#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:10 GMT TreeBASE (cc) 1994-2008 Study reference: Fujimori S., Abe J.P., Okane I., & Yamaoka Y. 2017. Three new species in the genus Epulorhiza isolated from orchid mycorrhiza of Spiranthes sinensis var. amoena f. amoena (Orchidaceae). Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21776] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=32; TAXLABELS 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428' Epulorhiza_sp._T164b Epulorhiza_sp._T182 Epulorhiza_sp._T273 Epulorhiza_sp._T275 Epulorhiza_sp._T277 Epulorhiza_sp._T289 Epulorhiza_sp._T292 Epulorhiza_sp._T293 Epulorhiza_sp._T299 Epulorhiza_sp._T300 Epulorhiza_sp._T304 Epulorhiza_sp._T326 Epulorhiza_sp._T327 Epulorhiza_sp._T334 Epulorhiza_sp._T335 Epulorhiza_sp._T338 Epulorhiza_sp._T423 Epulorhiza_sp._T424 Epulorhiza_sp._T446 Epulorhiza_sp._T447 Epulorhiza_sp._T451 Epulorhiza_sp._T452 'Tulasnella asymmetrica DQ388046_MAFF305806' 'Tulasnella asymmetrica T_DQ520101_MAFF305807' 'Tulasnella calospola T_EU218888_AY243521_CBS573_83' 'Tulasnella calospora DQ388041_MAFF305801' 'Tulasnella calospora DQ388042_MAFF305802' 'Tulasnella calospora DQ388043_MAFF305803' 'Tulasnella calospora DQ388044_MAFF305804' 'Tulasnella calospora DQ388045_MAFF305805' 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43266] TITLE MPtree; LINK TAXA = Taxa1; DIMENSIONS NCHAR=472; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428' TACAACCGGTAGCATTGGATCCCTTGGCATGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCTCTAAACCAGCCGGTATGCCCCTTTGAGCGTCATTAACTACCTGCCAGCACTCGCGCCAATGACAGGCACTCTTTGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGTGCTACCGGGATAAGGGCTATTGAGTGCTGGGGCTCTCGACGTGTGCTTTAGTGCTACGTCTTGAGACGGCCTGTGTGGGTTGATTGGGGTGAAACGCGCCTTTGGAATTCGGCTGCGGCTAT Epulorhiza_sp._T164b TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T182 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T273 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T275 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T277 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T289 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T292 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T293 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T299 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T300 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T304 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T326 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T327 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T334 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T335 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T338 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T423 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T424 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T446 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T447 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T451 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T452 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG 'Tulasnella asymmetrica DQ388046_MAFF305806' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella asymmetrica T_DQ520101_MAFF305807' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella calospola T_EU218888_AY243521_CBS573_83' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGCTCCGGG 'Tulasnella calospora DQ388041_MAFF305801' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTTGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACG{CT}GCTGTTGGAATTCAGCTGCTTCGGG 'Tulasnella calospora DQ388042_MAFF305802' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTG{CT}TTCGGA 'Tulasnella calospora DQ388043_MAFF305803' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCATCCGTCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG 'Tulasnella calospora DQ388044_MAFF305804' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATTATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGTTTCGGG 'Tulasnella calospora DQ388045_MAFF305805' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGTTTCGGA 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83' TACAACCGGTAGCGTTGGATCCCTTGGCACGCCGATCGATGAAGACCGTTGCAAACTGCGATAAGTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAATCATCGAATCGTTGAACGCACTGCACCGTCCTATCCGGACCGGTATGCCCCTTTGAGCGTCATTAACCTGCCTTGGGGTTGCGTGCCTACGACCGGCGCTCGTCGAGTCGCGTAGTTTTGTATTGCTGCGC?AATCGGGAGGTA?AGCCCTTCTAAAGCTAAATATTGCGGCGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACTATGAAGAATAGGTTGAAACAGCATTGAAAGCGTTACCGGGATAAGGGCTGGCGGATGCTGGGATCGGTGCGGCGTGCTTCAGTGCTGTCGCTCCGAACGGCTCGCGCGGGTTCGTTGCAGGGAAAAGCGCCTCGGGAATTCGGCCACTCCGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43268] TITLE NJtree; LINK TAXA = Taxa1; DIMENSIONS NCHAR=472; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428' TACAACCGGTAGCATTGGATCCCTTGGCATGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCTCTAAACCAGCCGGTATGCCCCTTTGAGCGTCATTAACTACCTGCCAGCACTCGCGCCAATGACAGGCACTCTTTGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGTGCTACCGGGATAAGGGCTATTGAGTGCTGGGGCTCTCGACGTGTGCTTTAGTGCTACGTCTTGAGACGGCCTGTGTGGGTTGATTGGGGTGAAACGCGCCTTTGGAATTCGGCTGCGGCTAT Epulorhiza_sp._T164b TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T182 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T273 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T275 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T277 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T289 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T292 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T293 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T299 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T300 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T304 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T326 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T327 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T334 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T335 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T338 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T423 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T424 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T446 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T447 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T451 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T452 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG 'Tulasnella asymmetrica DQ388046_MAFF305806' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella asymmetrica T_DQ520101_MAFF305807' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella calospola T_EU218888_AY243521_CBS573_83' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGCTCCGGG 'Tulasnella calospora DQ388041_MAFF305801' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTTGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACG{CT}GCTGTTGGAATTCAGCTGCTTCGGG 'Tulasnella calospora DQ388042_MAFF305802' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTG{CT}TTCGGA 'Tulasnella calospora DQ388043_MAFF305803' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCATCCGTCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG 'Tulasnella calospora DQ388044_MAFF305804' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATTATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGTTTCGGG 'Tulasnella calospora DQ388045_MAFF305805' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGTTTCGGA 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83' TACAACCGGTAGCGTTGGATCCCTTGGCACGCCGATCGATGAAGACCGTTGCAAACTGCGATAAGTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAATCATCGAATCGTTGAACGCACTGCACCGTCCTATCCGGACCGGTATGCCCCTTTGAGCGTCATTAACCTGCCTTGGGGTTGCGTGCCTACGACCGGCGCTCGTCGAGTCGCGTAGTTTTGTATTGCTGCGC?AATCGGGAGGTA?AGCCCTTCTAAAGCTAAATATTGCGGCGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACTATGAAGAATAGGTTGAAACAGCATTGAAAGCGTTACCGGGATAAGGGCTGGCGGATGCTGGGATCGGTGCGGCGTGCTTCAGTGCTGTCGCTCCGAACGGCTCGCGCGGGTTCGTTGCAGGGAAAAGCGCCTCGGGAATTCGGCCACTCCGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43265] TITLE MLtree; LINK TAXA = Taxa1; DIMENSIONS NCHAR=472; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428' TACAACCGGTAGCATTGGATCCCTTGGCATGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCTCTAAACCAGCCGGTATGCCCCTTTGAGCGTCATTAACTACCTGCCAGCACTCGCGCCAATGACAGGCACTCTTTGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGTGCTACCGGGATAAGGGCTATTGAGTGCTGGGGCTCTCGACGTGTGCTTTAGTGCTACGTCTTGAGACGGCCTGTGTGGGTTGATTGGGGTGAAACGCGCCTTTGGAATTCGGCTGCGGCTAT Epulorhiza_sp._T164b TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T182 