#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:06 GMT TreeBASE (cc) 1994-2008 Study reference: Der J., Stratford J., Thomson J., & Wolf P. 2009. Global chloroplast phylogeny and biogeography of bracken (Pteridium: Dennstaedtiaceae). American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2225] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=81; TAXLABELS Pteridium_aquilinum_ssp._aquilinum_002_ASSP Pteridium_aquilinum_ssp._aquilinum_017_FZSW Pteridium_aquilinum_ssp._aquilinum_031_BRFR Pteridium_aquilinum_ssp._aquilinum_065_CLYW Pteridium_aquilinum_ssp._aquilinum_099_EDSC Pteridium_aquilinum_ssp._aquilinum_103_ASSP Pteridium_aquilinum_ssp._aquilinum_106_OXLN Pteridium_aquilinum_ssp._aquilinum_188_CORF Pteridium_aquilinum_ssp._aquilinum_194_AMTK Pteridium_aquilinum_ssp._aquilinum_202_RVIT Pteridium_aquilinum_ssp._aquilinum_218_ACAW Pteridium_aquilinum_ssp._aquilinum_226_LBSP Pteridium_aquilinum_ssp._aquilinum_256_AZOR Pteridium_aquilinum_ssp._aquilinum_293_CPHW Pteridium_aquilinum_ssp._aquilinum_307_BRGW Pteridium_aquilinum_ssp._aquilinum_336_RAMD Pteridium_aquilinum_ssp._aquilinum_350_NIFR Pteridium_aquilinum_ssp._aquilinum_TAUR Pteridium_aquilinum_ssp._capense_110_KUFZ Pteridium_aquilinum_ssp._capense_191_GSAF Pteridium_aquilinum_ssp._capense_228_MCAM Pteridium_aquilinum_ssp._capense_233_MCAM Pteridium_aquilinum_ssp._capense_353_BBSA Pteridium_aquilinum_ssp._capense_358_NDNQ Pteridium_aquilinum_ssp._capense_368_NDNG 'Pteridium aquilinum ssp. capense 503 CAPM/ZOMA' 'Pteridium aquilinum ssp. centrali-africanum 112 CH3Z/ZAMB' 'Pteridium aquilinum ssp. centrali-africanum AKFZ' 'Pteridium aquilinum ssp. centrali-africanum CAF4' Pteridium_aquilinum_ssp._decompositum_145_MAHI Pteridium_aquilinum_ssp._decompositum_292_MAHI Pteridium_aquilinum_ssp._japonicum_029_TTWN Pteridium_aquilinum_ssp._japonicum_071_AIJP Pteridium_aquilinum_ssp._japonicum_085_YSCH Pteridium_aquilinum_ssp._japonicum_096_GNCH Pteridium_aquilinum_ssp._japonicum_104_MOGJ Pteridium_aquilinum_ssp._japonicum_113_YOJP Pteridium_aquilinum_ssp._japonicum_280_CHJP Pteridium_aquilinum_ssp._japonicum_316_SHJP Pteridium_aquilinum_ssp._latiusculum_143_YCCM Pteridium_aquilinum_ssp._latiusculum_147_WMCH Pteridium_aquilinum_ssp._latiusculum_148_BRMN Pteridium_aquilinum_ssp._latiusculum_Barrington_2287 Pteridium_aquilinum_ssp._latiusculum_Wolf_921 Pteridium_aquilinum_ssp._pinetorum_164_KUKR Pteridium_aquilinum_ssp._pinetorum_N2nR Pteridium_aquilinum_ssp._pinetorum_N6nR Pteridium_aquilinum_ssp._pinetorum_RU4K Pteridium_aquilinum_ssp._pseudocaudatum_169_FLUS Pteridium_aquilinum_ssp._pseudocaudatum_203_HFLA Pteridium_aquilinum_ssp._pseudocaudatum_Der_68 Pteridium_aquilinum_ssp._pubescens_100_AOUS Pteridium_aquilinum_ssp._pubescens_325_OWUS Pteridium_aquilinum_ssp._pubescens_Der_66 Pteridium_aquilinum_ssp._pubescens_Der_67 Pteridium_aquilinum_ssp._wightianum_001_AMSL Pteridium_aquilinum_ssp._wightianum_007_KLPH Pteridium_aquilinum_ssp._wightianum_068_SERI Pteridium_aquilinum_ssp._wightianum_182_PMAL Pteridium_aquilinum_ssp._wightianum_305_YGIN Pteridium_aquilinum_ssp._wightianum_354_WFNQ Pteridium_aquilinum_ssp._wightianum_362_HKSL Pteridium_aquilinum_ssp._wightianum_416_TREV Pteridium_arachnoideum_144_RMEX Pteridium_arachnoideum_317_SPBR 'Pteridium arachnoideum ME2-1VNZA' Pteridium_caudatum_238_HECR Pteridium_caudatum_274_QCOL Pteridium_caudatum_323_COCR 'Pteridium caudatum MD2-2VENZ' Pteridium_esculentum_127_KEWA Pteridium_esculentum_213_CRAN Pteridium_esculentum_275_KONC Pteridium_esculentum_324_HNNZ Pteridium_esculentum_332_SVNZ Pteridium_esculentum_387_CRDQ Pteridium_esculentum_401_RYNA