TGT--TCGGCGGCCCTTAAAACGAGTGGCGGTG-CCGTCGTGGACTCTACGCGTAGTACTTT--TTCTCGCGACAGGGCGGCGGC-GGTGACTGGCCAGCA-------------AGTCCATTTTTCTGGA---------AGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGGTTCTCCTCG-GTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTCGGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG 'Erysiphe alphitoides Ex_Quercus_macranthera_MUMH7008' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGC-----------------------------------------------------------------CCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe alphitoides Ex_Quercus_petrea_AB257435' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACG-------------- 'Erysiphe alphitoides Ex_Quercus_robur_AB292710' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe alphitoides Ex_Quercus_serrata_AB292695' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACG-------------- 'Erysiphe arcuata Ex_Carpinus_betulus_AB252459' CAGAGC-GTAAGGCTCAGC-CATGGCATCT-GTCGTGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGACCGGG----TACGCGCA--------CGACGC-CCGCA-AGGGCGGGTGA-----GCAGCCCACCGG-----CTTCG--GCTGGGGCGTGTCCGCCAGAGACTCA-TCC-CAAACTCAAGTTGTCTT--GCAGTCTAAGG-TTTAT-TATGT-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCGAGCTAC-TTTGAT-GTG-GCTCTGGTGTTGGGGCTCGCCGC-GATTCGCGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GAGGCCCTGCCAACAACTCTTA---TCGGGTCCCTTCACACGGATTCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe arcuata Ex_Carpinus_betulus_AB252463' CAGAGC-GTAAGGCTCAGC-CATGGCATCT-GTCGTGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGACCGGG----TACGCGCA--------CGACGC-CCGCA-AGGGCGGGTGA-----GCAGCCCACCGG-----CTTCG--GCTGGGGCGTGTCCGCCAGAGACTCA-TCC-CAAACTCAAGTTGTCTT--GCAGTCTAAGG-TTTAT-TATGT-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCGAGCTAC-TTTGAT-GTG-GCTCTGGTGTTGGGGCTCGCCGC-GAT{AT}CGCGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GAGGCCCTGCCAACAACTCTTA---TCGGGTCCCTTCACACGGATTCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe arcuata Ex_Carpinus_orinetalis_MUMH7010' CAGAGC-GTAAGGCTCAGC-CATGGCATCT-GTCGTGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGACCGGG----TACGCGCA--------CGACGC-CCGCA-AGGGCGGGTGA-----GCAGCCCACCGG-----CTTCG--GCTGGGGCGTGTCCGCCAGAGACTCA-TCC-CAAACTCAAGTTGTCTT--GCAGTCTAAGG-TTTAT-TATGT-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCGAGCTAC-TTTGAT-GTG-GCTCTGGTGTTGGGGCTCGCCGC-GATTCGCGGTGGCCCTTAAAGACAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Erysiphe berberidicola Ex_Berberis_vulgaris_LC009951' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TATCTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-TGGACATGCGCCG---GCCGCCCACCGGTGGT-TATCC--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAATCTCCCTATTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe berberidis Ex_Berberis_vulgaris_LC010057' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-TGGACATGCGTCG---GCCGCCCACCGGTGGTTTATCC--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTCCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCTCCCTATTGCTCCAGTCACATGGA-TCACAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7005' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-TGGACATGCGTCG---GCCGCCCACCGGTGGTTTATCC--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCG------------------------------------------------------------------------------------------------------CCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7022' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-TGGACATGCGTCG---GCCGCCCACCGGTGGT-TATCC--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGT----------------------------------------------------------------------ATTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe convolvuli