#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:47 GMT TreeBASE (cc) 1994-2008 Study reference: Videira S.I., Groenewald J.Z., Braun U., Shin H., & Crous P.W. 2016. All that glitters is not Ramularia. Studies in Mycology, 83: 49-163. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22449] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=300; TAXLABELS Ramularia_abscondita_CBS_114727__ Ramularia_acris_CBS_109794__ Ramularia_acris_CBS_141107 Ramularia_acris_CPC_25898 Ramularia_acris_CPC_25900 Ramularia_acroptili_CBS_120252__ Ramularia_acroptili_CBS_120253__ Ramularia_acroptili_CPC_18723_ Ramularia_acroptili_CPC_18724_ Ramularia_actinidiae_CBS_141108 Ramularia_agastaches_CPC_10819_ Ramularia_agastaches_CPC_10820_ Ramularia_agastaches_CPC_10821_ Ramularia_agrimoniae_CPC_11450_ Ramularia_agrimoniae_CPC_11451_ Ramularia_agrimoniae_CPC_11452_ Ramularia_agrimoniae_CPC_11651_ Ramularia_agrimoniae_CPC_11652_ Ramularia_agrimoniae_CPC_11653_ Ramularia_aplospora_CBS_109013__ Ramularia_aplospora_CBS_109014__ Ramularia_aplospora_CBS_109120__ Ramularia_aplospora_CBS_109121__ Ramularia_aplospora_CBS_114118__ Ramularia_aplospora_CBS_237.73__ Ramularia_aplospora_CBS_545.82__ Ramularia_archangelicae_CBS_108991__ Ramularia_archangelicae_CBS_108992__ Ramularia_archangelicae_CBS_109011__ Ramularia_archangelicae_CBS_109012__ Ramularia_archangelicae_CBS_288.49__ Ramularia_armoraciae_CBS_241.90 Ramularia_armoraciae_CBS_253.28__ Ramularia_asteris_CBS_131.21__ Ramularia_bellunensis_CBS_116.43__ Ramularia_beticola_CBS_113540__ Ramularia_beticola_CBS_141109 Ramularia_beticola_CBS_151.67__ Ramularia_beticola_CBS_341.29__ Ramularia_beticola_CPC_30063 Ramularia_beticola_CPC_30064 Ramularia_beticola_CPC_30065 Ramularia_beticola_CPC_30067 Ramularia_bosniaca_CBS_123880__ Ramularia_bosniaca_CBS_123881__ Ramularia_buniadis_CBS_114301__ Ramularia_calcea_CBS_101612__ Ramularia_calcea_CBS_101613__ Ramularia_calcea_CBS_114442__ Ramularia_carneola_CBS_108975__ Ramularia_carneola_CBS_108976__ Ramularia_carneola_CBS_108977__ Ramularia_carneola_CBS_108978__ Ramularia_carneola_CBS_109847__ Ramularia_cerastiicola_CBS_115913 Ramularia_chamaedryos_CBS_113307__ Ramularia_chamaedryos_CBS_114731__ Ramularia_chamaedryos_CBS_116577__ Ramularia_chamaedryos_CBS_118794__ Ramularia_chelidonii_CBS_113317__ Ramularia_chelidonii_CPC_12208_ Ramularia_chelidonii_CPC_12209_ Ramularia_coleosporii_CBS_131756__ Ramularia_coleosporii_CBS_131757__ Ramularia_coleosporii_CBS_131759__ Ramularia_coleosporii_CBS_131760__ Ramularia_coleosporii_CBS_131762__ Ramularia_coleosporii_CBS_131764__ Ramularia_coleosporii_CPC_10669_ Ramularia_coleosporii_CPC_10731_ Ramularia_coleosporii_CPC_10732_ Ramularia_coleosporii_CPC_10748_ 'Ramularia collo-cygni CBS 101180 ' 'Ramularia collo-cygni CBS 101181 ' 'Ramularia collo-cygni CBS 101182 ' 'Ramularia collo-cygni CBS 119439' 'Ramularia collo-cygni CBS 119440' 'Ramularia collo-cygni CBS 119441' 'Ramularia collo-cygni CBS 119442' Ramularia_coryli_CBS_117800 Ramularia_cupulariae_CBS_235.73__ Ramularia_cyclaminicola_CBS_399.51__ Ramularia_cynarae_CBS_114728__ Ramularia_cynarae_CBS_114729__ Ramularia_cynarae_CBS_128779 Ramularia_cynarae_CBS_128912 Ramularia_cynarae_CPC_18427_ Ramularia_cynarae_CPC_18726_ Ramularia_cynarae_CPC_25896 Ramularia_cynarae_CPC_25897 Ramularia_deusta_var._deusta_CBS_473.50__ Ramularia_didyma_var._didyma_CBS_114299__ Ramularia_didyma_var._didyma_CBS_420.67__ Ramularia_diervillae_CPC_16859_ Ramularia_diervillae_CPC_16860_ Ramularia_diervillae_CPC_16863_ Ramularia_diervillae_CPC_16864_ 'Ramularia digitalis-ambiguae CBS 297.37 ' 'Ramularia digitalis-ambiguae CBS 434.67 ' Ramularia_endophylla_CBS_101680__ Ramularia_endophylla_CBS_113265__ Ramularia_endophylla_CBS_113869__ Ramularia_endophylla_CBS_113871__ Ramularia_endophylla_CBS_115302__ Ramularia_endophylla_CBS_115303__ Ramularia_eucalypti__CBS_120728 Ramularia_eucalypti__CPC_19188_ Ramularia_eucalypti_CBS_120726 Ramularia_euonymicola_CBS_113308__ Ramularia_gaultheriae_299.80__ Ramularia_gei_CBS_113977__ Ramularia_gei_CBS_344.49__ Ramularia_geranii_CBS_159.24__ Ramularia_geranii_CBS_160.24__ Ramularia_geraniicola__CBS_141110 Ramularia_glechomatis_CBS_108979__ Ramularia_glechomatis_CBS_108980__ Ramularia_glechomatis_CBS_343.49__ Ramularia_glennii_CBS_120727 Ramularia_glennii_CBS_122989_ Ramularia_glennii_CBS_129441__ Ramularia_glennii_CPC_16560_ Ramularia_glennii_CPC_16565_ Ramularia_glennii_CPC_18468_ Ramularia_grevilleana_CBS_114732__ Ramularia_grevilleana_CBS_259.36__ Ramularia_grevilleana_CBS_298.34__ Ramularia_grevilleana_CBS_719.84__ Ramularia_haroldporteri_CBS_137272 Ramularia_haroldporteri_CPC_16297_ Ramularia_helminthiae_CBS_118418__ Ramularia_helminthiae_CPC_11502_ Ramularia_helminthiae_CPC_11504_ Ramularia_heraclei_CBS_108969__ Ramularia_heraclei_CBS_108972__ Ramularia_heraclei_CBS_108987__ Ramularia_heraclei_CBS_108988__ Ramularia_heraclei_CBS_113976__ Ramularia_heraclei_CBS_194.25__ Ramularia_heraclei_CPC_11505_ Ramularia_heraclei_CPC_11506_ Ramularia_heraclei_CPC_11507_ 'Ramularia hieraci-umbelati CPC 10690 ' 'Ramularia hieraci-umbelati CPC 10691 ' 'Ramularia hieraci-umbelati CPC 10692 ' 'Ramularia hieraci-umbelati CPC 10788 ' 'Ramularia hieraci-umbelati CPC 10789 ' 'Ramularia hydrangeae-macrophyllae CBS 113614 ' 'Ramularia hydrangeae-macrophyllae CBS 114117 ' 'Ramularia hydrangeae-macrophyllae CBS 118408 ' 'Ramularia hydrangeae-macrophyllae CBS 118410 ' 'Ramularia hydrangeae-macrophyllae CBS 122272 ' 'Ramularia hydrangeae-macrophyllae CBS 122273 ' 'Ramularia hydrangeae-macrophyllae CBS 122625' 'Ramularia hydrangeae-macrophyllae CBS 159.82 ' 'Ramularia hydrangeae-macrophyllae CBS 341.49 ' 'Ramularia hydrangeae-macrophyllae CBS 766.84 ' 'Ramularia hydrangeae-macrophyllae CPC 14811 ' 'Ramularia hydrangeae-macrophyllae CPC 19026 ' 'Ramularia hydrangeae-macrophyllae CPC 19027 ' 'Ramularia hydrangeae-macrophyllae CPC 19030 ' 'Ramularia hydrangeae-macrophyllae CPC 19854 ' 'Ramularia hydrangeae-macrophyllae CPC 20406' 'Ramularia hydrangeae-macrophyllae CPC 20406 ' 'Ramularia hydrangeae-macrophyllae CPC 20484 ' 'Ramularia hydrangeae-macrophyllae CPC 25901' 'Ramularia hydrangeae-macrophyllae CPC 25902 ' 'Ramularia hydrangeae-macrophyllae CPC 25903' 'Ramularia hydrangeae-macrophyllae CPC 25904' 'Ramularia hydrangeae-macrophyllae CPC 25905' 'Ramularia hydrangeae-macrophyllae CPC 25906' 'Ramularia hydrangeae-macrophyllae CPC 25907' 'Ramularia hydrangeae-macrophyllae CPC 25908' Ramularia_hydrangeicola_CPC_14767_ Ramularia_hydrangeicola_CPC_14768_ Ramularia_hydrangeicola_CPC_14769_ Ramularia_hydrangeicola_CPC_14832_ Ramularia_hydrangeicola_CPC_14833_ Ramularia_hydrangeicola_CPC_14834_ Ramularia_inaequalis_CBS_141111 Ramularia_inaequalis_CBS_250.96__ Ramularia_inaequalis_CPC_15752_ Ramularia_inaequalis_CPC_15753_ Ramularia_inaequalis_CPC_15815_ Ramularia_inaequalis_CPC_25742 Ramularia_kriegeriana_CPC_10825_ Ramularia_kriegeriana_CPC_10826_ Ramularia_kriegeriana_CPC_10827_ Ramularia_lamii_var._lamii_CBS_108970__ Ramularia_lamii_var._lamii_CBS_108971__ Ramularia_leonuri_CBS_141112 Ramularia_leonuri_CPC_11312_ Ramularia_leonuri_CPC_11313_ Ramularia_leonuri_CPC_11314_ Ramularia_leonuri_CPC_11411_ Ramularia_leonuri_CPC_11412_ Ramularia_leonuri_CPC_11413_ Ramularia_leonuri_CPC_14570_ Ramularia_leonuri_CPC_14571_ Ramularia_lethalis_CBS_141113 Ramularia_ligustrina_CBS_379.52__ Ramularia_major_CBS_141114 Ramularia_major_CPC_12543_ Ramularia_major_CPC_12544_ Ramularia_mali_CBS_129581__ Ramularia_malicola_CBS_119227__ Ramularia_miae_CBS_120121 Ramularia_miae_CPC_19770_ Ramularia_miae_CPC_19835_ Ramularia_miae_CPC_21692_ Ramularia_neodeusta_CBS_141115 Ramularia_neodeusta_CPC_13568_ Ramularia_nyssicola_CBS_127664__ Ramularia_nyssicola_CBS_127665__ Ramularia_osterici_CBS_141116 Ramularia_osterici_CPC_10751_ Ramularia_osterici_CPC_10752_ Ramularia_parietariae_CBS_123730__ Ramularia_parietariae_CBS_123731__ 'Ramularia phacae-frigidae CBS 234.55 ' Ramularia_plurivora__CPC_16123_ Ramularia_plurivora__CPC_16124_ Ramularia_plurivora_CBS_118693 Ramularia_plurivora_CBS_118743 Ramularia_pratensis_var._pratensis_CBS_122105__ Ramularia_pratensis_var._pratensis_CPC_16868_ Ramularia_pratensis_var._pratensis_CPC_19448_ Ramularia_pusilla_CBS_124973__ Ramularia_rhabdospora_CBS_118415__ Ramularia_rhabdospora_CBS_312.92__ Ramularia_rubella_CBS_114440__ Ramularia_rubella_CBS_120161__ Ramularia_rubella_CBS_141117 Ramularia_rubella_CPC_15748_ Ramularia_rubella_CPC_15749_ Ramularia_rubella_CPC_15750_ Ramularia_rubella_CPC_15821_ Ramularia_rubella_CPC_19471_ Ramularia_rubella_CPC_19472_ Ramularia_rufibasis_CBS_114567__ Ramularia_rumicicola_CBS_141118 Ramularia_rumicicola_CPC_11295_ Ramularia_rumicicola_CPC_11296_ Ramularia_rumicis_CBS_114300__ Ramularia_sp._A_CBS_114566__ Ramularia_sp._B_CBS_114568__ Ramularia_sp._C_CBS_299.49__ Ramularia_sp._D_CBS_135.23__ Ramularia_sphaeroidea_CBS_112891__ Ramularia_stellariicola_CBS_130592 Ramularia_stellariicola_CPC_11298_ Ramularia_stellenboschensis_CBS_130600 Ramularia_tovarae_CBS_113305__ Ramularia_tricherae_CBS_108973__ Ramularia_tricherae_CBS_108974__ Ramularia_tricherae_CBS_108989__ Ramularia_tricherae_CBS_108990__ Ramularia_tricherae_CBS_108994__ Ramularia_tricherae_CBS_108995__ Ramularia_tricherae_CBS_236.73__ Ramularia_trigonotidis_CBS_141119 Ramularia_trigonotidis_CPC_14765_ Ramularia_trigonotidis_CPC_14766_ Ramularia_trollii_CBS_109118__ Ramularia_trollii_CBS_109119__ Ramularia_unterseheri_CBS_117879 Ramularia_unterseheri_CBS_124826__ Ramularia_unterseheri_CBS_124838__ Ramularia_unterseheri_CBS_124884__ Ramularia_unterseheri_CBS_130721__ Ramularia_uredinicola_CBS_131769__ Ramularia_uredinicola_CBS_131770__ Ramularia_uredinicola_CBS_131771__ Ramularia_uredinicola_CBS_141120 Ramularia_uredinicola_CBS_179.68__ Ramularia_uredinicola_CPC_11481_ Ramularia_uredinicola_CPC_11482_ Ramularia_uredinicola_CPC_12491_ Ramularia_uredinicola_CPC_12492_ Ramularia_uredinicola_CPC_12493_ Ramularia_urticae_CBS_105.26__ Ramularia_urticae_CBS_113974__ Ramularia_urticae_CBS_162.91__ Ramularia_urticae_CPC_14807_ Ramularia_valerianae_var._valerianae_CBS_109122__ Ramularia_valerianae_var._valerianae_CBS_109123__ Ramularia_vallisumbrosae_CBS_271.38__ Ramularia_vallisumbrosae_CBS_272.38__ Ramularia_variabilis_CBS_141121___ Ramularia_variabilis_CPC_16865_ Ramularia_variabilis_CPC_16866_ Ramularia_veronicicola_CBS_113981__ Ramularia_vizellae_CBS_115981__ Ramularia_vizellae_CBS_115982__ Ramularia_vizellae_CBS_117798 Ramularia_vizellae_CBS_117871 Ramularia_vizellae_CBS_117872__ Ramularia_vizellae_CBS_130601 Ramularia_weberiana_CBS_136.23__ Zymoseptoria_halophila_CBS_128854 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=297; TAXLABELS Ramularia_abscondita_CBS_114727_ Ramularia_acris_CBS_109794_ Ramularia_acris_CPC_25898 Ramularia_acris_CPC_25899 Ramularia_acris_CPC_25900 Ramularia_acroptili_CBS_120252_ Ramularia_acroptili_CBS_120253_ Ramularia_acroptili_CPC_18723_ Ramularia_acroptili_CPC_18724_ Ramularia_actinidae_CPC_11675_ Ramularia_agastaches_CPC_10819_ Ramularia_agastaches_CPC_10820_ Ramularia_agastaches_CPC_10821_ Ramularia_agrimoniae_CPC_11450_ Ramularia_agrimoniae_CPC_11451_ Ramularia_agrimoniae_CPC_11452_ Ramularia_agrimoniae_CPC_11651_ Ramularia_agrimoniae_CPC_11652_ Ramularia_agrimoniae_CPC_11653_ Ramularia_aplospora_CBS_109013_ Ramularia_aplospora_CBS_109014_ Ramularia_aplospora_CBS_109120_ Ramularia_aplospora_CBS_109121_ Ramularia_aplospora_CBS_114118_ Ramularia_aplospora_CBS_237.73_ Ramularia_aplospora_CBS_545.82_ Ramularia_archangelicae_CBS_108991_ Ramularia_archangelicae_CBS_108992_ Ramularia_archangelicae_CBS_109011_ Ramularia_archangelicae_CBS_109012_ Ramularia_archangelicae_CBS_288.49_ Ramularia_armoraciae_CBS_241.90 Ramularia_armoraciae_CBS_253.28_ Ramularia_asteris_CBS_131.21_ Ramularia_bellunensis_CBS_116.43_ Ramularia_beticola_CBS_113540_ Ramularia_beticola_CBS_151.67_ Ramularia_beticola_CBS_341.29_ Ramularia_beticola_CPC_30063 Ramularia_beticola_CPC_30064 Ramularia_beticola_CPC_30065 Ramularia_beticola_CPC_30066 Ramularia_beticola_CPC_30067 Ramularia_bosniaca_CBS_123880_ Ramularia_bosniaca_CBS_123881_ Ramularia_buniadis_CBS_114301_ Ramularia_calcea_CBS_101612_ Ramularia_calcea_CBS_101613_ Ramularia_calcea_CBS_114442_ Ramularia_carneola_CBS_108975_ Ramularia_carneola_CBS_108976_ Ramularia_carneola_CBS_108977_ Ramularia_carneola_CBS_108978_ Ramularia_carneola_CBS_109847_ Ramularia_cerastiicola_CBS_115913 Ramularia_chamaedryos_CBS_113307_ Ramularia_chamaedryos_CBS_114731_ Ramularia_chamaedryos_CBS_116577_ Ramularia_chamaedryos_CBS_118794_ Ramularia_chelidonii_CBS_113317_ Ramularia_chelidonii_CPC_12208_ Ramularia_chelidonii_CPC_12209_ Ramularia_coleosporii_10669_ Ramularia_coleosporii_CBS_131756_ Ramularia_coleosporii_CBS_131757_ Ramularia_coleosporii_CBS_131759_ Ramularia_coleosporii_CBS_131760_ Ramularia_coleosporii_CBS_131762_ Ramularia_coleosporii_CBS_131764_ Ramularia_coleosporii_CPC_10731_ Ramularia_coleosporii_CPC_10732_ Ramularia_coleosporii_CPC_10748_ 'Ramularia collo-cygni CBS 101180 ' 'Ramularia collo-cygni CBS 101181 ' 'Ramularia collo-cygni CBS 101182 ' 'Ramularia collo-cygni CBS 119439' 'Ramularia collo-cygni CBS 119440' 'Ramularia collo-cygni CBS 119441' 'Ramularia collo-cygni CBS 119442' Ramularia_coryli_CBS_117800_ Ramularia_cupulariae_CBS_235.73_ Ramularia_cyclaminicola_CBS_399.51_ Ramularia_cynarae_CBS_114728_ Ramularia_cynarae_CBS_114729_ Ramularia_cynarae_CBS_128779 Ramularia_cynarae_CBS_128912 Ramularia_cynarae_CBS_18427_ Ramularia_cynarae_CPC_18726_ Ramularia_cynarae_CPC_25896 Ramularia_cynarae_CPC_25897 Ramularia_deusta_var._deusta_CBS__473.50_ Ramularia_didyma_var._didyma_CBS_114299_ Ramularia_didyma_var._didyma_CBS_420.67_ Ramularia_diervillae_CPC_16860_ Ramularia_diervillae_CPC_16863_ Ramularia_diervillae_CPC_16864_ 'Ramularia digitalis-ambiguae CBS 297.37 ' 'Ramularia digitalis-ambiguae CBS 434.67 ' Ramularia_endophylla_CBS_101680_ Ramularia_endophylla_CBS_113265_ Ramularia_endophylla_CBS_113869_ Ramularia_endophylla_CBS_113871_ Ramularia_endophylla_CBS_115302_ Ramularia_endophylla_CBS_115303_ Ramularia_eucalypti_CBS_120726 Ramularia_eucalypti_CBS_120728 Ramularia_eucalypti_CPC_19188_ Ramularia_euonymicola_CBS_113308_ Ramularia_gaultheriae_CBS_299.80 Ramularia_gei_CBS_113977_ Ramularia_gei_CBS_344.49_ Ramularia_geranii_CBS_159.24_ Ramularia_geranii_CBS_160.24_ Ramularia_geraniicola_CPC_25912_ Ramularia_glechomatis_CBS_108979_ Ramularia_glechomatis_CBS_108980_ Ramularia_glechomatis_CBS_343.49_ Ramularia_glennii_CBS_120727 Ramularia_glennii_CBS_122989 Ramularia_glennii_CBS_129441_ Ramularia_glennii_CPC_16560_ Ramularia_glennii_CPC_16565_ Ramularia_glennii_CPC_18468_ Ramularia_grevilleana_CBS_114732_ Ramularia_grevilleana_CBS_259.36_ Ramularia_grevilleana_CBS_298.34_ Ramularia_grevilleana_CBS_719.84_ Ramularia_haroldporteri_CPC_16297_ Ramularia_haroldporterii_CBS_137272 Ramularia_helminthiae_CBS_118418_ Ramularia_helminthiae_CPC_11502_ Ramularia_helminthiae_CPC_11504_ Ramularia_heraclei_CBS_108987_ Ramularia_heraclei_CBS_108988_ Ramularia_heraclei_CBS_113976_ Ramularia_heraclei_CBS_194.25_ Ramularia_heraclei_CPC_11505_ Ramularia_heraclei_CPC_11506_ Ramularia_heraclei_CPC_11507_ 'Ramularia hieraci-umbelati CPC 10690 ' 'Ramularia hieraci-umbelati CPC 10691 ' 'Ramularia hieraci-umbelati CPC 10692 ' 'Ramularia hieraci-umbelati CPC 10788 ' 'Ramularia hieraci-umbelati CPC 10789 ' 'Ramularia hydrangeae-macrophyllae CBS 113614 ' 'Ramularia hydrangeae-macrophyllae CBS 114117 ' 'Ramularia hydrangeae-macrophyllae CBS 118408 ' 'Ramularia hydrangeae-macrophyllae CBS 118410 ' 'Ramularia hydrangeae-macrophyllae CBS 122272 ' 'Ramularia hydrangeae-macrophyllae CBS 122273 ' 'Ramularia hydrangeae-macrophyllae CBS 122625 ' 'Ramularia hydrangeae-macrophyllae CBS 159.82 ' 'Ramularia hydrangeae-macrophyllae CBS 341.49 ' 'Ramularia hydrangeae-macrophyllae CBS 766.84 ' 'Ramularia hydrangeae-macrophyllae CPC 14811 ' 'Ramularia hydrangeae-macrophyllae CPC 19026 ' 'Ramularia hydrangeae-macrophyllae CPC 19027 ' 'Ramularia hydrangeae-macrophyllae CPC 19030 ' 'Ramularia hydrangeae-macrophyllae CPC 19854 ' 'Ramularia hydrangeae-macrophyllae CPC 20406' 'Ramularia hydrangeae-macrophyllae CPC 20406 ' 'Ramularia hydrangeae-macrophyllae CPC 20484 ' 'Ramularia hydrangeae-macrophyllae CPC 25901' 'Ramularia hydrangeae-macrophyllae CPC 25902' 'Ramularia hydrangeae-macrophyllae CPC 25903' 'Ramularia hydrangeae-macrophyllae CPC 25904' 'Ramularia hydrangeae-macrophyllae CPC 25905' 'Ramularia hydrangeae-macrophyllae CPC 25906' 'Ramularia hydrangeae-macrophyllae CPC 25907' 'Ramularia hydrangeae-macrophyllae CPC 25908' Ramularia_hydrangeicola_CPC_14767_ Ramularia_hydrangeicola_CPC_14768_ Ramularia_hydrangeicola_CPC_14769_ Ramularia_hydrangeicola_CPC_14832_ Ramularia_hydrangeicola_CPC_14833_ Ramularia_hydrangeicola_CPC_14834_ Ramularia_inaequalis_CBS_250.96_ Ramularia_inaequalis_CPC_15752_ Ramularia_inaequalis_CPC_15753_ Ramularia_inaequalis_CPC_15815_ Ramularia_inaequalis_CPC_25741 Ramularia_inaequalis_CPC_25742 Ramularia_kriegeriana_CPC_10825_ Ramularia_kriegeriana_CPC_10826_ Ramularia_kriegeriana_CPC_10827_ Ramularia_lamii_var._lamii_CBS_108970_ Ramularia_lamii_var._lamii_CBS_108971_ Ramularia_leonuri_CPC_11312_ Ramularia_leonuri_CPC_11313_ Ramularia_leonuri_CPC_11314_ Ramularia_leonuri_CPC_11411_ Ramularia_leonuri_CPC_11412_ Ramularia_leonuri_CPC_11413_ Ramularia_leonuri_CPC_14570_ Ramularia_leonuri_CPC_14571_ Ramularia_leonuri_CPC_14572_ Ramularia_lethalis_CPC_25910 Ramularia_ligustrina_CBS_379.52_ Ramularia_major_CBS_141114 Ramularia_major_CPC_12543_ Ramularia_major_CPC_12544_ Ramularia_mali_CBS_129581_ Ramularia_malicola_CBS_119227_ Ramularia_miae_CBS_120121 Ramularia_miae_CPC_19770_ Ramularia_miae_CPC_19835_ Ramularia_miae_CPC_21692_ Ramularia_neodeusta_CBS_141115 Ramularia_neodeusta_CPC_13568_ Ramularia_nyssicola_CBS_127664_ Ramularia_nyssicola_CBS_127665_ Ramularia_osterici_CBS_141116 Ramularia_osterici_CPC_10751_ Ramularia_osterici_CPC_10752_ Ramularia_parietariae_CBS_123730_ Ramularia_parietariae_CBS_123731_ 'Ramularia phacae-frigidae CBS 234.55 ' Ramularia_plurivora_CBS_118693_ Ramularia_plurivora_CBS_118743_ Ramularia_plurivora_CPC_16123_ Ramularia_plurivora_CPC_16124_ Ramularia_pratensis_var._pratensis_CBS_122105_ Ramularia_pratensis_var._pratensis_CPC_16868_ Ramularia_pratensis_var._pratensis_CPC_19448_ Ramularia_pusilla_CBS_124973_ Ramularia_rhabdospora_CBS_118415_ Ramularia_rhabdospora_CBS_312.92_ Ramularia_rubella_CBS_114440_ Ramularia_rubella_CBS_120161_ Ramularia_rubella_CPC_15748_ Ramularia_rubella_CPC_15749_ Ramularia_rubella_CPC_15750_ Ramularia_rubella_CPC_15821_ Ramularia_rubella_CPC_19471_ Ramularia_rubella_CPC_19472_ Ramularia_rubella_CPC_25911 Ramularia_rufibasis_CBS_114567_ Ramularia_rumicicola_CBS_141118 Ramularia_rumicicola_CPC_11295_ Ramularia_rumicicola_CPC11296_ Ramularia_rumicis_CBS_114300_ Ramularia_sp._A_CBS_114566_ Ramularia_sp._B_CBS_114568_ Ramularia_sp._C_CBS_299.49_ Ramularia_sp._D_CBS_135.23_ Ramularia_sphaeroidea_CBS_112891_ Ramularia_stellariicola_CBS_130592_ Ramularia_stellariicola_CPC_11298_ Ramularia_stellenboschensis_CBS_130600_ Ramularia_tovarae_CBS_113305_ Ramularia_tricherae_CBS_108973_ Ramularia_tricherae_CBS_108974_ Ramularia_tricherae_CBS_108989_ Ramularia_tricherae_CBS_108990_ Ramularia_tricherae_CBS_108994_ Ramularia_tricherae_CBS_108995_ Ramularia_tricherae_CBS_236.73_ Ramularia_trigonotidis__CPC_14765_ Ramularia_trigonotidis_CBS_141119 Ramularia_trigonotidis_CPC_14766_ Ramularia_trollii_CBS_109118_ Ramularia_trollii_CBS_109119_ Ramularia_unterseheri_CBS_117879_ Ramularia_unterseheri_CBS_124826_ Ramularia_unterseheri_CBS_124838_ Ramularia_unterseheri_CBS_124884_ Ramularia_unterseheri_CBS_130721_ Ramularia_uredinicola_CBS_141120 Ramularia_uredinicola_CBS_179.68_ Ramularia_uredinicola_CPC_11481_ Ramularia_uredinicola_CPC_11482_ Ramularia_uredinicola_CPC_12491_ Ramularia_uredinicola_CPC_12492_ Ramularia_uredinicola_CPC_12493_ Ramularia_uredinicola_CPC_131769_ Ramularia_uredinicola_CPC_131770_ Ramularia_uredinicola_CPC_131771_ Ramularia_urticae_CBS_113974_ Ramularia_urticae_CBS_162.91_ Ramularia_urticae_CPC_105.26_ Ramularia_urticae_CPC_14807_ Ramularia_valerianae_var._valerianae_CBS_109122_ Ramularia_valerianae_var._valerianae_CBS_109123_ Ramularia_vallisumbrosae_CBS_271.38_ Ramularia_vallisumbrosae_CBS_272.38_ Ramularia_variabilis_CBS_141121 Ramularia_variabilis_CPC_16865_ Ramularia_variabilis_CPC_16866_ Ramularia_veronicicola_CBS_113981_ Ramularia_vizellae_CBS_115981_ Ramularia_vizellae_CBS_115982_ Ramularia_vizellae_CBS_117798 Ramularia_vizellae_CBS_117871 Ramularia_vizellae_CBS_117872_ Ramularia_vizellae_CBS_130601_ Ramularia_weberiana_CBS_136.23_ Zymoseptoria_halophila_CBS_128854_ ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=187; TAXLABELS Acrodontium_crateriforme_CBS_144.33_ Acrodontium_crateriforme_CBS_151.58_ Acrodontium_crateriforme_CBS_840.71_ Acrodontium_crateriforme_CBS_842.71_ Acrodontium_crateriforme_CBS_985.70_ Acrodontium_crateriforme_CPC_11509_ Acrodontium_crateriforme_CPC_11519_ Acrodontium_crateriforme_CPC_22172_ Acrodontium_crateriforme_CPC_25894 Acrodontium_crateriforme_CPC_25895 Acrodontium_fagicola_CBS_714.79_ Acrodontium_luzulae_CBS_839.71_ Acrodontium_luzulae_CBS_841.71_ Acrodontium_pigmentosum_CBS_111111_ Aseudocercosporella_trigonotidis__CBS_131890 Aseudocercosporella_trigonotidis_CPC_10865_ Caryophylloseptoria_lychnidis_CBS_109102_ Caryophylloseptoria_pseudolychnidis_CBS_128614_ Cercospora_campi_silii_CBS_132615 Cercospora_cf._chenopodii_CBS_132677_ Cercospora_cf._chenopodii_CPC_12450_ Cercospora_dubia_CPC_15600_ Cercospora_sojina_CBS_132615 Cercospora_sojina_CPC_11422_ Cercospora_sorghi_CBS_478.92_ Cercospora_sp._CBS_220.31_ Cercosporella_catenulata_CBS_355.73_ Cercosporella_dolichandrae_CBS_138101_ Cercosporella_sp._CPC_19492_ Cercosporella_virgaureae_CBS_113304_ Cercosporella_virgaureae_CPC_10286_ Cercosporella_virgaureae_CPC_10287_ Cercosporella_virgaureae_CPC_10288_ Cercosporella_virgaureae_CPC_11456_ Cercosporella_virgaureae_CPC_11457_ Cercosporella_virgaureae_CPC_11460_ Cercosporella_virgaureae_CPC_11461_ Cladosporium_cladosporioides_CBS_112388_ Dissoconium_aciculare_CBS_204.89_ Dothistroma_pini_CBS_116486_ Dothistroma_pini_CBS_121005_ Dothistroma_septosporum_CPC_16798_ Epicoleosporium_ramularioides_CPC_10672_ Epicoleosporium_ramularioides_CPC_10673_ Filiella_pastinacae_CBS_114116_ Fusoidiella_depressa_CBS_141335 Microcyclosporella_mali_CBS_126136_ Microcyclosporella_sp._CBS_118960_ Microcyclosporella_sp._CBS_118969_ Microcyclosporella_sp._CBS_119461_ Microcyclosporella_sp._CBS_125651_ Microcyclosporella_sp._CBS_125653_ Microcyclosporella_sp._CBS_125654_ Mycosphaerelloides_madeirae_CBS_112895_ Mycosphaerelloides_madeirae_CBS_115936_ Mycosphaerelloides_madeirae_CBS_116066_ Mycosphaerelloides_madeirae_CBS_116068_ Neocercospora_ammicola_CBS_136450_ Neopseudocercosporella_brassicicola_CBS_173.88_ Neopseudocercosporella_brassicicola_CBS_228.32_ Neopseudocercosporella_brassicicola_CBS_267.53_ Neopseudocercosporella_capsellae__CBS_131896 Neopseudocercosporella_capsellae_CBS_112032_ Neopseudocercosporella_capsellae_CBS_112033_ Neopseudocercosporella_capsellae_CBS_135464_ Neopseudocercosporella_capsellae_CPC_12518_ Neopseudocercosporella_capsellae_CPC_12519_ Neopseudocercosporella_capsellae_CPC_14774_ Pallidocercospora_acaciigera_CBS_112515_ Pallidocercospora_crystallina_CBS_111045_ Pallidocercospora_heimii_CBS_132012 Pallidocercospora_irregularimosa_CBS_111211_ Pallidocercospora_konae_CBS_111028_ Parapenidiella_pseudotasmaniensis_CBS_111681_ Parapenidiella_pseudotasmaniensis_CBS_124991_ Parapenidiella_tasmaniensis_CBS_111687_ Pseudocercospora_dingleyae_CBS_114645_ Pseudocercospora_eucalyptorum_CBS_114866_ Pseudocercospora_eucalyptorum_CPC_11713_ Pseudocercospora_flavoma_CBS_124990_ Pseudocercospora_fori_CBS_113286_ Pseudocercospora_macadamiae_CBS_133432_ Pseudocercospora_metrosideri_CBS_114294_ Pseudocercospora_myopori_CBS_114644_ Pseudocercospora_norchiensis_CBS_120738_ Pseudocercospora_pistacina_CPC_23118_ Pseudocercospora_robusta_CBS_111175_ Pseudocercospora_sp._CBS_113386_ Pseudocercospora_sp._CPC_19535_ Pseudocercospora_sp._CPC_19537_ Pseudocercospora_vitis_CPC_11595_ Pseudocercosporella_bakeri_CBS_119488_ Pseudocercosporella_bakeri_CBS_125685_ Pseudocercosporella_sp._CBS_110780 Ramichloridium_apiculatum_CBS_156.59_ Ramichloridium_apiculatum_CBS_400.76_ Ramichloridium_sp._CPC_12310_ Ramularia_acroptili_CBS_120253_ Ramularia_alangiicola_CPC_10299_ Ramularia_archangelicae_CBS_288.49_ Ramularia_beticola_CBS_113540_ Ramularia_buniadis_CBS_114301_ Ramularia_chamaedryos_CBS_113307_ Ramularia_coleosporii_CPC_10653_ 'Ramularia collo-cygni CBS 101180 ' Ramularia_endophylla_CBS_113265_ Ramularia_eucalypti_CBS_120726 Ramularia_grevilleana_CBS_114732_ Ramularia_heraclei_CPC_11505_ 'Ramularia hydrangeae-macrophyllae CBS 122273 ' Ramularia_kriegeriana_CPC_10825_ Ramularia_macrospora_CBS_109015_ Ramularia_major_CPC_12544_ Ramularia_primulae_CBS_120.68_ Ramularia_proteae_CBS_112161 Ramularia_pseudoglycines_CBS_141100 Ramularia_pseudoglycines_CPC_18241_ Ramularia_pseudoglycines_CPC_20036_ Ramularia_pusilla_CBS_124973_ Ramularia_rubella_CPC_19471_ Ramularia_rufibasis_CBS_114567_ Ramularia_sp._A_CBS_114566_ Ramularia_sp._CPC_11501_ Ramularia_stellariicola_CBS_130592_ Ramularia_stellariicola_CPC_11298_ Ramularia_stellenboschensis_CBS_130600 Ramularia_trollii_CBS_109118_ Ramularia_trollii_CBS_109119_ Ramularia_uredinicola_CPC_11852_ Ramularia_vallisumbrosae_CBS_271.38_ Ramularia_vizellae_CBS_130601 Ramularia_weigeliae_CBS_113309_ Ramulariopsis_gossypii_CBS_141099 Readeriella_angustia_CBS_124998_ Readeriella_eucalyptigena_CPC_13026_ Readeriella_menaiensis_CBS_125003_ Readeriella_pseudocallista_CPC_13599_ Readeriella_tasmanica_CBS_125002_ Septoria_cerastii_CPC_12343_ Septoria_dysentericae_CPC_12328_ Septoria_lamiicola_CBS_123882 Septoria_leucathemi_CBS_353.58_ Septoria_lycopersici_CBS_128654_ Septoria_paridis_CBS_109110_ Sphaerulina_berberidis_CBS_324.52_ Sphaerulina_betulae_CBS_128597_ Sphaerulina_chaenomelis_CBS_131897_ Sphaerulina_gei_CBS_128632_ Sphaerulina_koreana_CBS_131898_ Sphaerulina_koreana_CBS_135462_ Sphaerulina_sp._CPC_13566_ Sphaerulina_tirolensis_CBS_109018_ Stromatoseptoria_castaneicola_CBS_102322_ Stromatoseptoria_castaneicola_CBS_102377_ Teratoramularia__infinita_CBS_120815_ Teratoramularia__infinita_CBS_141104 Teratoramularia__persicariae__CBS_195.27_ Teratoramularia__persicariae_CBS_141105 Teratoramularia__persicariae_CPC_11408_ Teratoramularia__persicariae_CPC_11409_ Teratoramularia__rumicicola_CBS_141106 Teratoramularia__rumicicola_CPC_14652_ Teratoramularia__rumicicola_CPC_14654_ Teratoramularia_kirschneriana_CBS_113093_ Teratosphaeria_biformis_CBS_124578_ Teratosphaeria_cryptica_CBS_111663_ Teratosphaeria_eucalypti_CPC_12552_ Teratosphaeria_gauchensis_CBS_119465_ Teratosphaeria_molleriana_CBS_118359_ Uwebraunia_australiensis_CBS_120729_ Uwebraunia_commune_CPC_12397_ Uwebraunia_musae_CBS_122453_ Uwebraunia_musae_CBS_122454 Xenoramularia_arxii_CBS_342.49_ Xenoramularia_neerlandica_CBS_113615_ Xenoramularia_neerlandica_CBS_141101 Xenoramularia_neerlandica_CPC_18378_ Xenoramularia_polygonicola_CBS_141102 Xenoramularia_polygonicola_CPC_10853_ Xenoramularia_polygonicola_CPC_10854_ Zymoseptoria_brevis_CBS_128853_ Zymoseptoria_halophila_CBS_128854 Zymoseptoria_passerini_CBS_120382_ Zymoseptoria_tritici_CBS_115943_ Zymoseptoria_tritici_CPC_18116_ Zymoseptoria_verkleyi_CBS_133618 Zymoseptoria_verkleyi_CBS_136761 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45219] TITLE Unpublished_his3_alignment; LINK TAXA = Taxa2; DIMENSIONS NCHAR=389; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ramularia_abscondita_CBS_114727_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCATTCA-----T---CACAACA------------ATCACTTACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCTTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acris_CBS_109794_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TCCTTCCA-----C---AATAATA------------ACCACTAACATC-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCGGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acris_CPC_25898 AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TCCTTCCA-----C------AATA------------ACCACTAACATC-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCGGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acris_CPC_25899 AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TCCTTCCA-----C------AATA------------ACCACTAACATC-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCGGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acris_CPC_25900 AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TCCTTCCA-----C---AATAATA------------ACCACTAACATC-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCGGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acroptili_CBS_120252_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTTCCCA-----C---CGCAACA------------ATCACTAACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTTGAGGCTTACCTTGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acroptili_CBS_120253_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AG-GA---CGCGTC-TTTTCCCA-----C---CGCAACA------------ATCACTAACATC-C--TATCTCAGGTACCGTAGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTTGAGGCTTACCTTGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acroptili_CPC_18723_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTTCCCA-----C---CGCAACA------------ATCACTAACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTTGAGGCTTACCTTGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_acroptili_CPC_18724_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTTCCCA-----C---CGCAACA------------ATCACTAACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTTGAGGCTTACCTTGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_actinidae_CPC_11675_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------GTCACTGACATG-C--CCATCTAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGCGCACTCCAGGAGTCGGTTGAGGCATACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agastaches_CPC_10819_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTATGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agastaches_CPC_10820_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTATGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agastaches_CPC_10821_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTATGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11450_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T------ACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11451_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T------ACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11452_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T------ACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11651_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T---CATACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11652_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T---CATACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_agrimoniae_CPC_11653_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--A-AA-GA---CGCGTC-TTCTTCCA-----T---CATACCA------------ATCACTAATGTT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAATCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_109013_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_109014_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_109120_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_109121_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_114118_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_237.73_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCTAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_aplospora_CBS_545.82_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACCC--G-AC-GA---TGCGTC-TCCCCACAA----T---CATAACA------------ATCACTAACATC-T--CCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_archangelicae_CBS_108991_ AAGCAGCTCGCATCCAAGGCCGCTCGCAAGTCTGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-GC-GA---CGCGTC-TTCTTCAA-----T---CACAACA------------ATCACTAACATC-C--TATTTTAGGTACCGTCGCTCTCCGTGAGATTCGTCGTTACCAGAAGTCCACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_archangelicae_CBS_108992_ AAGCAGCTCGCATCCAAGGCCGCTCGCAAGTCTGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-GC-GA---CGCGTC-TTCTTCAA-----T---CACAACA------------ATCACTAACATC-C--TATTTTAGGTACCGTCGCTCTCCGTGAGATTCGTCGTTACCAGAAGTCCACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_archangelicae_CBS_109011_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-GC-GA---TGCGTC-TTCTTCAA-----T---CACAACA------------ATCACTAACACA-C--CATTTTAGGTACCGTCGCTCTCCGTGAGATTCGTCGTTACCAGAAGTCCACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_archangelicae_CBS_109012_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-GC-GA---TGCGTC-TTCTTCAA-----T---CACAACA------------ATCACTAACACA-C--CATTTTAGGTACCGTCGCTCTCCGTGAGATTCGTCGTTACCAGAAGTCCACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_archangelicae_CBS_288.49_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-GC-GA---CGCGTC-TTCTTCAA-----T---CATGACA------------ATCACTAACATT-C--CATTTTAGGTACCGTCGCTCTCCGTGAGATTCGTCGTTACCAGAAGTCCACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGATTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_armoraciae_CBS_241.90 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCGTCCA-----T---CATAACA------------ATCACTAACATC-C--TCCCTCAGGTACTGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCGAGGCCAAGCGTGT- Ramularia_armoraciae_CBS_253.28_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCGTCCA-----T---CATAACA------------ATCACTAACATC-C--TCCCTCAGGTACTGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_asteris_CBS_131.21_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT-------GA---CGCGTC-TTCA---------T---CATTACA------------ATTATTAACATC-C--ACATCCAGGTACCGTCGCTCTCCGCGAGATCCGTCGTTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_bellunensis_CBS_116.43_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATCTCCG-AC-GA---CGCATC-TACTTCCC-----T---CATAACA------------GTCGCTAATATA-T--TCCCGCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CBS_113540_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CBS_151.67_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CBS_341.29_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CPC_30063 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CPC_30064 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CPC_30065 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CPC_30066 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_beticola_CPC_30067 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCGGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTGAC---C-GA---CGCCTC-CTCATCCG-----G---CATGACA------------GTCACTAACAAA-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCAGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_bosniaca_CBS_123880_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCCGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCTTACA-----T---CACCACA------------TCCACTAACATG-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCCTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_bosniaca_CBS_123881_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCCGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCTTACA-----T---CACCACA------------TCCACTAACATG-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCCTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_buniadis_CBS_114301_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TCCATTCA-----T---CACAACA------------ATCACTAACACA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTTGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_calcea_CBS_101612_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCATCCA-----C---CACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_calcea_CBS_101613_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCATCCA-----C---CACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_calcea_CBS_114442_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAACCTCACCGCTACAAGCCTGGTAAGCTTCT--A-TC-GA---CGCGTC-TTCCTTCA-----T---CACAACA------------GTTACTAACATA-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTGTCCCTCTTTGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_carneola_CBS_108975_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACACA-----T---TACAACA------------GTCATTGACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_carneola_CBS_108976_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACACA-----T---TACAACA------------GTCATTGACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_carneola_CBS_108977_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACACA-----T---TACAACA------------GTCATTGACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_carneola_CBS_108978_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACACA-----T---TACAACA------------GTCATTGACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_carneola_CBS_109847_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACACA-----T---TACAACA------------GTCATTGACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cerastiicola_CBS_115913 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---AGCGTC-GCCATCCA-----C---CGAAACA------------ATCACTAATATC-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGA?????????????????????????????????