#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:33 GMT TreeBASE (cc) 1994-2008 Study reference: Yagame T., & Yamato M. 2008. Isolation and identification of mycorrhizal fungi associated with Stigmatodactylus sikokiana (Maxim. ex Makino) Rauschert (Orchidaceae). Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2190] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=40; TAXLABELS Basidiomycota_sp._MB21_AB370323 Basidiomycota_sp._NA11_AB370314 Basidiomycota_sp._NA12_AB370315 Basidiomycota_sp._NA13_AB370316 Basidiomycota_sp._NA14_AB370317 Basidiomycota_sp._NA15_AB370318 Basidiomycota_sp._NA16_AB370319 Basidiomycota_sp._NA17_AB370320 Basidiomycota_sp._NA18_AB370321 Basidiomycota_sp._NB11_AB370322 Basidiomycota_sp._NB22_AB370324 Basidiomycota_sp._NB23_AB370325 Basidiomycota_sp._NB24_AB370326 Basidiomycota_sp._NB25_AB370327 Basidiomycota_sp._NB26_AB370308 Basidiomycota_sp._YA11_AB370308 Basidiomycota_sp._YA12_AB370309 Basidiomycota_sp._YA13_AB370310 Basidiomycota_sp._YA14_AB370311 Basidiomycota_sp._YA15_AB370312 Basidiomycota_sp._YA16_AB370313 Craterocolla_cerasi_DQ520103 Sebacina_aff_epigaea_AF490393 Sebacina_epigaea_AF490397 Sebacina_incrustans_DQ520095 Sebacina_sp._ex_Caladenia_carnea_AY643802 Sebacina_sp._ex_Epipactis_palustris_AY634132 Sebacina_sp._ex_Erythrorchis_cassythoides_DQ398099 Sebacina_sp._ex_Hexalectris_spicata_AY243528 Sebacina_sp._ex_Hexalectris_spicata_AY243530 Sebacina_sp._ex_Neottia_nidus_avis_AF440652 Sebacina_sp._ex_Neottia_nidusavis_AF440641 Sebacina_sp._ex_Neottia_nidusavis_AF440648 Sebacina_sp._ex_Neottia_nidusavis_AF440650 Sebacina_sp._ex_Neottia_nidusavis_AF440658 Sebacina_sp._ex_Neottia_nidusavis_AF440660 Sebacina_vermifera_DQ983814 Sebacina_vermifera_DQ983815 Sebacina_vermifera_DQ983816 Serendipita_vermifera_DQ520096 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3599] TITLE Sebacinaceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=638; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Basidiomycota_sp._MB21_AB370323 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------TGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTCTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA11_AB370314 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGCTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AGAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA12_AB370315 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGCTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AGAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA13_AB370316 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA14_AB370317 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA15_AB370318 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACTGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA16_AB370319 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------TGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCGGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA17_AB370320 