Pteridium_esculentum_Wolf_638 Pteridium_esculetum_083_WAWA Pteridium_semihastatum_251_PFNT Pteridium_semihastatum_278_KMAL ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3902] TITLE Pteridium_cpDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1771; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Pteridium_aquilinum_ssp._aquilinum_002_ASSP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATTTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_017_FZSW AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGA?ATGGAAATTACCGACATCGA---------- Pteridium_aquilinum_ssp._aquilinum_031_BRFR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_065_CLYW AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_099_EDSC AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_103_ASSP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATTTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_106_OXLN AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATTTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_188_CORF AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTT------------ATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_194_AMTK AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_202_RVIT AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_218_ACAW AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_226_LBSP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_256_AZOR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_293_CPHW AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAAT?AGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_307_BRGW AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_336_RAMD AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_350_NIFR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._aquilinum_TAUR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGGGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACTTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_110_KUFZ AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATTTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_191_GSAF AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_228_MCAM AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_233_MCAM AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_353_BBSA AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_358_NDNQ AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._capense_368_NDNG AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT 'Pteridium aquilinum ssp. capense 503 CAPM/ZOMA' AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATTTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGACATAAAAAGGAATAGCCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGA------------------------------- 'Pteridium aquilinum ssp. centrali-africanum 112 CH3Z/ZAMB' AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATTTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGATACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT 'Pteridium aquilinum ssp. centrali-africanum AKFZ' AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATTTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGATACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACC------------------ 'Pteridium aquilinum ssp. centrali-africanum CAF4' AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATTTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGTTTTGGTTTGGACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGATACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._decompositum_145_MAHI AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._decompositum_292_MAHI AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_029_TTWN AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_071_AIJP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTT----------------------AAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_085_YSCH AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_096_GNCH AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_104_MOGJ AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_113_YOJP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_280_CHJP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._japonicum_316_SHJP AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTATCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA------TTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._latiusculum_143_YCCM AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._latiusculum_147_WMCH AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._latiusculum_148_BRMN AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATTTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._latiusculum_Barrington_2287 AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGAC--------- Pteridium_aquilinum_ssp._latiusculum_Wolf_921 AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pinetorum_164_KUKR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pinetorum_N2nR -------------CTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCA?TTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pinetorum_N6nR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACTCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATAGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pinetorum_RU4K AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGCTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pseudocaudatum_169_FLUS --ATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pseudocaudatum_203_HFLA AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pseudocaudatum_Der_68 AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pubescens_100_AOUS AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pubescens_325_OWUS AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pubescens_Der_66 AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._pubescens_Der_67 AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAGGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAGGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_001_AMSL AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_007_KLPH AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_068_SERI AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_182_PMAL AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_305_YGIN AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_354_WFNQ AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_362_HKSL AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTT-CAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_aquilinum_ssp._wightianum_416_TREV AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATCGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTATTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTACCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTT----------------------AAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_arachnoideum_144_RMEX AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATCTTTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCATGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAAA-GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_arachnoideum_317_SPBR AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAACTTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGATAAATTAGCGAGATTTTCAAAAAGAAAAACGAGA------------------------------------TCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATCAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCATGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAAA-GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAA------------------------ 'Pteridium arachnoideum ME2-1VNZA' AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTT----------------------------------------------CCC?CTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCATGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACG-AAAAAAAGAAAAAAAAAAAA-GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACA-------------- Pteridium_caudatum_238_HECR AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGAGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_caudatum_274_QCOL AAATTTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGCTTTTAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGAGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_caudatum_323_COCR AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATCTTTTTTTTTTTTCTCTGGCGAAGCTAAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--CAGCGAAACGGCATAAAAAGTAATAATCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT 'Pteridium caudatum MD2-2VENZ' ----TTACCAGGGCTTGCAGGTAGGGGTAAAACATCCAACTTGGGAGAGATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCTGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACCCTTTCTCTATCGGAAGGGAGCAGGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCTGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTCATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGTAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGCGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTAAAACTGTCTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAG-----TCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAATAAAAATTCTATCCACGCCACGAAA-----TTTTTTTTTCTCCGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAAGAAAAACCGAAAAACTTCAATTTTCCTTTTTCTCTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGACTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGAGAGAAGCCCATACACTTGTATGTAGTATTAAAAATAGAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACGAAAAAAAAGAAACAAAAAA---GAGCGAAACGGCATAAAAAGGAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAACTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_esculentum_127_KEWA AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGAAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_esculentum_213_CRAN AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_esculentum_275_KONC AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAAAAGAGCGAAACGGCATAAAAAGTAATAATCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_esculentum_324_HNNZ AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_esculentum_332_SVNZ AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGAC--------- Pteridium_esculentum_387_CRDQ AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTCTGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTT-------------------GAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC--TTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACG-AAAAAAAGAAAAAAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------- Pteridium_esculentum_401_RYNA AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTAGAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACAT------------- Pteridium_esculentum_Wolf_638 AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTT-CAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATTAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATAC?CTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAATCGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACAT------------- Pteridium_esculetum_083_WAWA AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATC-TTTTTTTTTTTCTCTGGCGAAGCTGAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTAAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--GAGCGAAACGGCATAAAAAGTAATAGTCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGAAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_semihastatum_251_PFNT AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATCTTTTTTTTTTTTCTCTGGCGAAGCTAAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--CAGCGAAACGGCATAAAAAGTAATAATCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT Pteridium_semihastatum_278_KMAL AAATTTACCAGGGCTTGCAGGTAGAGGTAAAACATCCAACTTGGGAGAAATTCGAGTTGCTACTGATCAATCAACTTCGAGAAAAATTTCCCAATTTTGCGTCCGTTTGGAGGCCAAACAAAGATTACGTTTCAATTATGGATTAACAGAACGCTAACCGCTTAAATACGTCCGTATTGCTAGAAAAACTAGGGGTTCGACAGGCCAGGTACTACCGCAATTACTTGAGATGCGTCTAGATAATGTTATTTTTCACTTGGGTATGGCTTCCACAATTCCCGCCGCTAGACAATTAGTTAACCATAGACACATTTTAGTGAATAATCATGTTGTAGATATACCAAGCTATCGCTGTAAACCAAAAGATATTATTACTGTCCGAAATCGACCAACTTCCTACAATGCACTGAAGGGCGAGTCTCTTTTGGGGGAAAAGATACCGGATCATTTGACTCTTTCTCTATCCGAAGGGAGCAAGCCGACGGGATTAGTGAATCGCATTGCTAGCCGAGAATCCGTCAATTTGAATATAAATGAGTTGTTAGTTGTTGAGTATTACTCTCGCAAAGCTTAACGATCATTCATTTAATTTTCAATTTAACCAAATAATATGGAATTACTATGGCAGTACCCAGGTAAAGGGCTCGGAGTGATAAAAATTAATAAGCAGATTACTGAAAAACTAGCAAAAGTTTTACGGTCTATCTCATTCAGTTATTAGAACAATAATTAACTTCCAATCTCTTAGTTTAAACTAAAATCTTACACCTTTAAGCAAGTTGGTTTGGCATACGACGTGTTATTGTATTCATCGATACGCTTTATTTCAGCGAATCTTCTACTGAGAGATTAGTAATTTTTACAGTTTTTAGTGAAACTGTTTTTAGTAAAAGAACCCTTTCGCTCTTCTGTTTTGGTTTGG-----ACGGCTTTATTTGAAACCCAAGTCTAGTCTTTCTTTCTCAAATCGGTAAATTAGCGAGATTTTCAAAAAGAAAAACGAGAGACTTTTTTTTCAACATCTCTTTATCCGTAGAAAAATCTAACTAATTAATTGGTGAACCCACTCCCTCTCTTCAAGTACTAAATAAATGAGTGCTAGAGACGGAGCGGGATTATGTCATCGTAAAGAAAAATTCTATCCACGCCACGAAATCTTTTTTTTTTTTCTCTGGCGAAGCTAAAAACGATGCCAATTCACGGCTACTTCGAAA-AAAAACCGAAAAACTTCAATTTTCCTTTTTCTTTCACAATCGATCGTATGGTTAACCACTCAACTCCCGAAAGGCTGTGTTATGTAGCATGATTACCAAAATACTAAAAGAGAGCTTTGAGTCAGTTGCTACTAGGAACGTCGACTCAATCAAATCAAGATAGAGTAGGAAGCTCCAGCTAGGAAGAGAACCCAAACGTTTGCTCAAAGAGACTGAAAAACGAGGGGATTTCCGAATCTCATTCAGTCGGTGAATACCGAGATTCGGTAAATAGGATGGCGGGAGAAGCCCATACACTTGTATGTAGTATTAAAA---GAATAGAGCTCATTCTCGCCCGTGAATTTAGCACCAAGTAATATCTGAACCGCTATTTATAAATGGAACG-AAAAAAAGAAAAAAAAAAA--CAGCGAAACGGCATAAAAAGTAATAATCAGTAAGTTTGCGAAGTATGAGAACTGGTATCGAATTCATGAGGAGCCGGTTGAATGGAAATCTTCACGTCCGGTTTTGTATCAGAGATGGAAATTACCGACATCGACTGTAACCCT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Pteridium_cpDNA) = N: 1-1771; CODONPOSSET CodonPositions (CHARACTERS = Pteridium_cpDNA) = N: 1-1771; END; BEGIN TREES; TITLE Tb9449; LINK TAXA = Taxa1; TRANSLATE 1 Pteridium_arachnoideum_317_SPBR, 2 'Pteridium arachnoideum ME2-1VNZA', 3 Pteridium_arachnoideum_144_RMEX, 4 Pteridium_caudatum_238_HECR, 5 Pteridium_caudatum_274_QCOL, 6 Pteridium_caudatum_323_COCR, 7 'Pteridium caudatum MD2-2VENZ', 8 Pteridium_esculetum_083_WAWA, 9 Pteridium_esculentum_127_KEWA, 10 Pteridium_esculentum_213_CRAN, 11 Pteridium_esculentum_275_KONC, 12 Pteridium_esculentum_324_HNNZ, 13 Pteridium_esculentum_332_SVNZ, 14 Pteridium_esculentum_387_CRDQ, 15 Pteridium_esculentum_401_RYNA, 16 Pteridium_esculentum_Wolf_638, 17 Pteridium_aquilinum_ssp._pinetorum_164_KUKR, 18 Pteridium_aquilinum_ssp._pinetorum_N2nR, 19 Pteridium_aquilinum_ssp._pinetorum_N6nR, 20 Pteridium_aquilinum_ssp._pinetorum_RU4K, 21 Pteridium_aquilinum_ssp._aquilinum_002_ASSP, 22 Pteridium_aquilinum_ssp._aquilinum_017_FZSW, 