- Ramularia_chamaedryos_CBS_113307_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCTTTC--ACCC-GA---CGCGTC-TTCTCCCCA----T---CACAACA------------CTCACTAACATA-A--TCCATCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_chamaedryos_CBS_114731_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGTTACAAGCCTGGTAAGCTTTC--A-CC-GA---CGCGTC-TTCTCCCA-----C---CACAACA------------GTCACTAACATA-A--TCCATCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCGTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_chamaedryos_CBS_116577_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGTTACAAGCCTGGTAAGCTTTC--ACCC-GA---CGCGTC-CTCTCCCCA-TCAC---AACAACA------------CTCACTAACATA-A--TCCATCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_chamaedryos_CBS_118794_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTC-GCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCTTTC--ACCC-GA---CGCGTC-TTCTCCCCA----T---CACAACA------------CTCACTAACATA-A--TCCATCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTATGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_chelidonii_CBS_113317_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCAACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATCA----GC-CAT--CGTGCC-TTTCATCA--TCAT---CACAGCA------------GCCACTAACCTC----TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATTGCGCAGGACTTCAAGTCCGACCTCCGCTTTCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCGGTTGAGGCATACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATTCACGCCAAGCGTGT- Ramularia_chelidonii_CPC_12208_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCAACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATCA----GC-CAT--CGTGCC-TTTCATCA--TCAT---CACAGCA------------GCCACTAACCTC----TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATTGCGCAGGACTTCAAGTCCGACCTCCGCTTTCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCAGTTGAGGCATACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATTCACGCCAAGCGTGT- Ramularia_chelidonii_CPC_12209_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCAACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATCA----GC-CAT--CGTGCC-TTTCATCA--TCAT---CACAGCA------------GCCACTAACCTC----TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATTGCGCAGGACTTCAAGTCCGACCTCCGCTTTCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCAGTTGAGGCATACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATTCACGCCAAGCGTGT- Ramularia_coleosporii_10669_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131756_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131757_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131759_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131760_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131762_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTTAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CBS_131764_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTTAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CPC_10731_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTTAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CPC_10732_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT----CC-GGCGAAACATA-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTTAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_coleosporii_CPC_10748_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCGTCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCG----CC-GAGGAACCATT-TTGTGTCA-----T---CACCGCA------------GCCACTGACAAT---ACCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 101180 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCTATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 101181 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCTATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 101182 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCTATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 119439' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 119440' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 119441' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia collo-cygni CBS 119442' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTGTTCA-----C---TTCAACA------------ATCACTAACCAT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_coryli_CBS_117800_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--C-GC-GA---CGCGTC-TTCCACCA-----A---AACAATA------------GTCACTAACATG-T--TCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTTCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cupulariae_CBS_235.73_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCA--G-AC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATC-C--AACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTTGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cyclaminicola_CBS_399.51_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGATACAAGCCTGGTAAGCACCCG---AC-GA---TACCTT-TTCATCAAC--------CATAACA------------ATTTCTAACATC-C-GCTCTCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTATCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTTGAGGCCTACCTTGTATCTCTCTTCGAGGATACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CBS_114728_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------ATTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CBS_114729_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------ATTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGTTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAATCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCATGCCAAGCGTGT- Ramularia_cynarae_CBS_128779 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------TTTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CBS_128912 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------TTTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CBS_18427_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------TTTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CPC_18726_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------TTTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CPC_25896 AAGCAGCTCGCATCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---TGCGTC-TTCCAACA-----T---CACAACA------------ATTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_cynarae_CPC_25897 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCAATT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------ATTACTAACAAT-C--TATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_deusta_var._deusta_CBS__473.50_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTCTCC--A-CC-GA---CGTATC-TATTCCCA-----C---CACAACA------------GTCACTAACATG-T--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGATACCAACCTTTGCGCCATCCACGCAAAGCGTGT- Ramularia_didyma_var._didyma_CBS_114299_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCAT----ACAC-GA---CGACG----------------CGTCTCCTCA---CTCGCGATAACCACTAACAAC---AACCTTCAGGTACCGTCGCTCTCCGCGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTCATTCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCGCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_didyma_var._didyma_CBS_420.67_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCAT----ACAC-GA---CGACG----------------CGTCTCCTCA---CTCGCGATAACCACTAACAAC---AACCTTCAGGTACCGTCGCTCTCCGCGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTCATTCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCGCTCCAGGAGTCCGTCGAGGCATACCTCGTCTCGCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_diervillae_CPC_16860_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACCCA-----T---CACAACA------------GTCACTAACATA-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTGTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_diervillae_CPC_16863_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACCCA-----T---CACAACA------------GTCACTAACATA-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTGTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_diervillae_CPC_16864_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACCCA-----T---CACAACA------------GTCACTAACATA-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTGTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- 'Ramularia digitalis-ambiguae CBS 297.37 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CT-GA---CGCCTT-CCCCCCCA-----T---CACAGCA------------GTCACTAACATC-T--TC-CTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTTCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- 'Ramularia digitalis-ambiguae CBS 434.67 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CT-GA---CGCCTT-CCCCCCCA-----T---CACAGCA------------GTCACTAACATC-T--TC-CTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTTCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_101680_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GA---CGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_113265_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GA---CGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_113869_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GA---CGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_113871_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GA---CGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_115302_ AAGCAGCTCGCCTCTAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GAC-GCGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_endophylla_CBS_115303_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTG--C-AC-GA---CGCGTC-TTCCACCT-----C---CACAACA------------ATCACTAACATT-C----CCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACTTGCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_eucalypti_CBS_120726 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-G--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_eucalypti_CBS_120728 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_eucalypti_CPC_19188_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--ACTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_euonymicola_CBS_113308_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCTCGTGAC-GA---CACATG---------------TTCCACCGCA---------ACAATCACTAACACA-T-CAATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTCCGTGAGATTGCTCAGGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTGTTCGAGGACACCAACCTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_gaultheriae_CBS_299.80 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTC--G-AC-GA---CGCGTC-TTCCATCA-----T---CAGAACT------------ATCACTAACATT-C--TCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_gei_CBS_113977_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC-------GA---AGCGTC-TTCCTCCA-----T---CGCAACA------------ATTTCTAACACC-C--CCTCTCAGGTACTGTTGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTTCTCATTCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCTGTTGAGGCATACCTTGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCGAAGCGTGT- Ramularia_gei_CBS_344.49_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCC-------GA---AGCGTC-TTACTCCA-----T---CGCAACA------------ATTACTAACAGC-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTTCTCATTCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCGAAGCGTGT- Ramularia_geranii_CBS_159.24_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AT-GA---CGCGTC-TTCCACCA-----------CAACA------------ATCACTAACATC-T--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_geranii_CBS_160.24_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AT-GA---CGCGTC-TTCCACCA-----------CAACA------------ATCACTAACATC-T--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_geraniicola_CPC_25912_ ?????????????CCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCTTCT--A-CC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCACTAATATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTGTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_glechomatis_CBS_108979_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CACGTC-TTCATCCA-----T---TACAACA------------GTCACTAACATG-C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAATCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glechomatis_CBS_108980_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CACGTC-TTCATCCA-----T---TACAACA------------GTCACTAACATG-C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAATCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glechomatis_CBS_343.49_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CACGTC-TTCATCCA-----T---TACAACA------------GTCACTAACATG-C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAATCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glennii_CBS_120727 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TCTCAACT-----T---CACAACA------------ATCACTAACATT-C-TCCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATTCACGCCAAGCGTGT- Ramularia_glennii_CBS_122989 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCAACT-----T---CACAACA------------ATCACTAACATT-C-TCCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glennii_CBS_129441_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCAACT-----T---CACAACA------------ATCACTAACATT-C-TCCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glennii_CPC_16560_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCAGCT-----T---CACAACA------------ATCACTAACATT-C-TCATCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glennii_CPC_16565_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCAACT-----T---CACAACA------------ATCACTAACATT-C-TCCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_glennii_CPC_18468_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCAACT-----C---CACAACA------------ATCACTAACATC-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTTCGCTTCCAGAGCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_grevilleana_CBS_114732_ AAGCAGCTTGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TTCTCCCA-----C---CACCACA------ACAACAACAACTAACATC-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCTGTTGAGGCCTACCTCGTCTCACTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_grevilleana_CBS_259.36_ AAGCAGCTTGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TTCTCCCA-----C---CACCACA------ACAACAACAACTAACATC-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCTGTTGAGGCCTACCTCGTCTCACTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_grevilleana_CBS_298.34_ AAGCAGCTTGCCTCCAAGGCCGCTTGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TTCTCCCA-----C---CACCACA------ACAACAACAACTAACATC-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCTGTTGAGGCCTACCTCGTCTCACTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_grevilleana_CBS_719.84_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TTCT-CAA-----T---CACCATC------ACAACAACAACTAACATC-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACGGAGCTACTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCTGTTGAGGCCTACCTCGTCTCACTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_haroldporteri_CPC_16297_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGTATCT--G-AC-GA---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATC-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_haroldporterii_CBS_137272 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGTATCT--G-AC-GA---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATC-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_helminthiae_CBS_118418_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATC-ACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTTT--G-AT-GA---CGCGCC-TTCTCCCA-----T---CATAACA------------ATTACTAACATA-T--CATTCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCTGTTGAGGCATACCTCGTCTCTCTCTTCTAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_helminthiae_CPC_11502_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---TGCGCC-TTCTTCCA-----T---CATGACA------------CCCACTGATATA-T--TATCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGATTTCAAGTCCGATCTCCGCTTCCAAAGTTCTGCCATCGGCGCTCTGCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_helminthiae_CPC_11504_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---TGCGCC-TTCTTCCA-----T---CATGACA------------CCCACTGATATA-T--TATCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGATTTCAAGTCCGATCTCCGCTTCCAAAGTTCTGCCATCGGCGCTCTGCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CBS_108987_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACCACAT--------CCATCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CBS_108988_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACCACAT--------CCATCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CBS_113976_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACCACA------------TCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CBS_194.25_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATCG-------GACACGGCGTC-TCCACCCCT--------CACAACA------------TCCACTGACATC---TCCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGCGCGCTCCAGGAGTCCGTGGAAGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CPC_11505_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACAACA------------TCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CPC_11506_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACAACA------------TCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_heraclei_CPC_11507_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATGG-------GACACCGCATC-TCAACCCCT--------CACAACA------------TCTACTGACATC---TCTCCGCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hieraci-umbelati CPC 10690 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTTTCC--A-CC-GA---CGCGTC-TTCTTCTA-----T---CACAACA------------GCCACTAACAT--C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGTCCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGT- 'Ramularia hieraci-umbelati CPC 10691 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTTTCC--A-CC-GA---CGCGTC-TTCTTCTA-----T---CACAACA------------GCCACTAACAT--C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGTCCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGT- 'Ramularia hieraci-umbelati CPC 10692 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTTTCC--A-CC-GA---CGCGTC-TTCTTCTA-----T---CACAACA------------GCCACTAACAT--C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGTCCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGT- 'Ramularia hieraci-umbelati CPC 10788 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTTTCC--A-CC-GA---CGCGTC-TTCTTCTA-----T---CACAACA------------GCCACTAACAT--C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGTCCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGT- 'Ramularia hieraci-umbelati CPC 10789 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGTTTCC--A-CC-GA---CGCGTC-TTCTTCTA-----T---CACAACA------------GCCACTAACAT--C--TTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGTCCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 113614 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-TC-GA---CGCGTG-TTCCTCCA-----T---CACAACA------------ATCACTAACATC-T--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 114117 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 118408 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ACCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 118410 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 122272 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 122273 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ACCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 122625 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATT-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 159.82 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 341.49 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CBS 766.84 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 14811 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATT-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 19026 ' ????????????????????????CGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCG???????????????????- 'Ramularia hydrangeae-macrophyllae CPC 19027 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 19030 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 19854 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTTCATCA-----T---CACAACA------------ATCACTAACATT-T--CCACTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 20406' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--C-AC-GA---CGCGTC-TTCAATAA-----T---CACAACA------------ATCACTAACATT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 20406 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTTAGCATTT--C-AC-GA---CGCGTC-TTCAATAA-----T---CACAACA------------ATCACTAACATT-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 20484 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25901' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----C---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25902' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25903' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-TC-GA---CGCGTG-TTCCTCCA-----T---CACAACA------------ATCACTAACATC-T--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25904' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25905' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25906' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25907' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTCTTTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- 'Ramularia hydrangeae-macrophyllae CPC 25908' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAGGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATT-C--TCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14767_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14768_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14769_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14832_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14833_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_hydrangeicola_CPC_14834_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------GTCTCTAACCTCAC--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCGGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CBS_250.96_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CPC_15752_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CPC_15753_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CPC_15815_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CPC_25741 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_inaequalis_CPC_25742 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---AACAACA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_kriegeriana_CPC_10825_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCCA-ACGA-CG---TGCCTC---------------CATCACCACA---A------CAATCACTAACAGT---ATCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCGCTTCAGGAGTCCGTCGAGGCGTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_kriegeriana_CPC_10826_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCCA-ACGA-CG---TGCCTC---------------CATCACCACA---A------CAATCACTAACAGT---ATCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCGCTTCAGGAGTCCGTCGAGGCGTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_kriegeriana_CPC_10827_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCCA-ACGA-CG---TGCCTC---------------CATCACCACA---A------CAATCACTAACAGT---ATCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATTCGCAAGCTCCCATTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCGCTTCAGGAGTCCGTCGAGGCGTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_lamii_var._lamii_CBS_108970_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTGAGCATCTCCA-AC-GA---CGCGTC-TTCTCCCA-----C---CACAACA------------GCTGCTAACACA-G--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_lamii_var._lamii_CBS_108971_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTGAGCATCTCCA-AC-GA---CGCGTC-TTCTCCCA-----C---CACAACA------------GCTGCTAACACA-G--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_leonuri_CPC_11312_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_11313_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_11314_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_11411_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_11412_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_11413_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_14570_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_14571_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_leonuri_CPC_14572_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATG-C--CATGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCTAAGCGTGT- Ramularia_lethalis_CPC_25910 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCGTCC--A-CC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ACGACTAACATT-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_ligustrina_CBS_379.52_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCTCCG-CC-GA---CGCGTC-TTCCTCCA-----T---CACAGCA------------GCAACTAACATT----CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCTCTCTTCGAGGACA???????????????????????????????- Ramularia_major_CBS_141114 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CGCAACA------------ATCACTAACACC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGTTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_major_CPC_12543_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CGCAACA------------ACCACTAACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_major_CPC_12544_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCTTCCA-----T---CGCAACA------------ACCACTAACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_mali_CBS_129581_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCCCCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCAACT-----T---CACAACA------------ATCACTAACATC-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_malicola_CBS_119227_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_miae_CBS_120121 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GT---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_miae_CPC_19770_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GT---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_miae_CPC_19835_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GC---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_miae_CPC_21692_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GT---CGCGTC-TTTCAACA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_neodeusta_CBS_141115 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--C-GC-GA---CACGTC-TTCCACCA-----T---CACAATA------------ATTACTAACATC-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTCGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCAATCCACGCCAAGCGTGT- Ramularia_neodeusta_CPC_13568_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCAGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--C-GC-GA---CACGTC-TTCCACCA-----T---CACAATA------------ATTACTAACATC-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAAGAGTCCGTCGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCAATCCACGCCAAGCGTGT- Ramularia_nyssicola_CBS_127664_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCCCCATCGACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-ACGGA---CGCGTC-TTCGCCCA-----T---CACAACA------------TCCACTAACAAT-C--ACTTTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCTCTGTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_nyssicola_CBS_127665_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCCCCATCGACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACCT--G-AC-GA---CGCGTC-TTTACCTA-----T---CACAACA------------TGCACTAACAAT-C--ACTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCCTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTGTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGCGT- Ramularia_osterici_CBS_141116 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAC--A-AC-GA---CGCGTC-TTCTTCCA-----C---TACAACA------------ATCACTGACACT-T--CATCTCAGGTACCGTTGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCGTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_osterici_CPC_10751_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAC--A-AC-GA---CGCGTC-TTCTTCCA-----C---TACAACA------------ATCACTGACACT-T--CATCTCAGGTACCGTTGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCGTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_osterici_CPC_10752_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAC--A-AC-GA---CGCGTC-TTCTTCCA-----C---TACAACA------------ATCACTGACACT-T--CATCTCAGGTACCGTTGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCGTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCGGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_parietariae_CBS_123730_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCTTTCA-----T---CACAACA------------ATCACTAACACA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTATCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGTGT- Ramularia_parietariae_CBS_123731_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCTTTCA-----T---CACAACA------------ATCACTAACACA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTATCCCTCTTCGAGGACACCAACCTGTGCGCCATTCACGCCAAGCGTGT- 'Ramularia phacae-frigidae CBS 234.55 ' AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCCGGTAAGCATAC--A-TC-GA---CGCGTC-TTCTTCCA-----T---CTCAACA------------GTCCCTAACATC-T--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTGTCTCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_plurivora_CBS_118693_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGCC-TTTCATCA-----T---CACAACA------------ATCACTAACATC-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTGATCCGCAAGTTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGTTTCCAGAGCTCGGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTTTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_plurivora_CBS_118743_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------ATCTCTAACATT-T--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTGATCCGCAAGTTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGTTTCCAGAGCTCGGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTTTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_plurivora_CPC_16123_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTCCAACA-----T---CACAACA------------ATCTCTAACATT-T--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTGATCCGCAAGTTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCTCAGGACTTCAAGTCCGATCTCCGTTTCCAGAGCTCGGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTTTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_plurivora_CPC_16124_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCG{CT}C-TT{CT}CATCA-----T---CACAACA------------ATC{AT}CTAACATC-{CT}--CCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTGATCCGCAAGTTGCCTTTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGTTTCCAGAGCTCGGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTTTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_pratensis_var._pratensis_CBS_122105_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----T---CACAGCA------------ATCACTAACATT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_pratensis_var._pratensis_CPC_16868_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----C---CACAACA------------ATCACTGACATT-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_pratensis_var._pratensis_CPC_19448_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----C---CACAACA------------ATCACTGACATT-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_pusilla_CBS_124973_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATTT--G-GC-GA---CGCGTC-TTTCATCA-----T---CACAACA------------ATCACTAACAAC-CCCCCCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTTGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_rhabdospora_CBS_118415_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACTGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCCGGTAAGCATCC--A-TC-GA---CGCGTC-TCCTTCCA-----T---CACCACA------------GTCACTAATATA-T--CTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rhabdospora_CBS_312.92_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCCGGTAAGCATCC--A-TC-GA---CGCGTC-TGCTTCCA-----T---CACAACA------------GTCACTAACGTG-T--TTCATCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTTCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGTTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CBS_114440_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CBS_120161_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCTATCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_15748_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCT-CCTCGTCTCGATCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_15749_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_15750_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_15821_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_19471_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_19472_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGATCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rubella_CPC_25911 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCGTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGAAGCATGCGAC-GA---CGCGTC-TGCATCCGC--------TCCATCA------------GTCACTGACGTGTC--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACGGAGCTCCTCATCCGAAAGCTGCCATTCCAGCGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGCGCGCTCCAGGAGTCCGTGGAGGCCTACCTCGTCTCGCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_rufibasis_CBS_114567_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC-------GACAGCGCGTCCTTCACTCTC--------CACAACA------------TCCACTAACATA---TTTCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTGCCCTTCCAGCGTCTTGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTTCGCTTCCAGAGTTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCATACTTGGTGTCTCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_rumicicola_CBS_141118 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCAACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTCAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----T---CACAACG------------ATCACTAACATT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_rumicicola_CPC_11295_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTCAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----T---CACAACG------------ATCACTAACATT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_rumicicola_CPC11296_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTCAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----T---CACAACG------------ATCACTAACATT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGCCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_rumicis_CBS_114300_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCTCCA-----T---CACAACA------------ACCACTGACATT-T--CCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_sp._A_CBS_114566_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCG----TCTTGCA-----T---CACAACA------------ATCACTAACATG-C--CATCTTAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_sp._B_CBS_114568_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCGCCC-----C---CACAACA------------ATCACTAACATA-C--ACTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_sp._C_CBS_299.49_ AAGCAGCTCGCTTCCAAGGCCGCTCGCAAGTCTGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTTT-TTAT-GA---CGCGT----------------CGGCAACACA---C------TGGTCATTAACATA---TCATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTATCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATTGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCTCTTTTCGAGGACACCAACTTGTGTGCCATCCACGCCAAGCGTGT- Ramularia_sp._D_CBS_135.23_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCACCCA-----T---CACAACA------------ATCACTAACATA-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTGTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_sphaeroidea_CBS_112891_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGAATTTG---AC-AA---CGCGTC-TTCA---------T---CATCACA------------ATTACTAACACT-T--CACGTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAAATCGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACTAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_stellariicola_CBS_130592_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCCCCA-----C---CAAAACA------------ATCACTAACATA-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCACAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_stellariicola_CPC_11298_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATTT--G-AC-GA---CGCGTC-TTCCCCCA-----C---CAAAACA------------ATCACTAACATA-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCACAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATTGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_stellenboschensis_CBS_130600_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-CTTCAACA-----T---CACAACA------------ACAACTGACATC-C--CATCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTTGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tovarae_CBS_113305_ AAGCAGCTCGCATCCAAAGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATATA---AT-GA---CGCGTCGTTCA---------T---CACGGCA------------ATCTCTAACATT---ATCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108973_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAACA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108974_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAACA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108989_ AAGCAGCTTGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACAGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAGCA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108990_ AAGCAGCTTGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACAGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAGCA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108994_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAACA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_108995_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAACA------------GTCACTAACATG-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_tricherae_CBS_236.73_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCCACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCCTCC--A-CC-GA---CGCGCC-TCCTTCCA-----T---CACAACA------------GTCACTAACATG-C--TCCCT-AGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCTTTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_trigonotidis__CPC_14765_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CCCGCC-CGCTATCAC--CAT---CACAACA------------GCCACTAACACA-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCCTTCCAGCGCTTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGATTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAATCGGTTGAGGCATACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_trigonotidis_CBS_141119 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CCCGCC-CGCTATCAC--CAT---CACAACA------------GCCACTAACACA-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCCTTCCAGCGCTTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGATTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAATCGGTTGAGGCATACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_trigonotidis_CPC_14766_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCT--G-AC-GA---CCCGCC-CGCTATCAC--CAT---CACAACA------------GCCACTAACACA-C--CCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCCTTCCAGCGCTTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGATTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAATCGGTTGAGGCATACCTCGTCTCCCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_trollii_CBS_109118_ AAGCAGCTCGCTTCCAAGGCCGCTCGCAAGTCCGCACCATCGACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-CC-GA---TGCGAC-ATCCTCAA-----T---CACAATA------------ACCACTAACATT-C--TCACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCACTTTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_trollii_CBS_109119_ AAGCAGCTCGCTTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT--G-CC-GA---CGCGAC-TTCCTCCA-----T--------CA------------ATCACTAACATT-C--CTACTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCCACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTCCGTGAGATCGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGTGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_unterseheri_CBS_117879_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CGCAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTTGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_unterseheri_CBS_124826_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTG-CAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_unterseheri_CBS_124838_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTTGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_unterseheri_CBS_124884_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CTTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_unterseheri_CBS_130721_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-C--CCTCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTGTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CBS_141120 AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CBS_179.68_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAATCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_11481_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_11482_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_12491_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_12492_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_12493_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_131769_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCTACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_131770_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----CC-GACAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCGCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_uredinicola_CPC_131771_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATAT----AC-GATAGCGCGTC-CT---CAC-----T---CACAACA------------TCCACTAACATG---TCTCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCCCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCTCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGT- Ramularia_urticae_CBS_113974_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCA--A-TC-GA---CGCGTC-TTCATCCA-----T---CACGACA------------GTCACTAACACA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTTTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_urticae_CBS_162.91_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCATCCA-----T---CACGACA------------GTCACTAACACA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTTTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_urticae_CPC_105.26_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTGCC--A-TC-GA---TGCGTC-TTCACCCA-----T---TGCGACA------------GTCACTAACATA-C--CCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCATACCTCGTCTCCCTTTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_urticae_CPC_14807_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCGCCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCCTC--TCATCCA-----T---CACAAAA------------GTCACTAACATA-C--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCATACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_valerianae_var._valerianae_CBS_109122_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------ATCACTAACACA-A--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAATCGACCGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_valerianae_var._valerianae_CBS_109123_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCATCCA-----T---CACAACA------------ATCACTAACACA-A--TCCCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAATCGACCGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_vallisumbrosae_CBS_271.38_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTT--T-CC-GA---CGCGTC-TTCATCAT-----T---CACAACAACGACAACAACAACAACTAACCTC-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_vallisumbrosae_CBS_272.38_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCACTT--T-CC-GA---CGCGTC-TTCATCAT-----T---CACAACA---ACAACAACAACAACTAACCTC-C--CCTCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGTTGCCATTCCAGCGTCTTGTTCGTGAGATTGCTCAGGACTTCAAGTCGGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_variabilis_CBS_141121 AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATA-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_variabilis_CPC_16865_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATA-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_variabilis_CPC_16866_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-TC-GA---CGCGTC-TTCTTCCA-----T---CACAACA------------ATCACTAACATA-C--TCCCCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAGATTGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Ramularia_veronicicola_CBS_113981_ AAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCTTCC--A-CC-GA---CGCGTC-TTCCTTCA-----T---CACAACA------------GTCACTAACATG-C--CACCTCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCCGCCATTGGCGCACTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCGAAGCGTGT- Ramularia_vizellae_CBS_115981_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-T--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_vizellae_CBS_115982_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCGTCA-----T---CACAACA------------ACCACTAACATT-T--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_vizellae_CBS_117798 AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-A--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_vizellae_CBS_117871 AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCGTCA-----T---CACAACA------------ACCACTAACATT-T--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_vizellae_CBS_117872_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-T--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTTTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_vizellae_CBS_130601_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCTTCTACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTAAGCATCC--A-AC-GA---CGCGTC-TTCCATCA-----T---CACAACA------------ATCACTAACATT-T--CCTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGT- Ramularia_weberiana_CBS_136.23_ AAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCTGGTAAGCATCT--G-AC-GA---CGCGTC-TTTCCCCA-----T---AACAACA------------ATCACTAATATT-T--CATCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTTCGTGAGATCGCTCAGGACTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTCCAGGAGTCCGTCGAGGCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGT- Zymoseptoria_halophila_CBS_128854_ AAGCAGCTCGCCTCCAAGGCTGCTCGCAAGTCCGCACCATCCACCGGAGGTGTCAAGAAGCCTCACAGGTACAAGCCCGGTAAGCATCAC---AC-GA---CGCGTC-TTCTGACTCATCAT---CACAACA---------ACGTTGACTGACATG-C--TCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGATACCAAAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCATTCCAGCGTCTCGTCCGTGAGATCGCCCAGGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGGCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT- ; END; BEGIN SETS; CHARSET locus1 (CHARACTERS = Unpublished_his3_alignment) = 1-132 142-389; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45218] TITLE 'Combined alignment of five genes (rpb2, ITS, actA, gapdh, tef1-alpha)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2689; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ramularia_abscondita_CBS_114727__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAACACCCATTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTACGACCCAGTCCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGAGCACTTACCGAGACGTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGACGTCCGAGAACGCGAGATTCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGATAACAAGCCTGACTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAGGTCGAGAGACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCCCAGCACATCTACGGATGGATGGGCCTCGTCAATGAAGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACAAATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CCG------GCGTATC-CGCCAGCTGACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCATCATGGGT-ATGCGATGTC-----CAACCAATCCCTA---------------------ATCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----AAGCTGA-CAT-GGATACT------ATACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGTTCAC--------------------------------------------CAAGAATC---GTCG------------TCGAAAACC---CATCTAATTCAATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACTGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CGC-GCCT------CGC------ACAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGCGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCCC----------AACA-CCAG-----CACCA-CTCCACCT------CAAC----ACATGT---------------------------------------------------------------------------------CGCTC-GACCA-T-------------GCCG-AGAAACATTACTGACAA-TG-TCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acris_CBS_109794__ GCATCTACTCTCTCACATCTGAGGAGAACAAACACGCCTATTGGTCGTGACGGCAAGATTGCTAAGCCAAGGCAACTGCACAATACACATTGGGGTCTTGTCTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCATTGATGTGTTACGTTTCAGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGAACTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCAACCAAGGTTTTCATCAATGGTACATGGGTAGGTGTGCACAAGAATGCTGGCCAGCTTACCGAAACCTTGCGATCGCTACGAAGGAAAGGACTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGGGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAGAAACTCCAACACGATCAAGAGACGGCGGCGTCCCTTCGAGGCA---TAAGTGAAGAGGACAGAGCAGAGCATACCTATGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACCCGGCGTT-CCCCCGGAGG--TCACC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCATCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGACAAC-TATTTCGCAGGGGAGGT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGTTT------CTCAGG-----CAGATGC-------GT--GCA------ATGTACA-TACCAGCTGACTCC-ACAACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATT-----CCATCCACCCTCC---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTGGC-TC-------CA------GCTGTAGC-ATG---------ATTTTGGA----------------------------AGAGCAC----GAGCTGA-CAG-GATACATC-----CCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAATGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGAGCA--------------------------------------------ATACATGG---GATTG--------CT-ATTCCCTTC---GCGCTAATAAAGAT---ACCAGGCCTACATGCTCAAGTACGACTCCACGCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACGGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-GATCACT-CTG-----------------------ACA-TTATCACTGT------CT--TGC-GCCT------TTC------CACAAA----TCG-CT-TA-T---CACCCCTCGCC-------T------------------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------CATGACCTCACT-T-----GAAC-AG---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATTTACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TAC-CACAACAATGCTAATGA-CC-TCGCCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGCGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acris_CBS_141107 GCATCTACTCTCTCACATCTGAGGAGAACAAACACGCCTATTGGTCGTGACGGCAAGATTGCTAAGCCAAGGCAACTGCACAATACACATTGGGGTCTTGTCTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCATTGATGTGTTACGTTTCAGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGAACTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCAACCAAGGTTTTCATCAATGGTACATGGGTAGGTGTGCACAAGAATGCTGGCCAGCTTACCGAAACCTTGCGATCGCTACGAAGGAAAGGACTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGGGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAGAAACTCCAACACGATCAAGAGACGGCGGCGTCCCTTCGAGGCA---TAAGTGAAGAGGACAGAGCAGAGCATACCTATGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACCCGGCGTT-CCCCCGGAGG--TCACC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCATCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGACAAC-TATTTCGCAGGGGAGGT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGTTT------CTCAGG-----CAGATGC-------GT--GCA------ATGTACA-TACCAGCTGACTCC-ATAACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATT-----CCAGCTACCCTCC---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG???????CGCAATGCGTAAGTGGC-TC-------CA------GCTGTAGC-ATG---------ATTTAGGA----------------------------AGAGCAC----GAGCTGA-CAG-GATACATC-----CCACAGCGTCGAGCACGGCGATGTCACTGTCGTGGCTGTCAATGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGAGCA--------------------------------------------ATACATGG---GATTG--------CT-ATTCCCTTC---GCGCTAATAAAGAT---ACCAGGCCTACATGCTCAAGTACGACTCCACGCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACGGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-GATCACT-CTG-----------------------ACA-TTATCACTGT------CT--TGC-GCCT------TTC------CACAAA----TCG-CT-TA-T---CACCCCTCGCC-------T------------------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------CATGACCTCACT-------------------TGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATATCCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TAC-CACAACAATGCTAACGA-CC-TCGCCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGCGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acris_CPC_25898 GCATCTACTCTCTCACATCTGAGGAGAACAAACACGCCTATTGGTCGTGACGGCAAGATTGCTAAGCCAAGGCAACTGCACAATACACATTGGGGTCTTGTCTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCATTGATGTGTTACGTTTCAGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGAACTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCAACCAAGGTTTTCATCAATGGTACATGGGTAGGTGTGCACAAGAATGCTGGCCAGCTTACCGAAACCTTGCGATCGCTACGAAGGAAAGGACTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGGGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAGAAACTCCAACACGATCAAGAGACGGCGGCGTCCCTTCGAGGCA---TAAGTGAAGAGGACAGAGCAGAGCATACCTATGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACCCGGCGTT-CCCCCGGAGG--TCACC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCATCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGACAAC-TATTTCGCAGGGGAGGT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGTTT------CTCAGG-----CAGATGC-------GT--GCA------ATGTACA-TACCAGCTGACTCC-ATAACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATT-----CCAGCTACCCTCC---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG???????CGCAATGCGTAAGTGGC-TC-------CA------GCTGTAGC-ATG---------ATTTAGGA----------------------------AGAGCAC----GAGCTGA-CAG-GATACATC-----CCACAGCGTCGAGCACGGCGATGTCACTGTCGTGGCTGTCAATGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGAGCA--------------------------------------------ATACATGG---GATTG--------CT-ATTCCCTTC---GCGCTAATAAAGAT---ACCAGGCCTACATGCTCAAGTACGACTCCACGCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACGGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-GATCACT-CTG-----------------------ACA-TTATCACTGT------CT--TGC-GCCT------TTC------CACAAA----TCG-CT-TA-T---CACCCCTCGCC-------T------------------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------CATGACCTCACT-------------------TGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATATCCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TAC-CACAACAATGCTAACGA-CC-TCGCCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGCGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acris_CPC_25900 GCATCTACTCTCTCACATCTGAGGAGAACAAACACGCCTATTGGTCGTGACGGCAAGATTGCTAAGCCAAGGCAACTGCACAATACACATTGGGGTCTTGTCTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCATTGATGTGTTACGTTTCAGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGAACTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCAACCAAGGTTTTCATCAATGGTACATGGGTAGGTGTGCACAAGAATGCTGGCCAGCTTACCGAAACCTTGCGATCGCTACGAAGGAAAGGACTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGGGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAGAAACTCCAACACGATCAAGAGACGGCGGCGTCCCTTCGAGGCA---TAAGTGAAGAGGACAGAGCAGAGCATACCTATGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACCCGGCGTT-CCCCCGGAGG--TCACC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCATCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGACAAC-TATTTCGCAGGGGAGGT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGTTT------CTCAGG-----CAGATGC-------GT--GCA------ATGCACA-TACCAGCTGACTCC-ATAACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATT-----CCATCCACCCGCC---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTGGC-TC-------CA------GCTGTAGC-ATG---------ATTTTGGA----------------------------AGAGCAC----GAGCTGA-CAG-GATACATC-----CCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAATGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGAGCA--------------------------------------------ATACATGG---GATTG--------CT-ATTCCCTTC---GCGCTAATAAAGAT---ACCAGGCCTACATGCTCAAGTACGACTCCACGCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACGGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-GATCACT-CTG-----------------------ACA-TTATCACTGT------CT--TGC-GCCT------TTC------CACAAA----TCG-CT-TA-T---CACCCCTCGCC-------T------------------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------CATGACCTCACT-T-----GAAC-AG---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATATCCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TAC-CACAACAATGCTAACGA-CC-TCGCCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGCGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acroptili_CBS_120252__ GCCTCCACACTCTCGCATTTGAGGAGAACAAACACGCCCATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACTCATTGGGGTCTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGATTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCAGTTGGAACACCGGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACCGAGACCTTGCGTGGGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGACGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTCGTCGACAACAAGCCCGATTCTGCTGACCGCGGCAGTCTCGTGCTGGTGAGGAGTCAAGTGGAAAAGCTGCAGCACGACCAAGAGACTGCAGCTTCTCTGCGAGGCA---TAAGCGAGGAGGACAGGGCAGAGCATATTTACGGCTGGAGGGGCTTGGTAAAGGACGGAGTGGTGGAGTATCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTC-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-----TCCCAGG-----CAAGAGC-------AT--ATA------ATATACA-AGCCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATGTT-----CCACTCATCCTCC---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CA------GCTGTGGC-ATT---------GAGATTGGA---------------------------ATAAGAT----GGGCTGA-TAG-GATACC-------GCACAGCGTCGAGCACGGCGATGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCATACC--------------------------------------------ACACCGAC---CATAA--------CT-GCACAACAT---CCTCTAACACCACCAACCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCACT-CCCA-TC-------------------ACT-CCCTCACCGT------CG--CGC-GCCT------TGC------AACATA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--ATTTTGGCTTGGCGT------CATGACCTCACT-T-----TACC-AA---AATGCTTCGCTG-GCCAT----------AACA-TCAG-----CAGCG-AATCGCTC------TTCC----AC--------------------------------------------------------------------------------------------ATTATC--------------TGC-CACAACAATGCTAACGA-AC-TCGCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acroptili_CBS_120253__ GCCTCCACACTCTCGCATTTGAGGAGAACAAACACGCCCATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACTCATTGGGGTCTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGATTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCAGTTGGAACACCGGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACCGAGACCTTGCGTGGGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGACGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATTCTGCTGACCGCGGCAGTCTCGTGCTAGTGAGGAGTCAAGTCGAAAAGCTGCAGCACGACCAAGAGACTGCAGCTTCTCTGCGAGGCA---TAAGCGAGGAGGACAGGGCAGAGCATATTTACGGCTGGAGAGGCTTGGTAAAGGACGGAGTGGTGGAGTATCTCGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGGACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTC-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TATTT-----TCCCAGG-----CAAGAGC-------AT--ATA------ATGTACA-AGCCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATGTT-----CCACTCATCCTCC---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CA------GCTGTGGC-ATT---------GAGATTGGA---------------------------ATAAGAT----GGGCTGA-TAG-GATACC-------GCACAGCGTCGAGCACGGCGATGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCATACC--------------------------------------------GCACCGAC---CATAA--------CT-GCACAACAT---CCTCTAACACCACCAACCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCACT-CCCA-TC-------------------ACTCCCCTCACCGT------CG--CGC-GCCT------TGC------GACATA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--ATTTTGGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCTTCGCTG-GCCAC----------AACA-TCGG-----CAGCG-AATCGCTC------TTCC----AC--------------------------------------------------------------------------------------------ATTATC--------------TGC-CACAACAATGCTAACGA-AC-TCGCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acroptili_CPC_18723_ GCCTCCACACTCTCGCATTTGAGGAGAACAAACACGCCCATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACTCATTGGGGTCTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGATTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCAGTTGGAACACCGGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACCGAGACCTTGCGTGGGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGACGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATTCTGCTGACCGCGGCAGTCTCGTGCTGGTGAGGAGTCAAGTGGAAAAGCTGCAGCACGACCAAGAGACTGCAGCTTCTCTGCGAGGCA---TAAGCGAGGAGGACAGGGCAGAGCATATTTACGGCTGGAGGGGCTTGGTCAAGGACGGAGTGGTGGAGTATCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--GCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTC-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-----TCCCAGG-----CAAGAGC-------AT--ATA------ATATACA-AGCCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATGTT-----CCACTCATCCTCC---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CA------GCTGTGGC-ATT---------GAGATTGGA---------------------------ATAAGAT----GGGCTGA-TAG-GATACC-------GCACAGCGTCGAGCACGGCGATGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCATACC--------------------------------------------ACACCGAC---CATAA--------CT-GCACAACAT---CCTCTAACACCACCAACCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATTGAGATCGACGGCGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCACT-CCCA-TC-------------------ACT-CCCTCACCGT------CG--CGC-GCCT------TGC------AACATA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--ATTTTGGCTTGGCGT------CATGACCTCACT-T-----TACC-AA---AATGCTTCGCTG-GCCAT----------AACA-TCAG-----CAGCG-AATCGCTC------TTCC----AC--------------------------------------------------------------------------------------------ATTATC--------------TGC-CACAACAATGCTAACGA-AC-TCGCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_acroptili_CPC_18724_ GCCTCCACACTCTCGCATTTGAGGAGAACAAACACGCCCATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACTCATTGGGGTCTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGATTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCAGTTGGAACACCGGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACCGAGACCTTGCGTGGGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGACGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATTCTGCTGACCGCGGCAGTCTCGTGCTGGTGAGGAGTCAAGTGGAAAAGCTGCAGCACGACCAAGAGACTGCAGCTTCTCTGCGAGGCA---TAAGCGAGGAGGACAGGGCAGAGCATATTTACGGCTGGAGGGGCTTGGTCAAGGACGGAGTGGTGGAGTATCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--GCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTC-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-----TCCCAGG-----CAAGAGC-------AT--ATA------ATATACA-AGCCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATGTT-----CCACTCATCCTCC---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CA------GCTGTGGC-ATT---------GAGATTGGA---------------------------ATAAGAT----GGGCTGA-TAG-GATACC-------GCACAGCGTCGAGCACGGCGATGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCATACC--------------------------------------------ACACCGAC---CATAA--------CT-GCACAACAT---CCTCTAACACCACCAACCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATTGAGATCGACGGCGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCACT-CCCA-TC-------------------ACT-CCCTCACCGT------CG--CGC-GCCT------TGC------AACATA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--ATTTTGGCTTGGCGT------CATGACCTCACT-T-----TACC-AA---AATGCTTCGCTG-GCCAT----------AACA-TCAG-----CAGCG-AATCGCTC------TTCC----AC--------------------------------------------------------------------------------------------ATTATC--------------TGC-CACAACAATGCTAACGA-AC-TCGCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_actinidiae_CBS_141108 GCCTCAACTCTGTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCAAGACAACTTCATAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTTATGTGCTATGTCTCGGTGGGAACACCGGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACCTGGGTGGGGGTACACAAGAGCGCTGGCCAACTGACCGAGACATTGAGGTCATTGCGGAGGAAAGGTCTTTTGAGTTTCGAGGTCACAATCATTCGCGATGTTCGAGAACGCGAAATCCGGGTCTTTACTGATGCCGGACGTGTCTGTCGGCCGCTGTTCGTGGTCGACAACAAACCAGATTCCGCTGACCGTGGCAGTTTGGTACTGAAGCAGGATCAGGTCGCTAAACTCCACACCGATCAGGAGGCGGCGGCGTCTCTGCAAGGCA---TCAGCGAAGAGGACAAGGCTGCACATACCTATGGCTGGATGGGCCT?????????????????????????????????????????????????????????????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGTGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTT-------CCAGCG----ATAGATC-------GC--CCG------GCGTGCA-TACCCGCTGACTCC-TTCACAGCATCCATTGTTGGTCGACCGCGCCACCATGGGT-ATGCGATACC-----CCACCCGTTCCCT---------------------ATACGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-AT-------TC------AGATCAGC-ATC----CCATCAGCACGA---------------------------CTGAGCATT----AAGCTGA-CAT-GCACGT--------CACAGCGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTGCCC--------------------------------------------TTGAAAGA---GCCAA--------CT-CCAATCTGT---CCACTAACGCAATA--CTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCTGCCAGCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTCA----------------------CTT-TCTTCACCGT------CG--CGC-GCTC------TG-------CAAAAA----TTG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACT-AA---AATGCCTCGCTG-GCCAT----------CATA-CCAG-----CATGA-CTCCACTG------CTTC----ACATGT---------------------------------------------------------------------------------CGCGC-CAACGCA-------------CAAG-AACATAATGACTGACAA-CG-TTCTTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAAACTCCCAA Ramularia_agastaches_CPC_10819_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGGCAGGCCTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCGCTTACCGAGACTTTGCGGGCGCTGCGGAGAAAAGGTCTCCTGAGCTTCGAGGTCACCATCATCCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGTAGTCTCGTGCTGAGACGAGACCAGGTTGAGAAGCTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTTCGAGGAG---TCAGTGAAGAGGATCGAGCACAGCACATCTATGGATGGATGGGCCTGGTCAATGAGGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CTA------GCGTATC-CACCAGCTGACACC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATTCCTA---------------------CCCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAACGCGTGAGTAGA-GT-------CA------AGAGCAAC-TCC---------AGAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGACACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATGGC--------AT-TCGAAGACA---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCTACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACGACCACCGAGAAGGCTTCCGCTCATTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACTGT------CG--CCC-GCCT------CGC------CAAAAA----ATC-GC-TT-T---CACCCCTCGC--------CTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-AGTTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agastaches_CPC_10820_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGGCAGGCCTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCGCTTACCGAGACTTTGCGGGCGCTGCGGAGAAAAGGTCTCCTGAGCTTCGAGGTCACCATCATCCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGTAGTCTCGTGCTGAGACGAGACCAGGTTGAGAAGCTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTTCGAGGAG---TCAGTGAAGAGGATCGAGCACAGCACATCTATGGATGGATGGGCCTGGTCAATGAGGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CTA------GCGTATC-CACCAGCTGACACC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATTCCTA---------------------CCCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAACGCGTGAGTAGA-GT-------CA------AGAGCAAC-TCC---------AGAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGACACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATGGC--------AT-TCGAAGACA---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCTACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACGACCACCGAGAAGGCTTCCGCTCATTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACTGT------CG--CCC-GCCT------CGC------CAAAAA----ATC-GC-TT-T---CACCCCTCGC--------CTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-AGTTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agastaches_CPC_10821_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGGCAGGCCTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCGCTTACCGAGACTTTGCGGGCGCTGCGGAGAAAAGGTCTCCTGAGCTTCGAGGTCACCATCATCCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGTAGTCTCGTGCTGAGACGAGACCAGGTTGAGAAGCTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTTCGAGGAG---TCAGTGAAGAGGATCGAGCACAGCACATCTATGGATGGATGGGCCTGGTCAATGAGGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CTA------GCGTATC-CACCAGCTGACACC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATTCCTA---------------------CCCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAACGCGTGAGTAGA-GT-------CA------AGAGCAAC-TCC---------AGAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGACACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATGGC--------AT-TCGAAGACA---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCTACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACGACCACCGAGAAGGCTTCCGCTCATTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACTGT------CG--CCC-GCCT------CGC------CAAAAA----ATC-GC-TT-T---CACCCCTCGC--------CTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-AGTTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11450_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGAAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTCAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGTGGGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC---------AAACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11451_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGAAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTCAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGTGGGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11452_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGAAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTCAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGTGGGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11651_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGGAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTCAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATCCCAGGCCTACATGCTCAAGTACGACTCAACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11652_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGGAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------GA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_agrimoniae_CPC_11653_ GCTTCCACACTGTCTCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGCAAGATTGCTAAGCCGAGACAGCTGCACAATACACATTGGGGGCTTGTTTGTCCGGCTGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGGCAGCGTGGAATGGATCTTCTTGAGGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACCGAGACACTACGATCGCTGCGAAGGAAGGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGCCTCGTGCTGGTACGGAATCAGGTCGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGATAGAGCAGAGCACACCTACGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTAGAATATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTCAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--GCGTG-TTGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAGG------CAGAAGC-------AT--GCT------ATGTACA-AACCAGCTGACTTT-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATCCAATCCAACCCATCCTCC---------------------ACACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------GA------GCTGCCGC-ATA---------TAGATTGGAT--------------------------GAAGGAT----GATCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCAGTATGTCAAGCA--------------------------------------------ATCCAGAA---GATGGC------TTT-GCCAAACAC---CCTCTGACACCATCAATTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACGATCGAGGTGGACGGTGACAAGGGTCTCATCGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGCGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATTCCCGTCATCT?????GAGAAGGTAAGG-ACTCACT-CCCC-TC-------------------ACT-ACATTACTGT------CG--CGC-GTCT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGTGGGGGG---TTTG-AGA--TTTCTGGCTTGGCGT------CATGACCTCACC-TCA---CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACTC------CTTC----AC-TGC---------------------------------------------------------------------------------CGCTC-CACTGTC--------------TGC-CACAACAATGCTGACGA-CT-ACACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_109013__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTATCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAACAAGCCCGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTTCAAAACGATCAAGAGGCTGCTGCATCGCTACGAGGGT---TTAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTAAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCTTTCCTCCTCCCACATC---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACCCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACCA--CTTTACCCCTCCCCC-------------------ACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-TT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACATAGCC--AATCCG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTGGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_109014__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTATCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAACAAGCCCGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTTCAAAACGATCAAGAGGCTGCTGCATCGCTACGAGGGT---TTAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTAAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCTTTCCTCCTCCCACATC---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACCCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACCA--CTTTACCCCTCCCCC-------------------ACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-TT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACATAGCC--AATCCG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTGGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_109120__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTATCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGTGAGATCAGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAATAAGCCTGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTCCATAACGATCAAGAGGCTGCTGCATCGCTACGAGGGG---TCAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAGGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTAAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCCACCCTCCTCCCACATA---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACT-----TTACCCCTCCCCC-----------------CCACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-TT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACACCGCC--AACCAG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_109121__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTATCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGTGAGATCAGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAATAAGCCTGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTCCATAACGATCAAGAGGCTGCTGCATCGCTACGAGGGG---TCAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAGGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTAAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCCACCCTCCTCCCACATA---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACT-----TTACCCCTCCCCC-----------------CCACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-TT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACACCGCC--AACCAG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_114118__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTATCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAACAAGCCCGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTTCAAAACGATCAAGAGGCTGCTGCATCGCTACGAGGGT---TTAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTAAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCTTTCCTCCTCCCACATC---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACCCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACCA--CTTTACCCCTCCCCC-------------------ACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-TT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACATAGCC--AATCCG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTGGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_237.73__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTGTCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCAACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAATAAGCCTGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTCCATAACGATCAAGAGGCTGCTGCATCGCTACGAGGGG---TTAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCGATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCCACCCTCCTCCCACATA---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACT-----TTACCCCTCCCCC------------------CACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-GT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACACCGCC--AACCAG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_aplospora_CBS_545.82__ GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATCGCCAAGCCAAGACAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCAGAAACGCCAGAAGGGCAGGCTTGTGGTTTGGTGAAGAACTTGTCGTTGATGTGCTATGTCTCGGTTGGAACACCGGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAGGAATATGACCCTGTTTTGGAGCCCAAGTCAACCAAGGTTTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACCTTGCGATCTCTACGCAGGAAGGGTCTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGCGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGACGTGTTTGCCGGCCGCTGTTCGTGGTTGACAATAAGCCTGACTCTGCTGATCGCGGCAGTCTTGTGTTGAAGCAGGACCAAATAACAAAGCTCCATAACGATCAAGAGGCTGCTGCATCGCTACGAGGGG---TTAGCGAAGAGGACAGAGCTGAGCATACCTATGGATGGATGGGTCTGGTCGGCGATGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCGATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTGCGCGGCATTCACCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCCACCCTCCTCCCACATA---ACATCCC-----------TCA------CCGTGCC-CACAAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTGACACT-----TTACCCCTCCCCC------------------CACACACCGAAT-GGCACAT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCCC-GT-------CA------ACAGCAAG-CTT---------GATATGGGA---------------------------GAAAGAT----GAGCTGA-CAG-GACAAC-------TCCCAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTTATCA-------------------------------------------ACACCGCC--AACCAG--------CT-TGACCAGCG---TTTCTAACCGCCAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTACCGAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATTT?????GAGAAGGTAAGA-ACTCACC-ATCCTCATCCCCATCACA-----TTCTCA-TTCCCACCGT------CG--CGC-GCGC-------GC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGTG--TTTG-AGA--TTTCATTCTTGGCGT------CATGACCTCACT-T-----CACC-GA---AATGCCTCGCTG-GCCAC----------AAAA-CTCC-----AGCAA-CATCTCCC------CTCC----TCATGC---------------------------------------------------------------------------------CGCTC-AAATATC-------------CTCC-CCCAATAATGCTAACGA-CG-TCCCCT-CACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_archangelicae_CBS_108991__ GCCTCCACATTATCACATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCTAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCGGTTGGAACACCCGGTGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACTGAAACATTGCGTTCGCTGCGAAGGAAAGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAAATCCGAGTCTTTACTGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGTCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCATCAAGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAAGATAGAGCGGAGCATACTTATGGCTGGATGGGTTTGGTCAACGACGGTGTGGTGGAGTACTTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGACA-------CCAGA-----TAACAGC-------TT--CCA------TTGTGTC-CACCAGCTGACCCC-ATCACAGCGTCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCACCATC-----CTAAGCATCCCCT---------------------CCACGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGAATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GGTGTGTGGG--------------------------AGGGAAA----GAGCTGA-CAT-TCCACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTTAAAAA--------------------------------------------GGATA--A---GACAG--------CA-TCGATCATC---TCACTGACAAAATT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATTGAGGTCGATGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAAGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGTCCCC-ATTACATTCTTCATCA-------CCGTCT-CCATCGCTGT------CG--CGC-GCCT------TGC-A---AAAAAAA----TTGCTC-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---CTTG-AGA--TTTGCTTCTTGGCAT------CATGACCTCACC-T-----CACCCAA---ATGGCTTCGCTG-GCTAC----------CATA-TCAG-----CCTTA-CTTCGCGA-----------------------------------------------------------------------------------------------------------AAACATC--------------TGC-CACAACAACGCTGACGA-CC-TCCACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_archangelicae_CBS_108992__ GCCTCCACATTATCACATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCTAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCGGTTGGAACACCCGGTGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACTGAAACATTGCGTTCGCTGCGAAGGAAAGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAAATCCGAGTCTTTACTGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGTCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCATCAAGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAAGATAGAGCGGAGCATACTTATGGCTGGATGGGTTTGGTCAACGACGGTGTGGTGGAGTACTTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCA-------CCAGA-----TAACAGC-------TT--CCA------TTGTGTC-CACCAGCTGACCCC-ATCACAGCGTCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCACCATC-----CTACCCATCCCT----------------------CCACGCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGAATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GGTGTGTGGG--------------------------AGGGAAA----GAGCTGA-CAT-TCCACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTTAAAAA--------------------------------------------GGATA--A---GACAG--------CA-TCGATCATC---TCACTGACAAAATT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATTGAGGTCGATGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAAGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGTCCCC-ATTACATTCTTCATCA-------CCGTCT-CCATCGCTGT------CG--CGC-GCCT------TGC-A---AAAAAAA----TTGCTC-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---CTTG-AGA--TTTGCTTCTTGGCAT------CATGACCTCACC-T-----CACCCAA---ATGGCTTCGCTG-GCTAC----------CATA-TCAG-----CCTTA-CTTCGCGA-----------------------------------------------------------------------------------------------------------AAACATC--------------TGC-CACAACAACGCTGACGA-CC-TCCACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_archangelicae_CBS_109011__ GCCTCCACATTATCACATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCTAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCGGTTGGAACACCCGGTGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACTGAAACATTGCGTTCGCTGCGAAGGAAAGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAAATCCGAGTCTTTACTGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGTCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCATCAAGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAAGATAGAGCGGAGCATACTTATGGCTGGATGGGTTTGGTCAACGACGGTGTGGTGGAGTACTTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCA------TTGTGTC-CACCAGCTGACCCC-ATCACAGCGTCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCACCATC-----CTACCCATCCCT----------------------CCACGCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGAATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GGTGTGTGGGA-------------------------AGGGAAA----GGGCTGA-CAT-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTTAAAAG--------------------------------------------GGATA--A---GACAG--------CA-TCGATCATC---TCACTGACAAAACT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATTGAGGTCGATGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAAGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGTCCCC-ATTACATTCTTCATCA-------CCGTCT-CCATCGCTGT------CG--CGC-GCCT------TGC-A---AAAAAAA----TTGCTC-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---CTTG-AGA--TTTGCTTCTTGGCAT------CATGACCTCACC-T-----CACCCAA---ATGGCTTCGCTG-GCTAC----------CATA-TCAG-----CCTTA-CTTCGCGA-----------------------------------------------------------------------------------------------------------AAACATC--------------TGC-CACAACAACGCTGACGA-CC-TCCACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_archangelicae_CBS_109012__ GCCTCCACATTATCACATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCTAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCGGTTGGAACACCCGGTGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGCCAGCTTACTGAAACATTGCGTTCGCTGCGAAGGAAAGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAAATCCGAGTCTTTACTGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGTCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCATCAAGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAAGATAGAGCGGAGCATACTTATGGCTGGATGGGTTTGGTCAACGACGGTGTGGTGGAGTACTTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCA------TTGTGTC-CACCAGCTGACCCC-ATCACAGCGTCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCACCATC-----CTACCCATCCCT----------------------CCACGCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGAATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GGTGTGTGGG--------------------------AGGGAAA----GGGCTGA-CAT-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTTAAAAG--------------------------------------------GGATA--A---GACAG--------CA-TCGATCATC---TCACTGACAAAACT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATTGAGGTCGATGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAAGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGTCCCC-ATTACATTCTTCATCA-------CCGTCT-CCATCGCTGT------CG--CGC-GCCT------TGC-A---AAAAAAA----TTGCTC-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---CTTG-AGA--TTTGCTTCTTGGCAT------CATGACCTCACC-T-----CACCCAA---ATGGCTTCGCTG-GCTAC----------CATA-TCAG-----CCTTA-CTTCGCGA-----------------------------------------------------------------------------------------------------------AAACATC--------------TGC-CACAACAACGCTGACGA-CC-TCCACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_archangelicae_CBS_288.49__ GCCTCCACATTATCACATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCTAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCAGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGAGTGCACAAGAATGCTGGCCAGCTTACTGAAACATTGCGTTCGCTGCGAAGGAAAGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAAATCCGGGTCTTTACTGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGTCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCATCAAGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAAGATAGAGCGGAGCATACTTATGGCTGGATGGGTTTGGTCAACGACGGTGTGGTGGAGTACTTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGTAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCA------TTGTGTC-CACCTGCTGACCCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCACCATC-----CTACCCATCCCCT---------------------CCACGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGAATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GGTGTGTGGG--------------------------AGGGAAA----GGGCTGA-CAT-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTTAAAAA--------------------------------------------GGATA--A---GACAG--------CA-TCGATCATC---TTACTGACAAATTT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATTGAGGTCGATGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAAGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGTCCCC-ATTACATTCTTCATCA-------CCGTCT-CCATCACTGT------CG--CGC-GCCT------TGCAA---AAAAAAA----TTGCTC-TT-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTGCTTCTTGGCAT------CATGACCTCACC-T-----CACCCAA---ATGGCTTCGCTG-GCTAC----------CACA-TCAG-----CCTTA-CTTCGCGA-----------------------------------------------------------------------------------------------------------AAACATC--------------TGC-CACAACAACGCTGACGA-CC-TCCACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_armoraciae_CBS_241.90 GCATCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGCAAGATTGCGAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCCGGTGCACTTACCGAGACACTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTCTTTACCGATGCTGGGCGCGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGAGTCTGTCGAGCGCGGCAGTCTCGTGCTGAGACGAGACCAGGTTGAGAAACTTCAAGCCGATCAGGAGGCTGCTGCATCGCTACGAGGGG---TCAGTGAAGAGGACAGGGCACAACACATCTACGGATGGATGGGCCTGGTCAATGATGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--TGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--TGGA--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------CC--TTA------TCGGACC-CGCCAGCTGACACC-GTCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CTACCAATCCCCA---------------------ATCCCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TCT---------GGGATGG---------------------------TTGGAATGT----GAGCTGA-CAT-GGATACA------CCACAGCGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------AATGATGA---GTCGAT----------TTGGAAGAT---TGACTAACAATCCA---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCAAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATACCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACAT------CATC----ACATGT---------------------------------------------------------------------------------CGCCC-GATCACT-------------TCCG-AGAAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAACGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_armoraciae_CBS_253.28__ GCATCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGCAAGATTGCGAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCCGGTGCACTTACCGAGACACTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTCTTTACCGATGCTGGGCGCGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGAGTCTGTCGAGCGCGGCAGTCTCGTGCTGAGACGAGACCAGGTTGAGAAACTTCAAGCCGATCAGGAGGCTGCTGCATCGCTACGAGGGG---TCAGTGAAGAGGACAGGGCACAACACATCTACGGATGGATGGGCCTGGTCAATGATGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--TGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--TGGA--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------CC--TTA------TCGGACC-CGCCAGCTGACACC-GTCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CTACCAATCCCCA---------------------ATCCCCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TCT---------GGGATGG---------------------------TTGGAATGT----GAGCTGA-CAT-GGATACA------CCACAGCGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------AATGATGA---GTCGAT----------TTGGAAGAT---TGACTAACAATCCA---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCAAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATACCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACAT------CATC----ACATGT---------------------------------------------------------------------------------CGCCC-GATCACT-------------TCCG-AGAAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAACGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_asteris_CBS_131.21__ GCTTCCACCCTTTCCCATTTGCGCAGAACAAACACACCGATCGGGCGTGATGGCAAGATTGCTAAGCCCAGACAGCTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCATTGATGTGCTACGTCTCAGTTGGAACACCAGGCGAGCCGCTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAATATGACCCCGTCTTGGAGCCCAAGTCGACCAAAGTTTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGCCAGCTTACTGAGACGCTGCGATCGCTGCGGAGGAAGGGACTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACAGATGCTGGGCGTGTGTGCCGGCCGCTGTTCGTTGTCGACAACAAGCCTGATTCCGCCGAGCGTGGCAGTCTCGTGCTGGTTCGAAATCAGGTCGAAAAGCTCCAACACGATCAAGAGACAGCAGCGTCCCTTCGAGGCA---TAAGCGAAGAAGACAGAGCGGAGCATACTTACGGCTGGATGGGGTTGGTCAACGATGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGTGACCCTGCCGTTCACGCGGCGCT-CCCCCGGAGG--TCATC-CAAACACTGCATTCTTACGTCGGAGTATA--AGTTAATCGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--CGGG--TCGTG-GGGGCCGTT-AAATCCTTCAAAGGTTGACCTCGGATCAGGTACGGATA?????TTTCGCTGGTGACGATGCGCCCCGCGCGGTTTTCCGTGAG-----TGTAT------CCTAGCTAGC-CAGAAGC-------AC--TCA------ATGTACA-TGCCAGTTGACTTC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAGCATT-----CTATCCATCCTTA---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGCATGGG?????TCCGTAACGCGTGAGTTGT-CT-------CA------GCTATTGT-GTG---------GATGGAAAAGG-------------------------AAGGAGC----GAGCTGA-CAG-GATACC-------CCACAGCGTCGAGCACGGCGATGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTATGCCGTATGTCAAGTA--------------------------------------------ATACCGGA---GGCGG--------GC-TCCTTAAAC---TCTCTAACACGCAT--CATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTTGACGCCGACAAGGGTCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAACATTCCCTGGGGCGAGTCGAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATATCCGCTCCATCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGATATTCCCGTCATCT?????GAGAAGGTAAGT-ACTCACT-CTCA-TT-------------------CCT-AAATCACCGC------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTGTGGCTTGGCGT------CATGACCTCACT-A-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATTCCCTT------CTTC----AC-AGC---------------------------------------------------------------------------------CGTTC-AACAATC--------------TGC-TGCAACGATGCTGACGA-AC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_bellunensis_CBS_116.43__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCAGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCCGTGGGAACACCAGGCGAGCCATTGACGGACTTTATGCGACAGCGTGGGATGGATCTCCTCGAAGAGTACGACCCTGTCTTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGGACATGGGTTGGTGTACACAAAAACGCTGGTCAACTCACCGAGACTTTGCGGTCGCTGCGTAGGAAGGGTCTGCTGAGTTTTGAAGTTACCATCATTCGTGATGTTCGAGAACGCGAGATTCGGGTGTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGACAACAAGCCTGATGCCGTTGAGCGCGGCAGTCTCGTACTGAATCGAGACCAAGTTACCAAACTTCAGAACGACTCGGAGATTGCGGCCTCTCTACGAGGAA---TCAGTGAGGAGGATAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCGGGGACGGCGTTGTGGAGTATCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGTGC-------CTATTC----ACATGTC-------GC--CCA------GCATGCA-CGCCAGCTGACTCA-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATGT------CCACTTATATGCA-------------------CAAACGCCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTAGG-AT-------GA------AGAGCGGC-ATCA---ACATGGGCATAG---------------------------ATGGACTGT----GGAGTGA-TAT-GGACGT--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCAC--------------------------------------------CTGAAAGA---GTAAA--------TT-CCAATCCAA---CAACTAACAAAACA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACTGAGCGCGACCCCGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCGTCGGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACTTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-ATCA----------------------CAT-CCTTCACCGT------CG--CGC-GCTC------TGC------AAAAGA----TCG-CT-TA-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGG---TTCG-AGA---TTTCCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCTCCTC------ATTC----ACATGT---------------------------------------------------------------------------------CGCTT-GAATATT-------------GCTC-GGAACTATTACTGACAA-TG-TCCCCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCAAA Ramularia_beticola_CBS_113540__ GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CBS_141109 GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----TGGTTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCAATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CBS_151.67__ GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CBS_341.29__ GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGGAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CPC_30063 GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CPC_30064 GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CPC_30065 GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGTTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_beticola_CPC_30067 GCCTCCACACTCTCCCACTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGACCTTCTCGAAGAGTACGACCCGGTTCTCGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACTGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTTGTCGATAATAAGCCCGACTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTACAAGCTGATCAGGAGGCTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTATGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAAC-TATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCTGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGATTC-ATCTCCTAGCGTTGTAACAA---ATTTCGTAGAGGAGTT--TGGA--CCGGT-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCCCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCCGCTGACACA-GTTGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCTC-----CCACCAATCCCCA---------------------ACACCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGATCGG---------------------------GTGGAATGT----GGGCTAA-TAT-GGATACA------TCACAGCGTCGAGCACGGCGACGTCACAGTTGTGGCCGTCAACAATCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAATA---GTCGC--------AT-TCGACGAAC---CATCTAATGCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATTGAGGTCGATGGCGACAAGGGCCTGATCGTCAACGGCAAGAAGGTCCGTTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCAGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TTCCGAC-CTC-----------------------ACC-TCACTACCGT------CG--CAC-GTTC------TGC-------AAAAA----ATC-GC-AT-T---CACCCCTCCCCTGGTGGGTTGGTGGGT----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GTCAC----------TACT-CCAG-----CATCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GAGAA---------------GTCG-AGAAACATCACTGACAA-TG-TGCACA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_bosniaca_CBS_123880__ GCCTCCACACTCTCGCATTTGCGGAGAACGAACACACCCATTGGTCGTGATGGTAAGATTGCCAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACTGATTTCATGCGACAACGTGGTATGGATCTCCTCGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTGGGTGTGCATAAGAATGCTGGCCAACTTACCGAGACTTTGCGATCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATTATCCGAGATGTTCGCGAGCGCGAAATCCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGACCGCTCTTCGTGGTCGACAACAAGCTCGATTCTCCCGAGCGTGGCAGTCTTGTGCTGAGACGGGATCAGGTTGAGAAGCTCCAACACGATCAAGAGGCCGCGGCATCGCTACGAGGGGTCCTCAGTGAAGAGGAGAAAGCACAACAAACCTACGGCTGGATGGGTCTGGTCAATGATGGCGTTGTAGAGTATCTCGATGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGTGGA---TCGTAAAACGTCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCAATCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTTAAAGT-CTCCGGCTGTCCGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGAG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTAAG-----TGCTC-------CCATAC----ATGCAGC-------GT--CCA------CCGTGCC-CGGTAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----TCGCCCACTCCCA---------------------ATCTGCAAC-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGCATGGG?????TCCGCAATGCGTGAGTCGA-CT-------CC------AGATGAGC-ATC---------AGGAAGA---------------------------GTGGAATGT----GAGCTGA-CAT-GGACAT--------TACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTT-C--------------------------------------------TTGAAGGA---CCCGC--------CT-TCAGTCT-C---CCACTAACACAATC--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTTAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACTTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-TTC-----------------------ACT-TCATCACCGT------CG--GGC-GCTT------TGC------AAAATC----TCG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTTTTTCTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCTTCGCTG-GCCCA----------AACA-GCAG-----CATCG-CCCCATTG------CTTC----ACATAA---------------------------------------------------------------------------------CGCTC-GATCACT-------------CTCA-AGAACCATCACTGACAC-TG-CCACCT--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_bosniaca_CBS_123881__ GCCTCCACACTCTCGCATTTGCGGAGAACGAACACACCCATTGGTCGTGATGGTAAGATTGCCAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACTGATTTCATGCGACAACGTGGTATGGATCTCCTCGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTGGGTGTGCATAAGAATGCTGGCCAACTTACCGAGACTTTGCGATCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATTATCCGAGATGTTCGCGAGCGCGAAATCCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGACCGCTCTTCGTGGTCGACAACAAGCTCGATTCTCCCGAGCGTGGCAGTCTTGTGCTGAGACGGGATCAGGTTGAGAAGCTCCAACACGATCAAGAGGCCGCGGCATCGCTACGAGGGGTCCTCAGTGAAGAGGAGAAAGCACAACAAACCTACGGCTGGATGGGTCTGGTCAATGATGGCGTTGTAGAGTATCTCGATGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGTGGA---TCGTAAAACGTCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCAATCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTTAAAGT-CTCCGGCTGTCCGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGAG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTAAG-----TGCTC-------CCATAC----ATGCAGC-------GT--CCA------CCGTGCC-CGGTAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----TCGCCCACTCCCA---------------------ATCTGCAAC-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGCATGGG?????TCCGCAATGCGTGAGTCGA-CT-------CA------AGATGAGC-ATC---------AGGAAGA---------------------------GTGGAATGT----GAGCTGA-CAT-GGACAT--------TACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTT-C--------------------------------------------TTGAAGGA---CCCGC--------CT-TCAGTCT-C---CCACTAACACAATC--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTTAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACTTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-TTC-----------------------ACT-TCATCACCGT------CG--GGC-GCTT------TGC------AAAATC----TCG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTTTTTCTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCTTCGCTG-GCCCA----------AACA-GCAG-----CATCG-CCCCATTG------CTTC----ACATAA---------------------------------------------------------------------------------CGCTC-GATCACT-------------CTCA-AGAACCATCACTGACAC-TG-CCACCT--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_buniadis_CBS_114301__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGAGCACTTACCGAGACCTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTCTTCACCGATGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAATAAGCCCGACTCCGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCTGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCAGCTGACACA-GTCACAGCATCGATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATTCCTA---------------------ACCTTCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTTG-AT-------CA------AGAGCAGC-TCC---------AAAAAAG---------------------------GTGGAACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTGC--------------------------------------------CAAGAAGA---GTCG------------TCGAAAAAC---CATCTAA-TCGATA--TGCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTTAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTGGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TTATCACCGT------CG--CAC-GCAT------CGC------ACAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CACCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTT-GATCC-T-------------TCTG-AGATAAACGACTGACAA-TG-TCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTGTGGAAGTTCGAGACCCCCAA Ramularia_calcea_CBS_101612__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTTACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTCTTCACAGATGCTGGACGTGTCTGCCGGCCGTTGTTCGTCGTCGACAACAAGCCTGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGAGACCAAGTCGAGAAACTTCAAGCCGATCAAGACCTTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CGA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CAATCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAACGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATCGC--------AT-TCGAAAACC---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-TCATCACCGT------CG--CAC-GCCT------CGC--------AAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CTG------CATCA-CTCCACCT------CATC----ACCTGC---------------------------------------------------------------------------------CACTC-AATCCTC-------------TCCA-AGAAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_calcea_CBS_101613__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTTACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTCTTCACAGATGCTGGACGTGTCTGCCGGCCGTTGTTCGTCGTCGACAACAAGCCTGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGAGACCAAGTCGAGAAACTTCAAGCCGATCAAGACCTTGCAGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CGA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CAATCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAACGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATCGC--------AT-TCGAAAACC---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-TCATCACCGT------CG--CAC-GCCT------CGC--------AAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CTG------CATCA-CTCCACCT------CATC----ACCTGC---------------------------------------------------------------------------------CACTC-AATCCTC-------------TCCA-AGAAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_calcea_CBS_114442__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTAGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGAGCACTTACCGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTTGAGGTGACCATCATTCGCGATGTCCGAGAACGCGAGATTCGGGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGATAATAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTCCAAGCCGATCAAGAGGCAGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACT-TCTACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACGT----GAGCTGA-CCT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAT--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAAATC---CATCTAATTCGATA--TTTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GTCT------CGC------AAAAAA----ATC-GC-TT-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CGTCA-CTCCACCT------CATC----ACATTC---------------------------------------------------------------------------------CACTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-TATTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_carneola_CBS_108975__ GCCTCCACACTCTCGCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCATAAAAACGCTGGAGCGCTCACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGTTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGCGGCAGTCTTGTGCTGAGACGAGAACAAGTCGAGAAACTTCAGGCCGATCAAGAGGCAGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGTACAG---------------------------GTGGAACGT----GAGCTGA-CATGGGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTACGCTTTTAC--------------------------------------------CAAAAAGA---GTCGCC----------TTGGAAGAT---TGACTAACACCCCT---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCCCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACATCCAG-----CATCA-TTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_carneola_CBS_108976__ GCCTCCACACTCTCGCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCATAAAAACGCTGGAGCGCTCACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGTTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGCGGCAGTCTTGTGCTGAGACGAGAACAAGTCGAGAAACTTCAGGCCGATCAAGAGGCAGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATTCGGC-------GT--CTA------GGGTATC-CGCCAGCTGACACA-GTCTCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGTTATC-----CCACCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGTACAG---------------------------GTGGAACGT----GAGCTGA-CATGGGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTACGCTTTTAC--------------------------------------------CAAAAAGA---GTCGCC----------TTGGAAGAT---TGACTAACACCCCT---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCCCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACATCCAG-----CATCA-TTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_carneola_CBS_108977__ GCCTCCACACTCTCGCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCATAAAAACGCTGGAGCGCTCACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGTTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGCGGCAGTCTTGTGCTGAGACGAGAACAAGTCGAGAAACTTCAGGCCGATCAAGAGGCAGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGTACAG---------------------------GTGGAACGT----GAGCTGA-CATGGGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTACGCTTTTAC--------------------------------------------CAAAAAGA---GTCGCC----------TTGGAAGAT---TGACTAACACCCCT---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCCCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACATCCAG-----CATCA-TTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_carneola_CBS_108978__ GCCTCCACACTCTCGCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCCAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCGACGGTACTTGGGTCGGTGTGCATAAAAACGCTGGAGCGCTCACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGTTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGCGGCAGTCTTGTGCTGAGACGAGAACAAGTCGAGAAACTTCAGGCCGATCAAGAGGCAGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGGTGGATGGGCCTGGTCAGTGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGTACAG---------------------------GTGGAACGT----GAGCTGA-CATGGGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTACGCTTTTAC--------------------------------------------CAAAAAGA---GTCGCC----------TTGGAAGAT---TGACTAACACCCCT---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCCCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACATCCAG-----CATCA-TTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_carneola_CBS_109847__ GCCTCCACACTCTCGCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCATAAAAACGCTGGAGCGCTCACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGTTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGCGGCAGTCTTGTGCTGAGACGAGAACAAGTCGAGAAACTTCAGGCCGATCAAGAGGCAGCGGCGTCGCTGCGAGGAG---TCAGTGAAGAGGACAGAGCACAACACATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATGCGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGTACAG---------------------------GTGGAACGT----GAGCTGA-CATGGGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTACGCTTTTAC--------------------------------------------CAAAAAGA---GTCGCC----------TTGGAAGAT---TGACTAACACCCCT---ATCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCCCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACATCCAG-----CATCA-TTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cerastiicola_CBS_115913 GCTTCCACCCTTTCCCATTTGAGGAGAACCAACACCCCCATCGGGCGTGATGGCAAGATCGCAAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAAAACCTGTCGTTGATGTGCTACGTCTCGGTTGGAACTCCAGGCGAACCGCTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTAGAAGAGTATGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTCTTCATCAATGGCACATGGGTTGGTGTGCATAAGAATGCTGGTCAGCTTACCGAAACCCTGCGATCGCTACGGAGGAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGCGAAATTCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGTCCGCTGTTCGTTGTCGACAACAAGCCTGATTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAAAAGCTCCAACACGATCAGGAGACTGCAGCGTCCCTCCGGGGGA---TAAGCGAAGAGGATAGGGCAGAGCATACCTATGGCTGGATGGGCTTGGTCAACGAGGGCGTGGTAGAATACCTCGACGCAGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGG-------AGCAATCCCGAACCTCCAACCCTCTGTGAACGCATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCGTTCGGCATTTCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------TCCTCGCGCGTCCCAAAGT-CTCCGGCCGGGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT-CCGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCATA-----TCCTTGC-------GC--CCA------CAGCACC-CACCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CCACCCATCCTCCTC----------CTCCCCACTTCCAGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-GT-------CA------GATATAGC-ATT---------GATGTGGAG---------------------------GAGGAAT----GGGCTGA-C-G-GATACC-------TCACAGCGTTGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGTCATTCA--------------------------------------------ATACAGAT---GATGGC------TTT-CCACCAATC---CTCCTAACATCACC---TCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGATCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACAACCGAGAAGGCTTCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGATATCCCCGTCATCT???????????????????????????????----------------------TC--TACCGCTGT------CG--CGC-ACCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGG----------------G----------------------TGGT-GGGGG---TTTG-AGA---TTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAT-GA---AATGTCCCGTTGGGACAC----------AACA-CCAG-----CAGCA----CTTCC------CTCC----ACGTTC---------------------------------------------------------------------------------CGATT-CACAGCC--------------TGC-AATAACAATGCTGACGA-CC-TCACCC--GTAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCT{CG}T{CG}TGGAAGTTCGAGACCCCCAA Ramularia_chamaedryos_CBS_113307__ GCCTCTACACTCTCCCATTTGCGGAGAACAAACACTCCCATTGGCCGCGATGGTAAGATTGCCAAACCCAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGAGAGCCATTGACAGACTTCATGCGGCAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACGAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAGAATGCCGGTGCACTTACCGAGACCTTGCGATCGCTGCGAAGAAAGGGTCTCCTCAGCTTCGAGGTCACCATCATTCGGGATGTTCGAGAACGCGAAATTCGGGTCTTTACTGATGCTGGGCGCGTCTGCCGGCCACTATTCGTGGTCGACAATAAGCCAGATTCCCCCGAGCGCGGCAGTCTTGTGCTCAGACGGGACCAGGTTGAAAAACTCCAAGCCGACCAGGAGACTGCGGCGTCGCTACGAGGAATTCTCAGTGAAGAGGAAAAGGCACAACAAACGTACGGCTGGATGGGTTTGGTCAATGATGGTGTTGTAGAGTACCTTGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGATG---ATAATACATCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG-TTCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTCCCAAC------------ATGCGGC-------GC--CCA------GAGGACT-CGCCAGCTGACATT-ACCACAGCTTCGATTGTTGGCCGACCGCGCCACCATGGGT-ATGAGATACC-----CCACCCATTCCAAA--------------------TCTTGCAAT-GGCA-TT---TTTCTGACAAGAGCGTAGTATTATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGA-GT-------CA------AGATCAGC-ATC---------AAAGAATG--------------------------GGGGAATGT----GAGCTGA-CAC-GGACAC--------CATAGTGTCGAGCACGGCGATGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTGAC--------------------------------------------TTGGGATG---GCTAA--------CC-TTGGCCTAC---ATACTGACCTTTAA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTTTTCAAGGGCACCATCGAGGTCGACGGTGACAAAGGCCTGATTGTCAACGGCAAGAAAATCCGCTTCCACACTGAGCGTGACCCAGCCAGCATCCCATGGAAGGAGTCTGGCGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCCTGAC-CTCA----------------------ATT-CCTTCACCGT------CG--CGC-GCCC------GGC--------AAAA----TTG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG--TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAA---------AAACA-CCGG-----CTTCA-CTTCATTC------CTCC----GCATGC---------------------------------------------------------------------------------CACAT-GCTCAAT-------------ATCG-CGGATCATCACTGACAA-TG-TCAACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_chamaedryos_CBS_114731__ GCCTCTACACTCTCCCATTTGCGGAGGACAAACACTCCCATTGGCCGCGATGGTAAGATTGCCAAACCCAGACAACTCCACAATACCCACTGGGGTCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGAGAGCCATTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAGAATGCCGGTGCACTTACCGAGACCTTGCGATCGCTGCGAAGAAAGGGTCTCCTCAGCTTCGAGGTCACCATCATTCGGGATGTTCGAGAACGCGAAATTCGGGTCTTTACTGATGCTGGGCGCGTCTGCCGGCCACTATTCGTGGTCGACAATAAGCCAGATTCTCCCGAGCGCGGCAGTCTTGTGCTCAGACGGGACCAGGTCGAAAAACTCCAAGCCGACCAGGAGACTGCGGCGTCGCTCCGAGGAATTCTCAGTGAAGAGGAAAAGGCACAACAAACGTACGGCTGGATGGGTCTGGTCAATGATGGTGTCGTAGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGATG---ATAACACATCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATCTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG-TTCGGC-GCGGCCGTT-AAATCCTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTCCCAAC------------ATGCGGC-------GC--CCGGA---AGAGGACT-CGCCAGCTGACATT-TCCACAGCTTCGATTGTCGGCCGACCGCGCCACCATGGGT-ATGAGATACC-----CCACCCATTCCAAA--------------------TCTCCCAAC-GGCA-TT-TCTTTCTGACAAGAGTGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATCAGC-ATC---------AAAGAAT---------------------------GGGGAATGT----GAGCTGA-CAC-GGACAC--------CATAGCGTCGAGCACGGCGATGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTGAC--------------------------------------------TTGGGATG---GTTAA--------CC-TTGGCCTAA---ATACTGACTCTTTA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAAGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAGCATCCCATGGAAAGAGTCTGGTGCCGACTACATCGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCATTTGAAGGGCGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCCTGAC-CTCA----------------------ATT-CCTTCACCGT------CG--CGC-GCCC------GGC--------AAAA----TTG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG--TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAA---------AATCA-CCGG-----CTTCA-CTTCATTC------CTCC----GCATGC---------------------------------------------------------------------------------CACTT-GCTCAAT-------------GTCG-CGGATCATCACTGACAA-TG-TCA-----ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_chamaedryos_CBS_116577__ GCCTCTACACTCTCCCATTTGCGGAGAACAAACACTCCCATTGGCCGCGATGGCAAGATTGCCAAACCCAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGAGAGCCATTGACAGACTTCATGCGGCAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACAAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAGAATGCCGGTGCACTTACCGAGACCTTGCGATCGCTGCGAAGAAAGGGTCTCCTCAGCTTCGAGGTCACCATCATTCGGGATGTTCGAGAACGCGAAATTCGGGTCTTTACTGATGCTGGGCGCGTCTGCCGGCCACTATTCGTGGTCGACAATAAGCCAGATTCCCCCGAGCGCGGCAGTCTTGTGCTCAGACGGGACCAGGTTGAAAAACTCCAAGCCGACCAGGAGACTGCGGCATCGCTACGAGGAATTCTCAGTGAAGAGGAAAAGGCACAACAAACATACGGCTGGATGGGTCTGGTCAACGATGGTGTTGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGATG---ATAATACATCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG-TTCGGT-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTAGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTCCCAAC------------ATGCGGC-------GC--CCA------GAGGACT-CGCCAGCTGACATT-ACCACAGCTTCGATTGTTGGCCGACCGCGCCACCATGGGT-ATGAGATACC-----CCACCCATTCCAAA--------------------TCTTGCAAT-GGCA-TT---TTTCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATCAGC-ATC---------AAAGAAT---------------------------GGGGAATGT----GAGCTGA-CAC-GGACAC--------CATAGCGTCGAGCACGGCGATGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTGAC--------------------------------------------TTGGGATG---GTTAA--------CC-TTGGCCTAA---ATACTGACCCTTTA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAAGGCCTGATTGTCAACGGCAAGAAAATCCGCTTCCACACTGAGCGTGACCCAGCCAGCATCCCATGGAAGGAGTCTGGCGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCCTGAC-CTCA----------------------ATT-CCTTCACCGT------CG--CGC-GCCC------GGC--------AAAA----TTG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG--TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAA---------AAACA-CCGG-----CTTCA-CTTCATTC------CTCC----GCATGC---------------------------------------------------------------------------------CACTT-GCTCAAT-------------ATCG-CGGATCATCACTGACAA-TG-TCAACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_chamaedryos_CBS_118794__ GCCTCTACACTCTCCCATTTGCGGAGAACAAACACTCCCATTGGCCGCGATGGTAAGATTGCCAAACCCAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGAGAGCCATTGACAGACTTCATGCGGCAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACTAAGGT-TTCATCAACGGTACTTGGGT-GGTGTGCACAAG-ATGCCGGTGCACTTACCGAGACCTTGCGATCGCTGCGAAGAAAGGGTCTCCTCAGCTTCGAGGTCACCATCATTCGGGATGTTCGAGAACGCGAAATTCGGGTCTTTACTGATGCTGGGCGCGTCTGCCGGCCACTATTCGTGGTCGACAATAAGCCAGATTCCCCCGAGCGCGGCAGTCTTGTGCTCAGACGGGACCAGGTTGAAAAACTCCAAGCCGACCAGGAGACTGCGGCATCGCTACGAGGAATTCTCAGTGAAGAGGAAAAGGCACAACAAACATACGGCTGGATGGGTCTGGTCAACGATGGTGTTGTAGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGATG---ATAATACATCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG-TTCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTCCCAAC------------ATGCGGC-------GC--CCA------GAGGACT-CGCCAGCTGACATT-ACCACAGCTTCGATTGTTGGCCGACCGCGCCACCATGGGT-ATGAGATACC-----CCACCCATTCCAAA--------------------TCTTGCAAT-GGCA-TT---TTTCTGACAAGAGCGTAGTATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATGAGC-ATC---------AAAGAAT---------------------------GGGGGATGT----GAGCTGA-CAC-GGACAC--------CATAGCGTCGAGCACGGCGATGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTGAC--------------------------------------------TTGGGATG---GTTAA--------CC-TTGGCCTAC---ACACTGACCC-TTA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAAGGCCTGATTGTCAACGGCAAGAAAATCCGCTTCCACACTGAGCGTGACCCCGCCAGCATCCCATGGAAGGAGTCTGGCGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCCTGAC-CTCA----------------------ATT-CCTTCACCGT------CG--CGC-GCCC------GGT--------AAAA----TTG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG--TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAA---------AAACA-CCGG-----CTTCA-CTTCATTC------CTCC----GCATGC---------------------------------------------------------------------------------CACTT-GCTCAAT-------------ATCG-CGGATCATCACTGACAA-TG-TCAACC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_chelidonii_CBS_113317__ GCCTCTACACTGTCTCACTTACAAAGAACAAACACACCCGTCGGCCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGGCTTGTATGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCCTCGTGAATAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCTCTGACAGACTTTATGCGACAACGCGGCATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTCAACTTACCGAGACGTTGCGATCGTTGCGAAGGAAGGGTCTCCTAAGTTTCAAGGTCACCATTATTCGTGATGTTCGCGAACGCGAGATTCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCTGTTGAGCGTGGCAGTCTTGTCCTGAAACAAGACCAGGTCGCAAAACTCCACAACGACCAGGAGATCGCGGCGTCTCTACGGGGCA---TCAGTGAAGAGGATAGAGCACAGCACACGTACGGTTGGATGGGCTTGGTCAGCGATGGTGTTGTAGAGTATCTTGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTATGTGAACCCCTCTCGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCAGAGG--TCATT--CAACACTGCATCCTTACGTCGGAGCACA-AAGTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTCTTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TCTTTCGCCGCGGAGTG--CGAG--TCG-C-GTGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCTGGTGACGATGCGCCCCGTGCTGTCTTCCGTACG-----TGTTT-------CCAGTA----ATATATC-------GT--CCA------GCGTGCCCCGCCAGCTAACTCC-ATCACAGCATCTATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAATGTT-----CTACCCATTATTT------------------ACAAAGTCCTAT-GACA-AT-----TCTGACAACAGCATAGTATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-TT-------CGGTTCA-AGATGACC-ATC----GCATCAGCATGA---------------------------ATGGGCTGT----GAGCTGA-CTTGGAATAT--------CACAGCGTCGAACACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATTCCTCGAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAGTCCAC---CGACTAATACAGTA--TCTCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAATGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGAGGGACCCCGCCAACATCCCCTGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCTATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCCCGAC-CTC-----------------------GTA-TCTTCACCG-------CA--CGC-GCTC------TGC------CAAAAA----TCGCTT-TA-T---GACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-T-----CACT-AA---AATGCCTCGCTG-GTCAC----------AAAA-CTAG-----CACCG-CTTCTCTG------ACTC----ACACGT---------------------------------------------------------------------------------TGCGC-GTGTGTT-------------ATTC-GGAAACAATACTGACAA-TG-TCCGCC--GTAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCAAA Ramularia_chelidonii_CPC_12208_ GCCTCTACACTGTCTCACTTACAAAGAACAAACACACCCGTCGGCCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACGACACCCACTGGGGGCTTGTATGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCCTCGTGAATAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACACCATGCGAGCCTCTGACAGACTTTATGCGACAACGCGGCATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTCAACTTACCGAGACGTTGCGATCGTTGCGAAGGAAGGGTCTCCTAAGTTTCAAGGTCACCATTATTCGTGATGTTCGCGAACGCTAGATTCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCTGTTGAGCGTGGCAGTCTTGTCCTGAAACAAGACCAGGTCGCAAAACTCCACAACGACCAGGAGATCGCGGCGTCTCTACGGGGCA---TCAGTGAAGAGGATAGAGCACAGCACACGTACGGTTGGATGGGCTTGGTCAGCGATGGTGTTGTAGAGTATCTTGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTATGTGAACCCCTCTCGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCAGAGG--TCATT--CAACACTGCATCCTTACGTCGGAGCACA-AAGTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTCTTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TCTTTCGCCGCGGAGTG--CGAG--TCG-C-GTGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCTGGTGACGATGCGCCCCGTGCTGTCTTCCGTACG-----TGTTT-------CCAGTA----ATATATC-------GT--CCA------GCGTGCCCCGCCAGCTAACTCC-ATCACAGCATCTATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAATGTT-----CTACCCATTATTT------------------ACAAAGTCCTAT-GACA-AT-----TCTGACAACAGCATAGTATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-TT-------CGGTTCA-AGATGACC-ATC----GCATCAGCATGA---------------------------ATGGGCTGT----GAGCTGA-CTTGGAATAT--------CACAGCGTCGAACACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATTCCTCGAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAGTCCAC---CGACTAATACAGTA--TCTCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAATGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGAGGGACCCCGCCAACATCCCCTGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCTATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGG-TCCCGAC-CTC-----------------------GTA-TCTTCACCG-------CA--CGC-GCTC------TGC------CAAAAA----TCGCTT-TA-T---GACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCAC------TATGACCTCACA-T-----CACT-AA---AATGCCTCGCTG-GTCAC----------AAAA-CTAG-----CACCG-CTTCTCTG------ACTC----ACACGT---------------------------------------------------------------------------------TGCGC-GTGTGTT-------------ATTC-GGAAACAATACTGACAA-TG-TCCGCC--GTAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCAAA Ramularia_chelidonii_CPC_12209_ GCCTCTACACTGTCTCACTTACGAAGAACAAACACACCCATCGGCCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGGCTTGTATGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCCTCGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCTCTGACAGACTTTATGCGACAACGCGGCATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTCAACTTACCGAGACGTTGCGATCGTTGCGAAGGAAGGGTCTCCTAAGTTTCGAGGTCACCATTATTCGTGATGTTCGCGAACGCGAGATTCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCTGTTGAGCGTGGCAGTCTTGTCCTGAAACAAGACCAGGTCGCAAAACTCCACAACGACCAGGAGATCGCGGCGTCTCTACGGGGCA---TCAGTGAAGAGGATAGAGCACAGCACACGTACGGTTGGATGGGCTTGGTCAGCGATGGTGTTGTAGAGTATCTTGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTATGTGAACCCCTCTCGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCAGAGG--TCATT--CAACACTGCATCCTTACGTCGGAGCACA-AAGTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTCTTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TCTTTCGCCGCGGAGTG--CGAG--TCG-C-GTGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCTGGTGACGATGCGCCCCGTGCTGTCTTCCGTACG-----TGTTT-------CCAGTA----ATATATC-------GT--CCA------GCGTGCCCCGCCAGCTAACTCC-ATCACAGCATCTATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAATGTT-----CTACCCATTATTT------------------ACAAAGTCCTAT-GACA-AT-----TCTGACAACAGCATAGTATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-TT-------CGGTTCA-AGATGACC-ATC----GCAT-CAGATGA---------------------------ATGGGCTGT----GAGCTGA-CTTGGAATAT--------CACAGCGTCGAACACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATTCCTCGAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAGTCCAC---CGACTAATACAGTA--TCTCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAATGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGAGGGACCCCGCCAACATCCCCTGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCTATGTTCGTCCTGGGCGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGG-TCCCGAC-CTC-----------------------GTA-TCTTCACCG-------CA--CGC-GCTC------TGC------CAAAAA----TCGCTT-TA-T---GACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCAC------TATGACCTCACA-T-----CACT-AA---AATGCCTCGCTG-GTCAC----------AAAA-CTAG-----CACCG-CTTCTCTG------ACTC----ACACGT---------------------------------------------------------------------------------TGCGC-GTGTGTT-------------ATTC-GGAAACAATACTGACAA-TG-TCCGCC--GTAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCAAA Ramularia_coleosporii_CBS_131756__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATATC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TCGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CBS_131757__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACT-CCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TCGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CBS_131759__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATGCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TCGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------TGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CBS_131760__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCAGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCTAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA--CCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TTGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTTGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CBS_131762__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATTATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TCGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CBS_131764__ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGTCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATATC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TTGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CPC_10669_ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTCCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCACATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA--CCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TTGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTTGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CPC_10731_ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TTGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CPC_10732_ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGCCTGGTCAGCGATGGTGTCGTGGAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TTGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coleosporii_CPC_10748_ GCCTCCACGCTGTCCCACTTGCGGAGAACAAACACGCCCATTGGTCGTGACGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGCCCAGCAGAGACGCCTGAGGGACAGGCTTGCGGTCTCGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACCGACTTCATGCGACAACGTGGTATGGACCTTCTCGAAGAATACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTTCACAAAAATGCCGGCCAACTCACAGAGACTTTGCGGTCGCTGCGAAGGAAGGGCTTGCTAAGTTTCGAGGTCACGATCATTCGTGATGTCCGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAACCTGATGCCGTGGAGCGTGGCAGTCTTGTCCTCAACCGAGATCAGATCACAAAACTCCAAAACGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAGGAAGATAGAGCACAGCATACGTACGGCTGGATGGGTCTGGTCAGCGATGGTGTCGTGAAGTACCTGGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTC-------CCATAC----ACATGCC-------AT--CCA------GCGTGCA-TCCCGGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCCATAAC----ACCCCGCATCTTCG-------------------CATCCTCCAAT-GGCA-AT-----TCTGACGAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AT-------CA------AGAGCAGC-ATGA---ACA------------------------------------CCAGCATGG----GTGCTGA-CAA-TACAACC------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATACTCACAC--------------------------------------------CCAAAAGA---GCCAT--------CT-TCAATTCAC---CACCTAACAATGGA--CTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACGATCGAGGTCGACGGTGACAAGGGTTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGC-CCCCGAC-TTC-----------------------CTA-AGTTTCCCGT------CG--TGC-GGTT-----TCGA------AAAATA----TTG-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTGAAGA---TTTTCGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCGG-GACAC----------ACCA-CCGG-----CACCA-ATCCACC-------CGTC----GCACCC---------------------------------------------------------------------------------CGCTT-ACAAGTC-------------TCTC-GAAATCACTACTAACAA-TG-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 101180 ' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 101181 ' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 101182 ' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 119439' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TCAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 119440' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 119441' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA????????????GGTGACGATGCGCCCCGTGCTGTCTTCCGTACG-----TGTTT-------CCAGTA----ATATATC-------GT--CCA------GCGTGCCCCGCCAGCTAACTCC-ATCACAGCATCTATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAATGTT-----CTACCCATTATTT------------------ACAAAGTCCTAT-GACA-AT-----TCTGACAACAGCATAGTATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia collo-cygni CBS 