#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:36 GMT TreeBASE (cc) 1994-2008 Study reference: Degawa Y., Nakagiri A., & Yamaguchi K. 2008. An aero-aquatic fungus, Peyronelina glomerulata, is shown to have teleomorphic affinities with cyphelloid basidiomycetes. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2209] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=62; TAXLABELS Amyloflagellula_inflata_AY570990 Auriculariopsis_ampla_AY570991 Auriculariopsis_ampla_AY570992 Calathella_columbiana_AY570993 Calathella_gayana_AY572005 Calathella_mangrovei_AF426954 Calyptella_capula_AY570994 Calyptella_capula_AY570995 Chaetocalathus_liliputianus_AY570996 Coniophora_olivacea_AF098376 Crepidotus_mollis_AF205677 Crinipellis_stipitaria_AY570997 Cyphellopsis_anomala_AY570998 Cyphellopsis_anomala_AY570999 Cyphellopsis_anomala_AY571000 Entoloma_eulividum_AF261295 Entoloma_undatum_AF261314 Favolaschia_calocera_AY572006 Favolaschia_calocera_AY572007 Favolaschia_peziziformis_AY572008 Fistulina_antarctica_AY571002 Fistulina_antarctica_AY571003 Fistulina_hepatica_AY571004 Fistulina_pallida_AY571005 Flagelloscypha_japonica_NBRC_101830 Flagelloscypha_minutissima_AY571006 Flagelloscypha_sp._NBRC_104516 Halocyphina_villosa_NBRC_32086 Halocyphina_villosa_NBRC_32087 Henningsomyces_candidus_AY571008 Henningsomyces_puber_AY571009 Henningsomyces_sp._AY571010 Henningsomyces_sp._AY571011 Lachnella_alboviolascens_AY571012 Lachnella_villosa_AY571013 Lachnella_villosa_AY571014 Limnoperdon_incarnatum_AF426958 Merismodes_fasciculata_AY571015 Merismodes_fasciculata_AY571016 Nia_vibrissa_AF334750 Nia_vibrissa_NBRC_32089 Nia_vibrissa_NBRC_32090 Paxillus_involutus_AF098385 Pellidiscus_pallidus_AY571017 Peyronelina_glomerulata_NBRC_102381 Peyronelina_glomerulata_NBRC_104128 Peyronelina_glomerulata_NBRC_104517 Peyronelina_glomerulata_NBRC_104518 Peyronelina_glomerulata_NBRC_104520 Peyronelina_glomerulata_NBRC_104521 Peyronelina_glomerulata_NBRC_104522 Peyronelina_glomerulata_NBRC_32867 Phaeosolenia_densa_AY571018 Phaeosolenia_densa_AY571019 Rectipilus_idahoensis_AY571020 Rectipilus_natalensis_AY571021 Resupinatus_applicatus_AY571022 Resupinatus_conspersus_AY571024 Resupinatus_poriiformis_AY571025 Schizophyllum_radiatum_AY571023 Simocybe_centunculus_AF205707 Woldmaria_crocea_AY571026 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3876] TITLE 'D1/D2 regions, LSU rDNA'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=513; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amyloflagellula_inflata_AY570990 GGAAAGCTCAAATTTAAATCTGGCAGTCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCATTGTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCCAGGGATCTTGCGTGAGGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTCGACCATGGAAAAGGCTTTGGGAATGTGGCACCTTGGGTGTGTTTAGCCCATTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCAAAATGGCTTAAGCGAC Auriculariopsis_ampla_AY570991 GGAAAGCTCAAATTTAAATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGCGTTATCCGTGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCATTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCGAAAGGGAAACGATTGCAGTCAGTCGCGTCCCGGGGATCTTGCGCTTGGCGTACTTCCCGGTGGATGGGTCAGCATCAGTTTTGACCGGGGTAAAGGCAAGAGGAATGTGGCACCTTGGGTGTGTTTAGCCTCCTGTCTATGCCGCGGTTGGGACTGAGGTACTCAGCACGCTTCGTGCTTAGATGGGCATAATGTCTGAACCGAC Auriculariopsis_ampla_AY570992 GGAAAGCTCAAATTTAAATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGCGTTATCCGTGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCATTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCGAAAGGGAAACGATTGCAGTCAGTCGCGTCCCGGGGATCTTGCGCTTGGCGTACTTCCCGGTGGATGGGTCAGCATCAGTTTTGACCGGGGTAAAGGCAAGAGGAATGTGGCACCTTGGGTGTGTTTAGCCTCCTGTCTATGCCGCGGTTGGGACTGAGGTACTCAGCACGCTTCGTGCTTAGATGGGCATAATGTCTGAACCGAC