23 Pteridium_aquilinum_ssp._aquilinum_031_BRFR, 24 Pteridium_aquilinum_ssp._aquilinum_065_CLYW, 25 Pteridium_aquilinum_ssp._aquilinum_099_EDSC, 26 Pteridium_aquilinum_ssp._aquilinum_103_ASSP, 27 Pteridium_aquilinum_ssp._aquilinum_106_OXLN, 28 Pteridium_aquilinum_ssp._aquilinum_188_CORF, 29 Pteridium_aquilinum_ssp._aquilinum_194_AMTK, 30 Pteridium_aquilinum_ssp._aquilinum_202_RVIT, 31 Pteridium_aquilinum_ssp._aquilinum_218_ACAW, 32 Pteridium_aquilinum_ssp._aquilinum_226_LBSP, 33 Pteridium_aquilinum_ssp._aquilinum_256_AZOR, 34 Pteridium_aquilinum_ssp._aquilinum_293_CPHW, 35 Pteridium_aquilinum_ssp._aquilinum_307_BRGW, 36 Pteridium_aquilinum_ssp._aquilinum_336_RAMD, 37 Pteridium_aquilinum_ssp._aquilinum_350_NIFR, 38 Pteridium_aquilinum_ssp._capense_110_KUFZ, 39 Pteridium_aquilinum_ssp._capense_191_GSAF, 40 Pteridium_aquilinum_ssp._capense_228_MCAM, 41 Pteridium_aquilinum_ssp._capense_233_MCAM, 42 Pteridium_aquilinum_ssp._capense_353_BBSA, 43 Pteridium_aquilinum_ssp._capense_358_NDNQ, 44 Pteridium_aquilinum_ssp._capense_368_NDNG, 45 'Pteridium aquilinum ssp. capense 503 CAPM/ZOMA', 46 'Pteridium aquilinum ssp. centrali-africanum 112 CH3Z/ZAMB', 47 'Pteridium aquilinum ssp. centrali-africanum AKFZ', 48 'Pteridium aquilinum ssp. centrali-africanum CAF4', 49 Pteridium_aquilinum_ssp._decompositum_145_MAHI, 50 Pteridium_aquilinum_ssp._decompositum_292_MAHI, 51 Pteridium_aquilinum_ssp._japonicum_029_TTWN, 52 Pteridium_aquilinum_ssp._japonicum_071_AIJP, 53 Pteridium_aquilinum_ssp._japonicum_085_YSCH, 54 Pteridium_aquilinum_ssp._japonicum_096_GNCH, 55 Pteridium_aquilinum_ssp._japonicum_104_MOGJ, 56 Pteridium_aquilinum_ssp._japonicum_113_YOJP, 57 Pteridium_aquilinum_ssp._japonicum_280_CHJP, 58 Pteridium_aquilinum_ssp._japonicum_316_SHJP, 59 Pteridium_aquilinum_ssp._latiusculum_143_YCCM, 60 Pteridium_aquilinum_ssp._latiusculum_147_WMCH, 61 Pteridium_aquilinum_ssp._latiusculum_148_BRMN, 62 Pteridium_aquilinum_ssp._latiusculum_Barrington_2287, 63 Pteridium_aquilinum_ssp._latiusculum_Wolf_921, 64 Pteridium_aquilinum_ssp._pseudocaudatum_169_FLUS, 65 Pteridium_aquilinum_ssp._pseudocaudatum_203_HFLA, 66 Pteridium_aquilinum_ssp._pubescens_100_AOUS, 67 Pteridium_aquilinum_ssp._pubescens_325_OWUS, 68 Pteridium_semihastatum_251_PFNT, 69 Pteridium_semihastatum_278_KMAL, 70 Pteridium_aquilinum_ssp._aquilinum_TAUR, 71 Pteridium_aquilinum_ssp._wightianum_001_AMSL, 72 Pteridium_aquilinum_ssp._wightianum_007_KLPH, 73 Pteridium_aquilinum_ssp._wightianum_068_SERI, 74 Pteridium_aquilinum_ssp._wightianum_182_PMAL, 75 Pteridium_aquilinum_ssp._wightianum_305_YGIN, 76 Pteridium_aquilinum_ssp._wightianum_354_WFNQ, 77 Pteridium_aquilinum_ssp._wightianum_362_HKSL, 78 Pteridium_aquilinum_ssp._wightianum_416_TREV, 79 Pteridium_aquilinum_ssp._pubescens_Der_66, 80 Pteridium_aquilinum_ssp._pubescens_Der_67, 81 Pteridium_aquilinum_ssp._pseudocaudatum_Der_68; TREE Fig._2A = [&R] ((1,2,3,((6,68,69),11),((8,9),10,12,13,16),14,15),(((4,5,7),60,64,65,81),((17,19,51,52,53,54,55,57,58),18,20,56),(((((21,26,27),22,24,25,28,29,30,31,32,33,34,35,36,37,70),23),(38,45)),39,40,41,42,43,44,(46,47,48)),(49,50,59,66,67,79,80),61,62,63,(71,72,73,74,76,77,78),75)); END; BEGIN TREES; TITLE Tb9448; LINK TAXA = Taxa1; TRANSLATE 1 Pteridium_arachnoideum_317_SPBR, 2 'Pteridium arachnoideum ME2-1VNZA', 3 Pteridium_arachnoideum_144_RMEX, 4 Pteridium_caudatum_238_HECR, 5 Pteridium_caudatum_274_QCOL, 6 Pteridium_caudatum_323_COCR, 7 'Pteridium caudatum MD2-2VENZ', 8 Pteridium_esculetum_083_WAWA, 9 Pteridium_esculentum_127_KEWA, 10 Pteridium_esculentum_213_CRAN, 11 Pteridium_esculentum_275_KONC, 12 