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAGTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NA18_AB370321 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCCGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB11_AB370322 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------TGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTCTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB22_AB370324 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----T---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB23_AB370325 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTTTACCCACTCT---TGTGAAAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCCC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGACGTTGC----CGTGTTA----TGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTTGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB24_AB370326 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB25_AB370327 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------TGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._NB26_AB370308 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------TGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA11_AB370308 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGTGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA12_AB370309 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGCGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA13_AB370310 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGTGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA14_AB370311 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGTGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA15_AB370312 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGTGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Basidiomycota_sp._YA16_AB370313 ATTAACGAAT-GACAAG---ACTGACCGTT-----GCTGGCGGAAA------CGCATGTGCACG--TCGGTCGCAAAA---TCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTTT----C---------GACCCGGGG-------CAACCCTTTTTTA-ACCCACTCT---TGTAATAGAATGTTCATGTG---CTAAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCTC---AAAA----TTCATTTTT--TGGTGGTGGACTTGGATGTTGC----CGTGTTA----CGGCTCGTCTGGAATGTCTCAGTTGTGACCCGCTCGTCGGC--GTAAACAGTGTGATAGGTA-TCTTCACTG-GTCAGCTTCTCC--GGAGGCGTGCTTTCAGGTGGA-TGTCTGGCTGCCAACCGTCTTTT---AGACAAT-CT-------CTGACAATTTGACCTCAAA Craterocolla_cerasi_DQ520103 ATTAGAGAATTTGAACGTCGTTCGGTTGT------GCTGGCTCT------TTTGCAAGTGCACGC-CGTTCGGCTTACAT-CCAACCCCT-----------------GTGCACC--------TTTGGCCTCGTCGGTTTGGTCGCGATCGTAATGGTCGTCGGCTCGCCGCGGGGATTTTAC-ACAAACTCG-TATGTAAAGGAAATTGGAATTGT--GCTC-TGCACGATAATATA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCCCGTTTGAGTGTCATTGTAATCTCACACCCTAAGAT-----TTGTTTCGAGGGGAGGTGGACTTGGACGTTGC----CGCGTCGCT-GCGGCTCGTCTCAAATGCGTTAGT-GCAACTTTTGGTTGGACATA-GTACGGCGTGATAAGTA-TCTTCGCCGGCTCTCCGCAA----GGGGGTGTTCGATTTGAAAGC-TCTGTGCTT-CCAATCGTCTTCGGACAAGCCTTCACGGGCTTCTTGACAACTTGACCTCAAA Sebacina_aff_epigaea_AF490393 