Ex_Calystegia_sepium_MUMH7001' CAGAGT-GCGAGGCTCCGT-CGTGGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGC---CGTGTCGT--------CGCTGC-CCGCA-TGGGCATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGTGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGCGTTGGGGCTCGTCGC-GCT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACA{AG}AGTGAC{AG}AC-GGCGGCTTGCCA{AG}AACAACCTCTT-TTGGTTCCAGTCACATGGA-TCATAGGTTGACCTCGAAT-------------------------------------------------------------------------------------------AACAGCTCAAATTTGAAATCTGGCTCCCCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGTTGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7030' CAGAGT-GCGAGGCTCCGT-CGTGGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGC---CGTGTCGT--------CGCTGC-CCGCA-TGGGCATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGTGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGCGTTGGGGCTCGTCGC-GCT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCTCTT-TTGGTTCCAGTCACATGGA-TCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7048' CAGAGT-GCGAGGCTCCGT-CGTGGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGC---CGTGTCGT--------CGCTGC-CCGCA-TGGGCATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGTGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGCGTTGGGGCTCGTCGC-GCT--GCGGCGGCCCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe convolvuli Ex_Ipomoea_aquatica_KJ885178' CAGAGT-GCGAGGCTCCGT-CGTGGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGC---CGTGTCGT--------CGCTGC-CCGCA-TGGGCATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGTGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGCGTTGGGGCTCGTCGC-GCT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCTCTT-TTGGTTCCAGTCACATGGA-TCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe corylacearum Ex_Corylus_avellana_MUMH7047' CAGAGT-GTGAGGCTCACT-CGTGGCATCT-GCTGCGGG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGT---TGTGTCGT--------CGCTGC-CCGCA-AGGACATGCGTTG---GCCACCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCTATACC-AAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC{CT}TCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTTT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe corylacearum Ex_Corylus_heterophylla_KR048061' CAGAGT-GTGAGGCTCACT-CGTGGCATCT-GCTGCGGG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGT---TGTGTCGT--------CGCTGC-CCGCA-AGGACATGCGTTG---GCCACCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCTATACC-AAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGATTCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe corylacearum Ex_Corylus_sieboldiana_LC009928' CAGAGC-GTGAGGCTCACT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGT---TGTGTCGT--------CGCTGC-CCGCA-AGGACATGCGTTG---GCCACCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCTA-ACC-AAAACTCATGTTGTTTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTTT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe cruciferarum Ex_Brassica_juncea_KM260718' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCGCATGGGACATGCGTCG---GCCGCCCACCGG-----TTTCACGACTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCT-TTAGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe cruciferarum Ex_Brassica_juncea_MUMH7034' CAGAGT-GCGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCGCATGGGACATGCGTCG---GCCGCCCACCGG-----TTTCACCACTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCT{AG}C-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe cruciferarum Ex_Brassica_rapa_EU140958' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCGCATGGGACATGCGTCG---GCCGCCCACCGG-----TTTCACGACTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCT-TTAGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe euonymi Ex_Euonymus_europeae_LC010050' -----------------------------------------------GACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACCTGCGTCG---GCCGCCCACCGG-----TTTTG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250228' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCCAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250229' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCCAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH6999' CAGAGTGGTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCCAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTGGGTTCGGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH7012' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCTCCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCCAAGACCCA-ACC-AAAACTCATGTTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGT{GT}GGTTCGGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe heraclei Ex_Conium_maculatum_LC010021' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TGCGTCGT--------CGCTGT-CCGCC-TGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTGT-GTCGTCTTAGC-TTTATAAATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGACGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe heraclei Ex_Torilis_arvensis_MUMH7041' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TGCGTCGT--------CGCTGT-CCGCC-TGGACATGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTGT-GTCGTCTTAGC-TTTATAAATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGACGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe multappendicis Ex_Berberis_vulgaris_AB104520' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-TGGACATGCGTCG---GCCGCCCACCGGTGGTTTATCC--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCTCCCTATTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe necator Ex_Vitis_vinifera_LC028996' CAGAGC-GAGAGGCTCAGC-CATGACGGTA-GTCGTGTG-CTGGGTCGACCCTCCCACCCGTGTCGA-TATGTATTTTGTTGCTTTGGCGGGCCGGGTTTGCGCCCCGTTCGGCGTCCGCTGTGGCGCT-GGGGGA----------GCCGCCCACCGG-----CTTCG--GCTGGAGCGTGCCCGCCAGAGACCTC-ATC-CAAACTCACGTTGTCAT--GTAGTCTAAGC-TTTAT-TA-AGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCTGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCAAGCTGC-CCTTGTGGTG-GCTTCGGTGTTGGGGCTCGTCGCAGTTTTGCGGTGGCCCTTAAAGACAGTGGCGGTC-CCCGCGTGGGCTCTACGCGTAGTAACTTGTTCCTCGCGACAGAGTGACGCT-CGTGATCAGCCAGAACCACCCAC--CTTTGTCCGGTCATCCG-ATTGACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCTGTAGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCTTGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCGGATCACCTCGGGTTTT-CTCGAGGGCACTCGGTAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTTGGAACGTAGCTCCCCTCGGGGAGTGTTATAGCCAACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCACACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT 'Erysiphe necator Ex_Vitis_vinifera_MUMH7026' CAGAGC-GAGAGGCTCAGC-CATGACGGTA-GTCGTGTG-CTGGGTCGACCCTCCCACCCGTGTCGA-TATGTATTTTGTTGCTTTGGCGGGCCGGGTTTGCGCCCCGTTCGGCGTCCGCTGTGGCGCT-GGGGGA----------GCCGCCCACCGG-----CTTCG--GCTGGAGCGTGCCCGCCAGAGACCTC-ATC-CAAACTCACGTTGTCAT--GTAGTCTAAGC-TTTAT-TA-AGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCAAGCTGC-CCTTGTGGTG-GCTTCGGTGTTGGGGCTCGTCGCAGTTTTGCGGTGGCCCTTAAAGACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe necator Ex_Vitis_vinifera_MUMH7027' CAGAGC-GAGAGGCTCAGC-CATGACGGTA-GTCGTGTG-CTGGGTCGACCCTCCCACCCGTGTCGA-TATGTATTTTGTTGCTTTGGCGGGCCGGGTTTGCGCCCCGTTCGGCGTCCGCTGTGGCGCT-GGGGGA----------GCCGCCCACCGG-----CTTCG--GCTGGAGCGTGCCCGCCAGAGACCTC-ATC-CAAACTCACGTTGTCAT--GTAGTCTAAGC-TTTAT-TA-AGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAC--CCCCCTCAAGCTGC-CCTTGTGGTG-GCTTCGGTGTTGGGGCTCGTCGCAGTTTTGCGGTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe pisi Ex_Lathyrus_latifolium_AF011306' CAGAGT-GCGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGCTGT--------CGCTGT-CCGCA-TGGACATGCGTCG---GCCGCCCACCGGT----TTTCA--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAA--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCA-TCTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGA--AAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe platani Ex_Platanus_orientalis_JQ365943' CAGAGT-GCGAGGTCCCGCATGTAGCATCTTGCTACATG-TTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTATT-GTCGTCTCAGCTTTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-ACCCCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAC--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTAGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAAAACAACCCAC--TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Erysiphe platani Ex_Platanus_orientalis_MUMH7006' CAGAGT-GCGAGGTCCCGCATGTAGCATCTTGCTACATG-TTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTATT-GTCGTCTCAGCTTTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A-CCCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAC--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTA---------------------------------------------------------------------TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGGGCGCTGCCGATCACCCCGAGTTTT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe platani Ex_Platanus_orientalis_MUMH7050' CAGAGT-GCGAGGTCCCGCATGTAGCATCTTGCTACATG-TTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTATT-GTCGTCTCAGCTTTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A-CCCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAC--GCGGCGGCCCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe polygoni