#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:17 GMT TreeBASE (cc) 1994-2008 Study reference: Damm U., Sato T., Alizadeh A., Groenewald J.Z., & Crous P.W. 2019. The Colletotrichum draecaenophilum, C. magnum and C. orchidearum species complexes. Studies in Mycology, 92: 1-46. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21984] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=103; TAXLABELS Colletotrichum_1_tropicicula_BCC38877 Colletotrichum_1_tropicicula_CBS_133174 'Colletotrichum brevisporum BCC_38876' 'Colletotrichum brevisporum CBS_129957' 'Colletotrichum brevisporum CBS_129958' 'Colletotrichum brevisporum CBS_512_75' 'Colletotrichum brevisporum MAFF_305751' Colletotrichum_brevisporum_MFLUCC100182 'Colletotrichum cacao CBS_119297' 'Colletotrichum cattleyicola CBS_170_49' 'Colletotrichum cattleyicola MAFF_238321' 'Colletotrichum cliviicola CBS_125375' 'Colletotrichum cliviicola CBS_133705' Colletotrichum_cliviicola_CSSS2 'Colletotrichum dracaenophilum CBS_118199' 'Colletotrichum dracaenophilum CBS_118200' 'Colletotrichum dracaenophilum CBS_119360' 'Colletotrichum dracaenophilum CBS_121453' 'Colletotrichum excelsum altitudinum_CGMCC_3_15130' 'Colletotrichum excelsum altitudinum_CGMCC_3_15131' 'Colletotrichum gloeosporioides CBS_112999' 'Colletotrichum hymenocallidicola CBS_135131' 'Colletotrichum hymenocallidicola CBS_136877' 'Colletotrichum hymenocallidicola CGMCC_3_14982' 'Colletotrichum hymenocallidicola CGMCC_3_14983' Colletotrichum_hymenocallidicola_CORCG3 Colletotrichum_hymenocallidicola_CORCX11 Colletotrichum_hymenocallidicola_CORCX6 'Colletotrichum hymenocallidicola MAFF_238499' 'Colletotrichum hymenocallidicola MAFF_238779' 'Colletotrichum hymenocallidicola MAFF_239931' 'Colletotrichum hymenocallidicola MAFF_240480' 'Colletotrichum hymenocallidicola MAFF_240504' 'Colletotrichum hymenocallidicola MAFF_306084' 'Colletotrichum hymenocallidicola MFLUCC_12_0531' 'Colletotrichum hymenocallidicola UTFC_262' 'Colletotrichum hymenocallidicola UTFC_265' 'Colletotrichum hymenocallidicola UTFC_266' 'Colletotrichum liaoningense 1_CAUOS2' 'Colletotrichum liaoningense 1_CAUOS6' 'Colletotrichum liaoningense 2_CAUOS3' 'Colletotrichum liaoningense 2_CAUOS4' 'Colletotrichum lobatum IMI_79736' 'Colletotrichum magnum CBS_519_97' 'Colletotrichum magnum CBS_575_97' 'Colletotrichum magnum IMI_391662' 'Colletotrichum merremiae CBS_124955' 'Colletotrichum musicola CBS_127557' 'Colletotrichum musicola CBS_132885' 'Colletotrichum okinawense MAFF_240517' 'Colletotrichum orchidearum CBS_132504' 'Colletotrichum orchidearum CBS_132515' 'Colletotrichum panamaense CBS_125386' 'Colletotrichum piperis IMI_71397' 'Colletotrichum plurivorum CBS_125473' 'Colletotrichum plurivorum CBS_125474' 'Colletotrichum plurivorum CBS_132443' 'Colletotrichum plurivorum CBS_132444' 'Colletotrichum plurivorum CBS_903_69' 'Colletotrichum plurivorum CGMCC_3_17358' 'Colletotrichum plurivorum CMM_3742' 'Colletotrichum plurivorum CMM_3746' Colletotrichum_plurivorum_CORCG2 Colletotrichum_plurivorum_CORCX9 Colletotrichum_plurivorum_LFN0008 Colletotrichum_plurivorum_LJTJ16 Colletotrichum_plurivorum_LJTJ22 Colletotrichum_plurivorum_LJTJ3 Colletotrichum_plurivorum_LJTJ30 'Colletotrichum plurivorum MAFF_238315' 'Colletotrichum plurivorum MAFF_238697' 'Colletotrichum plurivorum MAFF_238875' 'Colletotrichum plurivorum MAFF_243073' 'Colletotrichum plurivorum MAFF_305790' 'Colletotrichum plurivorum MAFF_305974' 'Colletotrichum plurivorum MAFF_306007' 'Colletotrichum plurivorum MAFF_306008' 'Colletotrichum plurivorum UTFC_260' 'Colletotrichum plurivorum UTFC_261' 'Colletotrichum sojae ATCC_11871' 'Colletotrichum sojae ATCC_62257' Colletotrichum_sojae_CAUOS5 'Colletotrichum sojae CBS_128510' 'Colletotrichum sojae CBS_134_87' 'Colletotrichum sojae CBS_181_81' 'Colletotrichum sojae CBS_182_81' 'Colletotrichum sojae CGMCC_3_15171' Colletotrichum_sojae_IL18A Colletotrichum_sojae_IL26A Colletotrichum_sojae_LFN0009 'Colletotrichum sojae SAUCC_1407' 'Colletotrichum sojae UTFC_288' 'Colletotrichum sojae UTFC_301' 'Colletotrichum sojae UTFC_303' Colletotrichum_sp_COUFAL7300 'Colletotrichum sp GZAAS5_09545' 'Colletotrichum tropicicula 1_CBS_127555' 'Colletotrichum tropicicula 2_MFLUCC100167' 'Colletotrichum vittalense CBS_126_25' 'Colletotrichum vittalense CBS_181_82' 'Colletotrichum vittalense GUFCC_15503' 'Colletotrichum yunnanense AS3_9616' 'Colletotrichum yunnanense CBS_132135' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46516] TITLE Colletotrichum; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2498; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Colletotrichum_1_tropicicula_BCC38877 AGGGATCATTA?T-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGGCGACG--CCGCCTCCCCGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGCCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAA-----??????????--------------CCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCGTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCTATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAA----TTGGTCGGC-AT-GGCGGGGCGCGGTCATTGATCATGGCCAAGCACAAGCAATC-A---CTACAGTCACTAACACGCT-CCTCTCCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------GTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTTGGTCCCGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCCCGCC------GCTGCGGC-AATTTTCCTCCCTCC-GCGCCGCCGCCGCCTAACATGTGAA-TAGTATCATGATTGGTATGGGCC-------------??????????----------------------------------------------------------------------------------------GG-TAACCAAATCGGTGCTGCTTTCTGGTACGTGAT-CAGA-CGCCGAGCAACCGGTGACGTCCATGCCTCGATGAACCCA-AT-GCTGACCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGA-TTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGG?GCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATACATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG Colletotrichum_1_tropicicula_CBS_133174 AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGGCGACG--CCGCCTCCCCGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGCCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCGTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCTATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAA----TTGGTCGGC-AT-GGCGGGGCGCGGTCATTGATCATGGCCAAGCACAAGCAATC-A---CTACAGTCA--------------------------------------------------??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-GTTGGCCGGTATGGGTGTGTACCAGGAAGGTATTGCCAAGCAGCAGGTCAACAGCAAGGATGTCACGGCCCACATTTACGAGTACACGACCCAGGTTGGAATGACGATCAAGAACGACGTCGTCAGCTTGGTCCCCAAGCAGCAGCCCGTGCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACTGTCGCTCTTCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGTCATTTCCGATCCGGTATGTTTCTAC---CTGCCAGTTTTCTGATGCGTCCCTC----AAGGTTCGTGAGATCGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGTCCTCGGCCATCGGTGCTCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTTGGTCCCGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCCCGCC------GCTGCGGC-AATTTTCCTCCCTCC-GCGCCGCCGCCGCCTAACATGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTGCACCTTCAGACCGGTCAGTGCGTAAGTCTCGTCTC-----AAACCCGACAGGCCGAGTGCGGGGCTAA-----CTTCATGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAT-CAGA-CGCCGAGCAACCGGTGACGTCCATGCCTCGATGAACCCA-AT-GCTGACCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGA-TTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATACATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum brevisporum BCC_38876' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-GCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAACC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACC--??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAA-T-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCG--??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum brevisporum CBS_129957' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGTTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATACAAT-CGAGC-CACGCTTCTATATC-CGACACC--TATTAACCCACACGACC--AGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum brevisporum CBS_129958' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGTTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATACAAT-CGAGC-CACGCTTCTATATC-CGACACC--TATTAACCCACACGACC--AGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum brevisporum CBS_512_75' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAACC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATACAAT-CGAGC-CACGCTTCTATATC-CGACATC--TATTAACCCACACGACC--AGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum brevisporum MAFF_305751' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGTTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-----------------------------TTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCTGTCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG Colletotrichum_brevisporum_MFLUCC100182 AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----GTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-C-TC--------------AATCGCGAACGTCAGCTCCTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGTTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGATTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum cacao CBS_119297' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCACTTTCTT--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AATTGCGAACGTCAGCTCCTCGCTGTCGATAAACTGCGAAA------TCAACC-AAGC--TCCAATGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGCACTTTGGTCGCTGACACGCC--ATCCACAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCGCT-TCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACGTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTTACCTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTTCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCTTTCCAGCGTCTGGTAAGATATGCCTC-TGAGA-CACGTTCCTGCGCA-CGACACA--TGCTAACCCACACAACC--AGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTTACACCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCTTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACACATGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAATGAACGTGGGGCTAA-----CTCCTACGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCGATAACTTGACGGTGGCATATAACTAAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGTAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTCAACTGCTAATGCTCGACCAACAGGTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTATGCTGATGTCCCCAAC-AGTGC-AGAGGAACATGTCGACAAATACTAACCTTGTAACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAACTCTTCCGCCCCGACAACTTCGTCTTCGCCCAATCCGG 'Colletotrichum cattleyicola CBS_170_49' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCAAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGCCA-AGC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAATCATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAACGTTACCCCGACGGTTGCAGATCACTGATAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATGGGTCCCTACTTTGGCAATGTCGGGAGTTGACCGCTGATTCCCGGCCAACAGTTACAACGGGACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum cattleyicola MAFF_238321' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATTCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGATAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATGGGTCCCTACTTTGGCAATGTCGGGAGTTGACCGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum cliviicola CBS_125375' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTATGTCA-AAC-TGTCACCACACGTTCCTGTCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGG-----------??