ATTATTGACTGTGAATCGTTGCCTTCAGT------GCTGGC--------TCCGGCAAGTGCACG--TTGGTGACTTTCAT-CCAACACTCTT---------------GTGAACC--------TTTGGCCTCTT------------GCTGGCCTCGGCTGGC--------AGAGGATTTTT-ACACCCACTCG-CATGTAATGAAATT-ATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCTCAT-CCTTTGGATT--TGGAGCGGTGGACTTGGGTGTTGC----CGCTTTACG-GTGGCTCACCTCTAATGCATTCGT-GCAACTCTTGGTTGGAC-ATAGTACGGCGTGATAAGTG-TCTTCGCCGGCACCTCGCAA----GAGGGTGGCTGATTGAGAGC--TCTGTGCTTTCAAACCGTCCTTG----GACAATGA--------CTGACAACTTGACCTCAAA Sebacina_epigaea_AF490397 ATTATTGATATTAATTGTCTACCTTCAGT------GCTGGC--------TCTTGCAAGTGCACG--TTGGGGACATATAT-CCAATACCCTCTT-------------GTGAACC--------ATTGGCCT-TT------------GCTAGCTTCGGCTGGT--------AAAGGATTTT----ACACAAATG-AATGTAATGAAAT--AATCTTGT--GC-TGAGCACTAA-ATATA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCAAAGGGTATGCCCGTTTGAGTGTCATTATACTATCACACTCTCTAAT-----TAGTTA--GAGAGCGGTGGATTTGGATGCTGCCTGGTACTTACTGTCAGGCTCATCTTAAATAAATTAGT-GCGACTCTTAGTTAAAC-ATAGTACGGCGTGATAAGTAACCCTCGCTGTTTTCT---------------GTCTAATTAGGAGC--TCTGTGCTT-CAAACCGTCTCAG----GACAATAT--------TTGATAACTTGACCTCAAA Sebacina_incrustans_DQ520095 ATTAGTGATT--AAACTGTTGCCCTCTGT------GCTGGC---------TCTGCAAGTGCACG--TCGGTGACTTTCATTCCAATACCCTT---------------GTGAACC--------TTTGGCCTCTT------------GCTAGCTTCGGCTGGC--------AGAGGATTCTACATACAAACTCG-CATGTAATGAAACT-CTTGTTGT--GCACAAGCACTACTATATA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCTGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCCGAT---CTTGCATT--GGGAGCGGTGGACTTGGGT-TTGC----TGCCTTACC-GTAGCTTACCTCAAATGTGTTAGT-GCAACTCTTGGTTGGAC-ATAGTACGGCGTGATAAGTA-TCTTCGCCGGTGCCTCGCAATTGCGAGGGTGGCCGATCGGGATG--T-TGTGCTC-CAAACCGTCTTCG----GACAATCT--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Caladenia_carnea_AY643802 ATTAACGAAT-CAAAAGTCGGTCGACCGT------GCTGGCGGAAA------CGCACGTGCACG--TCGGTCGCAAACCAATCCACACACCT---------------GTGAACG--------TATGGCCTTTCGGGTCTC--TC---------GACTCGGGGG------CAAACCATTTTTT-ACCCACTCTGATCGTAAAGGAATGTC--TTTG---CCTAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCC---CGGAA---TTTATTTTC--TGGGAGTGGACTTGGACGCTGC----CGTGTCA----CGGCTCGTCTGGAATGTCTCAGTG-TGCCCCGCCCGTCGGT--GTTAACAGTGTGATAGATA-TCTTCACTG-GTT-GCCTCTCC--GGAGGCGCGCTCTCGGATGGATCG-TGTGCT?CCAACCGTCTTC----GGACAATACT-------CTGACAATTTGACCTCAAA Sebacina_sp._ex_Epipactis_palustris_AY634132 ATTAATGAAACTTCAA----GTCGGCTGTT-CTGTGCTGGTGGCAA------CACATGTGCACG-TTCAGTCGCAA-----TCCACACACCTGTGCACTTTGACTCTGAGCACCGCCGGTAACACGGCAG--AAGGTTTGAGATGAAGGTCTTAACCCCGGTA------CTCGAGTAGTTTA--CACACTCTGTATGTAATAGAATGTAACTG-----TACAATGTACAACTATAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCCC---AACACC--TTTATTGGTGTTGGATGTGGACTTGGATGTTGT----CGTGTT-CA-ACGACTCGTCTTAAATGCCTGAGT-GTACCCTGCTTTGCAGC--GTATC-AGTGTGATAAACA-TCTTCACTG-TTAAGTCTTTCG--GGACACGCTTGTGTT-GTAGGCTCTATGCTTTCCAACCGTCCTCT---GGACAAT-CT-------CTGACAATTTGACCTCAAA Sebacina_sp._ex_Erythrorchis_cassythoides_DQ398099 