Ex_Polygonum_arenastrum_AF011307' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-GGGACACGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTCTGT-GTCGTCTTAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAA--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAATGACGCCTGGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7036' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-GGGACACGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTCTGT-GTCGTCTTAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAA--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-CTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7045' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---TACGTCGT--------CGCTGT-CCGCA-GGGACACGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTCTGT-GTCGTCTTAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAA--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-CTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7028' CAGAGC-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCCCCGCA-AGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCC-ATC-AAAACTCATGTTGTTTAT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGTTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGT-GAT--ACGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7029' CAGAGC-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCCCCGCA-AGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCC-ATC-AAAACTCATGTTGTTTAT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGTTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGT-GAT--ACGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe quercicola Ex_Quercus_crispula_AB292691' CAGAGC-GTGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGCCCCGCA-AGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--GCTGGAGCGCGCCCGCCAAAGACCCC-ATC-AAAACTCATGTTGTTTAT-GTCGTCTTAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGTTAC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGT-GAT--ACGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCA---CTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe syringae Ex_Syringa_vulgaris_LC015612' CAGAGT-GCGAGGCTCAGT-CGTAGCATCT-GCTGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-CGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTTTTTTTCGTCGTCTCAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCAGAACAACCCAC--TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7018' CAGAGT-GCGAGGCTCAGT-CGTAGCATCT-GCTGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-CGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTTTTTTTCGTCGTCTCAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGC---------------------------------------------------------------------------GCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7019' CAGAGT-GCGAGGCTCAGT-CGTAGCATCT-GCTGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGC-CCACA-CGGACAAGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGTCCGCCAAAGACCCA-ACC-AAAACTCATGTTTTTTTTCGTCGTCTCAGC-TTTAT-TATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_AB295458' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGACTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7013' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGACTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7014' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7015' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7016' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7017' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7020' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGACGTGGACTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCT-----TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7021' CAGAGT-GTGAGGCTCAGT-CGTGGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGT---TGCGTCGT--------CGCTGC-CCGCA-AGGACATGCGTCG---GCCGCCCACCGG-----CTTCG--GCTGGAGCGCGTCCGCCAAAGACCCA-ACCAAAAACTCATGTTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GTTGCGGTGTTGGGGCACGTCGC-GGT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe trifoliorum Ex_Medicago_sativa_MUMH7038' CAGAGT-GCGAGGCTCAGT-CGCGGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACCTGCGTCG---GCCGCCCACCGG-----TTTTG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-GTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe trifoliorum