119442' GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGCAAGATTGCCAAGCCGCGACAACTTCACAACACCCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGACCTGTTGGAAGAATACGATCCCGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGACAACTCACCGAAACTCTGCGATCGCTACGAAGAAAAGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGACGTTCGAGAACGCGAGATTCGAGTCTTCACCGATGCTGGGCGTGTTTGTCGGCCGCTGTTTGTGGTCGACAACAAACCCGACTCGGCAGATCGCGGCAGTCTGGTGTTGAAGCAAGATCAGATTGCAAAGCTGCATGAAGACGAGGCGGCAGCGGCTTCCCTCCGTGGTA---TTAGTGAAGAGGACAGGGCCGAACATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTGGAGTACCTCGATGCGGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGCGCAAGCGGCATTCCCCCCGGAGG--TCATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATG------TCCAAA-----ATACGTT-------GT--CTA------GCGTGCC-CGCCCACTGACTCC-ATTACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACGAC-----CCAATTATGCTCC---------------------ACCTTCAAT-GGCA-TT-----TCTGACAAGAGCACAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------TCATGAGC-ATG---------AATCAGAAG---------------------------GAGACAT----TGGCTGA-CAA-G--GAC-------ATGCAGCGTCGAGCATGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAATCC--------------------------------------------ATGAA--C---AATGG--------CCAAGACAATCG---CATTTAACATCCAT----TCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTGAACGGCAAGAAGGTTCGCTTCCACACCGAGCGCGACCCCGCCAGCATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCCG-TCGCATC-------------------ACT-TTACTTCCGT------CG--CGC-GCCG------TG-------CAAAAA----TCG-CC-CA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCGTC-----CATGACCTCACA-C----CGAAC-AA---AAAGCCTAGCTG-GCCAC----------ATGG-CTGG-----CTTCA-CTCCACCC--------CC----ACATGC---------------------------------------------------------------------------------CGTCC-AAATTTC-----------CTCTAC-CATCAAAATGCTGACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_coryli_CBS_117800 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACTCCCATTGGACGTGATGGCAAAATCGCCAAGCCGCGACAGCTTCACAATACCCATTGGGGATTGGTGTGTCCGGCAGAAACGCCTGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTGTCGTTGATGTGCTACGTCACGGTTGGAACACCCGGTGAGCCTCTTGTGGACTTTATGCGACAGCGTGGTATGGACCTTCTCGAGGAGTACGACCCTGTGCTGGAGCCGAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTGGGTGTGCACAAGAACGCGGGAGCACTCACCGAGACGCTACGAGGCCTCCGGAGAAAGGGTTTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTTCGAGAACGCGAGATTCGGGTCTTCACCGACGCCGGGCGTGTTTGTCGGCCGCTATTCGTCGTCGACAATGCGCGAGATGCTGTAGAGCGCGGCAGTCTCGTGCTGAAGCAGGATCAAATCTCCAAACTCCAACAGGATCAGGAGAATGCTGCATCCCTAGTAGGCA---TCAGCGAGGAGGACAGACTTGAAAACACCTACGGTTGGCCAGGTCTGATCAAAGATGGTGTTGTCGAATACCTCGATGCTGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGCTGGTTTATAGTACAACCCGATCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TATTA-------TCATAATC--ACACCAC-------AT--ACA------GCAGGAC-TGCCAGCTGACACC-ACCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCACATC------CACTTTCCCACC---------------------CCACTCGAT-GGCAGAA-----TCTGACAGGAGCGCAGCATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-CTCCCA---CA------TCATCAAG-AGC----AGATCAATACGAGAAT-----------------------GGACGGCAC----ACGCTGA-CAT-GGATACC------TTACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCCTTCATTGAGCCCACCTACGCGGTATGCAGCATT--------------------------------------------GCATCCCA--GTCCAG--------CT-TCACTCCCC---CAACTAACTCTTCC----CCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTCTTCAACGGAACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGAGGGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCACCCTCCGCCGATGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGC-CGCCATC-CTCGCGC-------------------GTC-ACATCACTCCCC----TG-CTGC-AATC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTG--TTTG-AGA---TTTTCACTTGGCAT------CATGACCTCACC-T-----CACC-AA---AATGCCTCGCTG-GCATC----------ACCG-CTCG-----CAACACTCCCACCA------GTTC----ACATGT---------------------------------------------------------------------------------CGCGC-AAACATGAC---------TTCGAA-GAATACAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cupulariae_CBS_235.73__ ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGGCAGGCTTGTGGTCTCGTAAAGAACTTGTCCTTGATGTGCTACGTTTCGGTGGGAACACCGGGCGAACCACTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGATCCCGTTCTGGAGCCAAAGTCGACCAAGGTTTTCATCAATGGAACTTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACCGAAACCTTGCGATCGCTGCGAAGGAAGGGACTGCTCAGTTTTGAGGTTACAATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTCCGGAATCAGGTTGAAAAGCTTCAACACGATCAAGAGACTGCAGCTTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCGGAGCATACCTATGGCTGGATGGGCTTGGTCAATGAAGGCGTGGTTGAATACCTCGATGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGTTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTC-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC------CCTAGG-----CAGAAGC-------AT--ACA------ATGGACA-TACCAGCTGACTTT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCATCATCC--CACCACCCATCCTCC---------------------CTTTCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CC------ATCGTAGA-ACA---------TACTTTCCA---------------------------GAAGGAA----GAGCTGA-CAA-AATACC-------TCACAGCATCGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACTTACGCCGTATGACATGCA--------------------------------------------ATATAGAA---GACA----------T-CTATCGCTC---CCTCTAATTTCAAC---TCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGTACCATCGATGTGGACGGTGACAAGGGTCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATTCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACTTCCGACATCCCTGTCATCT?????GAGAAGGTAAGC-ATTCGCC-CCC--AA-------------------ACC-ACATCACTGT------CG--CGC-GCCG------TTC------CAAAAAT--TTCC-TT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-G-----CAAC-AA---AATGCCTCGCTG-GTCCC----------AACA-CCAG-----CAGCA-GTACATTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCTC-CGCTATC--------------TGT-CACAGCAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cyclaminicola_CBS_399.51__ GCGTCCACGCTTTCTCATTTGAGGAGAACAAACACACCTATCGGACGTGATGGCAAGATTGCTAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAATACGACCCTGTATTAGAACCCAAGTCGACCAAGGTATTCATCAACGGTACTTGGGTGGGAGTGCACAAGAACGCTGGCCAATTGACTGAGACATTGCGGTCATTGCGGAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATCCGTGACGTGAGAGAACGTGAGATTCGAGTTTTCACTGATGCTGGACGTGTCTGCCGACCGCTGTTCGTGGTCGACAACAAGCCTGATTCTGCTGAGCGCGGCAGTCTTGTACTGGTGCGGGATCAGGTTGCAAAGCTCCAACACGATCAAGAGACTGCGGCGTCTCTTCGCGGCA---TAAGCGAAGAGGATAGAGCCGAGCATACCTACGGCTGGATGGGCTTGGTCAATGATGGTGTGGTTGAGTACCTCGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCACTCCCCCCGAAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-CTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTC--GGAG--TCGTC-CCGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCTCCACGCGCTGTCTTCCGTGAG-----TGTTT------CCCATAC---CACACACTGTC----GC--CCA------ATATACT-CGACAGCTGACCCC-ACCACAGCTTCCATTGTCGGACGACCGCGCCACCATGGGT-ACGCAGCATC-----CGACTCATCCTCC------------------ACACTCATTGAT-GAGA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGC-TT-------AA------GCTTCATC-AGC---------AGTGGTATGGA-------------------------GGGGAAG----GAGCTGA-CGG-GAGATC-------TTATAGCGTGGAGCACGGCGACGTCACCGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTGGACGG--------------------------------------------GATTAA-----TACGG--------CA-TCGCATGCA---CTCCTAACACAAGTC-TTTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAAAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCTCACT-CTCATCACTCCAGCCAACCGTTACCGTCA-TCGTCACTGT------CG--CGC-GCCT------TCC------AAAAAT----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGTA--TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CATC-AA---AATGCCTC--------------------AACA-CCCG-----CATCA-TTCCATTC------CTCT----ACATGT---------------------------------------------------------------------------------CACTC-CAATTCC--------------GAT-CTCACCAATGCTGACAA-CA-TCACTT--GTAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CBS_114728__ GCTTCCACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTTGGTGTGCACAAGAACGCTGGCCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTGAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTTTTCACTGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTTGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGATGCAGAAGAGGAAGAGACCGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAGTAGACTGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CTACTCATCCTCC------------------TCCTCACGCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTTAC-TT-------CA------CATGTGGC-ATT---------GCTGTTGAAGG-------------------------AGAAAGA----GAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTAAATA--------------------------------------------ATCCACAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGAAAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCTCACTCCCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CBS_114729__ GCTTCCACACTCTCGCATCTGAGGAGAACAAACACACCTATCGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTTTTCACTGATGCTGGGCGTGTCTGCCGGCCCCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTTGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGTTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGAG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCTCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATC-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CCACTCATCCTCC---------------------TCACTCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGAAAGA----GAGCTAA-CAA-GAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCACAA---GACAG--------TT-ATACAACAC---TCCCTAATACCATAATTCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCTCACT-CCCA-TC-------------------ACT-TCATTGTTGT------TG--CGC-GCCT------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AA--------CT-GCCAC----------AACG--CAG-----TACCA-ATTCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CGCTATC--------------TGC-AACAACAATGCTGACGA-CC-C--TCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CBS_128779 GCTTCCACACTCTCGCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTATCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTCACAGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAACCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTCGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CTACTCATCCTCC------------------TCCTCACTCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGAAAGA----GAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCGACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCGCAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCAGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAATAAA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CBS_128912 GCTTCCACACTCTCGCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTATCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTCACAGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAACCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTCGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CTACTCATCCTCC------------------TCCTCACTCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGAAAGA----GAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCGACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCGCAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCAGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAATAAA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CPC_18427_ GCTTCCACACTCTCGCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTATCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTCACAGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAACCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTCGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CTACTCATCCTCC------------------TCCTCACTCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGAAAGAA--GAAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCGACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCGCAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCAGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAATAAA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CPC_18726_ ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGGCTTGCGGTTTGGTGAAGAACTTATCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTCACAGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAACCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTGCGATCGCTACGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTCGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CTACTCATCCTCC------------------TCCTCACTCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGAAAGA----GAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCGACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCGCAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCAGCCGATGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAATAAA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CPC_25896 GCTTCCACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGGTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTGTCGTTAATGTGCTACGTTTCTGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGGATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACACTTCGATCGCTACGAAGGAAGGGCTTGCTCAGTTTCGAGGTTACAATCATTCGTGATGTAAGAGAGCGTGAGATCCGAGTTTTCACTGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTTGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTCCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTAGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCACC-----CTACTCATCCTCC------------------TCCCCACGCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTAC-TT-------CA------CATATGGC-ATT---------GTTGTTGAAGG-------------------------AGAGAAA----GAGCTGA-CAG-CAAACT-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCACGA---GACAG--------TT-ATCCAACAC---TCCCTAACACCATCACGCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACTGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCTGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TCTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AA--------CG-GCCAC----------GACG--CAG-----TACCA-ATCCACTC------TTTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-CC-CCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_cynarae_CPC_25897 GCTTCCACACTCTCGCATTTGAGGAGAACAAACACACCTATCGGGCGTGATGGTAAGATCGCCAAGCCTAGACAGCTTCACAACACCCACTGGGGTTTGGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGATCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGTACGTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAGACCTTGCGATCGCTGCGAAGGAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTAAGAGAGCGTGAGATTCGAGTTTTTACTGATGCTGGGCGTGTCTGTCGGCCGCTCTTTGTGGTCGATAACAAGCCTGACTCGGCTGAGCGCGGCAGTCTCGTGTTGGTCCGGAGTCAGGTTGAAAAGCTTCAGCATGACCAAGAGACCGCAGCATCTCTTCGAGGAA---TAAGTGAGGAGGACAGAGCAGAGCATACATACGGTTGGATGGGCTTGGTCAATGAAGGTGTAGTTGAGTATCTGGACGCAGAAGAGGAAGAGACCGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCAGGCAG--ACGCATA-------AT-----------CTGTACA-CGCCAGCTGACTTC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCACC-----CTACTCATCCTCC------------------TCCCCACGCAAT-GGAA-TT-----TCTAACAAGAGCGCAGAATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TT-------CA------GCTGTGGC-ATT---------GATGTTGAAGG-------------------------AGCAAGA----GAGCTAA-CAA-CAAACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTAAGTA--------------------------------------------ATCCAAAA---GACAG--------TT-ATCCAACAC---TCCCTAATACCATCACTCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACTGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCTCACT-CCCA-TC-------------------GCT-ACATCACTGT------CG--CGC-GCCG------TGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAT-AA---AA--------CG-GCCAC----------GACG--CAG-----TGCCA-ATCCATTC------TGTC----ACATGC---------------------------------------------------------------------------------CGCTC-CACTATC--------------TGC-AACAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_deusta_var._deusta_CBS_473.50__ GCCTCCACACTCTCCCATTTGCGGAGAACGAACACGCCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTCCACAACACCCACTGGGGTCTTGTTTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTCATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTATGATCCTGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGAACTTGGGTGGGTGTGCACAAAAACGCCGGTGCACTTACCGAGACATTGCGATCATTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGTGAGATCCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCACTCTTCGTTGTCGACAACAAGCAAGATTCCCCCGAGCGCGGCAGTCTTGTGCTGAGACGGGACCAGGTTGAAAAGCTCCAAGCCGACCAGGAGACTGCGGCATCGCTACGCGGAATCCTCAGTGAAGAGGAGAAGGCGCAACAAACCTACGGCTGGATGGGTCTGGTCAATGATGGCGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGA------TTAAACGTCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGA--TTGGC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CGATCT----ACACGGC-------GT--CCA------ACGTGCC-CGCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----ACACCTTTCCCCA---------------------TCCTCCAAT-GGTA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGCATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CG------AGATAAGC-ATC----------GTACAG---------------------------GTGCAATGT----GAGCTGA-CGT-GGAGAC--------CACAGCGTCGAGCACAGCGACGTCAATGTCGTTGCCGTTAACGACCCTTTCATTGAGCCAACCTACGCCGTACGTCTTCAC--------------------------------------------TGGAAAGC---ATGGC--------TT-TCAACATAT---CCACTAACACGATA--CTCTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTTACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TTCCCGC-CCT-----------------------CAC-ATATCACTGT------TG--CGC-GTCT------GGC------GAAAAA----TCA-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG--TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGTTG-GACAC----------ATTA-CCAGCATATCATCA-CTACACTC------TTTC----ACATGC---------------------------------------------------------------------------------AGTCC-GATCAGT-------------TCAA-AGAATCACCACTGACAA-TG-TCATCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_didyma_var._didyma_CBS_114299__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACACCCATCGGCCGTGATGGCAAGATCGCCAAGCCGAGACAACTTCACAACACCCATTGGGGTCTGGTATGTCCGGCCGAGACGCCCGAAGGACAGGCCTGCGGATTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCACTGACCGACTTTATGCGACAGCGTGGTATGGATTTGCTGGAAGAATACGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTACACAAAAACGCCGGTCAACTCACCGAAACTTTGCGATCCTTGCGAAGGAAGGGTCTGCTGAGTTTCGAGGTCACCATCATTCGCGATGTTCGGGAGCGCGAGATTCGCGTCTTTACCGATGCGGGACGTGTCTGCCGGCCGCTGTTTGTGGTCGACAACAAGCCCGATGCCGTGGAGCGTGGCAGTCTGGTCCTGAAACAAGACCAGATTGCAAAACTTCAACATGACCAGGAGATTGCGGCCTCATTACGAGGCA---TCAGTGAAGAGGATCGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAGCGATGGTGTTGTAGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCCACCCTTTGTGAACCCATCTCGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCAGAGG--TCCAT-CCAACACTGCATTTGTACGTCGGAGTCAA-AAGTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCCGTGGAGTT--CGAG--TCGCG-GCGGCCGTT-AAATCTTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGACGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC------CCCTCG-----ATATAGCTCCCCCCCCAACCAG----CGTGTGCA-CACCCGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACCC--CAGCACCCATCCTGA------------------CCCACCGCCAAT-GGCA-AT-----TCTGACAAGCGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-CCTCGAT--CA------GCATCAAG-ACC---------ACCATGGGCG------------------------GTGGATTGC----GAGCTGA-CAT-GAACAT--------TTCAGCGTCGAGCACAGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTAAGCCTTGCCC-------------------------------------------TCAGAAGA---GACAC--------CT-TCGATCCAC---CCACTAACACCTCA---ATAAGGCATACATGCTCAAGTACGACACCACCCACGGTGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCCGCCAACATCCCATGGAAAGAGTCCAGCGCCGACTACATCGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCTGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCCTCGGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCTGACATTCCTGTCATCT?????GAGAAGGTAAGA-ACTCACC------------------------TCACAA-CCTGCATCGT------CG--CGC-GCTG------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA--TTTTTCGCTTGGCAT------CATGACCTCACA-CCAC--CACT-AA---AATGCCTCCCTC-ACTTGAC--------AACA-TCAG-----CATCA-ATCCACTC------CTTC----ACATGT---------------------------------------------------------------------------------CACGC-GAGAGCA-----------CTTGGG-AAGAGCAGATCTAACAA-AG-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCATTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_didyma_var._didyma_CBS_420.67__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACACCCATCGGCCGTGATGGCAAGATCGCCAAGCCGAGACAACTTCACAACACCCATTGGGGTCTGGTATGTCCGGCCGAGACGCCCGAAGGACAGGCCTGCGGATTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCTGGCGAGCCACTGACCGACTTTATGCGACAGCGTGGTATGGATTTGCTGGAAGAATACGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTACACAAAAACGCCGGTCAACTCACCGAAACTTTGCGATCCTTGCGAAGGAAGGGTCTGCTGAGTTTCGAGGTCACCATCATTCGCGATGTTCGGGAGCGCGAGATTCGCGTCTTTACCGATGCGGGACGTGTCTGCCGGCCGCTGTTTGTGGTCGACAACAAGCCCGATGCCGTGGAGCGTGGCAGTCTGGTCCTGAAACAAGACCAGATTGCAAAACTTCAACATGACCAGGAGATTGCGGCCTCATTACGAGGCA---TCAGTGAAGAGGATCGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAGCGATGGTGTTGTAGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCCACCCTTTGTGAACCCATCTCGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCAGAGG--TCCAT-CCAACACTGCATTTGTACGTCGGAGTCAA-AAGTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCCGTGGAGTT--CGAG--TCGCG-GCGGCCGTT-AAATCTTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGACGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC------CCCTCG-----ATATAGCTCCCCCCCCAACCAG----CGTGTGCA-CACCCGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACCC--CAGCACCCATCCTGA------------------CCCACCGCCAAT-GGCA-AT-----TCTGACAAGCGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-CCTCGAT--CA------GCATCAAG-ACC---------ACCATGGGCG------------------------GTGGATTGC----GAGCTGA-CAT-GAACAT--------TTCAGCGTCGAGCACAGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTAAGCCTTGCCC-------------------------------------------TCAGAAGA---GACAC--------CT-TCGATCCAC---CCACTAACACCTCA---ATAAGGCATACATGCTCAAGTACGACACCACCCACGGTGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCCGCCAACATCCCATGGAAAGAGTCCAGCGCCGACTACATCGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCTGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCCTCGGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCTGACATTCCTGTCATCT?????GAGAAGGTAAGA-ACTCACC------------------------TCACAA-CCTGCATCGT------CG--CGC-GCTG------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA--TTTTTCGCTTGGCAT------CATGACCTCACA-CCAC--CACT-AA---AATGCCTCCCTC-ACTTGAC--------AACA-TCAG-----CATCA-ATCCACTC------CTTC----ACATGT---------------------------------------------------------------------------------CACGC-GAGAGCA-----------CTTGGG-AAGAGCAGATCTAACAA-AG-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCATTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_diervillae_CPC_16859_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCTTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTCGAGAAACTTCAAGCTGATCAGGAAGCTGCGGCGTTGCTACGAGGAG---TCAGCGAGGAGGACAGAGCGCAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTTGTTGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATT-CCCCCGGAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATCTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ACTGC--------AT-TCCAAACCC---CATCTAACTCGATG--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAATCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC------AAAAAA----ATC-AC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAATATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_diervillae_CPC_16860_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCTTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTCGAGAAACTTCAAGCTGATCAGGAAGCTGCGGCGTTGCTACGAGGAG---TCAGCGAGGAGGACAGAGCGCAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTTGTTGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACACTGCCGTC--CGCGGCATT-CCCCCGGAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATCTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ACTGC--------AT-TCCAAACCC---CATCTAACTCGATG--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAATCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC------AAAAAA----ATC-AC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAATATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_diervillae_CPC_16863_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCTTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTCGAGAAACTTCAAGCTGATCAGGAAGCTGCGGCGTTGCTACGAGGAG---TCAGCGAGGAGGACAGAGCGCAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTTGTTGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATT-CCCCCGGAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATCTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ACTGC--------AT-TCCAAACCC---CATCTAACTCGATG--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAATCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC------AAAAAA----ATC-AC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAATATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_diervillae_CPC_16864_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCTTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTCGAGAAACTTCAAGCTGATCAGGAAGCTGCGGCGTTGCTACGAGGAG---TCAGCGAGGAGGACAGAGCGCAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTTGTTGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATT-CCCCCGGAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATCTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ACTGC--------AT-TCCAAACCC---CATCTAACTCGATG--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAATCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC------AAAAAA----ATC-AC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAATATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia digitalis-ambiguae CBS 297.37 ' GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATCGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGGCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTCAAGAATTTGTCGCTCATGTGCTACGTCTCGGTAGGAACACCAGGTGAGCCACTCACAGACTTCATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTATGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTAGGTGTGCACAAAAACGCTGGCGCACTTACCGAGACTTTGCGAGCGTTGCGGAGAAAGGGACTGCTCAGCTTCGAGGTTACAATCATCCGTGACGTTCGAGAGCGCGAGATTCGGGTCTTCACCGATGCTGGCCGTGTCTGCCGGCCGCTTTTCGTGGTCGATAACAAGCCCGACTCTGTGGAGCGCGGCAGTCTTGTGTTGAGACGGGACCAGGTCGAGAAGCTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGCGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGCCTGGTCAGTGATGGTGTCGTGGAGTACCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGTGACCCTGCCGCT--TGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGTCCCCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTGTTTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTATTCCGTGAG-----TCCAC-----------------ACACATTGG---------CCAAC----GCAGGCC-CGCCAGCTGACATT--TCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCAA-----ACACTTGTCCTCC---------------------ACCTTCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTACA-GT-------CA------AGGGCAGC-ATG----GCTTCGGCAGGT---------------------------TAGGACCAT----GGGCTGA-CAG-GCACAT--------CGCAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGCATATC---------------------------------------------CCGAAAGA---GCTAG--------CT-GCAACACGC---CCACTGACTCCTCG---CTCAGGCGTACATGCTCAAGTACGACTCCACCCACGGCGTCTTCAAGGGTACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGATCCCGCCAACATTCCCTGGAAGGAGTCCGGTGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCGGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????????????????-???????-???-----------------------???-??????????-------G--CGC-GCTC------TGC-------AAACC----TCG-CT-TG-T---CATCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGTCTCGCTG-GCCAC----------AACA-CCAG-----C---A-CCCTTCGA------CTTC----CCATCC---------------------------------------------------------------------------------CTCTC-GACTGGT-------------TGCA-AGAAACATTGCTGACAA-CA-TGACCC--GTAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTAGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia digitalis-ambiguae CBS 434.67 ' GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATCGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGGCTTGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTCAAGAATTTGTCGCTCATGTGCTACGTCTCGGTAGGAACACCAGGTGAGCCACTCACAGACTTCATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTATGACCCGGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTAGGTGTGCACAAAAACGCTGGCGCACTTACCGAGACTTTGCGAGCGTTGCGGAGAAAGGGACTGCTCAGCTTCGAGGTTACAATCATCCGTGACGTTCGAGAGCGCGAGATTCGGGTCTTCACCGATGCTGGCCGTGTCTGCCGGCCGCTTTTCGTGGTCGATAACAAGCCCGACTCTGTGGAGCGCGGCAGTCTTGTGTTGAGACGGGACCAGGTCGAGAAGCTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGCGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGCCTGGTCAGTGATGGTGTCGTGGAGTACCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGTGACCCTGCCGCT--TGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGTCCCCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTGTTTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTATTCCGTGAG-----TCCAC-----------------ACACATTGG---------CCAAC----GCAGGCC-CGCCAGCTGACATT--TCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCAA-----ACACTTGTCCTCC---------------------ACCTTCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTACA-GT-------CA------AGGGCAGC-ATG----GCTTCGGCAGGT---------------------------TAGGACCAT----GGGCTGA-CAG-GCACAT--------CGCAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGCATATC---------------------------------------------CCGAAAGA---GCTAG--------CT-GCAACACGC---CCACTGACTCCTCG---CTCAGGCGTACATGCTCAAGTACGACTCCACCCACGGCGTCTTCAAGGGTACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGATCCCGCCAACATTCCCTGGAAGGAGTCCGGTGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCGGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????????????????-???????-???-----------------------???-??????????------CG--CGC-GCTC------TGC-------AAACC----TCG-CT-TG-T---CATCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGTCTCGCTG-GCCAC----------AACA-CCAG-----C---A-CCCTTCGA------CTTC----CCATCC---------------------------------------------------------------------------------CTCTC-GACTGGT-------------TGCA-AGAAACATTGCTGACAA-CA-TGACCC--GTAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTAGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_endophylla_CBS_101680__ GCTTCTACACTTTCGCATTTGCGAAGAACAAATACCCCAATCGGCCGCGATGGAAAGATCGCCAAGCCGAGACAACTGCACAACACCCATTGGGGACTTGTCTGTCCAGCAGAAACGCCCGAAGGACAGGCTTGTGGACTGGTGAAGAACTTGTCGCTAATGTGCTACGTCACGGTTGGAACACCTGGCGAGCCTTTGACAGATTTCATGCGACAGCGGGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAACCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGCTCGCTGAGGAGAAAGGGCTTGCTCAGTTTCGAGGTGACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTCACTGACGCTGGCCGTGTCTGCCGGCCCCTGTTCGTGGTCGACAACAAACCAGACGCTACGGAACGTGGCAGTCTTGTTCTAAGGCAGGACCAGGTCGCGAAACTACAGAATGACCAGGAGATCGCGGCATCTCTGCGAGGAT---TGAGCGAAGAAGACCGAGCCGAGCACACATACGGCTGGATGGGACTGGTGAATGAGGGTGTGGTTGAGTACCTCGACGCAGAGGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTTCGTGAG-----TATTG-------CCAGAA----ACATCTC-----------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCTGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CG------AGATGAGC-AAC---------AAAACAG---------------------------GTGGAACCT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---GATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGCC-CGC-----------------------ATC-ACTTCACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CCGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAAGCCTCGCTG-GCCAC----------AACA-CTGG-----CAACC-CCTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGATCAATGCTGACGA-CC-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_endophylla_CBS_113265__ GCTTCCACACTGTCGCATTTGCGAAGAACAAATACCCCAATTGGCCGCGATGGAAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGACTTGTCTGTCCAGCAGAAACGCCCGAAGGCCAGGCTTGTGGACTGGTGAAGAATTTGTCGCTAATGTGCTACGTCACGGTAGGAACACCTGGCGAGCCTTTGACAGATTTCATGCGACAGCGCGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCACAAGAATGCCGGTCAGCTCACAGAGACTCTGCGCTCATTGAGGAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATCCGTGATGTCCGAGAACGCGAGATCAGAGTATTCACTGATGCTGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACGCTACGGAACGTGGCAGTCTCGTGCTGAGGCAGGACCAGGTCGCGAAGCTACAGAATGACCAAGAGATCGCGGCATCTCTGCGAGGAT---TGAGTGAAGAAGACCGAGCGGAGCATACCTACGGCTGGATGGGACTGGTAAATGAGGGTGTTGTTGAGTACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTTCGTGAG-----TATTG-------CCAGAA----ACATCTC-----------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCAGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAAGGCGTGAGTAGA-GT-------CA------AGATGAGC-AAC---------AAAATAG---------------------------GTGGAACCT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCAGTGAGCCAACATACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---AATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGCC-CGC-----------------------ATC-ACTTCACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CCGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAAGCCTCGCTG-GCCAC----------AACA-CTGG-----CAACC-CCTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGATCAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_endophylla_CBS_113869__ GCTTCCACACTGTCGCATTTGCGAAGAACAAATACCCCAATCGGCCGCGATGGAAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGCCTTGTTTGTCCAGCAGAAACGCCCGAAGGACAGGCTTGTGGACTGGTGAAGAACTTGTCACTAATGTGCTACGTCACGGTTGGAACACCTGGCGAGCCATTGACAGATTTCATGCGGCAGCGCGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCATAAGAACGCCGGTCAACTCACAGAGACTTTGCGCTCATTGAGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTATTCACTGATGCTGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACGCTACGGAACGTGGCAGTCTCGTGCTGAGGCAGGACCAGGTCGCGAAGCTACAGAATGACCAAGAGATCGCGGCATCTCTGCGAGGAT---TGAGTGAAGAAGACCGAGCGGAGCACACCTACGGCTGGATGGGACTGGTGAATGAGGGTGTTGTTGAGTACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTTCGTGAG-----TATTG-------CCAGAA----ACATCTC-----------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCAGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATGAGC-AAC---------AAAATAG---------------------------GTGGAACCT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---AATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGCC-CGC-----------------------ATC-ACTTCACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CCGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAAGCCTCGCTG-GCCAC----------AACA-CTGG-----CAACC-CCTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGATCAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_endophylla_CBS_113871__ GCTTCCACACTGTCGCATTTGCGAAGAACAAATACCCCAATTGGCCGCGATGGAAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGACTTGTCTGTCCAGCAGAAACGCCCGAAGGCCAGGCTTGTGGACTGGTGAAGAATTTGTCACTAATGTGCTACGTCACGGTAGGAACACCTGGCGAGCCTTTGACAGATTTCATGCGACAGCGCGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCACAAGAACGCCGGTCAGCTCACGGAGACTTTGCGCTCATTGAGGAGAAAGGGTTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTATTCACTGATGCTGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACGCTACGGAACGTGGCAGTCTCGTGCTGAGGCAGGACCAGGTCGCGAAGCTACAGAATGACCAAGAGATCGCGGCATCTCTGCGAGGAT---TGAGTGAAGAAGACCGAGCGGAGCATACCTACGGCTGGATGGGGCTGGTGAATGAGGGTGTTGTTGAGTACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTGAG-----TTTTG-------CCAGAA----ACAT--------------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCAGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATGAGC-AAC---------AAAATAG---------------------------GTGGAACCT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---AATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGCC-CGC-----------------------ATC-ACTTCACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CCGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAAGCCTCGCTG-GCCAC----------AACA-CTGG-----CAACC-CCTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGATCAATGCTGACGA-CC-TCACCC--ACAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_endophylla_CBS_115302__ GCTTCCACACTGTCGCATTTGCGAAGAACAAATACCCCAATCGGCCGCGATGGAAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGCCTTGTCTGTCCAGCAGAAACGCCCGAAGGACAGGCCTGTGGACTGGTGAAGAACTTGTCGCTAATGTGCTACGTCACGGTTGGAACACCTGGCGAGCCATTGACAGATTTCATGCGGCAGCGCGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCATAAGAACGCCGGTCAACTCACAGAGACTTTGCGCTCATTGAGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTATTCACTGATGCTGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACGCTACGGAACGTGGCAGTCTCGTGCTGAGGCAGGACCAGGTCGCGAAGCTACAGAATGACCAAGAGATCGCGGCATCTCTGCGAGGAT---TGAGTGAAGAAGACCGAGCGGAGCACACCTACGGCTGGATGGGACTGGTGAATGAGGGTGTTGTTGAGTACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTTCGTGAG-----TATTG-------CCAGAA----ACATCTC-----------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCTGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATGAGC-ATC---------AAAACAG---------------------------GTGAAACAT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---TATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-GTCCGCC-CGC-----------------------ATC-ACTACACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAATCCTCACTG-GCCAC----------AACA-CTGG-----CATCA-CTTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGAACAATGCTGACGA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_endophylla_CBS_115303__ GCTTCCACACTGTCGCATTTGCGAAGAACAAATACCCCAATTGGCCGCGATGGAAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGACTTGTCTGTCCAGCAGAAACGCCCGAAGGACAGGCTTGTGGACTGGTGAAGAACTTGTCGCTAATGTGCTACGTCACGGTTGGAACACCTGGCGAGCCATTGACAGATTTCATGCGACAGCGCGGTATGGATCTTCTGGAAGAGTACGACCCTGTGCTGGAGCCCAAGTCGACGAAAGTCTTCATCAACGGTACATGGGTCGGTGTGCATAAGAACGCCGGTCAACTCACAGAGACTTTGCGCTCATTGAGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATTAGAGTATTCACTGATGCTGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACGCTACGGAACGTGGCAGTCTCGTGCTGAGGCAGGACCAGGTCGCGAAGCTACAGAATGACCAAGAGATCGCGGCATCTCTGCGAGGAT---TGAGTGAAGAAGACCGAGCGGAGCACACCTACGGCTGGATGGGACTGGTGAATGAGGGTGTTGTTGAGTACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------CTTCCGGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTTCGTGAG-----TATTG-------CCAGAA----ACATCTC-----------CTCC-----TTGAGCG-CTACAGCTGACATC-GTCACAGCTTCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGAATACC----CAACACATCCAGA---------------------CTACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGATGAGC-AAC---------AAAACAG---------------------------GTGGAACCT----GGGCTGA-TCT-GGATACC------TCACAGCGTCGAGCACGGCGATGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCAGTAACAC------------------------------------------ATGGAAGA---TATGC--------CT-CCAGTACCC---CTTCTAATGTCATT---CTTAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGTCAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCGGATGCCCCCATGTTCGTTATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGCC-CGC-----------------------ATC-ACTTCACCGT------CG--CGC-GCAC------TGC------AGAAAA----TCT-CT-TA-T---CACCCCTCGC--------CCGGTGGGC----------------------TGGT-GGGGTG--TTCG-AGA---TTTTTGCTTGGCAT------CATGACCTCACATT-----CAGC-AA---AAAGCCTCGCTG-GCCAC----------AACA-CTGG-----CAACC-CCTCATCT--------CC----ACGTAC---------------------------------------------------------------------------------CGCAT-CGACTTCAC---TCATAAATCGAA-ATGATCAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_eucalypti__CBS_120728 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACTCCCATCGGCCGTGATGGCAAGATCGCCAAGCCGAGACAACTGCACAACACTCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTCGGAACACCTGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGGATGGATCTTTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTCGGTGTCCACAAAAACCCTGGCCAACTCACCGAGACTTTGCGGTCACTGCGGAGGAAGGGCTTGCTCAGCTTCGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGGGTATTCACCGACGCTGGTCGTGTTTGTCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTTGAGCGTGGCAGCCTCGTGCTAAGACGAGATCAAGTCACGAAGCTCCAACACGATCAAGAGACTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCATACCTACGGCTGGATGGGTCTTGTCAATGATGGTGTGGTCGAATACCTCGACGCAGAAGAGGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTT-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GT-AATC-------AC--CCT------TCAAGAC-CTTCAACTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAT-----CACTCCATCCTCC------------------CTCCCACTACAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGC-TT-------CA------ATATTAGG-ATT---------AGAATGGG----------------------------ACAAGAT----GAGCTGA-CGG-GATACT-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGCCAGAAA--------------------------------------------ATTCA--C---ATTGA--------CC-ACAGACTAT---TGACTAACACCAACC-CTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGGGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACATACC-CTCACTT--CCATTT-----------CCA-ACAGCCTCGC------CG--CGC-GGTC----ACAGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCG-CTTCACTT------CTTC----ACACGA---------------------------------------------------------------------------------CGCTC-CAATGTC-------------CCTC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_eucalypti__CPC_19188_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGCAAGATCGCCAAGCCGAGACAACTGCACAACACTCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCTGTTGGAACACCTGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGGATGGATCTTTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTCGGTGTCCACAAAAACCCTGGCCAACTCACCGAGACTTTGCGGTCACTGCGGAGGAAGGGCTTGCTCAGCTTCGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGGGTATTTACCGACGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTTGAGCGTGGCAGCCTCGTGCTGAGGCGAGATCAAGTCACGAAGCTCCAACACGATCAAGAGACTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCATACCTACGGCTGGATGGGTCTGGTCAATGATGGTGTGGTCGAATACCTCGACGCAGAAGAGGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTT-TGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GT-AATC-------AC--CCT------TCAAGAC-CTTCAACTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAT-----CACTCCATCCTCC------------------CTCCCACTACAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGAGTGAGTTGT-TT-------CC------ATATCAGG-ATT---------AGAATGGG----------------------------ACAAGAT----GAGCTGA-CGG-GATACT-------TCACAGCGTCGAGCACGGCGACGTCAACGTGGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCCAATCC--------------------------------------------TGACA--A---GCTCA--------CA-ATCAATCCC---CCACTGACATCCATC-CTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACATACC-CTCACTT--CCATTT-----------CCA-ACAGCCTCGC------CG--CGC-GGTC----ACAGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCG-CTTCACTT------CTTC----ACACGA---------------------------------------------------------------------------------CGCTC-CAATGTC-------------CCTC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_eucalypti_CBS_120726 