ATTAACGAAT-GTCAAGTCGGCCGACCGT------GCTGGTGGAAA------CGCATGTGCACG--TCGGTCGCAACACA-TCCACACACCT---------------GTGAACG--------TATGGCCT-TCGGGTCTT--CC---------GACCCGGGG-------CAAACCTTTTTTA--CCCACTCTGATCGTAAAGGAATGTCTACTTG---C-GAATGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCCC---GAGGGAATTTCGTTTCC--CCGGTGTGGACTTGGATGTTGC----CGTGCTCT---CGGCTCGTCTGGAATGTCTCAGT-GTTACCCGCTCGTCGGC--GTCGACAGTGTGATAAGTA-TCTTCACTGTGTAAGCCTCTTC--GGAGGCGCGCCCTCGGATGGAACGTCGCGCTGCCAACCGTCTTC----GGACGAC-TC-------TTGACGATTTGACCTCAAA Sebacina_sp._ex_Hexalectris_spicata_AY243528 ATTAATGATTGCGAATGGTTGCCTTCGGT------GCTGGC--------TCTTGCAAGTGCACG--TTGGTGGCTTTCAT-CCAATACCCTTT--------------GTGAACC--------TTTGGCCTCTT------------GCTAGCTTCGGCTGGC--------AGAGGATTTT---TACACACTCG-AATGTAATGAAAACTATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTCCGAT-CCTATGGATTCGGGGAGCGGTGGACTTGGGTGTTGC----TGCTTTCCTTGTGGCTCACCTCAAATGCGTCAGT-GCACCTCTTGGTTGGAC-ATAGTACGGCGTGATAAGTA-TCTTCGCCGGCGCCTCGCAA----GAGGGTGGCCGATCGGGAGC--TCTGTGCTTTCAAACCGTCTCCG----GACAATAT--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Hexalectris_spicata_AY243530 ATTATTGATTGTGAATCGTTGCCTCCAGT------GCTGGC--------TCTCGCAAGTGCACGG-TTGGTGACTTTCAT-CCAACACCCT----------------GTGAACC--------TTTGGCCTCTT------------GCTAGCTTCGGCTGGC--------AGAGGATTTTT-ACACACACTCG-AATGTAATGAAATT-ATTGTCGT--GCGCAAGCACTT--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCA-CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCTGAT-CCTTTGGATT--TGGAGCGGTGGACTTGGGTGTTGC----CACTTGACG-GTGGCTCACCTCTAATGCATTAGT-GCAACTCCTGGTTGGACCATAGTACGGCGTGATAAGTG-TCTTCGCCG-CACCTCGTGA----GAGG-TGGCCGATCGAGAGC--TCTGTGCTTTCAAACCGTCCTTGCAAGGACAATGA--------GGGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidus_avis_AF440652 ATTATTGATTGCGAATCGTTGTCTCCAGT------GCTGGCCAGGTCACTCTGGCAAGTGCACG--GAGACAGCTTTCAT-CCAATACCCT----------------GTGAACC--------TTTGGCCTCTT------------GCTAGCTTCGGCGAGC--------AGAGGATTTT--ACACCCACTCG-AATGTAATGAAATT-ATTGTTGT--GCACACGCACTA--CTATA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCCGAT-TGTTTGGATC--GGGAGCGGTGGACTTGGGTGTTGC----TGCGTAACT-GTGGCTCACCTTAAATGCATTAGT-GCACCTTTCGGTTGGAC-ATAGTACGGCGTGATAAGTG-TCTTCGCCGGCACCTCCTCACA--GAGGGTGGCCGATCGGGAGC--TCTGTGCTT-CAAACCGTCTTCG----GACAACAA--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidusavis_AF440641 ATTATTGACTGTGAATCGTTGCCTCCAGT------GCTGGC--------TCCGGCAAGTGCACG--TTGGTGACTTTCAT-CCAACACCCT----------------GTGAAC{CG}--------TTTGGCCTCTT------------GCTCGCTTCGGCTGGC--------AGAGGATTTTT-ACACCCACTCG-AATGTAATGAAATT-ATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCTGAT-CCTTTGGATT--TGGAGCGGTGGACTTGGGTGTTGC----TGCTTAACA-GTGGCTCACCTCGAATGCATTAGT-GCAACTCCTGATTGGACCATAGTACGGCGTGATAAGTG-TCTTCGCCGGCACCTCGCAA----GAGGGTGGCTGATTGAGAGC--TCTGTGCTTCCAAACCGTCCTTGCAAGGACAATGA--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidusavis_AF440648 ATTATTGATTGCGAATCGTTGCCTTCAGT------GCTGGCCGG----CTTCGGCAAGTGCACG--TCGGTGACTTTCAT-CCAATACCCT----------------GTGCACC--------TTTGGCCT-TT------------GCTAGCTTCGGCCGGC--------AGAGGATTTT--ACATAAACTCG-AATGTAATGAAATTTATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-CCTAATGCTTTTGGATT--GGGAGCGGTGGACTTGGGTGTTGC----TGCTTTACT-GTGGCTCACCTCAAATGGAGTAGT-GCAACTCTCGGTTGGAC-ATAGTACGGCGTGATAAGTG-TCTTCGCCGGCGCCTCATTC----GAGGGTGGCCGATCAGGAGC--TCTGTGCTT-CAAACCGTCTTCG----GACAACAT--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidusavis_AF440650 