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACATGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCCGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum cliviicola CBS_133705' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGATGCCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????------------CCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTATGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGG-----------??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACATGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCCGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_cliviicola_CSSS2 ---------------------------------ACCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAATAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????------------------------------------TGTG-G-------CC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACC--??????????----------------------------------------------------CGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACATGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCCGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum dracaenophilum CBS_118199' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCTTCGGCGGGCAGGCGGC---GACC--CCGCCTCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAAAGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTT-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------ATCGT-GGTATCACGCCCGCCACCCCCACCAC-CCACCCACCCACCTCCGATCGCCCGCACCTGGCCATCGAGGAGAGGTTGGAAGTCAATAACCA-AAGC-CTTTGTCTTGGAATGGCATTGACGAAAAAAAAAATGG-CGGGGAT-GACGGAATGTGGTC---AATCATGGCCAAAA-CACTCA-TCCAAGTCTGCAGTCACTGACA-ACT-CCTTCACAGGCCTACATG-CTCAAGTACAACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-TCTGGCCGGCATGGGGGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCTCACATTTACGAGTACACAACCCAAGTCGGAATGACGATCAAGAACGGCGTCGTCAGTTTGGTCCCAAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAAAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGCCCGCAAGAGCGCACCCTCCACTGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTGAGCTATCTCCATCTCGATGCGCCCC-ATACCCCGC-AGCTTGCTAACGCGCCC-TCCTCACAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCTATCGGTGCTCTCCAGGAGTCCGTCGAGTCCTACCTTGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTCGCCC-GTCAAGGGGTATCGAGATTTGCGGCTACGCATCACCAGAACACGTCGATGCTGACAGCTTCATAGCCTCCATTGTCGGTCGCCCCCGCCACCATGGGTATGTTTCCTGC-----GGCCCGA--AAATTT--TCCCTCGTCCG-CGCCGCCACCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTGCACCTTCAGACCGGCCAGTGCGTAAGTCTTTTCCCTT-CTTGACCCAACAGCCTGATTGCGGGGCTAA-----CTTCTTCAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAC-CAGA-TGCCGACGATCCGGCGACAGCGATGTCTCGATGAATCCAAAT-ACTGACTTTGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTCGACCCCTAATGTGACCACGTCGGGAGTTCACCGCTAAAT-TCCGCCAACAGTTACAACGGCACCTCCGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCA-ATAGCCCACAG-AGTGCAGGATAAACATATTGACAAGTACTGACCTTCGCTTCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum dracaenophilum CBS_118200' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCTTCGGCGGGCAGGCGGC---GACC--CCGCCTCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAAAGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTT-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------ATCGT-GGTATCACGCCCGCCACCCCCACCAC-CCACCCACCCACCTCCGATCGCCCGCACCTGGCCATCGAGGAGAGGTTGGAAGTCAATAACCA-AAGC-CTTTGTCTTGGAATGGCATTGACGAAAAAAAAAATGG-CGGGGAT-GACGGAATGTGGTC---AATCATGGCCAAAA-CACTCA-TCCAAGTCTGCAGTCACTGACA-ACT-CCTTCACAGGCCTACATG-CTCAAGTACAACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-TCTGGCCGGCATGGGGGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCTCACATTTACGAGTACACAACCCAAGTCGGAATGACGATCAAGAACGGCGTCGTCAGTTTGGTCCCAAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAAAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGCCCGCAAGAGCGCACCCTCCACTGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTGAGCTATCTCCATCTCGATGCGCCCC-ATACCCCGC-AGCTTGCTAACGCGCCC-TCCTCACAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCTATCGGTGCTCTCCAGGAGTCCGTCGAGTCCTACCTTGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTCGCCC-GTCAGGGGGTATCGAGATTTGCGGCTACGCATCACCAGAACACGTCGATGCTGACAGCTTCATAGCCTCCATTGTCGGTCGCCCCCGCCACCATGGGTATGTTTCCTAC-----GGCCCGA--AAATTT--TCCCTCGTCCG-CGCCGCCACCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGTCAGTGCGTAAGTCTTTTCCCTT-CTTGACCCAACAGCCTGATTGCGGGGCTAA-----CTTCTTCAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAC-CAGA-TGCCGACGATCCGGCGACAGCGATGTCTCGATGAATCCAAAT-ACTGACTTTGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTCGACCCCTAATGTGACCACGTCGGGAGTTCACCGCTAAAT-TCCGCCAACAGTTACAACGGCACCTCCGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCA-ATAGCCCACAG-AGTGCAGGATAAACATATTGACAAGTACTGACCTTCGCTTCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum dracaenophilum CBS_119360' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCTTCGGCGGGCAGGCGGC---GACC--CCGCCTCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAAAGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTT-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------ATCGT-GGTATCACGCCCGCCACCCCCACCAC-CCACCCACCCACCTCCGATCGCCCGCACCTGGCCATCGAGGAGAGGTTGGAAGTCAATAACCA-AAGC-CTTTGTCTTGGAATGGCATTGACGAAAAAAAAAATGG-CGGGGAT-GACGGAATGTGGTC---AATCATGGCCAAAA-CACTCA-TCCAAGTCTGCAGTCACTGACA-ACT-CCTTCACAGGCCTACATG-CTCAAGTACAACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-TCTGGCCGGCATGGGGGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCTCACATTTACGAGTACACAACCCAAGTCGGAATGACGATCAAGAACGGCGTCGTCAGTTTGGTCCCAAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAAAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGCCCGCAAGAGCGCACCCTCCACTGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTGAGCTATCTCCATCTCGATGCGCCCC-ATACCCCGC-AGCTTGCTAACGCGCCC-TCCTCACAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCTATCGGTGCTCTCCAGGAGTCCGTCGAGTCCTACCTTGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTCGCCC-GTCAAGGGGTATCGAGATTTGCGGCTACGCATCACCAGAACACGTCGATGCTGACAGCTTCATAGCCTCCATTGTCGGTCGCCCCCGCCACCATGGGTATGTTTCCTAC-----GGCCCGA--AAATTT--TCCCTCGTCCG-CGCCGCCACCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTGCACCTTCAGACCGGTCAGTGCGTAAGTCTTTTCCCTT-CTTGACCCAACAGCCTGATTGCGGGGCTAA-----CTTCTTCAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAC-CAGA-TGCCGACGATCCGGCGACAGCGATGTCTCGATGAATCCAAAT-ACTGACTTTGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTCGACCCCTAATGTGACCACGTCGGGAGTTCACCGCTAAAT-TCCGCCAACAGTTACAACGGCACCTCCGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCA-ATAGCCCACAG-AGTGCAGGATAAACATATTGACAAGTACTGACCTTCGCTTCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum dracaenophilum CBS_121453' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCTTCGGCGGGCAGGCGGC---GACC--CCGCCTCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAAAGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTT-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------ATCGT-GGTATCACGCCCGCCACCCCCACCAC-CCACCCACCCACCTCCGATCGCCCGCACCTGGCCATCGAGGAGAGGTTGGAAGTCAATAACCA-AAGC-CTTTGTCTTGGAATGGCATTGACGAAAAAAAAAATGG-CGGGGAT-GACGGAATGTGGTC---AATCATGGCCAAAA-CACTCA-TCCAAGTCTGCAGTCACTGACA-ACT-CCTTCACAGGCCTACATG-CTCAAGTACAACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-TCTGGCCGGCATGGGGGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCTCACATTTACGAGTACACAACCCAAGTCGGAATGACGATCAAGAACGGCGTCGTCAGTTTGGTCCCAAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAAAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGCCCGCAAGAGCGCACCCTCCACTGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTGAGCTATCTCCATCTCGATGTGCCCC-ATACCCCGC-AGCTTGCTAACGCGCCC-TCCTCACAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCTATCGGTGCTCTCCAGGAGTCCGTCGAGTCCTACCTTGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTCGCCC-GTCAGGGGGTATCGAGATTTGCGGCTACGCATCACCAGAACACGTTGATGCTGACAGCTTCATAGCCTCCATTGTCGGTCGCCCCCGCCACCATGGGTATGTTTCCTAC-----GGCCCGA--AAATTT--TCCCTCGTCCG-CGCCGCCACCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTGCACCTTCAGACCGGTCAGTGCGTAAGTCTTTTCCCTT-CTTGACCCAACAGCCTGATTGCGGGGCTAA-----CTTCTTCAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAC-CAGA-TGCCGACGATCCGGCGACAGCGATGTCTCGATGAATCCAAAT-ACTGACTTTGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTCGACCCCTAATGTGACCACGTCGGGAGTTCACCGCTAAAT-TCCGCCAACAGTTACAACGGCACCTCCGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCA-ATAGCCCACAG-AGTGCAGGATAAACATATTGACAAGTACTGACCTTCGCTTCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum excelsum altitudinum_CGMCC_3_15130' -----------------------GCTC--TAT-ACCCTTTGTG-ACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGTCGCCG--CCGCCTCCCGGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAA-----??????????