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T273 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T275 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T277 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T289 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T292 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T293 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T299 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T300 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T304 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T326 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T327 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T334 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T335 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T338 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T423 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T424 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T446 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T447 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T451 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T452 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG 'Tulasnella asymmetrica DQ388046_MAFF305806' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella asymmetrica T_DQ520101_MAFF305807' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella calospola T_EU218888_AY243521_CBS573_83' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGCTCCGGG 'Tulasnella calospora DQ388041_MAFF305801' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTTGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACG{CT}GCTGTTGGAATTCAGCTGCTTCGGG 'Tulasnella calospora DQ388042_MAFF305802' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTG{CT}TTCGGA 'Tulasnella calospora DQ388043_MAFF305803' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCATCCGTCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG 'Tulasnella calospora DQ388044_MAFF305804' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATTATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGTTTCGGG 'Tulasnella calospora DQ388045_MAFF305805' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGTTTCGGA 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83' TACAACCGGTAGCGTTGGATCCCTTGGCACGCCGATCGATGAAGACCGTTGCAAACTGCGATAAGTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAATCATCGAATCGTTGAACGCACTGCACCGTCCTATCCGGACCGGTATGCCCCTTTGAGCGTCATTAACCTGCCTTGGGGTTGCGTGCCTACGACCGGCGCTCGTCGAGTCGCGTAGTTTTGTATTGCTGCGC?AATCGGGAGGTA?AGCCCTTCTAAAGCTAAATATTGCGGCGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACTATGAAGAATAGGTTGAAACAGCATTGAAAGCGTTACCGGGATAAGGGCTGGCGGATGCTGGGATCGGTGCGGCGTGCTTCAGTGCTGTCGCTCCGAACGGCTCGCGCGGGTTCGTTGCAGGGAAAAGCGCCTCGGGAATTCGGCCACTCCGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43267] TITLE BItree; LINK TAXA = Taxa1; DIMENSIONS NCHAR=472; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428' TACAACCGGTAGCATTGGATCCCTTGGCATGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCTCTAAACCAGCCGGTATGCCCCTTTGAGCGTCATTAACTACCTGCCAGCACTCGCGCCAATGACAGGCACTCTTTGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGTGCTACCGGGATAAGGGCTATTGAGTGCTGGGGCTCTCGACGTGTGCTTTAGTGCTACGTCTTGAGACGGCCTGTGTGGGTTGATTGGGGTGAAACGCGCCTTTGGAATTCGGCTGCGGCTAT Epulorhiza_sp._T164b TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T182 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T273 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T275 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T277 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T289 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T292 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T293 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T299 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T300 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T304 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T326 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T327 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T334 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATTGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGTGAAACGCGCCGTTGGAATTCGGCTGTTTTGGA Epulorhiza_sp._T335 TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGCGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCGGCTGTTTCGGG Epulorhiza_sp._T338 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T423 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T424 TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG Epulorhiza_sp._T446 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T447 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTCGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCTGTAGGAATTCGGCTGCTTCGGG Epulorhiza_sp._T451 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG Epulorhiza_sp._T452 TACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACCGCACCGCCCTAACCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTTCTTGGGTGTGCTTCAGTGCTACCCTTGGAGACGGCCCGCGTGGGTTGATTGGGGCGAGACGCGCCGTTGGAATTCAGCTGTTTCGGG 'Tulasnella asymmetrica DQ388046_MAFF305806' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella asymmetrica T_DQ520101_MAFF305807' TACAACTCATAGCGTTGGATCCCTTGGCATGCCATTCGATGAAGACCGTTGCAAAATGCGATAAGTGGTGTGATATGCAAGTCCAAAACTTATACGTGAATCATCGAATTGTTGAACGCACTGCATCATCCTTATCCAGGCGATACGCCCTATTGAGCGTCATTTGTGCCCGTTAACCGTCTGCGCAATTGACCGACGTTCTGCGAGTCGCGTAGTTTTGTATTGCTGCGCTAATTGGGAGGTAGAGCCCTTCTAAAGCTAAATATTATGGCATGACCGATAGCATACAAGTACCGCGAGGGAAAGGTGCAAAGCAAATATGTAAAATATGTTGAAACAGTAGTGAAAGCGCTATGGGGATAAGGGCTGGGGATTGCTCGTGCCGATCGCCCGTGCTTTAGTGCTGGGCTTCCGGACGGCGTGCGGCGGTTCGATGGAGAGAACAGGCCACTTGGAATTCGGCTGGTCCGCC 'Tulasnella calospola T_EU218888_AY243521_CBS573_83' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGCTCCGGG 'Tulasnella calospora DQ388041_MAFF305801' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAAACCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTTGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACG{CT}GCTGTTGGAATTCAGCTGCTTCGGG 'Tulasnella calospora DQ388042_MAFF305802' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTG{CT}TTCGGA 'Tulasnella calospora DQ388043_MAFF305803' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCATCCGTCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGCTTTGGG 'Tulasnella calospora DQ388044_MAFF305804' TACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGTGCTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATTATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAATCGCTACCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTCGGAGACGGCCCGCGAGGGTTGATTGGGGCGAGACGCGCTGCAGGAATTCGGCTGTTTCGGG 'Tulasnella calospora DQ388045_MAFF305805' TACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCCCTAATCCGGCCGGTATGCCCCTTTGAGCGTCATTTACCACCTGCCTGCACTCGCGCCAATGACAAGCACTCCTCGAGTCGCGTAGTTTTGTAATGCTGCGCCAAGTGGGAGGTAGAGACCTTCTAAGGCTAAATATGATGACGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACCATGAAAAATGGGTTGAAACAGTAGTGAAAGCGCTTCCGGGATAAGGGCTATCGGGTGCTGGGGCTCTTTGGGTGTGCTTTAGTGCTACCCTTGGAGACGGCCCGCGCGGGTTGATTGGGGTGAGACGCGCCGTTGGAATTCGGCTGTTTCGGA 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83' TACAACCGGTAGCGTTGGATCCCTTGGCACGCCGATCGATGAAGACCGTTGCAAACTGCGATAAGTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAATCATCGAATCGTTGAACGCACTGCACCGTCCTATCCGGACCGGTATGCCCCTTTGAGCGTCATTAACCTGCCTTGGGGTTGCGTGCCTACGACCGGCGCTCGTCGAGTCGCGTAGTTTTGTATTGCTGCGC?AATCGGGAGGTA?AGCCCTTCTAAAGCTAAATATTGCGGCGTGACCGATAGCACACAAGTACCGCGAGGGAAAGGTGAAAAGCAACTATGAAGAATAGGTTGAAACAGCATTGAAAGCGTTACCGGGATAAGGGCTGGCGGATGCTGGGATCGGTGCGGCGTGCTTCAGTGCTGTCGCTCCGAACGGCTCGCGCGGGTTCGTTGCAGGGAAAAGCGCCTCGGGAATTCGGCCACTCCGGT ; END; BEGIN TREES; TITLE 'Trees from "1_1509591710_MPtree_151203_161222.txt"'; LINK TAXA = Taxa1; TRANSLATE 1 'Tulasnella asymmetrica T_DQ520101_MAFF305807', 2 'Tulasnella asymmetrica DQ388046_MAFF305806', 3 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83', 4 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428', 5 'Tulasnella calospora DQ388041_MAFF305801', 6 'Tulasnella calospora DQ388042_MAFF305802', 7 'Tulasnella calospora DQ388043_MAFF305803', 8 'Tulasnella calospora DQ388044_MAFF305804', 9 'Tulasnella calospora DQ388045_MAFF305805', 10 'Tulasnella calospola T_EU218888_AY243521_CBS573_83', 11 Epulorhiza_sp._T338, 12 Epulorhiza_sp._T423, 13 Epulorhiza_sp._T424, 14 Epulorhiza_sp._T335, 15 Epulorhiza_sp._T326, 16 Epulorhiza_sp._T273, 17 Epulorhiza_sp._T275, 18 Epulorhiza_sp._T277, 19 Epulorhiza_sp._T299, 20 Epulorhiza_sp._T300, 21 Epulorhiza_sp._T334, 22 Epulorhiza_sp._T289, 23 Epulorhiza_sp._T292, 24 Epulorhiza_sp._T293, 25 Epulorhiza_sp._T327, 26 Epulorhiza_sp._T451, 27 