Calathella_columbiana_AY570993 GGAAAGCTCAAATTTAAATCTGGTGTTTCACCCGAGTTGTAATTTAGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGAAATCTTGCGCTAGGTGTACTTTCTGTTCGATGGGTCAGCATCGATTTTGATCATGGAAAAGGCAGAGGGAATGTGGCATCCTGGATGTGTTTAGCCCTTTGTCCATGCAATGGTTGGGATCGAGGAACTCAGCACGCATCGTGCTTAGATGGGCATAATGGCTTAATCGAC Calathella_gayana_AY572005 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGCATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGCACGGACTCCCAGGGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGGGATCTTGATCCTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGCTTGAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTCTTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Calathella_mangrovei_AF426954 GGATAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGCGCTACCCGTGCTGGACCGTGCATAAGTCTTCTGGAAAGGAGCATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGTGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGCTTGGTGTACTTTCTGAGTGACGGGTCAGCATCAGTTTTGACTTTGGAAAAGGCAGGAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTCTTGTCTATACAGTGGTCGGGACTGAGGAACTCAGCACGCTTTGTGCTTAGATGGGCATAATGGCTTAAGCGAC Calyptella_capula_AY570994 GGAAAGCTCAAATTTAAATCTGGCAGTCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCTGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTGGGAATCTTGCGCTTGGTGTACTTTCTAGTTAATGGGTCAGCATCAGTTTTGAGTGTGGAAAAGATTAGGGGAATGTGGCATCCTGGATGTGTTTAGCCTCTAGTTTATACAGCATTTGGGACTGAGGAACTCAGCACGCTACGTGCTTAGATGGGCAAAATGGCTTAATCGAC Calyptella_capula_AY570995 GGAAAGCTCAAATTTAAATCTGGCAGTCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTGCTGGGAATCTTGCGCTTGGTGTACTTTCTAGTTAATGGGTCAGCATCAGTTTTGAGTGTGGAAAAGATTAGGGGAATGTGGCATCTTGGATGTGTTTAGCCCTTGGTTTATACAGCACTTGGGACTGAGGAACTCAGCACGCTACGTGCTTAGATGGGCAAAATGGCTTAATCGAC Chaetocalathus_liliputianus_AY570996 GGAAAGCTCAAATTTAAATCTGGCAGCCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCATTGTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCCAGGGATCTTGCGTGAGGCGTACTTCCTGGTTGACGGGTCAGCATCAGTTTTGACCACGGAAAAGGCTTGGGGAATGTGGCATCTTGGATGTGTTTAGCCCCTTGTCTATACGGTGATTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Coniophora_olivacea_AF098376 GGAAAGCTCAAATTTTGATCTGGCGGCCCGTCCGAGTTGTAATCTAGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCATCTCTGACACGGATCCCCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTTGAGATCTTGCGCGTGGTGTATTCTCTTGTCGACGGGTCAGCATCAATTTTGGCTGCGGAAAAGGCAGAGGGAATGTGGCACCTTAGGTGTGTTTAGCCCTTTGTTTATACGGTGGCTGGGATTGAGGAACTCAGTACGAGTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Crepidotus_mollis_AF205677 GGAAAGCTCAAATTTGAATCTGGCAGCTTGTCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTCCCAAGGCTTTGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTGGAAATCTTGCGTTGGGTGTACTTTCCAGTTGACGGGTCAGCATCAGTTTTGACCATGGAAAAGGCGTAGGAAATGTGGCTTCCTGGAAGTGTTTAGTCCTGCGTTTATACATTGGTTGGGACTGAGGAACTCAGCACGCGACGTGCTTAGATGGGCAAAATGGCTTAATCGAC Crinipellis_stipitaria_AY570997 GGAAAGCTCAAATTTAAATCTGGCAGCCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTGGGGATCTTGCGTGGGGTGTACTTCCTAGTCGACGGGTCAGCATCAGTTTTGACTATGGAAAGGACTTGAGGAATGTGGCAACTCGGTTGTGTTTAGCCTCTTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCATCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Cyphellopsis_anomala_AY570998 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGCTTGGTGTATTTCCTGAGTGACGGGTCAGCATCAGTTTTGACCGTAGAAAAGGCTGGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTCGGTCTATGTAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Cyphellopsis_anomala_AY570999 