-------------------------ACCAAGTACGCTGTGAGTATCACCCC-ACCTTACCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCCTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCAATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAAA---TTGGTCGAC-AT-GGCGGGGCGCGGTCATTGACCATGGCCAAGCTCAAGCAATC-ACTTCTACAGTCACTAACACGCT-CCTCTCCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------GATGCGCCCAGAGCTGTCTTCCGTAAGTTGGTCCCGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCCCGCC------GCTGCGGC-AATTTTCCTCCCTCC-GCGCCGCCGCCGCCTAACATGTGAA-TAGTATCATGATTGGTATGGGCC-------------??????????------------------------GTAAGTCTCGTCTC-----AAACCCGACAGGCCGAGTGCGGGGCTAA-----CTTCAAGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAT-CAGA-CGCCGAGCAGCCGGTGACGTCTATGCCTCGATGAACCCA-AT-GCTGACCACGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGAGTTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGGAGCTCCAGCTTGAGCGCATGAGCGTCTATTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATATATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum excelsum altitudinum_CGMCC_3_15131' ----------------------CGCTC--TAT-ACCCTTTGTG-ACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGTCGCCG--CCGCCTCCCGGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGTTGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------ACCAAGTACGCTGTGAGTATCACCCC-ACCTTACCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCCTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCAATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAAA---TTGGTCGAC-AT-GGCGGGGCGCGGTCATTGACCATGGCCAAGCTCAAGCAATC-ACTTCTACAGTCACTAACACGCT-CCTCTCCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------GATGCGCCCAGAGCTGTCTTCCGTAAGTTGGTCCCGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCCCGCC------GCTGCGGC-AATTTTCCTCCCTCC-GCGCCGCCGCCGCCTAACATGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTAAGTCTCGTCTC-----AAACCCGACAGGCCGAGTGCGGGGCTAA-----CTTCATGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAT-CAGA-CGCCGAGCAGCCGGTGACGTCTATGCCTCGATGAACCCA-AT-GCTGACCACGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGAGTTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGGAGCTCCAGCTTGAGCGCATGAGCGTCTATTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATATATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum gloeosporioides CBS_112999' AGGGATCATTACT-GAGTTTA-CGCTC--TACAACCCTTTGTGAACATACCTACAACTGTTGCTTCGGCGGGTAG--GGTCTCCGCG--AC-CCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGCCGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTTTA-CGTCTCGCA-CTGGGAT-CCGGAGGGACT--CTTGCCGTAAAA-CCCCCCAA-TTTTCCAAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------AACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCT-ACCCCTCCAAGCTC--------GACAT-GACTTCACATCCATCGCCACCACTA--CCG-----CTGTCAT-------CCGCATTTCGCCGCC-------CGCGGTTAGT-ACACAAGAAGGCCATCATGAATT-AATGCCAATTGA--AATCA----TGGGTCGGG-ACGGCCGGACACATGCTATC-ACTCATGTCAG----CCCCA-TC---TGTCACATTTACTGACTCGCT-CTTT-ACAGGCCTACATG-CTCAAGTACGACTCC-----??????????----------GATGCTTGGAAGAAGATTGTCGTCTGTGTCGTCAGCGACGGTCGTGCCAAGATCAACCCGCGAACAAGAGCACT-GCTGGCCGGTATGGGTGTGTACCAGGAGGGTATCGCGAAGCAACAGGTCAACAGCAAGGATGTCACCGCCCACATTTACGAATACACGACCCAGGTCGGCATGACCATCAAGAACGACGTTGTCTCCTTGGTTCCTAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGAT----------??????????---------------CAAGGCTCCCCGCAAGCAGCTTGCTTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACTGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGT-ATGTGCCA-----TGCACCGGCTTC---ACACAGCAAGGTAACTAACCAACACC--TTCCCAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTGTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCA--------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTG-CTCCCATCCGCAGACCGCAATC-CGCCTCTTCAGGGGGAACTCAGATTTGCGGTCATCAGTCGGCGTGTGCTGTCGATGCTGACCACCACGTAGCCTCCATCGTCGGTCGCCCTCGCCACCATGGGTATGTCTGCTTCTCGCCCTCGCTGCGGTAATTTCCGCCG--TCCG-CGCCGCGATCTAACATGTGAATCAGTATCATGATTGGTATGGGCCA------------??????????-----------------------CGTAAGT--CTTCCTAAGCCAAATCCAACCGCCTGATTGCGGGGCTAA----CCTCCTTGTACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAC-GAGACCGCCGACGACCCGGCAATATCATACTTGCGAGGACGGCAGATG-TTGACGATGGAATAGGCAAAACATTTCTGGCGAGCACGGCCTAGACAGCAATGGAGTGTATGTCAT-GCCCCTTA-TCTGTCCACATTGGTGGTTGACCGCTAAAC-TCG---AACAGCTACAACGGCACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTACCTT-ATAGCCCCAAG-AGTGCAAGATAAACATATTGACGAGTACTGACCTTCGCTCCTACCCAGGCTTCCGGCAACAAGTACGTGCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAAC-------------------- 'Colletotrichum hymenocallidicola CBS_135131' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-----GCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCATAACAAGATCAACTCTCACAGATGGTTCTTC--??????????-----CCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTGATCCGCAAGCTACCCTTCCAGCGCCTGGTAAGTCA-AGCTTGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola CBS_136877' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----GTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-----GCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCATAA------------------------------??????????----TCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTGATCCGCAAGCTACCCTTCCAGCGCCTGGTAAGTCA-AGCTTGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCA----??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola CGMCC_3_14982' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAA-----??????????--------------CCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------GTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCC------------------------------------------------??????????------------------------GTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATTGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCC-------------------------- 'Colletotrichum hymenocallidicola CGMCC_3_14983' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------AACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????-----------------------CGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATTGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_hymenocallidicola_CORCG3 ----------------------------------CCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------------------------------------------------GCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-----------------------------------------------------GCGCCACGATCAGCCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_hymenocallidicola_CORCX11 ----------------------------------CCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------------------------------------------------GCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-----------------------------------------------------GCGCCACGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_hymenocallidicola_CORCX6 ----------------------------------CCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------------------------------------------------GCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-----------------------------------------------------GCGCCACGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_238499' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_238779' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_239931' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_240480' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_240504' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MAFF_306084' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola MFLUCC_12_0531' -------ATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGATGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAA-----??????????--------------------------------------------GCACCCC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????--GGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAATATACGTCTCAGGTCGGAATGCAGATCAAGAATGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTT------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Colletotrichum hymenocallidicola UTFC_262' ------------------------------------------------------------------------------------------------CC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-----------------------------------CTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????---------------------------------------------------------CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola UTFC_265' ------------------------------ATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------GCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------------------------------------------------GCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum hymenocallidicola UTFC_266' -------------------------------------TTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACCCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CACCCCACTTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-----------------------------------CTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------------------------------------------------------CAGACCGCAATCTCGCCCCGTCAGGGG-CATCGAGATTTGCGGCCAGCTTCCGACCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTTC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATCGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum liaoningense 1_CAUOS2' AGGGATCATTATA-GAG-TTACCGCTCTTTATAACCCTTTGTGAACATACCTCAAAC-GTTGTCTCGGCGGGCAGCGGGAGCCCA-TCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTATATTGCAAAGATGTCTTTTGTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTGTGGCATAGATGAAGAACGCAGAGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATAGAATCTTTGAACGCACATTGCGCCCGCCAGCATTGTGGCGGGCACGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGGGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-CCCACCTCGCA-GGGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTA-----------------------------------------------??????????-GCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTCGCCACGATGCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TTCAGTGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATAACAT------------GCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-TGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGTGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTTGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------CGGTTTCTCCGGTGACGATGCGCCCAGAGCTGTCTTCTGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCACGTCAGGGGGCATCGAGGTTTGCGGCCGGCTTCCGCTCGCACACATAGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAAAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACT------------------- 'Colletotrichum liaoningense 1_CAUOS6' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-TGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTTGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------CGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCACGTCAGGGGGCATCGAGGTTTGCGGCCGGCTTCCGCTCGCACACATAGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACT------------------- 'Colletotrichum liaoningense 2_CAUOS3' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTA-----------------------------------------------??????????-GCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-ACTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGTCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---AAGTAACAT------------GCAAAGAACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-TGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACT------------------- 'Colletotrichum liaoningense 2_CAUOS4' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTA-----------------------------------------------??????????-GCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-ACTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGTCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---AAGTAACAT------------GCAAAGAACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-TGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------CGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTT----GCCGCGGCAATTTCTCGCG--TCT------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACT------------------- 'Colletotrichum lobatum IMI_79736' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------GGTCGCGAACGTCAGCT-CCAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTAGTGGGGTT---GAATAACAT------------GCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGA-GCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGACGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGGGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATACAAT-CGAGC-CACGCTTCTATATC-CGACACC--TATTAACCCACACGACC--AGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAATTTGACGGCCTCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGGAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum magnum CBS_519_97' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAACCCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AATC--TTCAGTGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATAACAT------------GCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCTTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATGCAAT-CGAGC-CACGCTTCTGCATC-TGACACC--TGTTAACCCACATGACT--AGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTGCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTT----GCCGCGGCAATTTCTCGCGTCT--------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCTGG 'Colletotrichum magnum CBS_575_97' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAACCCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AATC--TTCAGTGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATAACAT------------GCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCTTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATGCAAT-CGAGC-CACGCTTCTGCATC-TGACACC--TGTTAACCCACATGACT--AGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTGCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTT----GCCGCGGCAATTTCTCGCGTCT--------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum magnum IMI_391662' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAACCCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AATC--TTCAGTGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATAACAT------------GCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCTTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATGCAAT-CGAGC-CACGCTTCTGCATC-TGACACC--TGTTAACCCACATGACT--AGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTGCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTT----GCCGCGGCAATTTCTCGCGTCT--------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGAAGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTATCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAACCTTCTTAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum merremiae CBS_124955' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCATCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCTCCTGGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CAATATCAT------------CCAAAGGACTATGGTCGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCGCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCTGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCCATACAAT-CGAGC-CACGCTTCTACATC-CGACACC--TATTAACCCACACGACC--AGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTGTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGACGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTAGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTGATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum musicola CBS_127557' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGTGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACACCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGACC--GGCGCGGCGGGGTC---GATCATAACT-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACTTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCTCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTCA-AGCTTGTCACCACACGTTCCTACCTA-TGACGCGGCGGCTAACATGCACACCC--AGGTCCGTGAAATCGCCCAGGATTTCAAGTCCGACCTCCGTTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTTCCGCCTGCAGACCGCAATCTCGCCC-GTCAGGG--CATCGAGATTTGCGGCCAGCTTCCGTCCGCACACGTAGATGCTGACAGCTTCTTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGCTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCCATGTCGGGAGTTGACGGCTAATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGTAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum musicola CBS_132885' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCGGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGTGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACACCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGACC--GGCGCGGCGGGGTC---GATCATAACT-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACTTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCTCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTCA-AGCTTGTCACCACACGTTCCTACCTA-TGACGCGGCGGCTAACATGCACACCC--AGGTCCGTGAAATCGCCCAGGATTTCAAGTCCGACCTCCGTTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTTCCGCCTGCAGACCGCAATCTCGCCC-GTCAGGG--CATCGAGATTTGCGGCCAGCTTCCGTCCGCACACGTAGATGCTGACAGCTTCTTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAAGTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGCTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCCATGTCGGGAGTTGACGGCTAATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-AGTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGTAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum okinawense MAFF_240517' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AGTCGCGAACGTCAGCT-CTAGCTGTCGATAAAATGCGAAA------TCAATC-AAGC--TCCAATGCCGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATAACAT------------GCAAAGGACTACGGTCGCTGACACGTC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCCGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACTTGGATGCTGACAGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACAAATGGG-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCATCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACATATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGACGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTCACATGGTAACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum orchidearum CBS_132504' AGGGATCATTACT-GAG-TTACCGCTCTCTATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGGCGACG--CCGCCTCCCCGGCGCCC---TCGCGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCATAAGCAAAAATAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGCCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAC-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAATTCATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCCCACCTTATCCCTCCAAGCTC--------ACCAT-GATATCTCGCCCGCCGTCCCCACCAT-----CTGCCCACCACCAACCGCCACCACCTGGCC-CCGAGAACAGGCCTGAAGTCGATGAATAAAAGC-TCTTGCTTTGGAA-GACATTGACGAAAAA----TTGTTCGGGGATGGGCGGGGCGCGGTC---AATTACGGCCAAGCACAAGCAATC-AAGTTCGCAGTCGCTAACACGCC-ATTCCACAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-GCTGGCCGGTATGGGTGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGATGTTACAGCCCACATTTACGAGTACACGTCCCAGGTCGGAATGACGATCAAGAACGACGTCGTCAGCTTGGTTCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTCCTTCCCGATTTAGTGCGCTTCTACA--CTGC-AGCCTTTTAACGCGCCC-TC---GAAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCGGCCATCGGTGCTCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTTCCCT-GTCAGGGGTTGTCGAGATTTGCAGTCACCCATCGCCAGCCAACATCGATGCTGACAGCCTCGTAGCTTCTATTGTCGGTCGCCCTCGCCACCATGGGTATGTCCCGCC------GCTGCGGC-AATCTTCCTCCCTCC-CCGCCGCCGCCGCCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTAAGTTTCTCCTCGC-CTCAACCCGGCAGCCTGAGTGCGGGGCTAA-----CTTCCTGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAT-CAGA-CACCAAGCAGCCGGCGACGTCCATACCTCGATGAATCCGAAT-ACTGATCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGAGTTCACCGCTAACT-TCCGCCAACAGGTACAACGGCACCTCCGAGCTTCAGCTGGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATG--CCCCAG-AGTGCAGGACGAGCATGTTGATGAATACTAACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCTGGACCTTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum orchidearum CBS_132515' AGGGATCATTACT-GAG-TTACCGCTCTCTATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGGCGACG--CCGCCTCCCCGGCGCCC---TCGCGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCATAAGCAAAAATAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGCGTTGGGGCCCTACGGCCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAC-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAATTCATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCCCACCTTATCCCTCCAAGCTC--------ACCAT-GATATCTCGCCCGCCGTCCCCACCAT-----CTGCCCACCACCAACCGCCACCACCTGGCC-CCGAGAACAGGCCTGAAGTCGATGAATAAAAGC-TCTTGCTTTGGAA-GACATTGACGAAAAA----TTGTTCGGGGATGGGCGGGGCGCGGTC---AATTACGGCCAAGCACAAGCAATC-AAGTTCGCAGTCGCTAACACGCC-ATTCCACAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-GCTGGCCGGTATGGGTGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGATGTTACAGCCCACATTTACGAGTACACGTCCCAGGTCGGAATGACGATCAAGAACGACGTCGTCAGCTTGGTTCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTCCTTCCCGATTTAGTGCGCTTCTACA--CTGC-AGCCTTTTAACGCGCCC-TC---GAAGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCGGCCATCGGTGCTCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCTGCAGACCGCAATCTTCCCT-GTCAGGGGTTGTCGAGATTTGCAGTCACCCATCGCCAGCCAACATCGATGCTGACAGCCTCGTAGCTTCTATTGTCGGTCGCCCTCGCCACCATGGGTATGTCCCGCC------GCTGCGGC-AATCTTCCTCCCTCC-CCGCCGCCGCCGCCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTAAGTTTCTCCTCGC-CTCAACCCGGCAGCCTGAGTGCGGGGCTAA-----CTTCCTGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTAAT-CAGA-CACCAAGCAGCCGGCGACGTCCATACCTCGATGAATCCGAAT-ACTGATCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGAGTTCACCGCTAACT-TCCGCCAACAGGTACAACGGCACCTCCGAGCTTCAGCTGGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATG--CCCCAG-AGTGCAGGACGAGCATGTTGATGAATACTAACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCTGGACCTTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum panamaense CBS_125386' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTCCTCGGCGCGCCCC-ACCCGCCGGTGGACCACTAAACTCTATTCCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-ACTC--------------AGTCGCGAACGTCAGCTCCTAGCTGTCGATGAAATGCGAAA------TCAATC-AAGC--TCCAATGCTATGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---GAATATCAT------------CCAAAGGATTGTGGACGCTGACACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCTCACATTTACGAGTACACTTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACTGTCGCTCTTCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCGTTCCAGCGTCTGGTAAGCCATGCAAT-CGAGG-CACGCTTCTGCATC-CGACACC--TGTTAACCCACATGACC--AGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTGCAGGAGTCCGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGTGCCATTCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGTAGACCGCAATCTCGTCCCGTCAGGGGGCATCGAGATTTGCGGCCGGCTTCCGCTCGCACACCTGGATGCTGACTTTTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCGATTTCTCGCGTCTCC------GTCGCCTCCTAACAAATGGA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTCTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATAACTTGACGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGCAATGGCGTGTACGCGACAGGTCCCTAATCCGGCAATGTCGGGAGTTGGCCGCTAATTCTCGACCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAATCACTAACATGGTAATCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum piperis IMI_71397' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCC-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTCCAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCC-ACTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGGACCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGTCGATTAAACGCCAAAA-----TCAATC-AGGC--TCCCATACCGTGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTA-GGTTGCTGATACGCC--ATCCTCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTTACGGCACACATTTACGAGTATACGTCCCAGGTCGGAATGCAGATCAAGAACGATGTCGTCACCTTGGTCCCCAAGCAGCAGCCTGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTTGTGGCAAGGCCCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCTCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTGA-AGC-TGTCACCACACGCTCCTGCCTA-TGACGCGGCAGCTAACCCACACAAAC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAAGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAATCATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGCATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGTGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGGTACCCCGATGGTTGCAGATCACTGAGAATTTATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTAATTTGGCAATGTCGAGAGTTGACCGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGGTGTCCCCAAC-AGTCCAAGATGAACCTGTTGGCGAATACTGACCTCGCCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CBS_125473' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAATTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTATCCCAAGCACATGGAATGAACGCGAGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CBS_125474' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTTTCTCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGTGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CBS_132443' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTTGTCTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTTTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CBS_132444' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTTTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CBS_903_69' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------CATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTTTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CGMCC_3_17358' ---------------------------------ACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-GCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCTGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CMM_3742' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCTA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------ACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????----GGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????T-TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTCTAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????--------------------------------------------------------------------------------------------AACCAAATCGGTGCTGCTTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum CMM_3746' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCTA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTT-CC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------ACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGT-CGACTCCACCC-??????????----GGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????T-TGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTCTAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????--------------------------------------------------------------------------------------------AACCAAATCGGTGCTGCTTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_CORCG2 ----------------------------------CCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAATAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------------------------------CC-----------TCT-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-----------------------------------------------------GCGCCACGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGTGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGACGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_CORCX9 ----------------------------------CCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAATTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------------------------------CC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-----------------------------------------------------GCGCCACGATCACCCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------TGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTATCCCAAGCACATGGAATGAACGCGAGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_LFN0008 AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAG-------------------??????????--CCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCC-----??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------CTCCCCGCAAGCAGCTTGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCACACGTTCCTGCCTA-TGACGCGGCAGCTAACATGCATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTTTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGG-----------??????????---------CGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????------------------------------------------------------------------------------------------------------GTGCTGCTTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCC-------------------------- Colletotrichum_plurivorum_LJTJ16 --------------------ACCGCTCCTTAT-ACCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------TGAGTAGCACCCC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------GCTGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????------------------------------------------------------------------------------------------------------------------------------------------ATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAACGGCGTGTACGTGATAGGTCCCTACTTCGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_LJTJ22 --------------------TCCGCTCCTTATAACCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------------C-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------GCTGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????------------------------------------------------------------------------------------------------------------------------------------------ATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_LJTJ3 --------------------A-CGCTCCTTAT-ACCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------TGAGTAGCA-CCC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGT-------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------------------------------------------------CGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????