Ex_Medicago_sp._FJ378877' CAGAGT-GCGAGGCTCAGT-CGCGGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACCTGCGTCG---GCCGCCCACCGG-----TTTTG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe trifoliorum Ex_Trifolium_arvense_LC009955' CAGAGT-GCGAGGCTCAGT-CGCGGCGTCG-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACGTGCGTCG---GCCGCCCACCGG-----TTTAG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7031' CAGAGT-GCGAGGCTCAGT-CGCGGCGTCG-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACGTGCGTCG---GCCGCCCACCGG-----TTTAG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-CTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7046' CAGAGT-GCGAGGCTCAGT-CGCGGCGTCG-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-TCGCA-AGGACGTGCGTCG---GCCGCCCACCGG-----TTTAG-AACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CTTTGT-GTG-GCTGCGGTGTTGGGGCACGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCT-TTTGCTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe viciae-unijugae Ex_Lathyrus_odorathus_MUMH7040' CAGAGT-GCGAGGCTCAGT-CGTGGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-CCGCA-TGGACCTGCGTCG---GCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCGCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCCTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT{GT}GTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCTTGAGTTCTCCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTG-CTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC 'Erysiphe viciae-unijugae Ex_Vicia_angustifolia_LC009962' CAGAGT-GCGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-CCGCA-TGGACCTGCGTCGGCCGCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe viciae-unijugae Ex_Vicia_bifolia_LC009977' CAGAGT-GCGAGGCTCAGT-CGTGGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGC---CGCGTCGT--------CGCTGT-CCGCA-TGGACCTGCGTCGGCCGCCGCCCACCGG-----TTTCG--ACTGGAGCGCGCCCGCCAAAGACCCA-ACC-AAAACTCATGTTGTTTGT-GTCGTCTCAGC-TTTAT-AATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAC-A--CCCCCTCCAGCTGC-CGTTGT-GTG-GCTGCGGTGTTGGGGCTCGTCGC-GAT--GCGGCGGCCCTTAAAGACAGTGGCGGTC-CCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCTA-TTGGGTCCAGTCACATGGA-TCACAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_ambrosiae_AB769419 -AGAGC-GTGAGACTCTGC-CCGGGCTTGC-CCCGCGCG-CAGAGTTGACCCT-CCACCCGTGTTGA-CTTATCTCATGTTGCTTTGGCGGGCCAGG---------------------------------------TGCCTCG---CGCGCCGGCCGG-----CTCTG-TGCTGGCTCGTGTCCGCCAAAGACCCA-ACC--TAACTCGTGTTGTCGT--GTAGTCTGAGG-AAAAC-TATTTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCAC-A--CCCCCTCAAGCCGCGCCGTGT-GTGTGGTTTGGTGTTGGGGCTCGCC---CGT--CGGGCGGCCCTTAAAGACAGTGGCGGTG-CCGTGGTGGTCTCTACGCGTAGTA---CGATTCTCGCGACAGAGCTGCTGT-GGCCGCTTGCCA-ATCAATCCATCATC------------------TCA-AGGTTGACCTCGAATCAGGTAGGGATACCCGC------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTCGATCATCCGGGGTTCTCCTCG-GTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTT-GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCG-TTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACC-- ; END; BEGIN TREES; TITLE Erysiphe_ITS_28S; LINK TAXA = Taxa1; TRANSLATE 1 'Erysiphe alphitoides Ex_Quercus_petrea_AB257435', 2 'Erysiphe alphitoides Ex_Quercus_macranthera_MUMH7008', 3 'Erysiphe alphitoides Ex_Quercus_robur_AB292710', 4 'Erysiphe alphitoides Ex_Quercus_serrata_AB292695', 5 'Erysiphe arcuata Ex_Carpinus_orinetalis_MUMH7010', 6 'Erysiphe arcuata Ex_Carpinus_betulus_AB252459', 7 'Erysiphe arcuata Ex_Carpinus_betulus_AB252463', 8 'Erysiphe berberidicola Ex_Berberis_vulgaris_LC009951', 9 'Erysiphe berberidis Ex_Berberis_vulgaris_LC010057', 10 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7005', 11 'Erysiphe berberidis Ex_Berberis_vulgaris_MUMH7022', 12 'Erysiphe convolvuli Ex_Calystegia_sepium_MUMH7001', 13 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7030', 14 'Erysiphe convolvuli Ex_Convolvulus_arvensis_MUMH7048', 15 'Erysiphe convolvuli Ex_Ipomoea_aquatica_KJ885178', 16 'Erysiphe corylacearum Ex_Corylus_heterophylla_KR048061', 17 'Erysiphe corylacearum Ex_Corylus_avellana_MUMH7047', 18 'Erysiphe corylacearum Ex_Corylus_sieboldiana_LC009928', 19 'Erysiphe cruciferarum Ex_Brassica_juncea_KM260718', 20 'Erysiphe cruciferarum Ex_Brassica_rapa_EU140958', 21 'Erysiphe cruciferarum Ex_Brassica_juncea_MUMH7034', 22 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH6999', 23 'Erysiphe euonymicola Ex_Euonymus_japonicus_MUMH7012', 