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGCTTGGTGTATTTCCTGAGTGACGGGTCAGCATCAGTTTTGACCGTAGAAAAGGCTGGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTCGGTCTATGTAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Cyphellopsis_anomala_AY571000 GGAAAGCTCAAATTTGAATCTGACTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGCTTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACCGTAGAAAAGGCTAGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTGGTCTATGTAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Entoloma_eulividum_AF261295 GGAAAGCTCAAATTTAAATCTGGTAGCCTGCCCGAGTTGTAATCTAGAGAAGTGCTATCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGACTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTGCCAGGGATCTTGCGCTTGGTGTACTTTCTGGTTGATGGGTCAGCATCAATTTTGACCATGGAAAAGGTCAAGGGAATGTGGCATCTTGGATGTGTTTAGCCCTTGGTTCATACATTGGTTGGGATTGAGGAACTCAGCATGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Entoloma_undatum_AF261314 GGAAAGCTCAAATTTAAATCTGGTAGCCTGCCCGAGTTGTAATCTAGAGAAGCGTTATCCGCGTTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCCAGGGATCTTGCGCTTGGTGTACTTCCTGATTAACGGGTCAGCATCAATTTTGACCATGGAAAAGTTCGAGGGAATGTGGCATCCTGGATGTGTTTAGCCCTTGGTCTATACATTGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Favolaschia_calocera_AY572006 GGAAAGCTCAAATTTAAATCTGGCGGTCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCATTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGAGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGACAGAACTCTTGCGCTTGGTGTACTTTCTGTGCGACGGGTCAGCATCAGTTTTGGTCGCGGAAAAGGCTTGGAGAATGTGGCACCCTGGGTGTGTTTAGCTTCAGGTTTATACGTCGGCTAGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Favolaschia_calocera_AY572007 GGAAAGCTCAAATTTAAATCTGGCGGTCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCATTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGAGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGACAGAACTCTTGCGCTTGGTGTACTTTCTGTGCGACGGGTCAGCATCAGTTTTGGTCGCGGAAAAGGCTTGGAGAATGTGGCACCCTGGGTGTGTTTAGCTTCAGGTTTATACGTCGGCTAGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Favolaschia_peziziformis_AY572008 GGAAAGCTCAAATTTAAATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCATTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGAGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGAACTCTTGCGCTTGGTGTACTTTCTGTTCAATGGGTCAGCATCAGTTTTGATCGCGGAAAAGGCTCAGAGAATGTGGCACCTTGGGTGTGTTTAGCTTTGGGTTTATACGTCGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Fistulina_antarctica_AY571002 GGAAAGCTCAAATTTGTATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGCGTCACCCGCGCCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTGCCGGGGCTTTGTGGTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAACGATTGATGTCAGTCGCGTCCCAGGGATCTGGCGCCTGGCGTACTTCCTGTTGGACGGGTCAGCGTCAGTTTTGACCGTGTTAAAGGCCTTGGGAATGTGGCACCCTGGGTGTGTTTAGCCCTCGGTCCATGCGTCGGTTGGGACTGAGGAACTCAGCGCGCTCCGCGCTTAGATGGGCATAATGGCCTAATCGAC Fistulina_antarctica_AY571003 GGAAAGCTCAAATTTGTATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGCGTCGCCCGCGCCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCGTAGAGGGTGAGAATCCCGTCCATGACACGGACTGCCGGGGCTTTGTGGTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAACGCTTGATGTCAGTCGCGTCCCAGGGATCTGGCGCCTGGCGTACTTCCTGTTGGACGGGTCAGCGTCAGTTTTGATCGTGTTAAAGGCCTCGGGAATGTGGCGCCTTGGGTGTGTTTAGCCCCTGGTCCATGCGTCGATTGGGACTGAGGAACTCAGCGCGCTCCGCGCTTAGATGGGCATAATGGCCTAATCGAC Fistulina_hepatica_AY571004 