ATTAATGATTGCGAATCGTCGCCTTCAGT------GCTGGCCGG----CTTCGGCAAGTGCACG--TCGGTGGCTTTCAT-CCAATACCCT----------------GTGCACC--------TTTGGCCTCTT------------GCTAGCTTCGGCCGGC--------AGAGGATTTTT-ACACACACTCG-AATGTAATGAAATTTATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACTCT-CCCGATACTTTTGGATC--GGGAGTGGTGGACTTGGGTGCTGC----TGCTTAACT-GTGGCTCGCCTCAAATGAAGTAGT-GCAACTCTCGGTTGGAC-ATAGTACGGCGTGATAAGTA-TCTTCGCCGGCGCCTCATTC----GAGGGTGGCCGATCGGGAGC--TCTGTGCTT-CAAACCGTCTTCG----GACAATAT--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidusavis_AF440658 ATTAATGATTGCGAATCGTCGCCTTCAGT------GCTGGCCGG----CTTCGGCAAGTGCACG--TCGGTGGCTTTCAT-CCAATACCCT----------------GTGCACC--------TTTGGCCTCTT------------GCTAGCTTCGGCCGGC--------AGAGGATTTTT-ACACACACTCG-AATGTAATGAAATTTATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACTCT-CCCGATACTTTTGGATC--GGGAGTGGTGGACTTGGGTGCTGC----TGCTTAACT-GTGGCTCGCCTCAAATGAAGTAGT-GCAACTCTCGGTTGGAC-ATAGTACGGCGTGATAAGTA-TCTTCGCCGGCGCCTCATTC----GAGGGTGGCCGATCGGGAGC--TCTGTGCTT-CCAACCGTCTTCG----GACAATAT--------CTGACAACTTGACCTCAAA Sebacina_sp._ex_Neottia_nidusavis_AF440660 ATTAATGATTGCGAATCGTCGCCTTCAGT------GCTGGCCGG----CTTCGGCAAGTGCACG--TCGGTGGCTTTCAT-CCAATACCCT----------------GTGCACC--------TTTGGCCTCTT------------GCTAGCTTCGGCCGGC--------AGAGGATTTTT-ACACACACTCG-AATGTAATGAAATTTATTGTCGT--GCGCAAGCACTA--ATGTA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACTCT-CCCGATACTTTTGGATC--GGGAGTGGTGGACTTGGGTGCTGC----TGCTT{AC}ACT-GTGGCTCGCCTCAAATGAAGTAGT-GCAACTCTCGGTTGGAC-ATAGTACGGCGTGATAAGTA-TCTTCGCCGGCGCCTCATTC----GAGGGTGGCCGATCGGGAGC--TCTGTGCTT-CAAACCGTCTTCG----GACAATAT--------CTGACAACTTGACCTCAAA Sebacina_vermifera_DQ983814 ATTAACGAGG-TACAAGTCGGTCGACAGT------GCTGGCGGAGA------CGCACGTGCACG--TCGGTCGCAAACCAATCCACACACCT---------------GTGAACG--------TATGGCCT-TTGGGTCTC--AC---------GACTCGGGGG------CAAACTTTTTTTA--CCCACTCTGTCTGTAAAGGAATGTCTATGTG---CTCAAAGCGCAAA-GCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCC---CGGAGA--CTTGTTTTC--CGGGAGTGGACTTGGACGTTGC----CGTGACTC---CGGCTCGTCTCGAACGTCTCAGT-GTACCCCGATCATCGGC--GTCAACAGTGTGATATGTA-TCTTCACTG--TGAGTCTCTCC--GGAGGCGCGCTCTCGAACGTGGGCATACGCTGCCAACCGTCTTC----GGACAAT-CT-------CTGACAATTTGACCTCAAA Sebacina_vermifera_DQ983815 ATTAACGAAT-CGTAAG{CT}CGGTCGACCGT------GCTGGCGGCAA------CGCACGTGCACG--TCGAT{CT}GCAAACCAATCCACACACCT---------------GTGAACG--------TATGGCCTCTCGGGTCCT--TT{CT}G-------GACTCGGGGC------AAAACCCATTTTT-AC----TCTGATCGTAAAGGAATGTC--TTTG---CCTAAAGCGCAAAAGCAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCC---CGGAA---TCT-TTTCT--GGGGAGTGGACTTGGACGTTGC----CGTGTCA----CGGCTCGTCTGGAATGTCTCAGTGCTACCCCGCCCGTCGGC--GTATACAGTGTGATAAGTA-TCTTCACTG-GTCAGCTTCCTC--{AG}GAGGCGCGCTCTCGGACGGATCGGTGTGCTGCCAACCGTCTTC----GGACAATACT-------CTGACGATTTGACCTCAAA Sebacina_vermifera_DQ983816 