------------------------------------------------------------------------------------------------------------------------------------------ATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_plurivorum_LJTJ30 ---------------------CCGCTCCTTAT-ACCCTTTGTG-ACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------TGAGTAGCACCCC-----------TCC-AGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------GCTGTCTTCCGT-AGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????------------------------------------------------------------------------------------------------------------------------------------------ATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_238315' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAACGGCGTGTACGTGATAGGTCCCTACTTCGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATATTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_238697' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGGT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCTGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_238875' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACCACGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAACGGCGTGTACGTGATAGGTCCCTACTTCGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATATTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_243073' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????------------------------------GTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCT--------------------------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------GCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGT--------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAACGGCGTGTACGTGATAGGTCCCTACTTCGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATATTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_305790' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-----------------------------TTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCTCCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAACGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCCGCATTGCCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_305974' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAACGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCCGCATTGCCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_306007' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCCG-GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????----------------------------GTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGGGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTCCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGAT------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAACGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCCGCATTGCCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum MAFF_306008' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACCACGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTAC-----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCA------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAACGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCCGCATTGCCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum UTFC_260' --------------------------CCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------TGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACG----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------GCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTATCCCAAGCACATGGAATGAACGCGAGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum plurivorum UTFC_261' --------------------------CCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGTCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACCAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------------------------------GCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CGTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCACAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------GCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGTCACCATGGGTACGTCTCCTC------GCCGCGGCTAATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATGGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCATTGCCTCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATGTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACCTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTCATCCTGATGTCTCCAAC-ACTTCAAGATGAACCTGTTGACGAATACTGACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae ATCC_11871' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCACAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae ATCC_62257' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_sojae_CAUOS5 AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTT-C----------------------------------------------??????????--CCGTCAACGACCCCTTCATTGAGACAAGGTTCGCTGTGAGTAGCACCCC-----------TCCA-GCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-TGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACT------------------- 'Colletotrichum sojae CBS_128510' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCACAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae CBS_134_87' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae CBS_181_81' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae CBS_182_81' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae CGMCC_3_15171' ----------------------CGCT-CTTAT-ACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAATAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------------------ACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGCAGATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCC-??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------GATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_sojae_IL18A AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------GACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACG----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------TGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACATGTTTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAG------------??????????---------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????-----------------------CGTACGTTTCTTCCCTACCCCAAGCATATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCC-------------------------- Colletotrichum_sojae_IL26A AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------GACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACG----------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------TGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGCCACCACACGTGTCTGCCTA-TGACGCGGCAGCTAACATGCACAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATCCAGTCCAAG------------??????????---------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????-----------------------CGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTAACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCC-------------------------- Colletotrichum_sojae_LFN0009 AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGTGCGCCCC-ACCCGCCGGAGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAG-------------------??????????-------------------------ACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAA---------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------CTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACTGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGTCA-AG-ATGTCACCACACGTTTCTGCCTA-TGACGCGGCAGCTAACATACGCAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGCGTTACCATC---------------------??????????---------GGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTT-CCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAAATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????----------------------------------------------------------------------------------------------------------------CTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAAC-AGTTCAAGATGAATCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCT---------------------------------- 'Colletotrichum sojae SAUCC_1407' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------------------------------GCTGTGAGTAGCACCCC-----------TCCA-GCTC--------GCCGCAGATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCC??????????----GGCAAGGATGCTTGGAAGAAGATTGTCGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGTATGGGTGTGTACCAAGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACCGCGCACATTTACGAGTATACGTCTCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCCTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAAAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------------------------------------GT-AGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAGGGACTCGTA??????????-----------------------------------------------------------------------------------------------------GGTGCTGCTTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae UTFC_288' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------------------------------GCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------CCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCATATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTG-CCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae UTFC_301' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------------------------------GCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------CCCAGAGCTGTCTTCCGTAAGT-C-TCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum sojae UTFC_303' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????----------------------------------GCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATCGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAATC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GAACATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????----------------------------------------------------------------------------------GCCCCGTCAGGGGGCATCGAGATTTGCGGCTAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTGATTATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-CAGTATCATGATTGGTATGGGCCAG-----------??