Pteridium_esculentum_324_HNNZ, 13 Pteridium_esculentum_332_SVNZ, 14 Pteridium_esculentum_387_CRDQ, 15 Pteridium_esculentum_401_RYNA, 16 Pteridium_esculentum_Wolf_638, 17 Pteridium_aquilinum_ssp._pinetorum_164_KUKR, 18 Pteridium_aquilinum_ssp._pinetorum_N2nR, 19 Pteridium_aquilinum_ssp._pinetorum_N6nR, 20 Pteridium_aquilinum_ssp._pinetorum_RU4K, 21 Pteridium_aquilinum_ssp._aquilinum_002_ASSP, 22 Pteridium_aquilinum_ssp._aquilinum_017_FZSW, 23 Pteridium_aquilinum_ssp._aquilinum_031_BRFR, 24 Pteridium_aquilinum_ssp._aquilinum_065_CLYW, 25 Pteridium_aquilinum_ssp._aquilinum_099_EDSC, 26 Pteridium_aquilinum_ssp._aquilinum_103_ASSP, 27 Pteridium_aquilinum_ssp._aquilinum_106_OXLN, 28 Pteridium_aquilinum_ssp._aquilinum_188_CORF, 29 Pteridium_aquilinum_ssp._aquilinum_194_AMTK, 30 Pteridium_aquilinum_ssp._aquilinum_202_RVIT, 31 Pteridium_aquilinum_ssp._aquilinum_218_ACAW, 32 Pteridium_aquilinum_ssp._aquilinum_226_LBSP, 33 Pteridium_aquilinum_ssp._aquilinum_256_AZOR, 34 Pteridium_aquilinum_ssp._aquilinum_293_CPHW, 35 Pteridium_aquilinum_ssp._aquilinum_307_BRGW, 36 Pteridium_aquilinum_ssp._aquilinum_336_RAMD, 37 Pteridium_aquilinum_ssp._aquilinum_350_NIFR, 38 Pteridium_aquilinum_ssp._capense_110_KUFZ, 39 Pteridium_aquilinum_ssp._capense_191_GSAF, 40 Pteridium_aquilinum_ssp._capense_228_MCAM, 41 Pteridium_aquilinum_ssp._capense_233_MCAM, 42 Pteridium_aquilinum_ssp._capense_353_BBSA, 43 Pteridium_aquilinum_ssp._capense_358_NDNQ, 44 Pteridium_aquilinum_ssp._capense_368_NDNG, 45 'Pteridium aquilinum ssp. capense 503 CAPM/ZOMA', 46 'Pteridium aquilinum ssp. centrali-africanum 112 CH3Z/ZAMB', 47 'Pteridium aquilinum ssp. centrali-africanum AKFZ', 48 'Pteridium aquilinum ssp. centrali-africanum CAF4', 49 Pteridium_aquilinum_ssp._decompositum_145_MAHI, 50 Pteridium_aquilinum_ssp._decompositum_292_MAHI, 51 Pteridium_aquilinum_ssp._japonicum_029_TTWN, 52 Pteridium_aquilinum_ssp._japonicum_071_AIJP, 53 Pteridium_aquilinum_ssp._japonicum_085_YSCH, 54 Pteridium_aquilinum_ssp._japonicum_096_GNCH, 55 Pteridium_aquilinum_ssp._japonicum_104_MOGJ, 56 Pteridium_aquilinum_ssp._japonicum_113_YOJP, 57 Pteridium_aquilinum_ssp._japonicum_280_CHJP, 58 Pteridium_aquilinum_ssp._japonicum_316_SHJP, 59 Pteridium_aquilinum_ssp._latiusculum_143_YCCM, 60 Pteridium_aquilinum_ssp._latiusculum_147_WMCH, 61 Pteridium_aquilinum_ssp._latiusculum_148_BRMN, 62 Pteridium_aquilinum_ssp._latiusculum_Barrington_2287, 63 Pteridium_aquilinum_ssp._latiusculum_Wolf_921, 64 Pteridium_aquilinum_ssp._pseudocaudatum_169_FLUS, 65 Pteridium_aquilinum_ssp._pseudocaudatum_203_HFLA, 66 Pteridium_aquilinum_ssp._pubescens_100_AOUS, 67 Pteridium_aquilinum_ssp._pubescens_325_OWUS, 68 Pteridium_semihastatum_251_PFNT, 69 Pteridium_semihastatum_278_KMAL, 70 Pteridium_aquilinum_ssp._aquilinum_TAUR, 71 Pteridium_aquilinum_ssp._wightianum_001_AMSL, 72 Pteridium_aquilinum_ssp._wightianum_007_KLPH, 73 Pteridium_aquilinum_ssp._wightianum_068_SERI, 74 Pteridium_aquilinum_ssp._wightianum_182_PMAL, 75 Pteridium_aquilinum_ssp._wightianum_305_YGIN, 76 Pteridium_aquilinum_ssp._wightianum_354_WFNQ, 77 Pteridium_aquilinum_ssp._wightianum_362_HKSL, 78 Pteridium_aquilinum_ssp._wightianum_416_TREV, 79 Pteridium_aquilinum_ssp._pubescens_Der_66, 80 Pteridium_aquilinum_ssp._pubescens_Der_67, 81 Pteridium_aquilinum_ssp._pseudocaudatum_Der_68; TREE Fig._1 = [&R] ((2,14,15,(((6,68,69),11),((8,9),10,12,13,16),(1,3))),(((4,5,7),60,64,65,81),((17,19,51,52,53,54,55,57,58),18,20,56),(((((21,26,27),22,24,25,28,29,30,31,32,33,34,35,36,37,70),23),(38,45)),39,40,41,42,43,44,(46,47,48)),(49,50,59,66,67,79,80),61,62,63,(71,72,73,74,76,77,78),75)); END;