GGAAAGCTCAAATTTGTATCTGGCGGCTCGTCCGAGTTGTAATTTAGAGAAGCGTCGCCCGCGCCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCGGGGCTTTGTGGTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAACGATTGATGTCAGTCGCGTCTCAGGGATCTGGCGCCTGGCGTACTTCCTGTCGGATGGGTCAGCATCAGTTTTGACCGTGTTAAAGGCTTAGGGAATGTGGCACCTTGGGTGTGTTTAGCCCTTGGTCCATGCATCGGTTGGGACTGAGGAACTCAGCGCGCTCCGCGCTTAGATGGGCATAATGGCCTAATCGAC Fistulina_pallida_AY571005 GGAAAGCTCAAATTTGTATCTGGCAGCCTGCCCGAGTTGTAATCTAGAGAAGCGTCACCCGCGCCAGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCGTGACACGGATCCCTGGGGCTTTGTGGTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAACGCTTGATGTCAGTCGCATCTCAGGGATCTGGCGCCTGGTGTACTTCCTGTCGGATGGGTCAGCATCAGTTTTGACCGTGTTAAAGTCCTGGGGAATGTGGCACCTTGGGTGTGTTTAGCCCCTGGTCCATGCATCGGTTGGGACTGAGGAACTCAGTGCGCTCCGCACTCAGATGGGCATAATGGCCTAATCGAC Flagelloscypha_japonica_NBRC_101830 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGCAATGCCCGCGCTGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCAGCGCATTGTGGTATGCTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGGGATCTTCCGGTTGGTGTACTTCCTGAGTGATGGGTCAACATCAGTTTTGATTGTGGAAAAGGTGCAAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTTGTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Flagelloscypha_minutissima_AY571006 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTGCCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGATTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGGGATCTTCCGGTTGGTGTACTTCCTGAATAACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGCTAGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTGGTCTATACAGTGGTTGGGATTGAGGAACTCAGTACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Flagelloscypha_sp._NBRC_104516 GGAAAGCTCAAATTTGAATCTGGCTGCTAGTCCGAGTTGTAATTTCGAGAAGTGTTGCCCGTGCCGGACCGTACATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTATGGACTCCCGGTACATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATAATGGGTCAGCATCAGTTTTGACTGTGGAAAAGGTTTGGGGAATGTGGCTTCTTGGAAGTGTTTAGCCCCAGGTCTATACAGTGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCAAAATGGCTTAAGCGAC Halocyphina_villosa_NBRC_32086 GGAAAGCTCAAATTTGAATCTGGCTGCCGGTCCGAGTTGTAATTTCGAGAAGCGTTACCCGCGCTGGACCATACATAAGTCTTCTGGAAAGAAGCATCATAGAGGGTGAGAATCCCGTCTTTGGTATGGACTCCCAGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGAAATCTTACGTATGGTGTACTTTCTGTGTAACGGGTCAACATCAGTTTTGGTTGCGGAAAAGGCTTGAAGAATGTGGCTTCCTGGAAGTGTTTAGCTTCTTGTCTATACGATGATCGGGACTGAGGAACTCAGCACGCTTTGTGCTTAGATGGGCATAATGGCTTAAGCGAC Halocyphina_villosa_NBRC_32087 GGAAAGCTCAAATTTGAATCTGGCTGCCGGTCCGAGTTGTAATTTCGAGAAGCGTTACCCGCGCTGGACCATACATAAGTCTTCTGGAAAGAAGCATCATAGAGGGTGAGAATCCCGTCTTTGGTATGGACTCCCAGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGAAATCTTACGTATGGTGTACTTTCTGTGTAACGGGTCAACATCAGTTTTGGTTGCGGAAAAGGCTTGAAGAATGTGGCTTCCTGGAAGTGTTTAGCTTCTTGTCTATACGATGATCGGGACTGAGGAACTCAGCACGCTTTGTGCTTAGATGGGCATAATGGCTTAAGCGAC Henningsomyces_candidus_AY571008 GGAAAGCTCAAATTTAAATCTGGTAGCCTGCCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCATGTACAAGTCTTCTGGAATGGAGCATCATGGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCGCATGCTTGAGATCTGGCGCTTGGTGTATTCTCTAGTTAATGGGTCAACATCAGTTTTGACTATGGAAAGAGTTGGAGGAATGTGGCTCCTTAGGAGTGTTTAGCCTCTAGCTTATACAGTGGTTGGGACTGAGGCTCTCAGCACGCTACGTGCTTAGATGGGCATAATAACCTTAACGAC Henningsomyces_puber_AY571009 GGAAAGCTCAAATTTAAATCTGGCAGCTTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCATGTATAAGTCTTCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTAACATGGACTACCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCGCATGCTTGAGATCTGGCGCTTGGTGTATTCTCTTGTTAATGGGTCAACATCAGTTTTGACTATGGAAAGAGTTGGAGGAATGTGGCTCCTTAGGAGTGTTTAGCCTTCGGCTTATACAGTGGTTGGGACTGAGGATCTCAGCACGCTACGTGCTTAGATGGGCATAATAGCTTAAGCGAC