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAGTGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGAAAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGATAGGTCCCTACTTTCGCAATGTCGGGAGTTGACCGCTGATTTCCGG-CAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTCATGTCTCCAACAAGTTCAAGATGAACCTATTGACGAATACTGACCTCGGCACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACCTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG Colletotrichum_sp_COUFAL7300 AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTCCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAACCCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGTACCCC-----------TCCAAGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AA-CGCGAACGTCAGCTCCTTGCTGTCGATAAAATGCGGAA------TCAATC-AAGC--TACAATGCTGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CATTGTCAT------------CCAAAGGATTATGGCCGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAA---------------??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCCCT-TCTCGCCGGTATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACAGCGCACATTTACGAGTACACATCCCAGGTCGGAATGCAGATCAAGA-------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------GCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGTCCCGTCAGGGGACATTGGGATTTGCGGCCTGCTGCCGCTCGCACACTTGGATGCTGACGGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACACATGGA-CAGTATCATGATTGGTATGGGCC-------------??????????-------------------------------------------------------------------------------------------------------TGCTGCTTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATCATTTGACGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGTAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTTGGGAGTTGGCCGCTAATTCTCGACCAACAGGTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAGTCACTGACATGGTAACCTTCTCAGGCCTCCGGCAACAAGTATGTCCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCC----------------------------------------------- 'Colletotrichum sp GZAAS5_09545' ---------------------------------ACCCTTTGTG-ACATACCTCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCTCCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTGCAACGACGTCTCTTCTGAGTGGTACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAACCCCCCCAATTTATC--AAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????------------------------------------TGTGAGTAGTACC-C-----------TCC-AGCTC--------GCCAC-GATGCCACGCCCGCCACC-CCTC--------------AA-CGCGAACGTCAGCTCCTTGCTGTCGATAAAATGCGGAA------TCAATC-AAGC--TACAATGCTGTGAGCGATTGA---------------TGGGGTC--GGCGTGGTGGGGTT---CATTGTCAT------------CCAAAGGATTATGGCCGCTGATACGCC--ATCCGCAGGCCTACATG-CTCAAGT-------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------GT-CTTCCCGCCTGCAGACCGCAATCTCGTCCCGTCAGGGGACATTGGGATTTGCGGCCTGCTGCCGCTCGCACACTTGGATGCTGACGGCTTCGCAGCCTCCATTGTTGGTCGCCCTCGCCACCATGGGTATGTTTCCTCTC----GCCGCGGCAATTTCTCGCGTTTCC------GTCGCCTCCTAACACATGGA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTT-CCTA-CCCAAACACATGGAACGAACGTGGGGCTAA-----CTCCTTCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTGC-G-GAACGTCGGCGACCCGGCGCTAGCTATCATTTGACGGTCGCAGATAACTGAGGATTCATTAGGCAAAACATCTCTGGCGAGCACGGTCTCGACAGTAATGGCGTGTACGCGACAGGTCCCTAATCTGGCAATGTTGGGAGTTGGCCGCTAATTCTCGACCAACAGGTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGCGTTTACTTCAACGAGGTGTGTTGTGCTGATGTCCCCAAC-AGTGC-AGAGTAACATGTCGACAGTCACTGACATGGTAACCTTCTCAGGCCTCCGGCAACAAGTATGTCCCCCGCGCTGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGCGCTGGTCCCTTTGGCCAACTCTTCCGCCCCGACAACTTCGTCTTTGGCCAATCCGG 'Colletotrichum tropicicula 1_CBS_127555' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGGCGACG--CCGCCTCCCCGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGCCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATAACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTGCCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCGTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCTATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAA----TTGGTCGGC-AT-GGCGGGGCGCGGTCATTGATCATGGCCAAGCACAAGCAATC-A---CTACAGTCA--------------------------------------------------??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGATGGTCGTGCCAAGATCAACCCGAGAACAAGAGCTCT-GTTGGCCGGTATGGGTGTGTACCAGGAAGGTATTGCCAAGCAGCAGGTCAACAGCAAGGATGTCACGGCCCACATTTACGAGTACACGACCCAGGTTGGAATGACGATCAAGAACGACGTCGTCAGCTTGGTCCCCAAGCAGCAGCCCGTGCAGATGCTGTTCTGCCTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACTGTCGCTCTTCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGTCATTTCCGATCCGGTATGTTTCTAC---CTGCCAGTTTTCTGATGCGTCCCTC----AAGGTTCGTGAGATCGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGTCCTCGGCCATCGGTGCTCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGCGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTTGGTCCCGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTACGTCCCGCC------GCTGCGGC-AATTTTCCTCCCTCC-GCGCCGCCGCCGCCTAACATGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTGCACCTTCAGACCGGTCAGTGCGTAAGTCTCGTCTC-----AAACCCGACAGGCCGAGTGCGGGGCTAA-----CTTCATGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAT-CAGA-CGCCGAGCAACCGGTGACGTCCATGCCTCGATGAACCCA-AT-GCTGACCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGA-TTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATACATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAATCCGG 'Colletotrichum tropicicula 2_MFLUCC100167' ------CATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTC-AACTGTTGCCTCGGCGGGCAGGCGGCGTCGCCG--CCGCCTCTCCGGCGCCCC--TCGGGGCGCGCCC------GCCGGGGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAAGC-AATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGTCGACGTAGGCCCCCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTACCACCTCGCA-CTGGGAT-CCGGAGGGACTCTCCTGCCGTAAAA-CCCCCCAAAACATGACAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACCTTACCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCGTCTCGTCCCCACCAACCGCCCACCTCCAAGCGCCAACACCTGGCCGTTGAGAACAGGCTGGAGGTCAATGAACAGAAGC-TCCTGCT-TGCTGACCCATTGACGAAAAA----TTGGTCGGC-AT-GGCGGGGCGCGGTCATTGATCATGGCCAAGCACAAGCAATC-A---CTACAGTCACTAACACGCT-CCTTCCCAGGCCTACATG-CTCAAGT-------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????--------------------------------------------------------------CGCCCGCAGACCGCAATCTTGACC-TTCAGGGGTTATCGAGATTTGCGGCCGCCCATCGCCGGAACACGTCGATGCTGACGGCCCCGTAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCCCGCC------GCTGCGGC-AATTTTCCTCTCTCC-GCGCCGCCGCCGCCTAACACGTGAA-TAGTATCATGATTGGTATGGGCCAGA----------??????????GTTCACCTTCAGACCGGCCAGTGCGTAAGTCTCGTCTC-----GAACCCGACAGGCCGAGTGCGGGGCTAA-----CTTCATGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTGAT-CAGA-CGCCGAGCAGCCGGTGACGTTCATGCCTCGATGAACCCA-AT-GCTGACCATGGAATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTTGACCCCTAATCTGGCCACGTCGGGAGTTCACTGCTAAAC-TCGGTCAACAGGTACAACGGCACCTCGGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCT-ATA--CCCCAG-AGTGCAGGATATATATGTTGACGAATACTGACCTTCGCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTTCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTTCGTGCTGGTCCTTTCGGCCAGCTGTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG 'Colletotrichum vittalense CBS_126_25' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATTGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ACCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCCGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAAGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCATACGTTCCTGCCTA-TGATGCGGCAGCTAACATACATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAATCATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATCTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCTAAC-AATTCAAGATGAACCTGTTGACGAATACTAACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum vittalense CBS_181_82' AGGGATCATTATC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATTGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ACCCGCAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATCGTTGTGTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCTGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAAGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGCCTGGTAGGTCA-AAC-TGTCACCATACGTTCCTGCCTA-TGATGCGGCAGCTAACATACATAACC--AGGTCCGTGAAATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCTTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGCGTTACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAATCATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-TAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTTCAGACCGGCCAGTGCGTACGTTTCTTCCCTACCCCAAGCACATAGAATGAACGCGGGGCTAA-----CTCC-TCGACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATCTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCTAAC-AATTCAAGATGAACCTGTTGACGAATACTAACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum vittalense GUFCC_15503' -----------TC-GAG-TTACCGCTCCTTATAACCCTTTGTGAACATACCCCAAAC-GTTGCCTCGGCGGGCAGCCGGAGCCCA-GCTCCGGCGCCC-GGAGCCGCCGTCTCGGCGCGCCCC-ACCCGCCGGCGGACCACTAAACTCTATTTAAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGCGTTGGGGCCCTACGGCTTCCGTAGGCCCCGAAATACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACAT-ACCACCTCGCA-CTGGGAT-CCGGAGGGACT--CCTGCCGTAAAA-CCCCCCAATTTTCC-AAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????-------------CCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCCC-----------TCCAAGCTC--------GCCGC-GATATCACGCCCGCCACC-CCTC--------------AATTGCGAACGCCAGCTTCTGGCTGCCGATCAGACGCCAAAA-----TCAACC-AGGC--TCTGATACAGCGAGCGATTGA---------------TGGGGCC--GGCGCGGCGGGGTC---GATCATAGCC-----------TCAATGGTTTC-GGTTGCTGATACGCC--ACCCGCAGGCCTACATG-CTCAAGT-------------??????????------------TGCTTGGAAGAAGATCGTTGTTTGCGTCGTGAGCGATGGTCGCGCCAAGATCAACCCGAGAACGAGAGCACT-CCTGGCTGGCATGGGTGTGTACCAGGAGGGAATTGCCAAGCAGCAAGTCAACGGCAAGGACGTCACCGCACACATTTACGAGTATACGTCCCAGGTCGGAATGCAGATCAAGAACGACGTCGTCACCTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCTTGAAGGAGAAGAACCAGAAGAAGATCAACTCTCACA-------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------GGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGT-CTTCCCGCCTGCAGACCGCAATCTCGCCCCGTCAGGGGGCATCGAGATTTGCGGCCAGCTTCCGCCCGCACACGTAGATGCTGACAGCTTCGCAGCCTCCATTGTCGGTCGCCCTCGCCACCATGGGTATGTCTCCTC------GCCGCGGCTAATCATCGCGT-TCC------GTCGCCTCCTAACACGTGAA-TAGTATCATGATTGGTATGGGCC-------------??????????