ATTAACGAGTTCAAAAGTCGGTCGACCGT------GCTGGCGGAGA------CGCATGTGCACG--TCGGTCGCGAACCA-TCCACACACC----------------GTGAACC--------TATGGCCT--GGGGTTTGAGTTCA-------GACCCTGGG---------CACCATTTTTA----CACTCT{AG}TTTGTAAAGGAATGT----------CTTATATCATATAAACA{AT}A-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACC{CT}C---GAAA-----TCTTTTTT--T{CT}GGAGTGGACTTGGACGCTGC----CGTGTTGCA--TGGCTCGTCTTGAACGTCTCAGT-GT{AG}CCCCGCCCGTCGGT--GTAGACAGCGTGATAAGTA-TCTTCGCTGGTCAAGCCTCTCC--GGAGGCG{CT}GCCCTCGAGCATGGAAGTGTGCTGCCAACCGTCTTTT----GACAAC-{CT}T-------TTGACAATTTGACCTCAGA Serendipita_vermifera_DQ520096 ATTAATGAAACTTCAAA---GTCGGCCATTGTTGTGCTGGTGATTAA--CTTCACATGTGCAC{AG}CTTTGGTCGCAAA----TCCACACACAC-------------CTGTGCATC--------TATGACTC--{AG}AGGTT-GTAATGA-----------CTGAGA------GTAAATT---TTA--CACACTCTGAATGTAATGGAATGTCTTTTTGTGCTATAATGTACAA-TATAAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACTTC---TACAA---TTTATTGTA--TGAATGTGGACTTGGATGTTGC----CGTGTTATT-ACGGCTCGTCTTAAATGCCTGAGT-GTACCCTGCTTTGCAGC--GTATCCGGTGTAATAAACA-TTTCACCAG-AGTTGGTCGCAA--GACCGCGCTTTTATTTGTAGGCTCTATGCTT-CAAACCGTCCACTTGTGGACAAT-CT-------CTGACAATTTGACCTCAAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Sebacinaceae) = N: 1-638; CODONPOSSET CodonPositions (CHARACTERS = Sebacinaceae) = N: 1-638; END; BEGIN TREES; TITLE Tb9341; LINK TAXA = Taxa1; TRANSLATE 1 Basidiomycota_sp._MB21_AB370323, 2 Basidiomycota_sp._NA11_AB370314, 3 Basidiomycota_sp._NA12_AB370315, 4 Basidiomycota_sp._NA13_AB370316, 5 Basidiomycota_sp._NA14_AB370317, 6 Basidiomycota_sp._NA15_AB370318, 7 Basidiomycota_sp._NA16_AB370319, 8 Basidiomycota_sp._NA17_AB370320, 9 Basidiomycota_sp._NA18_AB370321, 10 Basidiomycota_sp._NB11_AB370322, 11 Basidiomycota_sp._NB22_AB370324, 12 Basidiomycota_sp._NB23_AB370325, 13 Basidiomycota_sp._NB24_AB370326, 14 Basidiomycota_sp._NB25_AB370327, 15 Basidiomycota_sp._NB26_AB370308, 16 Basidiomycota_sp._YA11_AB370308, 17 Basidiomycota_sp._YA12_AB370309, 18 Basidiomycota_sp._YA13_AB370310, 19 Basidiomycota_sp._YA14_AB370311, 20 Basidiomycota_sp._YA15_AB370312, 21 Basidiomycota_sp._YA16_AB370313, 22 Craterocolla_cerasi_DQ520103, 23 Sebacina_aff_epigaea_AF490393, 24 Sebacina_epigaea_AF490397, 25 Sebacina_incrustans_DQ520095, 26 Sebacina_sp._ex_Caladenia_carnea_AY643802, 27 Sebacina_sp._ex_Epipactis_palustris_AY634132, 28 Sebacina_sp._ex_Erythrorchis_cassythoides_DQ398099, 29 Sebacina_sp._ex_Hexalectris_spicata_AY243528, 30 Sebacina_sp._ex_Hexalectris_spicata_AY243530, 31 Sebacina_sp._ex_Neottia_nidus_avis_AF440652, 32 Sebacina_sp._ex_Neottia_nidusavis_AF440641, 33 Sebacina_sp._ex_Neottia_nidusavis_AF440648, 34 Sebacina_sp._ex_Neottia_nidusavis_AF440650, 35 Sebacina_sp._ex_Neottia_nidusavis_AF440658, 36 Sebacina_sp._ex_Neottia_nidusavis_AF440660, 37 Sebacina_vermifera_DQ983814, 38 Sebacina_vermifera_DQ983815, 39 Sebacina_vermifera_DQ983816, 40 Serendipita_vermifera_DQ520096; TREE Fig._2 = [&R] (((((((16,17,18,19,20,21,11,13),(2,10,1,14,15)),((3,4),(5,6,7,8,9)),12),(((37,(38,26)),39),28)),(40,27)),(((((35,(34,36)),33),(31,((23,32),30))),(25,29)),24)),22); END;