Henningsomyces_sp._AY571010 GGAAAGCTCAAATTTAAATCTGGCAGTTTGTCCGAGTTGTAATTTAGAGAAGTGCTATCCGCGCTGGACCGTGTACAAGTCTGCTGGAACGCAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTAGAAATCTTGCGCTGGGAGCATTTTCTAGTTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGTTAGAGGAATGTGGCATCTTGGATGTGTTTAGCCTCTGATTCATACGACAGTTGGGACTGAGGAACTCAGCACGCTACGTGCTTAGATGGGCATAATGGCTTAATCGAC Henningsomyces_sp._AY571011 GGAAAGCTCAAATTTAAATCTGGCAGCTTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCATGTATAAGTCTTCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTACATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCGCATGCTAGAGATCTGGCGCTTGGTGTACTCTCTAGTGAATGGGTCAACATCAGTTTTGACTATGGAAAGAATTAGAGGAATGTGGCTCCTTAGGAGTGTTTAGCCTTTAGTTTATACAGTAGTTGGGACTGAGGCTCTCAGCACGCTACGTGCTTAGATGGGCATAATAGCTTAAGCGAC Lachnella_alboviolascens_AY571012 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTCTTCTGGAAAGGAGCATCACAGAGGGTGAAAATCCCGTCTATGGTACGGACTCCCAGTGCATTGTGGTATGCTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCTGGGATCTTCCGGTTGGTGTATTTCCTGAGTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGCTTAGGGAATGTGGCTCCCTGGGAGTGTTTAGCCCTTTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Lachnella_villosa_AY571013 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTCTTCTGGAAAGGAGCATCACAGAGGGTGAAAATCCCGTCTATGGTACGGACTCCCAGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCTGGGATCTTCCGGTTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGCTTAGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Lachnella_villosa_AY571014 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTCTTCTGGAAAGGAGCATCACAGAGGGTGAAAATCCCGTCTATGGTACGGACTCCCAGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCTGGGATCTTCCGGTTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGCTTAGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTTGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Limnoperdon_incarnatum_AF426958 GGAAAGCTCAAATTTAAATCTGGCAGCCTGTCCGAGTTGTAATCTAGAGAAGTGCTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCCAGGAGTCTGTTAACAGGGATACTTCTGGTTGAACGGGTCAGCATCAATTTTGACTGTGGAAAAGGTCAGGGGAATGTGGCACCTTGGGTGTGTTTAGCCTCTGATTTATACAGCAGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Merismodes_fasciculata_AY571015 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGTTTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACCGTAGAAAAGGCTAGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTGGTCTATGTAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Merismodes_fasciculata_AY571016 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTACATAAGTTTTCTGGAAAGGAACATCATAGAGGGTGAAAATCCCGTCTTTGGTACGGACTCCCAGTGCATTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGGGATCTTGCGCTTGGTGTACTTCCTGAGTGACGGGTCAGCATCAGTTTTGACCGTAGAAAAGGCTGGGGGAATGTGGCTCTTTGGGAGTGTTTAGCCCTTGGTCTATGTAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Nia_vibrissa_AF334750 GGAAAGCTCAAATTTGAATCTGGCTGTCAGTCCGAGTTGTAATTTAAAGAAGTGTTACCCGTTCTGGACTGTGCATAAGTCTTCTGGAAAGAAGCATCATAGAGGGTGATAATCCCGTCTTTGGTACAGACTCCCAGGGCATTGTGGTGCACTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACACTTGAAGTCAGTCGCGTGTCAAAGATCTTGCGCTTGGTGTACTTTTTGAGTAATGGGTCAACATCAGTTTCAGTTGTGGAAAAGGCGAGAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTCTTGTTTATACAGTGACTGGGACTGAGGAACTCAGCACGCTTTGTGCTTAGATGGGCATAATGGCTTAAGTGAC Nia_vibrissa_NBRC_32089 GGAAAGCTCAAATTTGAATCTGGCTGTCAGTCCGAATTGTAATTTAAAGAAGTGTTACCCGCTCTGGACCATGCATAAGTCTTCTGGAAAGAAGCATCATAGAGGGTGATAATCCCGTCTTTGGTATGGATCCCCAGAGCATTGTGGTGCACTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACACTTGAAGTCAGTCGCGTGTCGAAGATCTTGCGCTTGGTGTACTTTTTGAGTGATGGGTCAACATCAGTTTTGGTTGTGGAAAAGGTTGGAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTCTGGTCTATACAGTGATTGGGATTGAGGAACTCAGCACGCTTTGTGCTTAGATGGGCATAATGGCTTAAGTGAC