-----------------------------------------------------------------------------------------------------GGTGCTGCTTTTTGGTACGTTAC-G-GAACGCCGACAATCCGGCCTCAGCGTTACCCCGACGGTTGCAGATCACTGAGAATTAATTAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTACGTGATAGGTCCCTACTTTGGCAATCTCGGGAGTTGACGGCTGATTCCCGGCCAACAGTTACAACGGCACTTCTGAGCTCCAGCTCGAGCGAATGAGTGTTTACTTCAACGAGGTTTGTTATCCTGATGTCTCTAAC-AATTCAAGATGAACCTGTTGACGAATACTAACCTCGGTACCTTCTCAGGCCTCCGGCAACAAGTATGTTCCCCGCGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTTCGTGCTGGTCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGTCAATCCGG 'Colletotrichum yunnanense AS3_9616' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCTA-AACCGTTGCTTCGGCGGGCGGGCGGC---GACC--CCGCCCCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATGCAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGCGTTGGGGCCCTACGGTTGGCGTAGGCCCTCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAACGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTTTAAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------??????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Colletotrichum yunnanense CBS_132135' AGGGATCATTACT-GAG-TTACCGCTC--TATAACCCTTTGTGAACATACCCA-AACCGTTGCTTCGGCGGGCGGGCGGC---GACC--CCGCCCCCCCGGCGCCG---TC-AGGCGCGCCC------GCCGGAGGATAACCAAACTCTGATGCAACGACGTCTCTTCTGAGTGGCACAAGCAAA-----TAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGCGTTGGGGCCCTACGGTTGGCGTAGGCCCTCAAAGACAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACACAAACGCCTCGCA-CTGGGAC-CCGGAGGGACT-TCCGGCCGTAAAA-CCCCCCAAATTCTTTAAAGGTTGACCTC-GGATCAGGTAGGAATACCCGCTGAACTTAA??????????TGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTATCACCCC-ACTTTACCCCTCCAAGCTC--------GCCAT-GATATCACGCCCGCCACCTCCACCAC-CCA-----CCGTCTCCGATGGCCACCACCTTGCCGTCGAGAGGAGGCTGGAAGTCGATGACTAGAAGC-TCTTGCTTTGAAA-GGCATGGACGAAAAT----GTGGTTGGG-AT-GGCGGGATGTGGTC---GACCATGGCCAGGCACAAACA-CCCAAGTCCGCATTCACTGACACGCCCCCATCACAGGCCTACATG-CTCAAGTACGACTCCACCCA??????????TTGGGGCAAGGATGCTTGGAAGAAGATTGTCGTCTGCGTGGTCAGCGACGGTCGTGCCAAGATCAACCCGAGAACGAGAGCTCT-GCTGGCCGGTATGGGTGTGTACCAGGAGGGTATTGCCAAGCAGCAGGTCAACGGCAAGGACGTCACGGCTCACATTTACGAGTACACGAGCCAAGTCGGAATGACGATCAAGAATGACGTCGTCAGTTTGGTCCCCAAGCAGCAGCCCGTTCAGATGCTGTTCTGCCTGAAAGAGAAGAACCAGAAGAAGATCAACTCTCACAGATGGTTCTTCCA??????????TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCCGCCCGCAAGAGCGCACCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTTCTGATCCGCAAGCTTCCCTTCCAGCGTCTGGTGAGTACTCCCGGCCTTGATACGCTCCTACC---CGCC-GCCTGCTAACGCGCGCCCCCTCTTAGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGATACCAACCTCTGTGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTA??????????TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCGTAAGTT-GTCCCGCCCACAGACCGCAATCTTGTCC-GTCAGGGGGTATCGAGATTTGCGGCTACGCACCACCAGACTACGTCGATGCTGACAGCCTCGTAGCCTCCATCGTCGGTCGCCCTCGCCACCATGGGTATGTTTCCTGC-----GCAACGGC-AAATT---TCCCTCCTCCG-CGTCGCCACCTAACATGTGAA-CAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA??????????GTTCACCTCCAGACCGGCCAGTGCGTAAGTCTCTCCCCGT-CTCGACCCGACGGCCTGAATGCGGGGCTAA-----CTTCTTGAACAGGG-TAACCAGATTGGTGCTGCCTTCTGGTGCGTACC-CAGA-CGCCGACGATCCGGCGATGTCGATGCCCCGATGAATCCAAAT-ACTGATTTTGGGATAGGCAAAACATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGTGGTCAACCCCTAATGTGGCCACGTCGGGAGTTCACCGCTAAAT-TCCGCCAACAGGTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTATCCA-ACCGTCCCCAG-AGTGCAGGATAAACATATTGACGAGTACTGAC-TT-GCTCCTTCCCAGGCTTCCGGCAACAAGTATGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGG ; END; BEGIN TREES; TITLE Colletotrichum_SMO; LINK TAXA = Taxa1; TRANSLATE 1 'Colletotrichum gloeosporioides CBS_112999', 2 'Colletotrichum yunnanense AS3_9616', 3 'Colletotrichum yunnanense CBS_132135', 4 'Colletotrichum dracaenophilum CBS_118199', 5 'Colletotrichum dracaenophilum CBS_118200', 6 'Colletotrichum dracaenophilum CBS_119360', 7 'Colletotrichum dracaenophilum CBS_121453', 8 'Colletotrichum orchidearum CBS_132504', 9 'Colletotrichum orchidearum CBS_132515', 10 'Colletotrichum tropicicula 1_CBS_127555', 11 Colletotrichum_1_tropicicula_CBS_133174, 12 Colletotrichum_1_tropicicula_BCC38877, 13 'Colletotrichum tropicicula 2_MFLUCC100167', 14 'Colletotrichum excelsum altitudinum_CGMCC_3_15131', 15 'Colletotrichum excelsum altitudinum_CGMCC_3_15130', 16 'Colletotrichum plurivorum CBS_125473', 17 'Colletotrichum plurivorum CBS_125474', 18 'Colletotrichum plurivorum CBS_132443', 19 'Colletotrichum plurivorum CBS_132444', 20 'Colletotrichum plurivorum CBS_903_69', 21 'Colletotrichum plurivorum UTFC_261', 22 'Colletotrichum plurivorum UTFC_260', 23 Colletotrichum_plurivorum_LJTJ16, 24 Colletotrichum_plurivorum_LJTJ3, 25 Colletotrichum_plurivorum_LJTJ30, 26 Colletotrichum_plurivorum_LJTJ22, 27 Colletotrichum_plurivorum_CORCX9, 28 Colletotrichum_plurivorum_CORCG2, 29 'Colletotrichum plurivorum CGMCC_3_17358', 30 Colletotrichum_plurivorum_LFN0008, 31 'Colletotrichum plurivorum CMM_3742', 32 'Colletotrichum plurivorum CMM_3746', 33 'Colletotrichum plurivorum MAFF_238697', 34 'Colletotrichum plurivorum MAFF_238875', 35 'Colletotrichum plurivorum MAFF_305790', 36 'Colletotrichum plurivorum MAFF_306008', 37 'Colletotrichum plurivorum MAFF_306007', 38 'Colletotrichum plurivorum MAFF_238315', 39 'Colletotrichum plurivorum MAFF_243073', 40 'Colletotrichum plurivorum MAFF_305974', 41 'Colletotrichum cliviicola CBS_133705', 42 'Colletotrichum cliviicola CBS_125375', 43 Colletotrichum_cliviicola_CSSS2, 44 'Colletotrichum vittalense CBS_181_82', 45 'Colletotrichum vittalense CBS_126_25', 46 'Colletotrichum vittalense GUFCC_15503', 47 'Colletotrichum musicola CBS_132885', 48 'Colletotrichum musicola CBS_127557', 49 'Colletotrichum hymenocallidicola MFLUCC_12_0531', 50 'Colletotrichum hymenocallidicola CGMCC_3_14982', 51 'Colletotrichum hymenocallidicola CGMCC_3_14983', 52 'Colletotrichum hymenocallidicola CBS_135131', 53 'Colletotrichum hymenocallidicola CBS_136877', 54 'Colletotrichum hymenocallidicola UTFC_265', 55 'Colletotrichum hymenocallidicola UTFC_266', 56 'Colletotrichum hymenocallidicola UTFC_262', 57 Colletotrichum_hymenocallidicola_CORCG3, 58 Colletotrichum_hymenocallidicola_CORCX6, 59 Colletotrichum_hymenocallidicola_CORCX11, 60 'Colletotrichum hymenocallidicola MAFF_238499', 61 'Colletotrichum hymenocallidicola MAFF_238779', 62 'Colletotrichum hymenocallidicola MAFF_239931', 63 'Colletotrichum hymenocallidicola MAFF_240480', 64 'Colletotrichum hymenocallidicola MAFF_306084', 65 'Colletotrichum hymenocallidicola MAFF_240504', 66 'Colletotrichum sojae ATCC_62257', 67 Colletotrichum_sojae_IL18A, 68 Colletotrichum_sojae_IL26A, 69 'Colletotrichum sojae ATCC_11871', 70 'Colletotrichum sojae CBS_128510', 71 'Colletotrichum sojae CBS_134_87', 72 'Colletotrichum sojae CBS_181_81', 73 'Colletotrichum sojae CBS_182_81', 74 'Colletotrichum sojae UTFC_288', 75 'Colletotrichum sojae UTFC_301', 76 'Colletotrichum sojae UTFC_303', 77 'Colletotrichum sojae CGMCC_3_15171', 78 Colletotrichum_sojae_LFN0009, 79 'Colletotrichum sojae SAUCC_1407', 80 Colletotrichum_sojae_CAUOS5, 81 'Colletotrichum cattleyicola CBS_170_49', 82 'Colletotrichum cattleyicola MAFF_238321', 83 'Colletotrichum piperis IMI_71397', 84 'Colletotrichum brevisporum BCC_38876', 85 Colletotrichum_brevisporum_MFLUCC100182, 86 'Colletotrichum brevisporum CBS_512_75', 87 'Colletotrichum brevisporum CBS_129957', 88 'Colletotrichum brevisporum CBS_129958', 89 'Colletotrichum brevisporum MAFF_305751', 90 'Colletotrichum merremiae CBS_124955', 91 'Colletotrichum panamaense CBS_125386', 92 'Colletotrichum okinawense MAFF_240517', 93 'Colletotrichum lobatum IMI_79736', 94 'Colletotrichum magnum CBS_519_97', 95 'Colletotrichum magnum CBS_575_97', 96 'Colletotrichum magnum IMI_391662', 97 'Colletotrichum liaoningense 1_CAUOS2', 98 'Colletotrichum liaoningense 1_CAUOS6', 99 'Colletotrichum liaoningense 2_CAUOS3', 100 'Colletotrichum liaoningense 2_CAUOS4', 101 'Colletotrichum sp GZAAS5_09545', 102 Colletotrichum_sp_COUFAL7300, 103 'Colletotrichum cacao CBS_119297'; TREE Fig._1 = [&R] (1:0.088617,((((2:0.0,3:0.003135):0.034787,(5:0.0,(7:8.73E-4,(4:8.74E-4,6:0.0):8.75E-4):4.39E-4):0.038213):0.024674,((8:0.0,9:0.0):0.038173,((12:0.001995,(10:0.0,11:0.0):7.69E-4):0.004378,(13:0.00493,(14:0.0,15:6.2E-4):0.005853):0.001611):0.038078):0.02156):0.021411,((103:0.017894,((101:0.0,102:6.54E-4):0.01532,(91:0.013134,((90:0.002393,(93:0.005095,((84:0.0,86:0.0):9.09E-4,(85:0.0,87:0.0,88:0.0,89:0.0):4.56E-4):9.01E-4):0.003252):0.004856,(92:0.003866,((99:0.0,100:0.0):0.003489,((97:0.006509,98:0.0):0.011637,(94:4.55E-4,95:4.55E-4,96:0.0):0.001283):0.001153):0.002454):0.002289):7.56E-4):0.005148):0.014945):0.035541,(83:0.013757,((81:0.00248,82:0.002224):0.003307,((78:0.003953,(76:0.0,(80:0.002045,((77:6.42E-4,79:0.001819):0.0,(75:0.0,((67:0.0,74:0.0):0.001016,(66:0.0,68:5.2E-4,71:0.0,72:0.0,73:0.0,(69:0.0,70:0.0):4.55E-4):4.56E-4):0.0):0.0):0.0):0.0):0.003152):0.007463,(((47:4.54E-4,48:0.0):0.010656,(56:0.0,(63:0.0,(65:0.0,(64:0.0,(54:0.0,(60:0.0,((50:0.0,51:0.0):6.45E-4,(61:0.0,((57:5.91E-4,58:0.0,59:0.0):5.91E-4,(49:0.003364,(53:0.0,(55:0.0,(52:0.0,62:0.0):0.0):0.0):0.001003):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.005077):0.001508,((45:0.0,(44:4.57E-4,46:0.001211):4.56E-4):0.006898,((43:5.85E-4,(41:0.0,42:4.56E-4):0.0):0.001841,((23:0.0,(34:0.0,38:0.0,39:0.0):5.69E-4):0.00113,((31:0.0,32:0.0):0.003591,((22:0.0,(16:0.0,27:0.001179):4.57E-4):9.15E-4,((40:7.27E-4,(35:5.72E-4,(36:0.0,37:0.0):0.0):0.0):0.001721,((17:0.0,28:0.002958):4.57E-4,(21:6.46E-4,(18:9.13E-4,19:0.0,20:4.57E-4,24:0.0,25:0.0,26:7.19E-4,30:0.001097,(29:0.0,33:6.4E-4):6.31E-4):4.09E-4):4.66346E-5):0.001837):9.08E-4):0.0):0.0):0.001844):0.005154):0.002682):0.001138):5.09E-4):0.008345):0.019933):0.14609):0.088617); END;