24 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250228', 25 'Erysiphe euonymicola Ex_Euonymus_japonicus_AB250229', 26 'Erysiphe euonymi Ex_Euonymus_europeae_LC010050', 27 'Erysiphe heraclei Ex_Torilis_arvensis_MUMH7041', 28 'Erysiphe heraclei Ex_Conium_maculatum_LC010021', 29 'Erysiphe multappendicis Ex_Berberis_vulgaris_AB104520', 30 'Erysiphe necator Ex_Vitis_vinifera_MUMH7026', 31 'Erysiphe necator Ex_Vitis_vinifera_MUMH7027', 32 'Erysiphe necator Ex_Vitis_vinifera_LC028996', 33 'Erysiphe pisi Ex_Lathyrus_latifolium_AF011306', 34 'Erysiphe platani Ex_Platanus_orientalis_JQ365943', 35 'Erysiphe platani Ex_Platanus_orientalis_MUMH7006', 36 'Erysiphe platani Ex_Platanus_orientalis_MUMH7050', 37 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7045', 38 'Erysiphe polygoni Ex_Polygonum_aviculare_MUMH7036', 39 'Erysiphe polygoni Ex_Polygonum_arenastrum_AF011307', 40 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7028', 41 'Erysiphe quercicola Ex_Castanea_sativa_MUMH7029', 42 'Erysiphe quercicola Ex_Quercus_crispula_AB292691', 43 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7018', 44 'Erysiphe syringae Ex_Syringa_vulgaris_MUMH7019', 45 'Erysiphe syringae Ex_Syringa_vulgaris_LC015612', 46 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_AB295458', 47 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7013', 48 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7014', 49 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7015', 50 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7016', 51 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7017', 52 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7020', 53 'Erysiphe syringae-japonicae Ex_Syringa_vulgaris_MUMH7021', 54 'Erysiphe trifoliorum Ex_Trifolium_arvense_LC009955', 55 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7046', 56 'Erysiphe trifoliorum Ex_Trifolium_pratense_MUMH7031', 57 'Erysiphe trifoliorum Ex_Medicago_sativa_MUMH7038', 58 'Erysiphe trifoliorum Ex_Medicago_sp._FJ378877', 59 'Erysiphe viciae-unijugae Ex_Vicia_angustifolia_LC009962', 60 'Erysiphe viciae-unijugae Ex_Vicia_bifolia_LC009977', 61 'Erysiphe viciae-unijugae Ex_Lathyrus_odorathus_MUMH7040', 62 Arthrocladiella_mougeotii_AB329690, 63 Golovinomyces_ambrosiae_AB769419; TREE 'PAUP_1' = [&R] ((62:0.041254,63:0.048256):0.0538985,((31:0.0,(30:0.0,32:0.001636):0.0):0.068547,((5:0.0,(6:0.0,7:0.0):0.0):0.064281,(((18:0.001604,(16:0.001261,17:0.0):0.001657):0.005894,(48:0.0,(50:0.0,(46:0.001213,47:0.0,49:0.0,51:0.0,52:0.0,53:0.0):0.0):0.0):0.00326):0.008816,((36:0.0,(34:0.0,35:0.0):0.0):0.016318,((44:0.0,(43:0.0,45:0.0):0.0):0.01166,(((40:0.0,41:0.0,42:0.0):0.013232,(2:0.0,(1:0.0,3:0.0,4:0.0,(24:0.0,25:0.0,(22:0.0,23:0.0):0.0):0.002415):0.0):8.65E-4):0.003385,((59:0.0,(60:0.0,(61:0.00263,((27:0.0,28:0.0):0.003038,(37:0.0,38:0.0,39:0.001219):0.004261):0.005847):9.11E-4):0.0):0.007823,((21:3.5E-4,(19:0.001208,20:0.0):0.003448):0.007187,((33:0.007713,(57:0.0,58:0.0,(26:8.66E-4,(55:0.0,(54:0.0,56:0.0):0.0):0.007372):0.0):0.008):0.001547,((15:0.002462,(14:0.0,(12:0.003041,13:0.0):0.0):0.0):0.014487,(29:0.0,(8:0.003196,10:0.0):0.0,(9:0.00124,11:0.0):7.582E-7):0.008465):5.66E-4):9.94E-4):0.002495):0.010402):0.002604):0.003213):0.014097):0.007471):0.013957):0.0538985); TREE 'PAUP_2' = [&R] ((62:0.04123,63:0.048236):0.053874,((31:0.0,(30:0.0,32:0.001637):0.0):0.068538,((5:0.0,(6:0.0,7:0.0):0.0):0.064266,(((18:0.001604,(16:0.001261,17:0.0):0.001657):0.005894,(48:0.0,(50:0.0,(46:0.001213,47:0.0,49:0.0,51:0.0,52:0.0,53:0.0):0.0):0.0):0.00326):0.008818,((36:0.0,(34:0.0,35:0.0):0.0):0.016317,((44:0.0,(43:0.0,45:0.0):0.0):0.011659,(((40:0.0,41:0.0,42:0.0):0.01323,(2:0.0,(1:0.0,3:0.0,4:0.0,(24:0.0,25:0.0,(22:0.0,23:0.0):0.0):0.002415):0.0):8.67E-4):0.003382,(((61:0.003301,(59:0.0,60:0.0):0.0):0.001098,((27:0.0,28:0.0):0.00288,(37:0.0,38:0.0,39:0.001219):0.004432):0.00573):0.006869,((21:3.51E-4,(19:0.001208,20:0.0):0.003447):0.007175,((33:0.007714,(57:0.0,58:0.0,(26:8.66E-4,(55:0.0,(54:0.0,56:0.0):0.0):0.007371):0.0):0.007999):0.001545,((15:0.002462,(14:0.0,(12:0.003041,13:0.0):0.0):0.0):0.014488,(29:0.0,(8:0.003196,10:0.0):0.0,(9:0.00124,11:0.0):7.45927E-7):0.008464):5.69E-4):0.001008):0.002537):0.010417):0.002608):0.003213):0.014094):0.007476):0.013935):0.053874); END;