Epulorhiza_sp._T452, 28 Epulorhiza_sp._T164b, 29 Epulorhiza_sp._T182, 30 Epulorhiza_sp._T304, 31 Epulorhiza_sp._T446, 32 Epulorhiza_sp._T447; TREE PAUP_1 = [&R] (1,2,(3,(4,(5,10,14,15,(6,9),(8,(7,11,12,13)),(16,17,18,19,20,21),(22,23,24,25,26,27),(28,29,30,31,32))))); END; BEGIN TREES; TITLE 'Trees from "1_1509591673_MLtree_151203_161225.txt"'; LINK TAXA = Taxa1; TRANSLATE 1 'Tulasnella asymmetrica T_DQ520101_MAFF305807', 2 'Tulasnella asymmetrica DQ388046_MAFF305806', 3 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83', 4 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428', 5 'Tulasnella calospora DQ388041_MAFF305801', 6 'Tulasnella calospora DQ388042_MAFF305802', 7 'Tulasnella calospora DQ388043_MAFF305803', 8 'Tulasnella calospora DQ388044_MAFF305804', 9 'Tulasnella calospora DQ388045_MAFF305805', 10 'Tulasnella calospola T_EU218888_AY243521_CBS573_83', 11 Epulorhiza_sp._T338, 12 Epulorhiza_sp._T423, 13 Epulorhiza_sp._T424, 14 Epulorhiza_sp._T335, 15 Epulorhiza_sp._T326, 16 Epulorhiza_sp._T273, 17 Epulorhiza_sp._T275, 18 Epulorhiza_sp._T277, 19 Epulorhiza_sp._T299, 20 Epulorhiza_sp._T300, 21 Epulorhiza_sp._T334, 22 Epulorhiza_sp._T289, 23 Epulorhiza_sp._T292, 24 Epulorhiza_sp._T293, 25 Epulorhiza_sp._T327, 26 Epulorhiza_sp._T451, 27 Epulorhiza_sp._T452, 28 Epulorhiza_sp._T164b, 29 Epulorhiza_sp._T182, 30 Epulorhiza_sp._T304, 31 Epulorhiza_sp._T446, 32 Epulorhiza_sp._T447; TREE 'PHYLIP 1+' = [&U] (3,(4,(((((15,(14,(5,(10,(9,6))))),(8,(7,(11,(13,12))))),(28,(29,(30,(31,32))))),((22,23),(24,(25,(26,27))))),(16,(17,(18,(19,(20,21))))))),(1,2)); END; BEGIN TREES; TITLE 'Trees from "1_1509591741_MrBayestree_151203_161224.txt"'; LINK TAXA = Taxa1; TRANSLATE 1 'Tulasnella asymmetrica T_DQ520101_MAFF305807', 2 'Tulasnella asymmetrica DQ388046_MAFF305806', 3 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83', 4 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428', 5 'Tulasnella calospora DQ388041_MAFF305801', 6 'Tulasnella calospora DQ388042_MAFF305802', 7 'Tulasnella calospora DQ388043_MAFF305803', 8 'Tulasnella calospora DQ388044_MAFF305804', 9 'Tulasnella calospora DQ388045_MAFF305805', 10 'Tulasnella calospola T_EU218888_AY243521_CBS573_83', 11 Epulorhiza_sp._T338, 12 Epulorhiza_sp._T423, 13 Epulorhiza_sp._T424, 14 Epulorhiza_sp._T335, 15 Epulorhiza_sp._T326, 16 Epulorhiza_sp._T273, 17 Epulorhiza_sp._T275, 18 Epulorhiza_sp._T277, 19 Epulorhiza_sp._T299, 20 Epulorhiza_sp._T300, 21 Epulorhiza_sp._T334, 22 Epulorhiza_sp._T289, 23 Epulorhiza_sp._T292, 24 Epulorhiza_sp._T293, 25 Epulorhiza_sp._T327, 26 Epulorhiza_sp._T451, 27 Epulorhiza_sp._T452, 28 Epulorhiza_sp._T164b, 29 Epulorhiza_sp._T182, 30 Epulorhiza_sp._T304, 31 Epulorhiza_sp._T446, 32 Epulorhiza_sp._T447; TREE 'PHYLIP 1+' = [&U] (1,2,(3,(4,16,17,18,19,20,21,(((((5,10),(6,9)),(14,15)),(8,(7,11,12,13))),(22,23,24,25,26,27),(28,29,30,31,32))))); TREE 'PHYLIP 2+' = [&U] (1,2,(3,(4,16,17,18,19,20,21,(((((5,10),(6,9)),(14,15)),(8,(7,11,12,13))),(22,23,24,25,26,27),(28,29,30,31,32))))); END; BEGIN TREES; TITLE 'Trees from "1_1509591772_NJtree_151203_161225.txt"'; LINK TAXA = Taxa1; TRANSLATE 1 'Tulasnella asymmetrica T_DQ520101_MAFF305807', 2 'Tulasnella asymmetrica DQ388046_MAFF305806', 3 'Tulasnella irregularis T_EU218889_AY243519_CBS574_83', 4 'Epulorhiza anaticula T_EU218891_AY243520_UAMH5428', 5 'Tulasnella calospora DQ388041_MAFF305801', 6 'Tulasnella calospora DQ388042_MAFF305802', 7 'Tulasnella calospora DQ388043_MAFF305803', 8 'Tulasnella calospora DQ388044_MAFF305804', 9 'Tulasnella calospora DQ388045_MAFF305805', 10 'Tulasnella calospola T_EU218888_AY243521_CBS573_83', 11 Epulorhiza_sp._T338, 12 Epulorhiza_sp._T423, 13 Epulorhiza_sp._T424, 14 Epulorhiza_sp._T335, 15 Epulorhiza_sp._T326, 16 Epulorhiza_sp._T273, 17 Epulorhiza_sp._T275, 18 Epulorhiza_sp._T277, 19 Epulorhiza_sp._T299, 20 Epulorhiza_sp._T300, 21 Epulorhiza_sp._T334, 22 Epulorhiza_sp._T289, 23 Epulorhiza_sp._T292, 24 Epulorhiza_sp._T293, 25 Epulorhiza_sp._T327, 26 Epulorhiza_sp._T451, 27 Epulorhiza_sp._T452, 28 Epulorhiza_sp._T164b, 29 Epulorhiza_sp._T182, 30 Epulorhiza_sp._T304, 31 Epulorhiza_sp._T446, 32 Epulorhiza_sp._T447; TREE 'PHYLIP 1+' = [&U] ((3,(4,(((((5,(10,(9,6))),(14,15)),(8,(11,(12,(13,7))))),((28,(29,(30,(31,32)))),((22,23),(24,(25,(26,27)))))),(16,(17,(18,(19,(20,21)))))))),(1,2)); END;