Nia_vibrissa_NBRC_32090 GGAAAGCTCAAATTTGGATCTGGCTGTCAGTCCGAGTTGTAATTTAAAGAAGTGTTACCCGTTCTGGACTGTGCATAAGTCTTCTGGAAAGAAGCATCATAGAGGGTGATAATCCCGTCTTTGGTACAGTTTCCCAGGGCATTGTGGTACACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCCAATAGGGAAACACTTGAAGTCAGTCGCGTGTCAAAGATCTTGCGCTTGGTGTACTTTTTGAGTAATGGGTCAACATCAGTTTTAGTTGTGGAAAAGGCGAGAGGAATGTGGCTCCCTGGGAGTGTTTAGCCTCTTGTTTATACAGTGATCAGGACTGAGGAACTCAGCACGCTTTGTGCTCAGATGGGCATAATGGCTTAAGTGAC Paxillus_involutus_AF098385 GGATAGCTCAAATTTTGATCTGGCGGCCCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGCAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATCGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAGGTCAGTCGCGTGACGGGGATCTTGCGCTCGGTGTACTTCCTGCTCGACGGGTCAGCATCAGTTTCGATCGCGTAAAGGGTCGAGGGAATGTGGCACTCTGAGTGTGTTTAGTCCTCGGTCCATGCGGTGGTCGGGACTGAGGAACTCAGCACGAGTCGTGCTTAGATGGGCATAATGGCCTAAGCGAC Pellidiscus_pallidus_AY571017 GGAAAGCTCAAATTTGAATCTGGCAGCTTGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGCGTTGGGCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTGGGAATCTTGCGCTGGGTGTACTTTCTAGTCAATGGGTCAGTATCAGTTTCGACCGTGGAAAAGGTGCAGGGAATGTGGCTCCCTGGGAGTGTTTAGCCTTGTGTCGATACATCGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATAGGCATAATGGCTTAATCGAC Peyronelina_glomerulata_NBRC_102381 GGAAAGCTCAAATTTGAATCTGACTGCCAGTCCGAATTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGGGATCTTCCGGTTGGTGTACTTCCTGAATGACGGGTCAGCATCAGTTTTGACCATGGAAAAGGCATGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTGGGTCTATACAGTGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104128 GGAAAGCTCAAATTTGAATCTGACTGCCAGTCCGAATTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCGTGTCGGGGATCTTCCGGTTGGTGTACTTCCTGAATGACGGGTCAGCATCAGTTTTGACCATGGAAAAGGCATGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTGGGTCTATACAGTGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104517 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATGATGGGTCAGCATCAGTTTTGATCATGGAAAAGGTTTGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTAGATCTATACAGTGGTTGGGACTGAGGAATTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104518 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATGATGGGTCAGCATCAGTTTTGATCATGGAAAAGGTTTGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTAGATCTATACAGTGGTTGGGACTGAGGAATTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104520 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATGATGGGTCAGCATCAGTTTTGATCATGGAAAAGGTTTGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTAGATCTATACAGTGGTTGGGACTGAGGAATTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104521 GGAAAGCTCAAATTTGAATCTGGCTGCTAGTCCGAGTTGTAATTTCGAGAAGTGTTGCCCGTGCCGGACCGTACATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTATGGACTCCCGGTACATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATAATGGGTCAGCATCAGTTTTGACTGTGGAAAAGGTTTGGGGAATGTGGCTTCTTGGAAGTGTTTAGCCCCAGGTCTATACAGTGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCAAAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_104522 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTGCCCGTGCCGGACCGTACATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTATGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATGATGGGTCAGCATCAGTTTTGACTGTGGAAAAGGTTTGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCCAGGTCTATACAGTGGTTGGGACTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCAAAATGGCTTAAGCGAC Peyronelina_glomerulata_NBRC_32867 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTCGAGAAGTGTTACCCGTGCCGGACCGTGCATAAGTCCTCTGGAAAGGGGTATCATAGAGGGTGACAATCCCGTCTTTGGTACGGACTCCCGGTGCATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGCTTGAAGTCAGTCGCATGTCAGGGATCTTCCGGTTGGTGTACTTCCTGAATGATGGGTCAGCATCAGTTTTGATCATGGAAAAGGTTTGGGGAATGTGGCTTCCTGGAAGTGTTTAGCCCTAGATCTATACAGTGGTTGGGACTGAGGAATTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAAGCGAC Phaeosolenia_densa_AY571018 GGAAAGCTCAAATTTAAATCTGGCAGCTTGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGTGCTGTGCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGAACGTCAGGACTTTGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGAAATCTTGCGCTTGGTGTACTTTCTGTTCGATGGGTCAGCATCAATTTTGACCGTGGAAAAGTCCAGGGGAATGTGGCATCTTGGATGTGTTTAGCCTCTGGTCCATACATCGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Phaeosolenia_densa_AY571019 GGAAAGCTCAAATTTAAATCTGGCAGCTTGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGTGCTGTGCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGAACGTCAGGACTTTGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGTCAGAAATCTTGCGCTTGGTGTACTTTCTGTTCGATGGGTCAGCATCAATTTTGACCGTGGAAAAGTCCAGGGGAATGTGGCATCTTGGATGTGTTTAGCCTCTGGTCCATACATCGGTTGGGATTGAGGAACTCAGCACGCTTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Rectipilus_idahoensis_AY571020 GGAAAGCTCAAATTTAAATCTGATAGCCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCATGGATAAGTTTCCTGGAATGGGGCATCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTGCCAGTACATTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCACATACTTGAGATCTGGCGCTTGGTGTATTCTCTAGTTGATGGGTCAACATCAGTTTTGATCATGGAAAGAGTTGAGGGAATGTGGCTCCTTAGGAGTGTTTAGCCTTTAGCTTATACATTGGTTGGGACTGAGGATCTCAGCACGCTTCGTGCTTAGATGGGCATAATAGCTTAAGCGAC Rectipilus_natalensis_AY571021 GGAAAGCTCAAATTTAAATCTGGCAGCCCGTCCGAGTTGTAATTTAGAGAAGTGCTATCCGCGCTGGACCGTGTACAAGTCTGCTGGAACGCAGCGTCATAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTAGAAATCTTGCGCTGGGAGCACTTTCTAGTTGACGGGTCAGCATCAGTTTTGACTGTGGAAAAGGTTAGAGGAATGTGGCATCTTGGATGTGTTTAGCCTCTGATTTATACGACGGTTGGGACTGAGGAACTCAGCACGCTACGTGCTTAGATGGGCATAATGGCTTAATCGAC Resupinatus_applicatus_AY571022 GGAAAGCTCAAATTTAAATCTGGCAGCCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCACAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTAGAAATCTGGTACCTGGTGTACTTTCTAGTCTACGGGTCAGCATCAGTTTTGACCATGGAAAAGGTCAGAGGAATGTGGCATCTTGGATGTGTTTAGCCTCCGATTTATACAGTGGTTGGGACTGAGGAACTCAGCACGCGACGTGCTTAGATGGGCATAATGGCTTAATCGAC Resupinatus_conspersus_AY571024 GGAAAGCTCAAATTTAAATCTGGCAGTCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCATTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCTGGGGATCTGGTACCTGGTGTACTTCCTAGTTTACGGGTCAGCATCAGTTTTGAATGTGGAAAAGGTTGAGGGAATGTGGCATCCTGGATGTGTTTAGCCCTTGATTTATGCATCATTTGGGACTGAGGTACTCAGCACGCGACGTGCTTAGATGGGCATAATGGCTTAATCGAC Resupinatus_poriiformis_AY571025 GGAAAGCTCAAATTTAAATCTGGCAGCCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCACAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGTTACGAATCTGGTACCAGGCGTACTTCCTAGTCTACGGGTCAGCATCAGTTTTGACCATGGAAAAGGTCGGAGGAATGTGGCATCTTGGGTGTGTTTAGCCTCTGATTTATACAGTGGTTGGGACTGAGGAACTCAGCACGCGACGTGCTTAGATGGGCATAATGGCTTAATCGAC Schizophyllum_radiatum_AY571023 GGAAAGCTCAAATTTAAATCTGGCGGCCCGTCCGAGTTGTAATTTAGAGAAGCGTTATCCGTGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCATTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCGAAAGGGAAACGGTTGCAGTCAGTCGCGTCCCGGGGATCTTGCGCTTGGCGTATTTCCCGGTGGATGGGTCAGCATCAGTTTTGACCGAGTTAAAGGCTGGAGGAATGTGGCACCTTGGGTGTGTTTAGCCTCCTGTCTATGCTGCGGTTGGGACTGAGGAACTCAGCACGCATCGTGCTTAGATGGGCATAATGTCTGAACCGAC Simocybe_centunculus_AF205707 GGAAAGCTCAAATTTAAATCTGGCGGCCTGTCCGAGTTGTAATCTACAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAAGGCTTTGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCACGCGCGGGGAATCTTTCGACTGGTGTATTTTCCTGTTGGCGGGTCAGCATCAGTTTTGATCATGGAAAAGATCATGGAAATGTGGCACCCTGGGTGTGTTTAGTCTGTGGTTTATACACTGATTGGGACTGAGGTACTCAGCACGCGTCGTGCTTAGATGGGCATAATGGCTTAATCGAC Woldmaria_crocea_AY571026 GGAAAGCTCAAATTTGAATCTGGCTGCCAGTCCGAGTTGTAATTTAGAGAAGTGCTACCCGCGCTGGACCATGTATAAGTCTTCTGGAAGGGAGCATCATAGAGGGTGAAAATCCCGTCTTTGACATGGACTGCCAGGGCATTGTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCATGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAATAGGGAAACGGTTGCAGTCAGTCGCGTGCCGGGGATCTTGCGCTTGGTGTATTTCCTGGTTTACGGGTCAGCATCAGTTTTGGCCGTGGAAAAGGTCAGAGGAATGTGGCTTCTTGGAAGTGTTTAGCCTCTGGTCGATGCAGCGGTCGGGACTGAGGAACTCAGCGTGCTTCGCGCTTAGATGGGCATAATGGCTAAACCGAC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'D1/D2 regions, LSU rDNA') = N: 1-513; CODONPOSSET CodonPositions (CHARACTERS = 'D1/D2 regions, LSU rDNA') = N: 1-513; END; BEGIN TREES; TITLE Tb9405; LINK TAXA = Taxa1; TRANSLATE 1 Cyphellopsis_anomala_AY570998, 2 Cyphellopsis_anomala_AY570999, 3 Merismodes_fasciculata_AY571015, 4 Merismodes_fasciculata_AY571016, 5 Cyphellopsis_anomala_AY571000, 6 Peyronelina_glomerulata_NBRC_104517, 7 Peyronelina_glomerulata_NBRC_104520, 8 Peyronelina_glomerulata_NBRC_32867, 9 Peyronelina_glomerulata_NBRC_104518, 10 Peyronelina_glomerulata_NBRC_104521, 11 Flagelloscypha_sp._NBRC_104516, 12 Peyronelina_glomerulata_NBRC_104522, 13 Peyronelina_glomerulata_NBRC_102381, 14 Peyronelina_glomerulata_NBRC_104128, 15 Flagelloscypha_japonica_NBRC_101830, 16 Flagelloscypha_minutissima_AY571006, 17 Lachnella_villosa_AY571013, 18 Lachnella_villosa_AY571014, 19 Calathella_gayana_AY572005, 20 Nia_vibrissa_AF334750, 21 Nia_vibrissa_NBRC_32090, 22 Nia_vibrissa_NBRC_32089, 23 Halocyphina_villosa_NBRC_32086, 24 Halocyphina_villosa_NBRC_32087, 25 Calathella_mangrovei_AF426954, 26 Pellidiscus_pallidus_AY571017, 27 Calyptella_capula_AY570994, 28 Calyptella_capula_AY570995, 29 Resupinatus_poriiformis_AY571025, 30 Resupinatus_applicatus_AY571022, 31 Resupinatus_conspersus_AY571024, 32 Woldmaria_crocea_AY571026, 33 Henningsomyces_candidus_AY571008, 34 Lachnella_alboviolascens_AY571012, 35 Henningsomyces_puber_AY571009, 36 Rectipilus_idahoensis_AY571020, 37 Henningsomyces_sp._AY571011, 38 Fistulina_antarctica_AY571003, 39 Fistulina_hepatica_AY571004, 40 Auriculariopsis_ampla_AY570991, 41 Auriculariopsis_ampla_AY570992, 42 Schizophyllum_radiatum_AY571023, 43 Fistulina_antarctica_AY571002, 44 Favolaschia_calocera_AY572006, 45 Favolaschia_calocera_AY572007, 46 Fistulina_pallida_AY571005, 47 Amyloflagellula_inflata_AY570990, 48 Chaetocalathus_liliputianus_AY570996, 49 Crinipellis_stipitaria_AY570997, 50 Phaeosolenia_densa_AY571018, 51 Phaeosolenia_densa_AY571019, 52 Calathella_columbiana_AY570993, 53 Favolaschia_peziziformis_AY572008, 54 Henningsomyces_sp._AY571010, 55 Rectipilus_natalensis_AY571021, 56 Limnoperdon_incarnatum_AF426958, 57 Paxillus_involutus_AF098385, 58 Coniophora_olivacea_AF098376, 59 Entoloma_undatum_AF261314, 60 Entoloma_eulividum_AF261295, 61 Simocybe_centunculus_AF205707, 62 Crepidotus_mollis_AF205677; TREE Fig._20 = [&R] (((((((1,2),4),(5,3)),19),(((((((((6,7),8),9),((10,11),12)),(13,14)),16),15),((17,18),34)),((((20,21),22),(23,24)),25))),32),((((38,43),39),46),((40,41),42)),((((((26,62),61),(((27,28),31),(((29,30),56),(54,55)))),(((33,37),35),36)),((47,48),49)),(((50,51),(52,(59,60))),(((44,45),53),(57,58))))); END;