GCCTCCACACTCTCGCATTTGCGGAGAACAAACACTCCCATCGGCCGTGATGGCAAGATCGCCAAGCCGAGACAACTGCACAACACTCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGGATGGATCTTTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTCGGTGTCCACAAAAACCCTGGCCAACTCACCGAGACTTTGCGGTCACTGCGGAGGAAGGGCTTGCTCAGCTTCGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGGGTATTTACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTTGAGCGTGGCAGCCTCGTGCTGAGACGAGATCAAGTCACGAAGCTCCAACACGATCAAGAGACTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCATACCTACGGCTGGATGGGTCTGGTCAATGATGGTGTGGTCGAATACCTCGACGCAGAAGAGGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGCTT-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GT-AATC-------AC--CCT------TCAAGAC-CTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----CACCCCATCCTCC------------------CTCCCACTACAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGC-TT-------CA------ATATCAGG-ATT---------AGAATGGG----------------------------ACAAGAT----GAGCTGA-CGG-GATACT-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCTAATCC--------------------------------------------TGACA--A---GCTCA--------CA-ATCAATCCC---CCACTGACATCCATC-CTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCACTT--CCATTT-----------CCA-ACATCCTCGC------CG--CGC-GGTC----ACAGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCG-CTTCACTT------CTTC----ACACGA---------------------------------------------------------------------------------CGCTC-CAATGTC-------------CCTC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_euonymicola_CBS_113308__ GCCTCAACGCTGTCTCACTTACGGAGAACAAATACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGCCTTGTTTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTTGTGAAGAACTTGTCGCTTATGTGCTACGTCTCCGTGGGAACACCAGGCGAGCCTTTGACAGACTTTATGCGACAGCGCGGTATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTTTTTATCAACGGTACCTGGGTCGGTGTGCACAAAAACGCCGGTCAACTAACCGAGACTTTGCGATCGTTGCGAAGGAAGGGTCTCCTGAGTTTCGAGGTCACCATCATCCGCGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCTGTTGATCGTGGCAGCCTTGTCCTAAAGCAAGACCAGGTCGCAAAACTCCACAACGATCAGGAGATCGCGGCGTCTCTACGAGGAA---TCAGTGAAGAGGATAGAGCACAGCACACGTACGGCTGGATGGGCTTGGTCAGCGATGGTGTTGTGGAGTATCTAGACGCAGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--TGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCTTCAAAGT-CCCCGGCTGTCTGACCCAATCTCCCAGCGTTGTGGCAAC-TATTTCGCCGTGGAGTT--GGAG--TTGGA-GCGGCCGTT-AAATCTTTATAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGCGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----GGCTC-------CCATGC----ATGCGGC-------GC--ACA------GAGTGCA-CGCCAGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGC-ATATC-----CCATCCATCCTCG-------------------CAGTTTTCAAT-GGCA-GT-----TCTGACAAGAGCACAGCATCATGATCGGTATGGG?????????CAATGCGTATGTGGA-AT-------CA------AGATCAGC-ATC----GTATCAGCAGGG---------------------------AGGATCTGG----GAGCTGA-CAC---ACAT--------CACAGCGTCGAGCACGGCGACGTCACGGTTGTGGCCGTCAATGACCCTTTCATCGAGCCAACCTACGCGGTATGCCTTGCC--------------------------------------------TTGGACAT---GCGGT--------CT-CCATTCCAC---CGACTAATATAGCA--TCTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAAGTTGATGGCGACAAGGGCCTTATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGGGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTATTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACTTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCTGAC-CTCA----------------------TAT-TCTTCACCGC------TG--CGC-GCTC------TGC-------AAAAA----TCT-CT-TA-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTGGCTTGGCGT------CATGATCTGACA-C-----CACC-AG---AATGCCTAGCTG-GCCAC----------AACA-TCAG-----GATAA-CT---------------------TATGT---------------------------------------------------------------------------------TGCGC-GAGTAAT-------------GCTA-CAACACAATACTGACAA-TA-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGCGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCAAA Ramularia_gaultheriae_299.80__ GCCTCCACACTCTCCCA-TTGCGGAGAACAAACACCCCCATCGGCCGTGATGGAAAGATCGCCAAGCCCAGACAACTCCACAACACTCACTGGGGTCTCGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCACGGTTGGAACACCTGGCGAGCCCCTCACAGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCCGTTCTGGAGCCAAAGTCGACGAAAGTCTTCATCAACGGTACTTGGGTGGGTGTGCACAAGAATGCTGGACAACTTACAGAAACCCTACGATCTCTCCGGAGAAAGGGCTTGCTCAGCTTTGAAGTCACCATCATCCGTGATGTACGAGAACGTGAGATCCGAGTCTTCACCGACGCTGGTCGTGTCTGCCGGCCACTGTTCGTAGTCGACAACAAGCCCGATTCCGCTGACCGCGGCGGTCTTGTCCTCAAGCAAGACCAGATCGCAAAACTTCAAAATGATCAAGAAATCTCAGCATCCCTCCGCGGTA---TCAGCGAGGAGGACAAAGCCCAACATACCTACGGCTGGATGGGCTTGGTGGGTGAGGGTGTTGTCGAATACCTCGATGCCGAAGAAGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGTGCCTCAAAGT-CTCCGGCTGTCTTGATTCAATTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAAA---CGAG--TCAAA-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTCT-------CCAGCT----CTACGGC-------GC--CCA------GTGTGCA-CGCCTGCTGACACC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATAAT-----CTATCATTTCTACT--------------------CACCGCGAT-CGAA-AT-----TCTGACAAGAGCGCAATATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTCTC-TT-------CA------AGATG-----------ATGTGGATATGA---------------------------TGGAAATCG----GACATAA-TCT-GACAGCA------TCACAGCGTCGAGCACGGCGATGTCCACGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCAT--------------------------------------------CTTGAAAA----GTAT--------CC-TCAACCTCC---CCACTGACCT--CA--ATCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTTTTCAACGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCTCGCC-GCTCC---------------------ATC-ACTTCACTGT------CC--GGC-GCCC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTG--TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACT-A-----CATC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGA-----CTTTA-CTTCAGCC------GCGC----ACATGT---------------------------------------------------------------------------------CCCGC-GAACATGATT-------AAAAAAT-TGCAACAATGCTGACCA-TC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_gei_CBS_113977__ GCCTCCACATTGTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGTAAGATCGCCAAGCCGAGACAACTTCACAACACCCATTGGGGTCTTGTCTGTCCGGCTGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGCGGTATGGACCTTCTCGAAGAATATGACCCTGTTCTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAACGCAGGCCAACTGACCGAGACTTTGCGGTCGTTGCGAAGAAAGGGTCTCCTGAGTTTCGAGGTTACCATTATTCGTGATGTCCGGGAACGCGAAATTCGGGTCTTTACCGATGCTGGGCGTGTTTGCAGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCCGTTGAGCGTGGCAGTCTTGTACTGAACCGGGATCAGGTCGCAAAACTTCACAACGATGCGGACCTTGCGGCATCTCTAAGAGGCG---TCAGTGAAGAGGATCGAGCACAACACACCTACGGCTGGATGGGCTTGGTCGGCGAAGGTGTCGTAGAGTACCTCGACGCAGAAGAAGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCACAC----ATTCGTG-------GC--CCA------GCGTGCC-CTCCAGCTGACCTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----TCACCTGACCTCCC--------------------CTCAGCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGG-AT-------CA------GTATCAGC-TTT---------AGCATCA---------------------------AAGAGCTGT----GAGCTGA-CAT-GGACAT--------CACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTATGCGGTATGCCTTTAC--------------------------------------------TTGGAGGA---AACAT--------CT-CCAATCCAC---CATCTGACAAGACA--TCACAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAAGGCCTGATTGTCAACGGCAAGAAGGTGCGCTTCCACACCGAGCGTGATCCAGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-TTCA----------------------CAT-CATGCACCGT------CG--CGC-GCTC------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC----------------C----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CTCC-AA---AATGCCTCGCTG-GCCCT----------GACT-CCGA-----CATCA-CTCCACTC-------TTC----ACATGT---------------------------------------------------------------------------------TGCCT-GAATATT-------------ACCA-CAATAA-TCACTGACAG-TG-TCACCC--GCAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_gei_CBS_344.49__ GCCTCCACATTGTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGTAAGATCGCCAAGCCGAGACAACTTCACAACACCCATTGGGGTCTTGTCTGTCCGGCTGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAACGCGGTATGGACCTTCTCGAAGAATACGACCCTGTTCTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAAAACGCAGGCCAACTGACCGAGACTTTGCGGTCGTTGCGAAGAAAGGGTCTCCTGAGTTTCGAGGTTACCATTATTCGTGATGTCCGGGAACGCGAAATTCGGGTCTTTACCGATGCTGGGCGTGTTTGCAGGCCGCTGTTCGTGGTCGACAACAAGCCCGATGCCGTTGAGCGTGGCAGTCTTGTACTGAACCGGGATCAGGTCGCAAAACTTCACAACGATGCGGACCTTGCGGCATCTCTAAGAGGCG---TCAGTGAAGAGGATCGAGCACAGCACACGTACGGCTGGATGGGCTTGGTCGGCGAAGGTGTCGTAGAGTACCTCGACGCAGAAGAAGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTTCCA---CCCACAC----ATTCGTG-------GC--CCA------GCGTGCC-CTCCAGCTGACCTC-ATCACAGCTTCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGTGATACC-----TCACCTGACCTCCC--------------------CTCAGCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGG-AT-------CA------GTATCAGC-ATT---------AGCATCA---------------------------AAGAGCTGT----GAGCTGA-CAT-GGACAT--------CACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTATGCGGTATGCCTTTAA--------------------------------------------TTAGAGGA---AATAT--------CT-CCAATCCAC---CATCTGACAAGATA--TCCCAGGCATACATGCTCAAGTTCGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-TTCG----------------------CAT-CATGCACCGT------CG--CGC-GCTC------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC----------------C----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CTCC-AA---AATGCCTCGCTG-GCCCT----------GACT-CCGA-----CATCA-CTCCACTC-------TTC----ACATGT---------------------------------------------------------------------------------TGCCC-GAATATT-------------ACCA-CAATAA-TCACTGACAG-TG-TCACCC--GCAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_geranii_CBS_159.24__ GCCTCCACACTCTCGCATTTGAGGAGAACAAATACGCCTATTGGTCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGACTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCGCTTACAGATTTCATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGCGTGCACAAGAATGCAGGTCAGCTCACCGAAACATTGCGATCGCTACGAAGAAAGGGGCTGCTCAGTTTCGAAGTCACCATCATTCGTGATGTGAGAGAACGTGAAATTCGAGTCTTTACTGATGCCGGGCGTGTCTGCCGACCGCTATTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGTCTTGTGCTGGTAAGGAATCAGGTCGAAAAGCTCCTACACGATCAAGAGATTGCAGCGTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCATACCTATGGCTGGATGGGCTTAGTCAACGAGGGCGTGGTGGAGTATCTTGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAGTCCCGAACCTCCAACCCTTTGTGAACCAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACTCGGCATT-CCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTGTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCTAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGGTG------TACAGG-----CAGAAGC-------AT--GCA------CTGTACA-CACCTGCTGACTTC-ATCACAGCATCGATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACACC-----CCACACTCCCTCA-----------------CTCCCCTCCCAAT-AGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG????????????TGCGTAAGTCGC-TT-------CATA----GTCTCGGG--------------------------------------------AAAAGGTTGCAA----CATCTGA-CAG-CATCTCATC----CTCCAGCGTCGAGCATGGCGACGTCACCGTCGTCGCGGTCAACGATCCGTTCATCGAGCCCACCTACGCCGTATGTCCAATCTCCATATCCACATCCGACACCGACACTGCCATCTCCACCCCTCCCTCTAACATCCCCCAT--------CT-TCACCCCTC---CCTCTAACATCTCCCCTCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATCGTCAACGGCAAAAAGGTCCGCTTCCACACCGAGCGGGACCCCGCCAACATCCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACTGAAAAGGCTTCTGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCTTCT-CTCA-TC-------------------CCT-GCATCACTGT------CG--CGC-GTCT------TGC------AAAAAA----TCG-CT-TA-TCACCACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------TATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACC-TCAG-----CAGCA-ATCTATTG------CTCC----ACATAC---------------------------------------------------------------------------------CGCCC-GATCATC--------------TGC-GATAACAATGCTGACAC-AT-TCCCCC--ATAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_geranii_CBS_160.24__ GCCTCCACACTCTCGCATTTGAGGAGAACAAATACGCCTATTGGTCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGACTCGTCTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCGCTTACAGATTTCATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGCGTGCACAAGAATGCAGGTCAGCTCACCGAAACATTGCGATCGCTACGAAGAAAGGGGCTGCTCAGTTTCGAAGTCACCATCATTCGTGATGTGAGAGAACGTGAAATTCGAGTCTTTACTGATGCCGGGCGTGTCTGCCGACCGCTATTCGTGGTCGACAACAAGCCTGACTCTGCCGAGCGCGGCAGTCTTGTGCTGGTAAGGAATCAGGTCGAAAAGCTCCTACACGATCAAGAGATTGCAGCGTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCATACCTATGGCTGGATGGGCTTAGTCAACGAGGGCGTGGTGGAGTATCTTGACGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAGTCCCGAACCTCCAACCCTTTGTGAACCAATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCACTCGGCATT-CCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTGTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCTAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGGTG------TACAGG-----CAGAAGC-------AT--GCA------CTGTACA-CACCTGCTGACTTC-ATCACAGCATCGATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACACC-----CCACACTCCCTCA-----------------CTCCCCTCCCAAT-AGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG????????????TGCGTAAGTCGC-TT-------CATA----GTCTCGGG--------------------------------------------AAAAGGTTGCAA----CATCTGA-CAG-CATCTCATC----CTCCAGCGTCGAGCATGGCGACGTCACCGTCGTCGCGGTCAACGATCCGTTCATCGAGCCCACCTACGCCGTATGTCCAATCTCCATATCCACATCCGACACCGACACTGCCATCTCCACCCCTCCCTCTAACATCCCCCAT--------CT-TCACCCCTC---CCTCTAACATCTCCCCTCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATCGTCAACGGCAAAAAGGTCCGCTTCCACACCGAGCGGGACCCCGCCAACATCCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACTGAAAAGGCTTCTGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCTTCT-CTCA-TC-------------------CCT-GCATCACTGT------CG--CGC-GTCT------TGC------AAAAAA----TCG-CT-TA-TCACCACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------TATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACC-TCAG-----CAGCA-ATCTATTG------CTCC----ACATAC---------------------------------------------------------------------------------CGCCC-GATCATC--------------TGC-GATAACAATGCTGACAC-AT-TCCCCC--ATAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_geraniicola__CBS_141110 GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTCTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCAGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGAACTTGGGTCGGTGTGCACAAAAACGCTGGAGCGCTTACTGAGACTCTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTTACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTCTTTACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTGGATAACAAGCCCGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTTCGAGGAG---TCAGCGAAGAGGACAGAGCACAACACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTTGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATTCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----TCACCAGTCCCTA---------------------ATCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------AGAATAG---------------------------TTGG-ACAT----AAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCAACCTACGCCGTATGCCTTTCC--------------------------------------------CAAGAAGA---ATCGC--------AC-TCCAAACCC---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCTTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTATTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GTCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATAATC-------------TCCA-AAAAACATCACTGACAA-TGCTCCGCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATTGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_glechomatis_CBS_108979__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGACGTCCGAGAACGCGAGATCCGGGTCTTTACAGACGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATTCGGC-------GT--CTA------GGGTATC-CGCCAGCTGACACA-GTCTCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGTTATC-----CCACCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------ATAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATCGC--------AT-TCGAAGACA---CTTCTAACTCGATA--TTCCAGGCTTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------TG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TT-T---CATCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AAACC-T-------------TCCG-AGAAACATCACTGACAA-TGCTCCTCT--ATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATTACTATTGATATCGCCCTCTGGAAGTTTGAGACCCCAAA Ramularia_glechomatis_CBS_108980__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGACGTCCGAGAACGCGAGATCCGGGTCTTTACAGACGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATTCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACA-GTCTCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGTTATC-----CCACCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------ATAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATCGC--------AT-TCGAAGACA---CTTCTAACTCGATA--TTCCAGGCTTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------TG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TT-T---CATCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AAACC-T-------------TCCG-AGAAACATCACTGACAA-TGCTCCTCT--ATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATTACTATTGATATCGCCCTCTGGAAGTTTGAGACCCCAAA Ramularia_glechomatis_CBS_343.49__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCCAGACAGCTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGACGTCCGAGAACGCGAGATCCGGGTCTTTACAGACGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTCGTAGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------TCATAC----ATTCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACA-GTCTCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGTTATC-----CCACCAATTCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGCAGC-TTC---------ATAAAAG---------------------------GTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---ATCGC--------AT-TCGAAGACA---CTTCTAACTCGATA--TTCCAGGCTTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------TG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TT-T---CATCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCACTG-GCCAC----------AACA-TCAG-----CATCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CACTC-AAACC-T-------------TCCG-AGAAACATCACTGACAA-TGCTCCTCT--ATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATTACTATTGATATCGCCCTCTGGAAGTTTGAGACCCCAAA Ramularia_glennii_CBS_120727 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACTCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCAGGTGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTCTTTATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCCGGCCAACTTACCGAGACTTTGCGATCACTGCGAAGGAAGGGTTTGCTCAGTTTTGAGGTCACTATCATTCGCGACGTGAGAGAACGTGAGATTCGGGTTTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGATGCGGTTGAGCGTGGCAGTCTCGTGCTGAGGCGGGATCAAGTTGAGAAGCTTCAAGCCGATCAGGAGACGGCGGCGTCCCTCCGAGGTA---TAAGTGAAGAGGATAGAGCAGAGCACACCTATGGCTGGATGGGCTTGGTGAATGAGGGTGTAGTCGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----AT-AATC-------AC--CCT------CCAAGACCCTCCAGCTGACTCC-ATCCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC------ACCCCAACCTTC------------------TCTCCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTGCGA--------TT-TACATTGTC---ATACTGATATCACA--TCACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-ACGCCCT-CCTG------ATACT-----------GCA-TCATCGTCGC------CG--CGC-GCATC-ACACTGC------AAAAAA----ACG-CT-TA-T---CACCCCTCG---------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACT-T-----GAGG-AA---AATGCCTCGCTG-TCCGC----------AACC----------------TTCCAACC------TCTC----ACCAGC---------------------------------------------------------------------------------CGTAC-AAATGCA-------------TCAC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_glennii_CBS_122989_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCTGAAACCCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCTTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTTTGCGATCACTACGGAGAAAGGGCTTGCTCAGTTTTGAGGTCACCATTATTCGTGATGTGAGAGAACGTGAAATTCGGGTCTTTACAGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGACGCGGTTGAGCGTGGCAGCCTCGTGCTGAGGCGGGATCAAGTTGAGAAGCTTCAAGCCGATCAAGAGACTGCGGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCAGAGCACACTTACGGCTGGATGGGGCTGGTTAATGAGGGTGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----AT-AATC-------AC--CCT------CGAAAACCCTCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCCTCC------------------TCCACACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTGCGA--------TT-TACAACACC---ATACTGATCTCACA--ACATAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAAAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-ACGCCCT-CCTG------ATACT-----------GCA-TCATCGTCGC------CG--CGC-GCATC-ACACTGC------AAAAAA----ACG-CT-TA-T---CACCCCTCG---------CTGGTGGCC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACT-T-----GAGG-AA---AATGCCTCGCTG-TCCGC----------AACC----------------TTCCAACC------TCTC----ACCAGC---------------------------------------------------------------------------------CGTAC-AAATGCA-------------TCAC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_glennii_CBS_129441__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCTGAAACCCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCTTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTTATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTTTGCGATCACTACGGAGAAAGGGCTTGCTCAGTTTTGAGGTCACCATTATTCGTGATGTGAGAGAACGTGAAATTCGGGTCTTTACAGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGACGCGGTTGAGCGTGGCAGCCTCGTGCTGAGGCGGGATCAAGTTGAGAAGCTTCAAGCCGATCAAGAGACTGCGGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCAGAGCACACTTACGGCTGGATGGGGCTGGTTAATGAGGGTGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----AT-AATC-------AC--CCT------CGAAAACCCTCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCCTCC------------------TCCACACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTGCGA--------TT-TACAACACC---ATACTGATCTCACA--ACATAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAAAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-ACGCCCT-CCTG------ATACT-----------GCA-TCATCGTCGC------CG--CGC-GCATC-ACACTGC------AAAAAA----ACG-CT-TA-T---CACCCCTCG---------CTGGTGGCC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACT-T-----GAGG-AA---AATGCCTCGCTG-TCCGC----------AACC----------------TTCCAACC------TCTC----ACCAGC---------------------------------------------------------------------------------CGTAC-AAATGCA-------------TCAC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_glennii_CPC_16560_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCAACGAAGGTCTTTATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTTTGCGATCACTACGGAGAAAGGGCTTGCTCAGTTTTGAGGTCACCATTATTCGTGACGTGAGAGAACGTGAAATTCGGGTCTTTACAGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGATGCGGTTGAGCGTGGCAGTCTCGTGCTGAGGCGGGATCAAGTCGAGAAGCTCCAAGCCGATCAGGAGACCGCGGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCAGAGCACACTTACGGCTGGATGGGCTTGGTCAATGAGGGTGTGGTCGAATATCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----ATAAACC-------AC--CCT------CCAAGACTCTCCAGCTGACTCT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCAC-----TACCCCATCCTCC------------------TCCCCACTCAAT-GGCA-TT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTACGA--------TT-TACAATGTC---ATACTGATATCACA--TCACAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-ACGCCTT-CCTG------ATACT-----------GCA-TCATCGTCGC------CG--CGC-GCATC-ACACTGC------AAAAAA----ACG-CT-TA-T---CACCCCTCG---------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACA-T-----CATG-AA---AATGCCTCGCTG-GCCTA----------AGCA-CCGG-----CATCT-CACCACTC-TTATCCTCA----GTCAAC---------------------------------------------------------------------------------GGCAC-AAATACC--------------TTA-CAAAACAATGCTAACAA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_glennii_CPC_16565_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGTCGTGATGGAAAGATTGCAAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACCCCCGAAGGGCAGGCTTGCGGTCTGGTGAAGAACTTGTCTCTAATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCGCTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTTTTTATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTCTGCGATCACTACGGAGAAAGGGCTTGCTCAGTTTTGAGGTCACCATTATTCGTGACGTGAGAGAACGTGAAATTCGGGTCTTTACAGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGACGCGGTTGAGCGTGGCAGCCTCGTGCTGAGGCGGGATCAAGTTGAGAAGCTTCAAGCCGATCAGGAGACTGCGGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCAGAGCACACTTACGGCTGGATGGGCTTGGTCAATGAGGGTGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACCGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----ATAAACC-------AC--CCT------CCAAGACTCTCCAGCTGACTCT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCAC-----TACCCCATCCTCC------------------TCCCCACTCAAT-GGCA-TT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTACGA--------TT-TACAATGTC---ATACTGATATCACA--TCACAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCGCCCT-CACA------CCACT-----------GCA-CCATCATTGC------CG--CGC-GCATC-ACACTGC------AAAAAA----TTG-CT-TA-T---CACCCCTCG---------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-GGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACA-T-----GAGG-AA---AATGCCTCGCCG-----------------------------ACAGCC-TTCCAGCC------TTTC----ACCAGC---------------------------------------------------------------------------------CGTAC-AAATACA-------------TCACAAAAAACAATACTGACGA--T-GCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_glennii_CPC_18468_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACCCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCGCTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACTAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTTTGCGATCACTGCGGAGAAAGGGCTTGCTCAGTTTTGAGGTCACCATTATTCGTGACGTGAGAGAACGTGAAATTCGGGTCTTTACAGATGCTGGTCGTGTCTGCCGGCCGCTCTTCGTGGTTGACAACAAGCCAGACGCGGTTGAGCGTGGCAGTCTCGTGCTGAGGCGGGATCAAGTTGAGAAGCTTCAAGCCGATCAAGAGACTGCGGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCAGAGCACACTTACGGCTGGATGGGCTTGGTCAATGAGGGTGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACCGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----ATAAACC-------AC--CCT------CCAAGACTCTCCAGCTGACTCT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCAC-----TACCCCATCCTCC------------------TTCCCACTCAAT-GGCA-TT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CG------ATAAGAAA-------------GATGTGAG----------------------------GAAGCAA----TAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATGA--------------------------------------------AGCATTGA--TTGCGA--------TT-TACAACACC---ATACTGATCTCACA--ACATAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAAAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-ACGCCCT-CCTG------ATACT-----------GCA-TCATCGTCGC------CG--CGC-GCATC-ACACTGC------AAAAAA----ACG-CT-TA-T---CACCCCTCG---------CTGGTGGCC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCATTCGAGGCATGACCTCACT-T-----GAGG-AA---AATGCCTCGCTG-TCCGC----------AACC----------------TTCCAACC------TCTC----ACCAGC---------------------------------------------------------------------------------CGTAC-AAATGCA-------------TCAC-AAAAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_grevilleana_CBS_114732__ ???????CACTCTCCCATTTGCGAAGAACAAATACACCCATCGGTCGTGATGGAAAGATTGCCAAACCAAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCAGAAGGGCAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTTTGGAAGAATACGACCCTGTTTTGGAGCCCAAATCAACCAAGGTGTTTATCAATGGAACTTGGGTTGGTGTGCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTTCGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACGATCATTCGTGATGTGAGAGAACGTGAAATTCGTGTCTTCACCGATGCAGGGCGTGTCTGTCGGCCGCTATTCGTGGTTGACAACAAGCCCGATGCTGTTGAGCGTGGCAGCCTTGTACTGACCCGAGAGCAAGTCTTAAAGCTTCAGCAAGACCAGGAGAACGCGGCGGCCCTACGGGGTA---TCAGTGAAGAGGACAGAGCGGAGCATACTTATGGCTGGATGGGCCTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--CCATC--AAACACTGCATTCTTACGTCGGAGTGAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------ACCAAAT----CTACAAC------TCC--CTAC----AACGTTCC-CACCAGCTGACTCC-CTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTCCCATCACATCCTACCCTCT--------------CCACCCCACAACCAAT-GGCA-AT-----TCTAACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAACGCGTGAGTCTC-TC-------CA------ACAACATC-AAGC------TCGGCATGG-----------------------------GAATGGA----GAGCTGA-CAG-CATATC-------TCACAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCGTTCATTGAGCCAACCTACGCCGTATGTCTATC---------------------------------------------CAACACAG---CACGA--------TC-CTCAAGATC---CATCTAACAACAAC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAATGGCACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACTGAGCGTGACCCCGCCAACATTCCTTGGGGCGAGTCCAATGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCGTC-CTCACTTC------------------ATT-TCCATACCGT------CG--CGC-GCTT------TG-------CAAAAA----TCG-CT-TA-T---CAGCCCCTCCT-------TTGGTGG-----------------------------GGAGA---TTTG-GGA---TTTGTGCTTGGCGCC-----CGTCACCGCAC-------------AA---ACTGCCTAGCTC-ATTCA------------------------------CTTTGCCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATC-ATATATC--------------TTA-TCCAACAATGCTAACGA-CT-TAATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_grevilleana_CBS_259.36__ GCCTCCACACTCTCCCATTTGCGAAGAACAAATACACCCATCGGTCGTGATGGAAAGATTGCCAAACCAAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCAGAAGGGCAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTTTGGAAGAATACGACCCTGTTTTGGAGCCCAAATCAACCAAGGTGTTTATCAATGGAACTTGGGTTGGTGTGCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTTCGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACGATCATTCGTGATGTGAGAGAACGTGAAATTCGTGTCTTCACCGATGCAGGGCGTGTCTGTCGGCCGCTATTCGTGGTTGACAACAAGCCCGATGCTGTTGAGCGTGGCAGCCTTGTACTGACCCGAGAGCAAGTCTTAAAGCTTCAGCAAGACCAGGAGAACGCGGCGGCCCTACGGGGTA---TCAGTGAAGAGGACAGAGCGGAGCATACTTATGGCTGGATGGGCCTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--CCATC--AAACACTGCATTCTTACGTCGGAGTGAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAAAT----CTACAAC------TAC--CTAC----AACGTTCC-CACCAGCTGACTCC-CTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTCCCATCACATCCTACCCTCTCCACCCCACCCACCCCACCCCACAACCAAT-GGCA-AT-----TCTAACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAACGCGTGAGTCTC-TC-------CA------ACAACATC-AAGC------TCGGCATGG-----------------------------GAATGGA----GAGCTGA-CAG-CATACC-------TCACAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCGTTCATTGAGCCAACCTACGCCGTATGTCTATC---------------------------------------------CAACACAG---CACGA--------TC-CTCAAGATC---CATCTAACAACAAC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAATGGCACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCGCC-CTCACTTC------------------ATT-TCCATACCGT------CG--CGC-GCTT------TG-------CAAAAA----TCG-CT-TA-T---CGGCCCCTCCT-------TTGGTGG-----------------------------GGAGA---TTTG-GGA---TTTGTGCTTGGCGCC-----CGTCACCGCAC-------------AA---ACTGCCTAGCTC-ATTCA------------------------------CTTTGCCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATC-ATATATC--------------TTA-TCCAACAATGCTAACGA-CT-TAATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_grevilleana_CBS_298.34__ GCCTCCACACTCTCCCATTTGCGAAGAACAAATACACCCATCGGTCGTGATGGAAAGATTGCCAAACCAAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCAGAAGGGCAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTTTGGAAGAATACGACCCTGTTTTGGAGCCCAAATCAACCAAGGTGTTTATCAATGGAACTTGGGTTGGTGTGCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTTCGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACGATCATTCGTGATGTGAGAGAACGTGAAATTCGTGTCTTCACCGATGCAGGGCGTGTCTGTCGGCCGCTATTCGTGGTTGACAACAAGCCCGATGCTGTTGAGCGTGGCAGCCTTGTACTGACCCGAGAGCAAGTCTTAAAGCTTCAGCAAGACCAGGAGAACGCGGCGGCCCTACGGGGTA---TCAGTGAAGAGGACAGAGCGGAGCATACTTATGGCTGGATGGGCCTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--CCATC--AAACACTGCATTCTTACGTCGGAGTGAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAAAT----CTACAAC------TCC--CTAC----AACGTTCC-CACCAGCTGACTCC-CTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTCCCATCACATCCTACCCTCT--------------CCACCCCACAACCAAT-GGCA-AT-----TCTAACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAACGCGTGAGTCTC-TC-------CA------ACAACACC-AAGC------TCGGCATGG-----------------------------GAATGGA----GAGCTGA-CAG-CATACC-------TCACAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCGTTCATTGAGCCAACCTACGCTGTATGTCTATC---------------------------------------------CAACACAG---CACGA--------TC-CTCAAGATC---CATCTAACAACAAC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAATGGCACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCGTC-CTCACTTC------------------ATT-TCCATACCGT------CG--CGC-GCTT------TG-------CAAAAA----TCG-CT-TA-T---CAGCCCCTCCT-------TTGGTGG-----------------------------GGAGA---TTTG-GGA---TTTGTGCTTGGCGCC-----CGTCACCGCAC-------------AA---ACTGCCTAGCTC-ATTCA------------------------------CTTTGCCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATC-ATATATC--------------TTA-TCCAACAATGCTAACGA-CT-TAATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_grevilleana_CBS_719.84__ GCCTCCACACTCTCCCATTTGCGAAGAACAAATACACCCATCGGTCGTGATGGAAAGATTGCCAAACCAAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCAGAAGGGCAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTTTGGAAGAATACGACCCTGTTTTGGAGCCCAAATCAACCAAGGTGTTTATCAATGGAACTTGGGTTGGTGTGCACAAAAACGCTGGCCAACTCACCGAAACACTGCGATCACTTCGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACGATCATTCGTGATGTGAGAGAACGTGAAATTCGTGTCTTCACCGATGCAGGGCGTGTCTGCCGGCCGCTATTCGTGGTTGACAACAAGCCCGATGCTGTTGAGCGTGGCAGCCTTGTACTGACCCGAGAGCAAGTCTTAAAGCTTCAGCAAGACCAGGAGAACGCGGCGGCCCTACGGGGTA---TCAGTGAAGAGGACAGAGCGGAGCATACTTATGGCTGGATGGGCCTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--CCATC--AAACACTGCATTCTTACGTCGGAGTGAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAAAT----CTACAAC------TAC--CTAC----AACGTTCC-CACCAGCTGACTCC-CTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTCCCATCACATCCTACCTTCTCCACCCCACCCACCCCACCCCACAACCAAT-GGCA-AT-----TCTAACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAACGCGTGAGTCTC-TC-------CA------AAAACATC-AAGC------TCGGCATGG-----------------------------AAATGGA----GAGCTGA-CAG-CATAAC-------TCACAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCGTTCATTGAGCCAACCTACGCCGTATGTCTATC---------------------------------------------CAACACAG---CACGA--------TC-CTCAAGATC---CATCTAACAACAAC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAATGGCACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATTCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCGTC-CTCACTTC------------------ATT-TTCATACCGT------CG--CGC-GCTT------TG-------CAAAAA----TCG-CT-TA-T---CAGCCCCTCCT-------TTGGTGG-----------------------------GGAGA---TTTG-GGA---TTTGTGCTTGGCGCC-----{CT}GTCACCGCAC-------------AA---ACTGCCTAGCTC-ATTCA------------------------------CTTTGCCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATC-ATATATC--------------TTA-TCCAACAATGCTAACGA-CT-TAATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_haroldporteri_CBS_137272 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCTAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTCACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTAAGAAGAGATCAAGTCGAGAAGCTTCAGCACGATCAAGAGACTGCGGCGTCCCTTCGAGGCA---TTAGCGAGGAGGACAGAGCAGAGCACACCTACGGATGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????????????????????????????????????????????-----?????------????CA-----AT-ACCC-------AC--CCT------TCAAGCC-TTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CA------ATATCAGG-ATT---------GGCGTGGG----------------------------GAAAGAT----GGGCTGA-CAG-GATACC-------TTATAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCCATCGA--------------------------------------------TTCAAG-----CTTAC--------CA-TTCAACCAC---CCACTGACATCAACC-CTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACGATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCAGCTTCCATTCCATGGGGCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGCGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCAGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCATAA----TACT-----------CCA-TCTCCCTCGC------CG--CGC-GGAC----ACCGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCATTCGAAGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAA-----CAGCG-CTTCACTC------TTGC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_haroldporteri_CPC_16297_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCTAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTCACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTAAGAAGAGATCAAGTCGAGAAGCTTCAGCACGATCAAGAGACTGCGGCGTCCCTTCGAGGCA---TTAGCGAGGAGGACAGAGCAGAGCACACCTACGGATGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????????????????????????????????????????????-----?????------????CA-----AT-ACCC-------AC--CCT------TCAAGCC-TTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CA------ATATCAGG-ATT---------GGCGTGGG----------------------------GAAAGAT----GGGCTGA-CAG-GATACC-------TTATAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCCATCGA--------------------------------------------TTCAAG-----CTTAC--------CA-TTCAACCAC---CCACTGACATCAACC-CTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACGATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCAGCTTCCATTCCATGGGGCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGCGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCAGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGAGCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCATAA----TACT-----------CCA-TCTCCCTCGC------CG--CGC-GGAC----ACCGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCATTCGAAGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAA-----CAGCG-CTTCACTC------TTGC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_helminthiae_CBS_118418__ GCTTCCACACTCTCGCATTTGAGGAGAACGAACACGCCTATCGGGCGTGACGGGAAGATCGCAAAGCCGAGACAGCTGCACAATACCCATTGGGGTCTAGTGTGTCCGGCAGAGACGCCAGAAGGACAGGCTTGTGGTCTCGTGAAGAACTTGTCATTGATGTGCTACGTTTCAGTTGGAACACCGGGCGAACCACTAACAGATTTCATGCGACAGCGTGGAATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACTGAAACCTTGCGATCATTGCGAAGAAAAGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTTTTCACCGATGCTGGGCGTGTCTGTCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAACGCGGCAGTCTCGTGCTTGTTCGGAACCAGGTTGAAAAGCTTCAACACGATCAAGAGACTGCGGCGTCCCTCAGGGGGA---TAAGCGAGGAGGACAGAGCGGAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAAGAGACTGCCA????????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGCTCATCCGGCACTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTGCGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CCCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGGT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCTGGG-----CAGAAGC-------AT--ACA------ATGTACA-TACCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGTAAACTT-----CCACCCATCCTCC-----------------CTCGCTCACCGTT-GGCA-CT-----TCTGACGAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CA------GCCGTGGC-ATA---------TACATCCGA---------------------------CAAGGGT----GAATTGA-CAG-GATATT-------TTGCAGCGTTGAGCACGGCGACGTCAATGTCGTCGCTGTCAACGACCCATTCATCGAGCCAACCTACGCCGTATGTGTTGCG--------------------------------------------CTCCCAGA---GAAGA--------TC-ATGTCACCC---TCTCTGACATTCCA---TTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAGCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCGGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCGTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACTTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCATT-CCCT-TC-------------------ACG-GCATCATTGT------CG--CGC-GTTC------TGC------CAGAAA----TCG-CT-TA-T---CACCCCTCTCC-------TTGGTGGGC----------------------TGGT-GGGGGA--CTTA-AGA--TTTTTGTCTTGGCGT------CATGACCTCACT-T-----CATC-AT---ATTGCCCCGTTT-GCCTC----------AACA-TCAG-----CAGCA-ATGCGCTC------CTCG----ACATAT---------------------------------------------------------------------------------CGCCC-CGCTATC--------------TGC-CAATAAAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCTTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACTATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAA Ramularia_helminthiae_CPC_11502_ GCTTCCACACTCTCGCATTTGAGGAGAACCAACACGCCTATTGGGCGTGACGGCAAGATTGCAAAGCCGAGACAGCTGCACAATACCCATTGGGGTCTAGTGTGTCCGGCAGAGACGCCAGAAGGACAGGCTTGTGGTCTCGTGAAGAACTTGTCATTGATGTGCTACGTTTCAGTTGGAACGCCAGGCGAACCACTTACAGACTTCATGCGACAACGTGGAATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCTAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACTGAAACCTTGCGATCATTGCGGAGAAAAGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTTTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAACGCGGCAGTCTCGTACTGGTTCGGAACCAGGTTGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGGGGAA---TAAGTGAGGAGGACAGAGCGGAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAAGAGACTGCCA????????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTCGGGGGGCGACCCTGCCGTTCACCCGGCACT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGTCCCCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGGT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCTGGG-----CGAAAGC-------AC--ACA------ATGTACA-TACCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACCTT-----CCACCCATCCTCC-----------------CTCACTCACCAAT-GGCA-AT-----GCTGACGCGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CC------GCTGTGGC-ATA---------TACATTCGA---------------------------GAAGGGT----GAGCTGA-CAG-GATACC-------TTGCAGCGTTGAGCACGGCGACGTCGATGTTGTCGCTGTCAACGACCCATTCATTGAGCCAACCTACGCTGTATGCCTTGCA--------------------------------------------CTCCCAGA---GAAGA--------TC-ATGTCACCC---TCTCTTACATTCCA---TCCAGGCCTACATGCTCAAGTACGACTCTACCCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTTAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGTATCCCCTGGGGCGAGTCCAAGGCCGACTATATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCGGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCGTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCATT-AACT-TC-------------------ACA-GCATCATTGT------CG--CGC-GTTC------TGC------AAGATA----TCG-CT-TA-T---CACCCCTCTCC-------TTGGTGGGC----------------------TGGT-GGGGGG--CTTA-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AT---ATTGCCTCGCTT-TCCTC----------AACA-TCAG-----CAGCA-ATGCGCTC------CTCG----ACATAT---------------------------------------------------------------------------------CGCTC-CGCTATC--------------TGC-CAACAAAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_helminthiae_CPC_11504_ GCTTCCACACTCTCGCATTTGAGGAGAACCAACACGCCTATTGGGCGTGACGGCAAGATTGCAAAGCCGAGACAGCTGCACAATACCCATTGGGGTCTAGTGTGTCCGGCAGAGACGCCAGAAGGACAGGCTTGTGGTCTCGTGAAGAACTTGTCATTGATGTGCTACGTTTCAGTTGGAACGCCAGGCGAACCACTTACAGACTTCATGCGACAACGTGGAATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCTAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAATGCTGGTCAGCTCACTGAAACCTTGCGATCATTGCGGAGAAAAGGACTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTTTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAACGCGGCAGTCTCGTACTGGTTCGGAACCAGGTTGAAAAGCTTCAGCACGATCAAGAGACCGCAGCGTCCCTCCGGGGAA---TAAGTGAGGAGGACAGAGCGGAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAAGAGACTGCCAAAG?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTCGGGGGGCGACCCTGCCGTTCACCCGGCACT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGTCCCCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGGT--CGAG--TCGTC-GCGGCCGTT-AAATCTTCCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCTGGG-----CGAAAGC-------AC--ACA------ATGTACA-TACCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACCTT-----CCACCCATCCTCC-----------------CTCACTCACCAAT-GGCA-AT-----GCTGACGCGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-TT-------CC------GCTGTGGC-ATA---------TACATTCGA---------------------------GAAGGGT----GAGCTGA-CAG-GATACC-------TTGCAGCGTTGAGCACGGCGACGTCGATGTTGTCGCTGTCAACGACCCATTCATTGAGCCAACCTACGCTGTATGCCTTGCA--------------------------------------------CTCCCAGA---GAAGA--------TC-ATGTCACCC---TCTCTTACATTCCA---TCCAGGCCTACATGCTCAAGTACGACTCTACCCACGGAGTCTTCAACGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTTAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAGTATCCCCTGGGGCGAGTCCAAGGCCGACTATATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCGGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCGTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-AATCATT-AACT-TC-------------------ACA-GCATCATTGT------CG--CGC-GTTC------TGC------AAGATA----TCG-CT-TA-T---CACCCCTCTCC-------TTGGTGGGC----------------------TGGT-GGGGGG--CTTA-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AT---ATTGCCTCGCTT-TCCTC----------AACA-TCAG-----CAGCA-ATGCGCTC------CTCG----ACATAT---------------------------------------------------------------------------------CGCTC-CGCTATC--------------TGC-CAACAAAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_108969__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTTTCAGTGGGAACTCCAGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTCGGCGTGCACAAACATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCAGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGTCACTGCAAGGCA---TCAGCGAGGAGGTCAAAGCTCAACACACGTACGGTTGGATGGGCTTGGTCGGTGAAGGTGTTGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TGTTC-------CCATAC----GCACGCC-------GC--CCA------GCGTGCC-CGTTAGCTGACCCT-GTCACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGTAATGCGATATC-----CCATGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTGAC-AC-------CA------AGAGTAGC-TTCC---CTGTGGATCTCG---------------------------GTGGGTTGT----GAGCTGA-CAT-CCCCAT--------GCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCGACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTCT--------CC-CGACCATAC---CCACTAATATAGTA--CCCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCGGCCAACATTCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCCCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCTCAC-TCC-----------------------ACA-TCACTACCGT------CG--CGC-GCTC------TGC------AAAAAT----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCATCT---------------CACGT---------------------------------------------------------------------------------CGCAT-TACCACA--------------CCC-AAAAACATTACTGACAA----TGTCTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_108972__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTTTCAGTGGGAACTCCAGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTCGGCGTGCACAAACATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCAGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGTCACTGCAAGGCA---TCAGCGAGGAGGTCAAAGCTCAACACACGTACGGTTGGATGGGCTTGGTCGGTGAAGGTGTTGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TGTTC-------CCATAC----GCACGCC-------GC--CCA------GCGTGCC-CGTTAGCTGACCCT-GTCACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGTAATGCGATATC-----CCATGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTGAC-AC-------CA------AGAGTAGC-TTCC---CTGTGGATCTCG---------------------------GTGGGTTGT----GAGCTGA-CAT-CCCCAT--------GCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCGACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTCT--------CC-CGACCATAC---CCACTAATATAGTA--CCCTAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCGGCCAACATTCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCCCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCTCAC-TCC-----------------------ACA-TCACTACCGT------CG--CGC-GCTC------TGC------AAAAAT----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCATCT---------------CACGT---------------------------------------------------------------------------------CGCAT-TACCACA--------------CCC-AAAAACATTACTGACAA----TGTCTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_108987__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTAAG-----TGTTC-------CCATAC----ACGCGCC-------GC--CCA------GCTTGCC-CGCCAGCTGACCCT-GTTACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACATATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAAA---TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCCGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_108988__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTAAG-----TGTTC-------CCATAC----ACGCGCC-------GC--CCA------GCTTGCC-CGCCAGCTGACCCT-GTTACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACATATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAAA---TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCCGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_113976__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTAAG-----TGTTC-------CCATAC----ACGCGCC-------GC--CCA------GCTTGCC-CGCCAGCTGACCCT-GTTACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACATATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTCTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAAA---TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCCGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CBS_194.25__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCAGTGGGAACTCCAGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTGGGCGTGCACAAACATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGTTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCAGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGTCACTGCAAGGCA---TCAGCGAGGAGGTCAAAGCTCAACACACGTACGGTTGGATGGGCTTGGTCGGTGAAGGTGTTGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TGTTC-------CCATAC----ACACGCC-------GC--CCA------GCGTGCC-CGTTAGCTGACCCT-GTCACAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCATGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTGAC-AC-------CA------AGAGTAGC-TTCC---CTGTGGATCTCG---------------------------GTGGGTTGT----GAGCTGA-CAT-CCCCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCGACCTACGCGGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTCT--------CC-CGACCATAC---CCACTAATATAGTA--CCCTAGGCATACATGCTCAAGTACGACTCCACCCATGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCGGCCAACATTCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCCCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCTCAC-TCC-----------------------ACA-TCACTACCGC------CG--CGC-GCTC------TGC------AAAAAT----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCATCT---------------CACGT---------------------------------------------------------------------------------CGCAT-TACCACA--------------CCC-AAAAACATTACTGACAA----TGTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CPC_11505_ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGCTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TATTC-------CCATAC----ACGCGCC-------GC--CCA------GCGTGCC-CGCCAGCTGACCCT-GTTGCAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCAGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCTGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CPC_11506_ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGCTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TATTC-------CCATAC----ACGCGCC-------GC--CCA------GCGTGCC-CGCCAGCTGACCCT-GTTGCAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCAGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCTGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_heraclei_CPC_11507_ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACCCCGATCGGCCGTGATGGGAAGATTGCCAAGCCGAGACAACTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCCCTCACAGACTTTATGCGACAGCGCGGGATGGACCTTCTCGAAGAGTACGATCCTGTCTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGCGTGCACAAGCATGCTGGTCAACTCACGGAGACTCTACGATCACTCCGAAGAAAGGGTCTTCTCAGCTTTGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATTCGCGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAGGCCGGATTCCGCCGAGCGTGGCAGTCTCGTGCTGAAACGGGAGCAGGTTGAGAAACTACAAGCCGACCAGGAGGCGGCGGCGGCACTGCAAGGCA---TCAGCGAGGAGGACAAAGCTAAACACACGTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTGGACGCCGAAGAGGAGGAGACTGCAATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TATTC-------CCATAC----ACGCGCC-------GC--CCA------GCGTGCC-CGCCAGCTGACCCT-GTTGCAGCATCTATCGTCGGCCGACCGCGCCACCACGGGT-ATGCGATATC-----CCACGTATCCTCA---------------------ACCTCCAAT-CGCA-AT-----TCTGACAAGAGCATAGCATCATGATTGGTATGGG?????TCCGTAATGCGTGAGTGAC-AT-------CA------AGAGCAGC-TTCT---CTGTGGATATCG---------------------------ATGGGTTGC----GAGCTGA-CAT--CCCAT--------CCCAGCGTCGAGCACGGCGACGTCACCGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCAGTATGCCTTTC---------------------------------------------CTGAGAGG---CTTTC--------CC-CGACCATAC---CCACTGACGCAGTA--CCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACTATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACTGAGCGTGACCCAGCCAACATCCCATGGTCGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCAATC-C-------------------------ACT-TCACTACCGT------TG--CGC-GCTT------TGCAAATG-CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACTC------CGTC----ATATAT---------------------------------------------------------------------------------CGCCG-TACCACA--------------CCC-AAAAACATTACTGACAA----TATCTC--ACAGGAAGCTGCCGAGCTAGGCAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hieraci-umbelati CPC 10690 ' GCCTCCACTCTCTCTCATCTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAACTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGAGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTTACCGAGACCTTGCGAGCGCTGCGGAGAAAAGGGCTTCTTAGCTTCGAGGTCACTATCATTCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGATGCTGGACGTGTCTGCCGGCCGCTATTTGTGGTCGACAACAAGCCGGATTCCGCCGATCGCGGCAGTCTTGTCCTGCAGCGGAGTCAGGTTGATAAGCTCCAAGCCGATCAGGAAGCGGCAGCGTCGCTACGGGGGG---TCAGTGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGTTTGGTCAGTGAAGGTGTGGTGGAGTACCTCGACGCTGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGTG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATC-------CCATAC----ACGCAGC-------GT--TCG------GCGGGCC-CGCCAGCTGACCCT-CTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATAGC-----CCATCTACCCTCA---------------------ATCCCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGG-AT-------CG------AGAAGATA-ATA---------TCCATGA---------------------------ATAGGACAT----GAGCTGA-TGT-GGAGAT--------CACAGCGTCGAGCACGGCGACGTCACTGTAGTGGCCGTCAACGACCCTTTCATTGAGCCAAGCTACGCGGTATGCCTTGTC--------------------------------------------TTGAAAGA---GCAGC--------CT-CCAACACAC---CCACTGACAAGACA---TCCAGGCCTACATGCTCAAGTACGACTCCACTCATGGAGTGTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGATTCCGGCGCCGACTACATTGTCGAGTCGACGGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-CCCTCACCGT------CC--CGC-ACTC------TGC------AAAAAA----TCGTCT-TT-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----AATCA-CCCCACTC------CTTC----ATATGC---------------------------------------------------------------------------------CGCTG-AGCCACT-------------CTTG-AGAAATATTACTGACAA-CT-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hieraci-umbelati CPC 10691 ' GCCTCCACTCTCTCTCATCTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAACTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGAGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTTACCGAGACCTTGCGAGCGCTGCGGAGAAAAGGGCTTCTTAGCTTCGAGGTCACTATCATTCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGATGCTGGACGTGTCTGCCGGCCGCTATTTGTGGTCGACAACAAGCCGGATTCCGCCGATCGCGGCAGTCTTGTCCTGCAGCGGAGTCAGGTTGATAAGCTCCAAGCCGATCAGGAAGCGGCAGCGTCGCTACGGGGGG---TCAGTGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGTTTGGTCAGTGAAGGTGTGGTGGAGTACCTCGACGCTGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGTG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATC-------CCATAC----ACGCAGC-------GT--TCG------GCGGGCC-CGCCAGCTGACCCT-CTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATAGC-----CCATCTACCCTCA---------------------ATCCCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGG-AT-------CG------AGAAGATA-ATA---------TCCATGA---------------------------ATAGGACAT----GAGCTGA-TGT-GGAGAT--------CACAGCGTCGAGCACGGCGACGTCACTGTAGTGGCCGTCAACGACCCTTTCATTGAGCCAAGCTACGCGGTATGCCTTGTC--------------------------------------------TTGAAAGA---GCAGC--------CT-CCAACACAC---CCACTGACAAGACA---TCCAGGCCTACATGCTCAAGTACGACTCCACTCATGGAGTGTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGATTCCGGCGCCGACTACATTGTCGAGTCGACGGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-CCCTCACCGT------CC--CGC-ACTC------TGC------AAAAAA----TCGTCT-TT-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----AATCA-CCCCACTC------CTTC----ATATGC---------------------------------------------------------------------------------CGCTG-AGCCACT-------------CTTG-AGAAATATTACTGACAA-CT-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hieraci-umbelati CPC 10692 ' GCCTCCACTCTCTCTCATCTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAACTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGAGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTTACCGAGACCTTGCGAGCGCTGCGGAGAAAAGGGCTTCTTAGCTTCGAGGTCACTATCATTCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGATGCTGGACGTGTCTGCCGGCCGCTATTTGTGGTCGACAACAAGCCGGATTCCGCCGATCGCGGCAGTCTTGTCCTGCAGCGGAGTCAGGTTGATAAGCTCCAAGCCGATCAGGAAGCGGCAGCGTCGCTACGGGGGG---TCAGTGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGTTTGGTCAGTGAAGGTGTGGTGGAGTACCTCGACGCTGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGTG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATC-------CCATAC----ACGCAGC-------GT--TCG------GCGGGCC-CGCCAGCTGACCCT-CTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATAGC-----CCATCTACCCTCA---------------------ATCCCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGG-AT-------CG------AGAAGATA-ATA---------TCCATGA---------------------------ATAGGACAT----GAGCTGA-TGT-GGAGAT--------CACAGCGTCGAGCACGGCGACGTCACTGTAGTGGCCGTCAACGACCCTTTCATTGAGCCAAGCTACGCGGTATGCCTTGTC--------------------------------------------TTGAAAGA---GCAGC--------CT-CCAACACAC---CCACTGACAAGACA---TCCAGGCCTACATGCTCAAGTACGACTCCACTCATGGAGTGTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGATTCCGGCGCCGACTACATTGTCGAGTCGACGGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-CCCTCACCGT------CC--CGC-ACTC------TGC------AAAAAA----TCGTCT-TT-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----AATCA-CCCCACTC------CTTC----ATATGC---------------------------------------------------------------------------------CGCTG-AGCCACT-------------CTTG-AGAAATATTACTGACAA-CT-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hieraci-umbelati CPC 10788 ' GCCTCCACTCTCTCTCATCTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAACTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGAGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTTACCGAGACCTTGCGAGCGCTGCGGAGAAAAGGGCTTCTTAGCTTCGAGGTCACTATCATTCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGATGCTGGACGTGTCTGCCGGCCGCTATTTGTGGTCGACAACAAGCCGGATTCCGCCGATCGCGGCAGTCTTGTCCTGCAGCGGAGTCAGGTTGATAAGCTCCAAGCCGATCAGGAAGCGGCAGCGTCGCTACGGGGGG---TCAGTGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGTTTGGTCAGTGAAGGTGTGGTGGAGTACCTCGACGCTGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGTG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATC-------CCATAC----ACGCAGC-------GT--TCG------GCGGGCC-CGCCAGCTGACCCT-CTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATAGC-----CCATCTACCCTCA---------------------ATCCCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGG-AT-------CG------AGAAGATA-ATA---------TCCATGA---------------------------ATAGGACAT----GAGCTGA-TGT-GGAGAT--------CACAGCGTCGAGCACGGCGACGTCACTGTAGTGGCCGTCAACGACCCTTTCATTGAGCCAAGCTACGCGGTATGCCTTGTC--------------------------------------------TTGAAAGA---GCAGC--------CT-CCAACACAC---CCACTGACAAGACA---TCCAGGCCTACATGCTCAAGTACGACTCCACTCATGGAGTGTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGATTCCGGCGCCGACTACATTGTCGAGTCGACGGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-CCCTCACCGT------CC--CGC-ACTC------TGC------AAAAAA----TCGTCT-TT-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----AATCA-CCCCACTC------CTTC----ATATGC---------------------------------------------------------------------------------CGCTG-AGCCACT-------------CTTG-AGAAATATTACTGACAA-CT-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hieraci-umbelati CPC 10789 ' GCCTCCACTCTCTCTCATCTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAACTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACCTGTCGCTCATGTGCTACGTTTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGAGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGTGCACTTACCGAGACCTTGCGAGCGCTGCGGAGAAAAGGGCTTCTTAGCTTCGAGGTCACTATCATTCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGATGCTGGACGTGTCTGCCGGCCGCTATTTGTGGTCGACAACAAGCCGGATTCCGCCGATCGCGGCAGTCTTGTCCTGCAGCGGAGTCAGGTTGATAAGCTCCAAGCCGATCAGGAAGCGGCAGCGTCGCTACGGGGGG---TCAGTGAAGAGGATAGAGCACAACACATCTACGGCTGGATGGGTTTGGTCAGTGAAGGTGTGGTGGAGTACCTCGACGCTGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGTG-TTTGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGATC-------CCATAC----ACGCAGC-------GT--TCG------GCGGGCC-CGCCAGCTGACCCT-CTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATAGC-----CCATCTACCCTCA---------------------ATCCCCAGT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGG-AT-------CG------AGAAGATA-ATA---------TCCATGA---------------------------ATAGGACAT----GAGGTGA-TGT-GGAGAT--------CACAGCGTCGAGCACGGCGACGTCACTGTAGTGGCCGTCAACGACCCTTTCATTGAGCCAAGCTACGCGGTATGCCTTGTC--------------------------------------------TTGAAAGA---GCAGC--------CT-CCAACACAC---CCACTGACAAGACA---TCCAGGCCTACATGCTCAAGTACGACTCCACTCATGGAGTGTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGATTCCGGCGCCGACTACATTGTCGAGTCGACGGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACT-CCCTCACCGT------CC--CGC-ACTC------TGC------AAAAAA----TCGTCT-TT-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----AATCA-CCCCACTC------CTTC----ATATGC---------------------------------------------------------------------------------CGCTG-AGCCACT-------------CTTG-AGAAATATTACTGACAA-CT-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CBS 113614 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCTACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACCGATGCAGGACGTGTATGCCGGCCGCTATTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCATCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATTCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGTGTAAGTTCC-TT-------CA------GTTTCAGT-GTT---------GATATAGCG---------------------------AAAAAAT----GAGTTGA-CAG-GATACC-------TCATAGCGTCGAGCACGGAGAAGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAGCCA--------------------------------------------GTAGA-AG---ACACA--------CC-CTCAACACC---CAACTAAGATCATT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCGCCATCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGG-ACTCACC-CTCA-ACAT-----------------CCT-GCATGACTGT------CG--CTC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------TGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCTTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CBS 114117 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATCCGAGTGTTTACCGATGCTGGACGTGTATGCCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GGGCAGC-------AT--CCA------TTGTACA-CGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT----CAACA------GCTTCAGT-CTT---------GATATGAA----------------------------GGAACAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTGATCG--------------------------------------------ATACAACG---GCCAA--------CA-CTTGACAGC---CCACTGATTGCATT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTTCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTGGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????????????????-???????-????-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------GTCC----ACACGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------ACC-CACAACAATGCTAACGA-TC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CBS 118408 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTTGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCATCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCACA-----GTATAGC-------ACAGCCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACTTC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGTA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCT-TT-------CA------GCTTCAGT-GTT---------GATATGAA----------------------------GGAACAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAAACA--------------------------------------------GCACAAG----AACTA--------CT-TCCAACAAC---CCACTAACATCACT---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGATATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCATC-CTCA-CCAT-----------------CCT-CCATCACTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGATCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------ACC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CBS 118410 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTCGGAACACCTGGCGAGCCCCTGACAGACTTCATGCGACAGCGGGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTATTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGGCAACTGACCGAGACTTTGCGATCATTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATTCGAGTCTTTACCGATGCCGGACGTGTTTGCCGGCCGCTATTCGTGGTCGACAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCCGAGCACACTTATGGCTGGATGGGTTTGGTCAATGAAGGTGTTGTGGAATACCTCGATGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCACA-----GTATAGC-------ACAGCCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACTTC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGTA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TATTTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCATC-CTCA-CCAT-----------------CCT-CCATCACTGT------CG--CGC-GCCT------TGA------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGATCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------ACC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CBS 122272 ' GCCTCTACGCTCTCCCACTTGCGAAGAACAAATACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGCCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCTTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACGCCCGGCGAGCCACTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCCGGACAGCTCACAGAAACTTTGCGATCACTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACTGATGCTGGACGTGTATGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCGGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGACAGAGCCGAGCACACTTATGGCTGGATGGGTCTGGTCAATGAAGGTGTAGTGGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCAACCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTATATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------ATGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAACATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CBS 122273 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTCGGAACACCTGGCGAGCCCCTGACAGACTTCATGCGACAGCGGGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTATTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGGCAACTGACCGAGACTTTGCGATCATTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATTCGAGTCTTTACCGATGCCGGACGTGTTTGCCGGCCGCTATTCGTGGTCGACAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGTGAAGAGGATAGAGCCGAGCACACTTATGGCTGGATGGGTTTGGTCAATGAAGGTGTTGTGGAATACCTCGATGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTCT------CCCACT-----GTATAGC-------ACAACCT------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGGCCGCGCCACCATGGGT-ATGCAAGATC-----CCACTCATCCTCC---------------------TCCCTCACT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCT-TT-------CA------GCTTCAGT-GTT---------GATATG------------------------------AAGGAAC----ATGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCACCA---------------------------------------------ATACAACA---AACAA--------CA-TTGAACAGC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCATC-CTCA-CCAT-----------------CCT-CCATCACTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGATCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------ACC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CBS 122625' GCCTCTACGCTCTCCCACTTGCGAAGAACAAATACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGCCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCTTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACGCCCGGCGAGCCACTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCCGGACAGCTCACAGAAACTTTGCGATCACTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACTGATGCTGGACGTGTATGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCGGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGACAGAGCCGAGCACACTTATGGCTGGATGGGTCTGGTCAATGAAGGTGTAGTGGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT-------CA------GCTTCAGT-GTT---------GATATAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGGATCC--------------------------------------------ATACATCA---ATCAA--------CA-CTCAACAAC---CCACTAATTTCAAT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATCAACTC------CTTC----ACATGT---------------------------------------------------------------------------------CGCGC-AAACATC--------------TAC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAAACTCCCAA 'Ramularia hydrangeae-macrophyllae CBS 159.82 ' ??CTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTTTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATTCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGAGGCAGTCTTGTGTTGAGACAAGATCAGGTCGTGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTTAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GGTATAGCA---------------------------AGAGAAT----AAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTC-ACCA--------------------------------------------ATACAACA---AACAA--------CA-TTCAACAGC---CCACTAATATCAAT----ACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTTCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CBS 341.49 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATCCGAGTCTTTACCGATGCGGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTTAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCTC-TT----CAGCA------GCTTCAGT-GTT---------GATCTAGCA---------------------------AGAGGAT----GAGCTGA-CAA-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGATCA--------------------------------------------ATACAACA---AACAG--------CA-TTCCACAGC---TCACTAATATCAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CAC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCCG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CBS 766.84 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTTTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATTCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGAGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGTGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATG-----CCACTCATCCTCC---------------------TCCCTTAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTGATCA--------------------------------------------ATACACCG---ACCAG--------CA-CTCAACAGC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 14811 ' GCCTCTACGCTCTCCCACTTGCGAAGAACAAATACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGCCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGCTTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACGCCCGGCGAGCCACTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCCGGACAGCTCACAGAAACTTTGCGATCACTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACTGATGCTGGACGTGTATGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCGGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGACAGAGCCGAGCACACTTATGGCTGGATGGGTCTGGTCAATGAAGGTGTAGTGGAATACCTCGACGCAGAGGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT-------CA------GCTTCAGT-GTT---------GATATAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGGATCC--------------------------------------------ATACATCA---ATCAA--------CA-CTCAACAAC---CCACTAATTTCAAT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATCAACTC------CTTC----ACATGT---------------------------------------------------------------------------------CGCGC-AAACATC--------------TAC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAAACTCCCAA 'Ramularia hydrangeae-macrophyllae CPC 19026 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTCAGAGAACGAGAAATCCGAGTCTTTACCGATGCTGGACGTGTGTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 19027 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTCAGAGAACGAGAAATCCGAGTCTTTACCGATGCTGGACGTGTGTGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 19030 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTTTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATTCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGAGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTTAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCT-TT-------CA------GCTTCAGT-GTT---------GATACAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TTACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAACCA--------------------------------------------GTAGA-AG---ACATA--------CC-CTCAACACC---CAACTAAAATCATT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCTAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGATATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 19854 ' GCCTCCACGCTCTCCCATTTGCGGAGAACGAATACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTCTTGGAGCCAAAGTCCACCAAGGTATTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGGCAACTGACCGAGACTTTGCGATCATTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATTCGAGTCTTTACCGATGCCGGACGTGTATGCCGGCCGCTGTTCGTGGTCGATAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATATCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGTCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCATCATC-----CCACTCATCCTCT--------------------ATCCCTCAAA-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCT-TT-------CA------GCTTCAGT-GTT---------GATATG------------------------------AAGGAAC----ATGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCACCA---------------------------------------------ATACAACA---AACAA--------CA-TTGAACAGC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CAC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATCAACTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCGC-AAACATC--------------TAC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAAACCCCCAA 'Ramularia hydrangeae-macrophyllae CPC 20406' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATCCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTTAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----ATATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCATCCATCTTCC---------------------CCCTCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT-------CA------GCTTCAGT-GTT---------GATATAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGGATCC--------------------------------------------ATACATCA---ATCAA--------CA-CTCAACAAC---CCACTAATTTCAAT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATCAACTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCGC-AAACATC--------------TAC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAAACTCCCAA 'Ramularia hydrangeae-macrophyllae CPC 20406 ' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATCCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTTAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----ATATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCATCCATCTTCC---------------------CCCTCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT-------CA------GCTTCAGT-GTT---------GATATAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGGATCC--------------------------------------------ATACATCA---ATCAA--------CA-CTCAACAAC---CCACTAATTTCAAT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATCAACTC------CTTC----ACATGC---------------------------------------------------------------------------------CGCGC-AAACATC--------------TAC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAAACTCCCAA 'Ramularia hydrangeae-macrophyllae CPC 20484 ' ???????????????????????GAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTTTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATTCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGAGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGTGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTGATCA--------------------------------------------ATACACCG---ACCAG--------CA-CTCAACAGC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAAA-ACCCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CGC-GCCT------GGCC-----AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATCAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCGC-AAATATC-------------TTTC-TACAACATTGCTAACGA-CC-TCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25901' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTTTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATTCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGAGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGTGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTTCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTTGATCA--------------------------------------------ATACACCG---ACCAG--------CA-CTCAACAGC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-TT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-C-----TAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGAACAC------CTCG----ACATGT---------------------------------------------------------------------------------CGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25902 ' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCGAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAATGCTGGGCAACTGACCGAGACTTTGCGATCACTACGAAGGAAGGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTCACTGATGCTGGGCGTGTATGCCGGCCGCTGTTCGTGGTCGATAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTTCACCAAGATCAAGAAGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGACAGAGCCGAGCACACCTATGGTTGGATGGGTTTGGTCAACGAGGGTGTGGTGGAGTATCTCGACGCAGAGGAAGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCACA-----GTATAGC-------ACAGCCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACTTC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGTA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCATC-CTCA-TCAT-----------------CCT-CCATCACTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGATCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATA--------------ACC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25903' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCTAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCTACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACCGATGCAGGACGTGTATGCCGGCCGCTATTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCATCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATTCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGTGTAAGTTCC-TT-------AA------GTTTCAGT-GTT---------GATATAGCG---------------------------AAAGAAT----GAGCTGA-CAG-{GT}ATACC-------TCACAG{AC}GTCGAGCACGGCGA{AC}GTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCAGCCA--------------------------------------------GTAGA-AG---ACACA--------CC-CTCAACACC---CAACTAAGATCATT---CCCAGGCATACATGCTCAAGTACGACTCCACTCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGT{CT}GTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCCACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACC-CTCA-ACAT-----------------CCT-GCATGACTGT------CG--CTC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------CTCC----ACATGT---------------------------------------------------------------------------------TGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25904' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGTCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTTGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCAAAGTCCACCAAAGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTTACCGATGCTGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCATCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTTTGGTCAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATTATCGGTATGGG?????TCCGCAATGCGTAAGTTCC-TT-------CA------GCTTCAGT-GTT---------GATATAGCG---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCGGATCC--------------------------------------------ATACATCA---ATCAA--------CA-CTCAACAAC---CCACTAATTTCAAT---CCCAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CAC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCCG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25905' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTCGGAACACCTGGCGAGCCCCTGACAGACTTCATGCGACAGCGGGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTATTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGGCAACTGACCGAGACTTTGCGATCATTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATTCGAGTCTTTACCGATGCCGGACGTGTTTGCCGGCCGCTATTCGTGGTCGACAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCCGAGCACACTTATGGCTGGATGGGTTTGGTCAATGAAGGTGTTGTGGAATACCTCGATGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCACA-----GTATAGC-------ACAGCCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACTTC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGTA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAACATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25906' GCCTCCACGCTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCGAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAATGCTGGGCAACTGACCGAGACTTTGCGATCACTACGAAGGAAGGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATCCGAGTCTTCACTGATGCTGGGCGTGTATGCCGGCCGCTGTTCGTGGTCGATAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTTCACCAAGATCAAGAAGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGACAGAGCCGAGCACACCTATGGTTGGATGGGTTTGGTCAACGAGGGTGTGGTGGAGTATCTCGACGCAGAGGAAGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCACA-----GTATAGC-------ACAGCCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCAACTTC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGTA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACCCATC-CTCA-TCAT-----------------CCT-ACATCACTGT------CG--CGC-GCCT------TGC------AAAAAG----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAACATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25907' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCTCGGTAGGAACACCCGGCGAGCCATTGACGGACTTCATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTGTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAATGCTGGACAGCTCACCGAGACCTTGCGATCACTTCGAAGGAAAGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAAATCCGAGTCTTTACCGATGCGGGACGTGTATGCCGGCCGCTCTTCGTGGTCGACAACAAGCCTGACTCCGCTGATCGTGGCAGTCTTGTGTTGAGACAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTATGGCTGGATGGGTCTGGTTAATGAAGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GAGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCTC-TT----CAGCA------GCTTCAGT-GTT---------GATCTAGCA---------------------------AGAGGAT----GAGCTGA-CAA-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGATCA--------------------------------------------ATACAACA---AACAG--------CA-TTCCACAGC---TCACTAATATCAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACT-CTCA-ACAT-----------------CAT-ACATCACTGT------CG--CAC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CACC-AA---AATGCCTCGCCG-GCCAC----------AACA-CCAG-----CAGCACATGAACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------TCC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA 'Ramularia hydrangeae-macrophyllae CPC 25908' GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGAAAGATTGCCAAGCCAAGACAACTTCACAACACTCACTGGGGTCTGGTGTGTCCGGCAGAGACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTATCGTTGATGTGCTACGTCTCGGTCGGAACACCTGGCGAGCCCCTGACAGACTTCATGCGACAGCGGGGTATGGATCTTCTCGAAGAATACGACCCTGTTTTGGAGCCAAAGTCCACCAAGGTATTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGGCAACTGACCGAGACTTTGCGATCATTACGAAGGAAGGGCTTGCTCAGCTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGAGAGATTCGAGTCTTTACCGATGCCGGACGTGTTTGCCGGCCGCTATTCGTGGTCGACAACAAGCCAGACTCTGCTGATCGTGGCAGTCTTGTGTTGAGGCAAGATCAGGTCGCGAAGCTCCACCAAGATCAAGAGGCTGCAGCGTCCCTCCGAGGCA---TCAGCGAAGAGGATAGAGCCGAGCACACTTATGGCTGGATGGGTTTGGTCAATGAAGGTGTTGTGGAATACCTCGATGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACT-----GTATAGC-------ACAACCA------TTGTACA-TGCCAGCTGACAGC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACATC-----CCACTCATCCTCC---------------------TCCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTTC-TT----CAGCA------GCTTCAGT-GTT---------GATATAGCA---------------------------AAAGGAT----GAGCTGA-CAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTATGTCGACCA--------------------------------------------ATACAACA---ATCAA--------TA-TTGAACACC---CCACTAATAACAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCAGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTATATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCATC-CTCA-TCAT-----------------CCT-CCATCACTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCACATGATCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCAC-AAATATC--------------ACC-CACAACAATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_hydrangeicola_CPC_14767_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCTC--------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_hydrangeicola_CPC_14768_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCTC--------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_hydrangeicola_CPC_14769_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCCTC-------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_hydrangeicola_CPC_14832_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCTC--------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_hydrangeicola_CPC_14833_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCTC--------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_hydrangeicola_CPC_14834_ GCCTCCACACTCTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAATTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCCGGCGAGCCTCTGACAGACTTTATGCGGCAGCGTGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTTCTCAACTTACCGAGACTTTACGGTCATTGCGAAGAAAGGGTCTACTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGAGAGATCCGCGTGTTTACCGATGCTGGGCGTGTATGCCGGCCACTTTTTGTGGTCGACAACAAACCCGATGCCGTGGAGCGTGGTAGCCTGGTGTTGAAACAAGAGCAAGTCGCGAAACTCCACAACGATCAGGAGATTGCTGCGTCTCTACGAGGCA---TCAGTGAAGAAGATAGAGCACAGCACACATACGGCTGGATGGGCTTGGTCAACGATGGTGTTGTGGAATACCTCGACGCGGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCA-ACCTCTAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCAACCCTACCGTT--CGCGGCATT-CCCCCGGAGGTCTCATC-AAAACACTACGTCCTTATGTCAGAGTAAA-AAGTCAATGGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGAAGCGGTCCGTCTCCTAGCGTTGTGGCAAC-TATTTCGCGGTAGAGCT--CGGG--TCGTT-GCAGCCGTT-AAATCTTTCCTAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTATG-----TGCTC-------CCATTC----TCATCTC-------GC--CCA------ACGTGCA-CCCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCTCCCATCCTCA-------------------CCACCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-AT-------CA------AGATCGGT-ATG-------------------------------------------GATGAGCTG----GGGCTGA-TGA-TACCAT--------CCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATCCCTCGAT--------------------------------------------CTGACAAA---ACCGC--------CC-TCAACCCAT---CGACTAATCCAATC--TCCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGGGACCCAGCCAGCATCCCATGGAAGGAGTCCGGCGCTGAGTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAAGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCAGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGAGTCAACAACAAGACTTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGC-CCACGAC-TTCC----------------------CAT-CCTGCACCGT------CG--CAC-GCTG------T--------GCAAAA----TCG-CT-TA-T---CACCCCTCTC--------CTGGTGGC-----------------------TGGT-GGGGG---TTTG-AGA---TTTTTGCTTGGCGT------CATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGCA-CTCCACCCA----ACTTC----ACATAC---------------------------------------------------------------------------------CGCGCAAAACCATC------------ATTC-GGAACTATCACTGACAG-AG-TCTCTT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCGTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CBS_141111 GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GC-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAGACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CBS_250.96__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AGTGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CPC_15752_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AGTGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CPC_15753_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AGTGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CPC_15815_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AGTGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAAACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_inaequalis_CPC_25742 GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCCATTGGTCGTGATGGTAAAATTGCCAAGCCCAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCATTGACTGAGACTTTGCGGGCGCTGAGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGTGAGATCCGGGTGTTTACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAAGCCGGATTCTGCTGAGCGGGGCAGTCTCGTGCTGAGGCGGGACCAAGTCGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAGGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCAGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGC-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---GTTTCGCAGTGGAGTT--CGAG--T-AAC-ATGGCCGTTAAAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------ACGTATC-CGCCAGCTGACACG-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GC-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACAT----TAGCTGA-AAC-GGATACT------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAAGAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCAT------CG--CAC-GCCT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCACCT------CACC----ACATGC---------------------------------------------------------------------------------CGCTC-AATCCTT-------------TCCG-AGAGACATCACTGACAA-TGCTCCCCA--ACAGGAAGCGGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_kriegeriana_CPC_10825_ GCTTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACAGACTTCATGCGACAGCGCGGGATGGACCTTCTGGAAGAATACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAAAACGCGGGTCAGCTTACCGAGACTTTGCGGTCGCTGCGAAGGAAGGGTCTCCTGAGTTTCGAGGTCACGATCATTCGTGATGTTCGAGAACGCGAGATCCGCGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGATGCCGCCGAGCGTGGTAGTCTTGTACTGAAACAAGATCAAGTTGCAAAACTCCAGAACGATCAGGAAGCCGCGGCGTCGCTACGAGGCA---TCAGCGAAGAGGATCGAGCCCAGCACACCTACGGCTGGATGGGCTTGGTCAATGATGGTGTCGTAGAGTACCTAGATGCGGAAGAGGAGGAGACGGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGCG--TCGGC-GCGGCCGTT-AAATCTTTACAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCATAC----AAACGGT-------GC--CCAAGTGTGCCGTGCC-CGCCAGCTGACTTG-ATGCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACA---CCCCACCTACCCTCA---------------------ATCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGA-CT-------CA------ATACCGGC-ACCA---ACATCAATATGG---------------------------AAGGGTTGT----GAGCTGA-CATGTAACAT--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCGTTCATTGAGCCCACCTACGCGGTACGCCTTTC---------------------------------------------CTCGAAGA---GCCAC--------CT-TCCATCCAC---CAACTAATACAGTC--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCATTTTCAAGGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGAGAGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACGACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGAGCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGG-TTCCAAT-CATT----------------------CTG-CAATCACCGT------CG--CGC-GCTC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGCGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------GATGACCTCA---T-----CACC-AA---ACTGC------G-GCCTT----------CACA-CCAC-----CATCA-CACCACCA------CTTT----ACATAT---------------------------------------------------------------------------------CGCAA-GAGTAAT--------------TTC-TACAACAATACTGACAA-GT-CCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_kriegeriana_CPC_10826_ GCTTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACAGACTTCATGCGACAGCGCGGGATGGACCTTCTGGAAGAATACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAAAACGCGGGTCAGCTTACCGAGACTTTGCGGTCGCTGCGAAGGAAGGGTCTCCTGAGTTTCGAGGTCACGATCATTCGTGATGTTCGAGAACGCGAGATCCGCGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGATGCCGCCGAGCGTGGTAGTCTTGTACTGAAACAAGATCAAGTTGCAAAACTCCAGAACGATCAGGAAGCCGCGGCGTCGCTACGAGGCA---TCAGCGAAGAGGATCGAGCCCAGCACACCTACGGCTGGATGGGCTTGGTCAATGATGGTGTCGTAGAGTACCTAGATGCGGAAGAGGAGGAGACGGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGCG--TCGGC-GCGGCCGTT-AAATCTTTACAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCATAC----AAACGGT-------GC--CCAAGTGTGCCGTGCC-CGCCAGCTGACTTG-ATGCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACA---CCCCACCTACCCTCA---------------------ATCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGA-CT-------CA------ATACCGGC-ACCA---ACATCAATATGG---------------------------AAGGGTTGT----GAGCTGA-CATGTAACAT--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCGTTCATTGAGCCCACCTACGCGGTACGCCTTTC---------------------------------------------CTCGAAGA---GCCAC--------CT-TCCATCCAC---CAACTAATACAGTC--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCATTTTCAAGGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGAGAGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACGACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGAGCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGG-TTCCAAT-CATT----------------------CTG-CAATCACCGT------CG--CGC-GCTC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGCGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------GATGACCTCA---T-----CACC-AA---ACTGC------G-GCCTT----------CACA-CCAC-----CATCA-CACCACCA------CTTT----ACATAT---------------------------------------------------------------------------------CGCAA-GAGTAAT--------------TTC-TACAACAATACTGACAA-GT-CCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_kriegeriana_CPC_10827_ GCTTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTGAAGAACCTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTGACAGACTTCATGCGACAGCGCGGGATGGACCTTCTGGAAGAATACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTGGGTGTGCACAAAAACGCGGGTCAGCTTACCGAGACTTTGCGGTCGCTGCGAAGGAAGGGTCTCCTGAGTTTCGAGGTCACGATCATTCGTGATGTTCGAGAACGCGAGATCCGCGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCAGATGCCGCCGAGCGTGGTAGTCTTGTACTGAAACAAGATCAAGTTGCAAAACTCCAGAACGATCAGGAAGCCGCGGCGTCGCTACGAGGCA---TCAGCGAAGAGGATCGAGCCCAGCACACCTACGGCTGGATGGGCTTGGTCAATGATGGTGTCGTAGAGTACCTAGATGCGGAAGAGGAGGAGACGGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGCG--TCGGC-GCGGCCGTT-AAATCTTTACAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCATAC----AAACGGT-------GC--CCAAGTGTGCCGTGCC-CGCCAGCTGACTTG-ATGCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATACA---CCCCACCTACCCTCA---------------------ATCTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGA-CT-------CA------ATACCGGC-ACCA---ACATCAATATGG---------------------------AAGGGTTGT----GAGCTGA-CATGTAACAT--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCGTTCATTGAGCCCACCTACGCGGTACGCCTTTC---------------------------------------------CTCGAAGA---GCCAC--------CT-TCCATCCAC---CAACTAATACAGTC--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCATTTTCAAGGGTACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGAGAGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACGACCGAGAAGGCATCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGAGCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGG-TTCCAAT-CATT----------------------CTG-CAATCACCGT------CG--CGC-GCTC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGCGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCAC------GATGACCTCA---T-----CACC-AA---ACTGC------G-GCCTT----------CACA-CCAC-----CATCA-CACCACCA------CTTT----ACATAT---------------------------------------------------------------------------------CGCAA-GAGTAAT--------------TTC-TACAACAATACTGACAA-GT-CCCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_lamii_var._lamii_CBS_108970__ GCCTCCACATTGTCTCACTTGCGGAGAACAAACACGCCCATTGGCCGCGATGGTAAGATTGCCAAGCCGAGACAACTTCATAACACCCACTGGGGAATGGTTTGTCCGGCAGAAACGCCCGAAGGCCAGGCTTGCGGACTTGTGAAGAACGTGTCGCTCATGTGCTACGTTTCGGTCGGAACGCCAGGCGAGCCACTCACCGACTTTATGCGACAGCGCGGTATGGATCTTCTTGAGGAGTATGATCCTGTTCTGGAACCCAAATCGACCAAGGTCTTCATCAATGGTACCTGGGTCGGTGTGCACAAGAACGCCGGTCAACTCACAGAGACTCTGCGGTCGCTGCGAAGGAAGGGTTTGCTAAGTTTCGAAGTCACCATCATTCGCGACGTGAGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGACCGCTGTTCGTGGTCGACAACAAGCCTGATGCCGTGGAGCGTGGCAGTCTTGTGCTGAACCGAGAACAGATCAACAAACTCCAAAATGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAAGAGGACAGAGCACAACACACGTACGGTTGGATGGGCTTGGTCGGCGATGGTGTTGTCGAGTACCTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTT-------CCCTTC----ACATGCC-------AT--CCA------GCGTGCG-CGCCAGCTGACTCC-ATCTCAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATCAT-----CCACCCACCCTCA-------------------CAGCCGCCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-GC-------CA------GCTTCAAT-CTGGA-AAGATGGATATGA---------------------------GTGGGCTGT----GAGCTGA-CGT-CTACATGTACCC-TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCCGGA---------------------------------------------GTGGAAGA---GAGGC--------TT-CAATGCCAC---CCGCTAACACCACC--TTCCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCACCGTCCGCCGACGCGCCCATGTTCGTCATGGGAGTCAACAACAAGACCTATACCTCTGACATCCCCGTCATCT??????????????????????????????----------------------CCT-ATCTCACCGT------CG--CGC-GCTC------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTT-CGCTTGGCAT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCATCC------CGTC----ACATGC---------------------------------------------------------------------------------CGCAT-ACATGCC-------------GCCC-AAAACT-TTACTGACAA-TG-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_lamii_var._lamii_CBS_108971__ GCCTCCACATTGTCTCACTTGCGGAGAACAAACACGCCCATTGGCCGCGATGGTAAGATTGCCAAGCCGAGACAACTTCATAACACCCACTGGGGTCTGGTTTGTCCGGCAGAAACGCCCGAAGGCCAGGCTTGCGGTCTTGTGAAGAACTTGTCGCTCATGTGCTACGTTTCGGTGGGAACACCAGGCGAGCCACTCACCGACTTTATGCGACAGCGCGGTATGGATCTTCTTGAGGAGTATGATCCTGTTCTGGAACCCAAATCGACCAAGGTATTCATCAATGGTACCTGGGTCGGTGTGCACAAGAACGCCGGTCAACTCACAGAGACTCTGCGGTCGCTGCGAAGGAAGGGTTTGCTAAGTTTTGAAGTCACCATCATTCGCGACGTGAGAGAACGCGAGATTCGGGTCTTCACCGACGCTGGACGTGTCTGCCGACCGCTGTTCGTGGTCGACAACAAGCCTGATGCCGTGGAGCGTGGCAGTCTTGTGCTGAACCGAGAACAGATCAACAAACTCCAAAATGATCAGGAGATCAAGTCATCTCTACTAGGCG---TCAGTGAAGAGGACAGAGCACAACACACGTACGGTTGGATGGGCTTGGTCGGCGATGGTGTTGTCGAGTACCTGGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTT-------CCCTTC----ACATGCC-------AT--CCA------GCGTGCG-CGCCAGCTGACTCC-ATCTCAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATCAT-----CCACCCACCCTCA-------------------CAGCCGCCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-GC-------CA------GCTTCAAT-CTGGG-AAGATGGATATGA---------------------------GTGGGCTGT----GAGCTGA-CGT-CTACATGTACCCTCATCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCCGGA---------------------------------------------GTGGAAGA---GAGGC--------TT-CAATGCCAC---CCACTAACACCACC--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCGTCCGCCGACGCGCCCATGTTCGTCATGGGAGTCAACAACAAGACCTATACCTCCGACATCCCCGTCATCT??????????????????????????????----------------------CCT-ATCTCACCGT------CG--CGC-GCTC------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTT-CGCTTGGCAT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-CTCCATCC------CGTC----ACATGC---------------------------------------------------------------------------------CGCAT-ACATGCC-------------GCCC-AAAACT-TTACTGACAA-TG-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_leonuri_CBS_141112 GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCTACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTGAAGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11312_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TC-------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11313_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11314_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11411_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGAA--------------------------GTAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11412_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_11413_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_14570_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_leonuri_CPC_14571_ GCTTCTACACTCTCGCATTTGAGGAGAACAAACACGCCTATTGGGCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACACATTGGGGCCTTGTGTGTCCAGCAGAAACGCCAGAGGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCATTGATGTGCTACGTTTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGTGCAGCTTACTGAAACCTTGCGCGGGCTAAGAAGAAAGGGCTTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGACCACTGTTCGTGGTCGACAATAAGCCTGACTCTGCTGAGCGTGGCAGTCTCGTGCTAGTGAGGAATCAAGTCGAGAAACTCCAACACGATCAAGAGACTGCAGCTTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCACCGATGGTGTGGTAGAATACCTCGACGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTT-GGGGGCGACCCTGCCGTTCATTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAATT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGCT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------TCCAGG-----CAGAAGT-------AT--ACA------TTCTACA-AACCAGCTGACTCC-AACACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATC-----ACACCCATCCTCC---------------------TAACTCGAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAT-TC-------CA------GCTATGGC-ATT---------GATGTCGGA---------------------------AGAGCAT----GAGCTGACCAG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGTGCAT-------------------------------------------ACCCGAGA---TATGG--------CT-ACTGTACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAAGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGTGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCTATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGG-ACTCATT-CCCA-TA-------------------ATA-ACATCATTGC------CG--CGC-GCCT------TCA------AAAAAA--------------T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CAGCA-ATCCACAC------ATTC----ACACGC---------------------------------------------------------------------------------CGCTC-CCATATC-------------CAAC-TACACCAGCGCTAACGA-CC-TCTCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_lethalis_CBS_141113 GCCTCCACACTCTCGCATTTGCGGAGAACAAACACTCCTATCGGACGAGACGGTAAGATTGCTAAGCCGAGACAACTTCACAACACCCATTGGGGGTTAGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTGTCTCTAATGTGCTATGTCACGGTCGGAACACCCGGTGAGCCCCTCACAGACTTCATGCGACAGCGCGGTATGGACCTTCTCGAGGAATACGACCCCGTGTTGGAACCAAAGTCGACCAAGGTCTTCATCAACGGAACCTGGGTCGGGGTGCACAAGAACGCCGGAGCCCTCACCGAGACCCTACGAGGCCTGAGAAGAAAAGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGTGAAATCCGAGTCTTCACCGACGCGGGACGTGTCTGCCGTCCCCTCTTCGTGGTCGACAACGCGCGGGATGCCGTGGAGCGCGGGAGTTTGGTGCTCAAACAGGATCAAATCACTAAACTTCACCAAGATCAAGAAGCTGCGGCATCACTTGGTGGCG---TCAGCGAAGAGGATCGACTGGAGCATACATATGGCTGGCCTGGTCTGGTCAAGGATGGTGTTGTCGAATACCTCGATGCCGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTTCGGGGGC-AATCCCAGTCCCGAAACTCCCACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCT--CGCGGCACTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATATAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----CATCC-------CTACAA----ACACTGC-------GC--ACA------GCGGGCA-CCCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCACCTC-----CACCCTCCCCACC---------------------TCACGCGAT-GACA-GT-----TCTGACAAGAACGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGAC-CA-------CC------AGATGCAG-ATG---------AGAATGAGGATGAGAAT-----------------GGACGGCAC----ATGCTGA-CAT-GGACACCA-----CCATAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCCTTCATTGAGCCCACCTACGCAGTACGCATCAAT--------------------------------------------ACATTCAT--GGCCAG--------CT-TCAATGCCC---TCACTAATTACCTC---CCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAGCATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCGCCTTCCGCCGACGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACGTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGC-CTCCCTC-GCGC----------------------AGC-ACTTCACTTC------CT--TGCAGCAC------TG-------CAAAAA----TCG--T-TA-T---CACCCCTCGC--------CTGGTGGGG----------------------TGGT-----------TG-AGA---TTTTCGCTTGGCAT------GATGACCTCACC-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACG-CCAG-----CTTCA-CTTCACTT------GTTC-----C--------------------------------------------------------------------------------------------------------------------TGGAATAACGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_ligustrina_CBS_379.52__ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGAAAGATTGCAAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTTTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTCATGCGACAGCGTGGAATGGATCTTCTCGAAGAATACGACCCTGTCCTGGAACCAAAGTCGACCAAGGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGTTCGCTCACCGACACTTTGCGAACCTTGCGGAGAAAGGGTCTTCTCTCCTTTGAGGTCACCATCATTCGCGATGTTCGAGAACGTGAGATTCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGTTATTCGTCGTCGACAACAAGCTCGATGCCGTTGAGCGTGGCAGTCTTGTGCTCAAACAAGAGCAGGTGGCAAAACTTCATAGTGATCAAGAGATCAAGGCGTCTCTAGCCGGCA---TCAGTGAAGAAGATCGCGCACAGCACACATACGGTTGGATGGGCTTGGTCAACGAGGGTGTCGTGGAGTACCTCGATGCCGAAGAGGAGGAGACAGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCTCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTTT-------CCACTC----ACATGTG-------GC--CCA------GCGTGCA-CGCCAGCTGACCCT-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAACACC-----CGACCCATCCTCA--------------------------CAACTGGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG????????GCAATGCGTGAGTGAT-TT-------CA------AGAGCAGC-TTCA---GTACAAGCAGAG---------------------------ATGGACAGT----GAGCTGA-CAG-ACACCT--------CACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTTGTG--------------------------------------------TTAGAGGT---TTCG---------CT-CCGCAGCAC---CATCTAACGCGAGA--TTCTAGGCATACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCAGCTGCCATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCTACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-TACCCAC-TTCACTCA------------------CTG-CCTTCACCGT------CG--CGC--------------------GAGAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TCTG-AGA---TTTTCGCTTGGCAT------CATGACCTCACA-C-----CACTTAA---AATGCCTCGCTG-GCCGC----------AACA-CTAG-----CACCC-CTCCACTG------CTTC----ACATGT---------------------------------------------------------------------------------CGCTC-AGACCTT--------ACACCGCTG-GGAATTATCACTGACAA-TG-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTGGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_major_CBS_141114 GCTTCCACACTCTCGCATTTGAGGAGAACAAACACGCCTATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTAGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCGTGCGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTCTCAGTTGGAACACCAGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTTTTCATTAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAAACCTTGCGATCGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATTATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTCGTTCGGAATCAGGTTGAAAAGCTCCAACACGATCAAGAGACCGCAGCGTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCATATCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCGATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGTTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAGG-----CAGAAGT-------CT--ACA------CTGTACA-TATCAGCTGACTTT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACGTC-----CCACCTATCCTCC---------------------TCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGGAGC-ATT---------GGGATGGATGGATGGA---------------ATGGGAGAGGAT----AAGCTGA-CAG-GATACC------TTCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCTGTATGTTCATCA--------------------------------------------CCACAAAA---GATGG--------CT-ATACAACAC-CACCTCTAACATTACT---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGGCCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCTGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACTTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTGAAT-CCCA-TC-------------------ACA-TCATCACTGT------CG--CGC-GCCT------CGA------CAAAAA----TTG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGC------CATGACCTCACC-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----AAGCA-ATCCACCT------ATCC----ACAAGC---------------------------------------------------------------------------------CGCTT-CGCTATT--------------TGC-CACAACAATGCTGACAA-CC-TCACCC--ATAGGAAGCCGCGGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_major_CPC_12543_ GCTTCCACACTCTCGCATTTGAGGAGAACAAACACGCCTATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTAGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCGTGCGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTCTCAGTTGGAACACCAGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTTTTCATTAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAAACCTTGCGATCGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATTATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTCGTTCGGAATCAGGTTGAAAAGCTCCAACACGATCAAGAGACCGCAGCGTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCATATCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCGATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGTTCGGCATT-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTCTGTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAGG-----CAGAAGT-------CT--ACA------CTGTACA-TATCAGCTGACTTT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACGTC-----CCACCTATCCTCC---------------------TCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGGAGC-ATT---------GGGATGGATGGATGGA---------------ATGGGAGAGGAT----AAGCTGA-CAG-GATACC------TTCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCTGTATGTTCATCA--------------------------------------------CCACAAAA---GATGG--------CT-ATACAACAC-CACCTCTAACATTACT---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGGCCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCTGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACTTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTGAAT-CCCA-TC-------------------ACA-TCATCACTGT------CG--CGC-GCCT------CGA------CAAAAA----TTG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGC------CATGACCTCACC-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----AAGCA-ATCCACCT------ATCC----ACAAGC---------------------------------------------------------------------------------CGCTT-CGCTATT--------------TGC-CACAACAATGCTGACAA-CC-TCACCC--ATAGGAAGCCGCGGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_major_CPC_12544_ GCTTCCACACTCTCGCATTTGAGGAGAACAAACACGCCTATCGGGCGTGATGGCAAGATCGCCAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTAGTGTGTCCGGCAGAAACGCCAGAAGGACAGGCGTGCGGTCTGGTGAAGAATTTGTCGTTGATGTGCTACGTCTCAGTTGGAACACCAGGCGAGCCACTTACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTACGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTTTTCATTAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACCGAAACCTTGCGATCGCTACGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATTATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTCGTTCGGAATCAGGTTGAAAAGCTCCAACACGATCAAGAGACCGCAGCGTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCATATCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTGGACGCAGAAGAGGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCAGG-----CAGAAGT-------CT--ACA------CTGTACA-TATCAGCTGACTTT-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAACGTC-----CCACCTATCCTCC---------------------TCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATTATGATCGGTATGGG?????TCCGCAATGCGTAAGTCAC-TT-------CA------GCTGGAGC-ATT---------GGGATGGATGGATGGA---------------ATGGGAGAGGAT----AAGCTGA-CAG-GATACC------TTCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCTGTATGTTCATCA--------------------------------------------CCACAAAA---GATGG--------CT-ATACAACAC-CACCTCTAACATTACT---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGGCCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCTGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACTTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACTGAAT-CCCA-TC-------------------ACA-TCATCACTGT------CG--CGC-GCCT------CGA------CAAAAA----TTG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGC------CATGACCTCACC-T-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----AAGCA-ATCCACCT------ATCC----ACAAGC---------------------------------------------------------------------------------CGCTT-CGCTATT--------------TGC-CACAACAATGCTGACAA-CC-TCACCC--ATAGGAAGCCGCGGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_mali_CBS_129581__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTCCACAATACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTGACGGACTTTATGCGACAACGTGGTATGGATCTTCTGGAAGAGTACGACCCTGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAGAACGCTGGCCAGCTCACCGAGACTTTGCGATCACTACGGAGGAAGGGCTTGCTAAGTTTTGAGGTCACTATCATTCGTGACGTGAGAGAACGCGAGATTCGAGTGTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTGGTCGACAATAAGCCAGACGCGGTTGAGCGCGGCAGTCTCGTGCTAAGGCGGGATCAAGTCGAGAAGCTTCAAGCCGATCAAGAGACTGCGGCGTCCCTCCGCGGTA---TAAGCGAAGAGGATAGAGCAGAGCACACCTATGGCTGGATGGGCTTGGTCAATGAGGGTGTGGTCGAATATCTCGACGCAGAAGAAGAAGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCATG-----AC-ATTC-------AC--CCT------CCAAGACCCTCCAGCTGACTCC-ATCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCGTCCTCC------------------TCCCCAATCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CA------ATATGAGA-------------GATGTGAG----------------------------GAAACAA----TAGCTGA-CAG-GACACC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGTGA--------------------------------------------AGCCATGA--TTGGGA--------TT-TACAATGCC---ATACTGATTGCACA--ACACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCTATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-AGACACC-TTCACT----TCACTC--------CATCA-TCATCACCGC------CT--CGC-GCGTC-ACACTGCC----AAAAAAA----TCG-CT-TA-T---CACCCCTCG---------CTGGTGGGC----------------------TGGT-GGGGG---GATG-AGA---TTTTTTCTTGGCATTCGGGGCATGACCTCACT-T-----GAGG-AA---AATGCCTCGCTG-GCCAC----------AACA-TCAG-----CATCA-CCCCACTC------AATC----ACCAGC---------------------------------------------------------------------------------CGCCG-TATTGAA-----------ATCTAG-CAAACACATACTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_malicola_CBS_119227__ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTAATGAGTGAGGGGG---CCACAAACCCCCAACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTG-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--ACGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCGTCCG-CGCTCGC-------------------CTC-ACTCCACTGT------CT--GGC-GCTC------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTTGCTTGGCAC------CATGACCTCACA-C-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCA-TGCCGAAC------ACGC-------------------------------------------------------------------------------------------AAAAT-AATTGCG-----------AGATGA-GACAACATTGCTGACTGG---TTTGTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_miae_CBS_120121 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAGAACGCTGGCCAACTAACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTGAGAAGAGATCAAGTCGAGAAGCTTCAACACGATCAAGAGACTGCGGCATCTCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTACGGCTGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----AT-ACCC-------AC--CCT------TCAAGCC-CTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATCAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAAAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CT------ATATCAGG-GTT---------GGCAAGGG----------------------------GAAAGAT----TGGCTGA-CAG-GATACC-------TTCTAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACTTACGCTGTACGCCAATCT--------------------------------------------ATTCA-GC---CTTGC--------CC-TTCAATTCC---CCACTGACATCAACC-CTCCAGGCCTATATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTTGTTATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCAAAA----AACT-----------CCA-TCATCCTCGC------CG--CGC-GGAC----ACTGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCGTTCGAGGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCGC----------AACA-TCAG-----CAGCG-CTTCACTC------TTTC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_miae_CPC_19770_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAGAACGCTGGCCAACTAACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTGAGAAGAGATCAAGTCGAGAAGCTTCAACACGATCAAGAGACTGCGGCATCTCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTACGGCTGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCCTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----AT-ACCC-------AC--CCT------TCAAGCC-CTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATCAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAAAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CT------ATATCAGG-GTT---------GGCAAGGG----------------------------GAAAGAT----TGGCTGA-CAG-GATACC-------TTCTAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACTTACGCTGTACGCCAATCT--------------------------------------------ATTCA-GC---CTTGC--------CC-TTCAATTCC---CCACTGACATCAACC-CTCAAGGCCTATATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTTGTTATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCAAAA----AACT-----------CCA-TCATCCTCGC------CG--CGC-GGAC----ACTGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCGTTCGAGGGATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCGC----------AACA-TCAG-----CAGCG-CTTCACTC------TTTC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_miae_CPC_19835_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAGAACGCTGGCCAACTAACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTGAGAAGAGATCAAGTCGAGAAGCTTCAACACGATCAAGAGACTGCGGCATCTCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTACGGCTGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCCTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----AT-ACCC-------AC--CCT------TCAAGCC-CTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATCAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAAAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CT------ATATCAGG-GTT---------GGCAAGGGA---------------------------GAAAGAT----TGGCTGA-CAG-GATACC-------TTCTAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACTTACGCTGTACGCCAATCT--------------------------------------------ATTCA-GC---CTTGC--------CC-TTCAATTCC---CCACTGACATCAACC-CTCCAGGCCTATATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTTGTTATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCAAAA----AACT-----------CCA-TCATCCTCGC------CG--CGC-GGAC----ACTGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCGTTCGAGGGATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCGC----------AACA-TCAG-----CAGCG-CTTCACTC------TTTC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_miae_CPC_21692_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACGCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCTCTGATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTCTTGGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTTCACAAGAACGCTGGCCAACTAACCGAGACTTTGCGATCACTGCGGCGGAAGGGCTTGCTCAGCTTTGAGGTGACCATCATTCGAGATGTCAGAGAGCGTGAGATTCGAGTATTCACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCAGACTCGGTCGAACGTGGCAGCCTCGTGCTGAGAAGAGATCAAGTCGAGAAGCTTCAACACGATCAAGAGACTGCGGCATCTCTTCGAGGCA---TCAGCGAAGAGGACAGAGCAGAGCACACCTACGGCTGGATGGGTCTGGTCAATGAGGGCGTGGTCGAATACCTCGACGCAGAAGAAGAAGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTT-GGGGGCGACCCTGCCGTTC-CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----AT-ACCC-------AC--CCT------TCAAGCC-CTTCAGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATCAA-----CACCCCATCCTCC---------------------ACACTACAT-GGCA-AT-----TCTGACAAAAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-TT-------CT------ATATCAGG-GTT---------GGCAAGGG----------------------------GAAAGAT----TGGCTGA-CAG-GATACC-------TTCTAGCGTCGAGCACGGCGACGTCACCGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACTTACGCTGTACGCCAATCT--------------------------------------------ATTCA-GC---CTTGC--------CC-TTCAATTCC---CCACTGACATCAACC-CTCCAGGCCTATATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCAGCTTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTTGTTATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-CTCAAAA----AACT-----------CCA-TCATCCTCGC------CG--CGC-GGAC----ACTGC------AAAAAT----CTG-CT-TA-T---CACCCCT-----------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTCCTCTTGGCGTTCGAGGCATGACCTCACC-G-----CAAC-AA---AATGCCTCGCTG-GCCGC----------AACA-TCAG-----CAGCG-CTTCACTC------TTTC----ACACGC---------------------------------------------------------------------------------CGCTT-CAATCAC-------------CCTC-AAGTACAATGCTAACGA-CC-TCATCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_neodeusta_CBS_141115 GCCTCCACACTCTCACATTTGAGGAGGACAAACACACCAATCGGGCGTGATGGCAAGATCGCGAAGCCGAGACAACTTCACAACACACATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCGGTTGGAACACCGGGCGAGCCTCTGACGGATTTTATGCGACAGCGTGGCATGGATCTTCTCGAAGAGTATGACCCCGTCTTGGAGCCCAAATCGACCAAGGTTTTCATCAATGGTACATGGGTGGGTGTGCACAAGAATGCCGGCCAGCTCACAGAGACATTACGATCACTTCGAAGGAAAGGATTGCTGAGTTTCGAGGTGACCATCATTCGTGATGTGAGAGAACGTGAGATTCGTGTCTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTTGACAACAAGCCTGACTCTGCTGAGCGCGGCAGCCTTGTGCTGTTGCGCAATCAGGTCGAAAAGCTCCAACACGATCAAGAGACCGCAGCATCCCTCCGAGGCA---TAAGCGAAGAGGATAGAGCGGAGCACACCTACGGATGGATGGGCTTGGTCAACGATGGCGTGGTAGAATACCTCGATGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGGA--GACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCTCCCCGCGCTGTGTTTCGTGAG-----TGTCT------CCCAATGAGCAGCGCACC--------------------AGAAACC-TACCATCTGACTTT-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCACGGGT-ATGCACCATC-----CCACCCATTCTCT---------------------CCATTCAAT-GGCA-AT-----TCTAACAACAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTTAC-TT-------CA------GATACAGC-GTC---------GGTATGAGGC--------------------------AAGGAAG----AAGCTGA-CAG-GATACC-------CCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGATCA--------------------------------------------ATCCATACA-GAATAG--------GG-CTCCGTTCC---CCTTTAACATTCCT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACTGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGACGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATTCCTGTCATCT?????GAGAAGGTAAGA-TTTCACT-CCTA-TC-------------------ACT-ACATCGCTGT------CG--CGC-GCCT------CGC------AAAATA----TCA-CT-TA-T---CACCCCTCGCT-------TTGGTGGGT----------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------TATGACCTCACT-TTAA--CAAC-AA---AATGTCTCGCTG-GCCAC----------AATA-TCAG-----CAGCA-CTCCAACT------CTACCTATGCATGC---------------------------------------------------------------------------------TGCTC-AACAAACTTCTCAACAAACTTCCT-GAAAATAATGCTGACGA-CA-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCTAA Ramularia_neodeusta_CPC_13568_ GCCTCCACACTCTCACATTTGAGGAGGACAAACACACCAATCGGGCGTGATGGCAAGATCGCGAAGCCGAGACAACTTCACAACACACATTGGGGTCTCGTGTGTCCGGCAGAAACGCCGGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTATGTTTCGGTTGGAACACCGGGCGAGCCTCTGACGGATTTTATGCGACAGCGTGGCATGGATCTTCTCGAAGAGTATGACCCCGTCTTGGAGCCCAAATCGACCAAGGTTTTCATCAATGGTACATGGGTGGGTGTGCACAAGAATGCCGGCCAGCTCACAGAGACATTACGATCACTTCGAAGGAAAGGATTGCTGAGTTTCGAGGTGACCATCATTCGTGATGTGAGAGAACGTGAGATTCGTGTCTTTACTGATGCTGGACGTGTCTGCCGGCCGCTGTTCGTGGTTGACAACAAGCCTGACTCTGCTGAGCGCGGCAGCCTTGTGCTGTTGCGCAATCAGGTCGAAAAGCTCCAACACGATCAAGAGACCGCAGCATCCCTCCGAGGCA---TAAGCGAAGAGGATAGAGCGGAGCACACCTACGGATGGATGGGCTTGGTCAACGATGGCGTGGTAGAATACCTCGATGCAGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGAATCTCGTTGCTTC-GGGGGCGACCCTGCCGGA--GACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCTCCCCGCGCTGTGTTTCGTGAG-----TGTCT------CCCAATGAGCAGCGCACC--------------------AGAAACC-TACCATCTGACTTT-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCACGGGT-ATGCACCATC-----CCACCCATTCTCT---------------------CCATTCAAT-GGCA-AT-----TCTAACAACAGCGCAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTTAC-TT-------CA------GATACAGC-GTC---------GGTATGAGGC--------------------------AAGGAAG----AAGCTGA-CAG-GATACC-------CCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCGATCA--------------------------------------------ATCCATACA-GAATAG--------GG-CTCCGTTCC---CCTTTAACATTCCT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGCCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACTGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCTGCCGACGCTCCCATGTTTGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATTCCTGTCATCT?????GAGAAGGTAAGA-TTTCACT-CCTA-TC-------------------ACT-ACATCGCTGT------CG--CGC-GCCT------CGC------AAAATA----TCA-CT-TA-T---CACCCCTCGCT-------TTGGTGGGT----------------------TGGT-GGGGG---TTTG-AGA--TTTTCGGCTTGGCGT------TATGACCTCACT-TTAA--CAAC-AA---AATGTCTCGCTG-GCCAC----------AATA-TCAG-----CAGCA-CTCCAACT------CTACCTATGCATGC---------------------------------------------------------------------------------TGCTC-AACAAACTTCTCAACAAACTTCCT-GAAAATAATGCTGACGA-CA-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCTAA Ramularia_nyssicola_CBS_127664__ GCCTCCACGCTTTCCCATCTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCAAAGCCAAGACAACTCCACAACACCCACTGGGGACTTGTATGCCCGGCAGAAACGCCCGAAGGCCAAGCTTGTGGACTGGTGAAGAATCTGTCTCTAATGTGTTACGTTACCGTCGGAACGCCTGGCGAACCACTAACAGAGTTCATGCGACAGCGCGGCTTGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGGCGACCAAGGTATTCATCAACGGTACCTGGGTCGGTGTGCACAAAAATGCAGGTCAGCTTACAGAGACATTGCGCCATCTACGGAGAAAGGGCCTGCTCAGCTTTGAGGTCACCATCATTCGTGATGTTCGTGAGCGCGAAATCCGAGTATTCACCGACGCTGGACGTGTCTGCAGACCTCTGTTCGTGGTCGACAACAAGCCCGATTCCGCTGACCGGGGCAGTCTGGTCCTGAAGCAAGACCAAATCGCGAAACTCCAAAATGATGCGGAGATCGCGGCAACGCTCGTGGGTG---TCAGCGAGGAAGACAGAGCTGAGCACACCTATGGCTGGATGGGCTTGGTCAACGAGGGTGTTGTTGAATATCTTGATGCAGAAGAGGAAGAAACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGCGGGGGTTAGTTGTTCCCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCATT--CGTGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCAGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TAGCA-------TCAGAAAC--ACATGGC------TGCTACGAT-------------CGCCGGCTGACTTTTAACACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC------------CGCACG---------------TTAATATCACTCGAT-GGCA-AT-----TCTGACGAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGG-CT------CCA------GTTATGGT-AGA---------AATATGAAGAGGGAAATGGTTAGAATGGGCGGAAACAGGACAC----AGGCTGA-TAT-CAACACA------ATATAGCGTTGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCCTTCATCGAGCCTCACTACGCGGTATGCAGCATT--------------------------------------------GGATTGAC---TGAGA--------TC-ATCAGAGCT---ATTCTAACATATGT----CTAGGCCTACATGCTCAAGTACGACTCGACCCACGGTGTCTTCAACGGCACCATCGAGGTGGACGGCGACAATGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGCGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCGCCCA-GCC-----------------------ATG-ACTTCACTGC------CG--CGC-----------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTG--TTTG-AGA---TTTTTGCTTGGCACT-----CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-TCTTC----------AACG-TCCG-----CAGCA-CTCCATCC-------CGC----ACATGT---------------------------------------------------------------------------------AGCTC-GTGTTTC------------------TACAACAATGCTGACCA-CT-TCACTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATTGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_nyssicola_CBS_127665__ GCCTCCACGCTTTCCCATCTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCAAAGCCAAGACAACTCCACAATACCCATTGGGGACTTGTATGCCCAGCAGAAACGCCCGAAGGCCAAGCTTGTGGACTGGTGAAGAATCTGTCTCTAATGTGTTATGTTACCGTCGGAACGCCTGGCGAACCACTGACAGAGTTCATGCGACAGCGCGGTTTGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGGCGACAAAGGTATTCATCAATGGTACTTGGGTCGGTGTTCACAAGAATGCCGGCCAGCTCACGGAGACCTTACGCCATCTACGGAGAAAAGGTCTGCTCAGCTTCGAGGTCACCATCATTCGTGATGTTCGTGAGCGCGAAATCCGAGTATTCACCGACGCTGGACGTGTCTGCAGACCGCTATTCGTGGTCGACAACAAGCCAGATTCGGCTGATCGAGGCAGTCTGGTCCTGAAGCAGGACCAAATCGCGAAACTCCAAAATGATGCGGAGATCGCGGCAACGCTCGTGGGTG---TCAGCGAGGAGGACAGAGCGGAGCACACCTATGGCTGGATGGGCTTGGTCAACGAGGGTGTTGTTGAATATCTCGATGCGGAAGAGGAAGAAACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGCGGGGGTTAGTTGTTCCCCCG-ACCTCCAACCCTTTGTGAACATATCTTGTTGCTTC-GGGGGCGACCCTGCCATT--CGTGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCAGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TAGCA-------TTAGAAAC--ACATGGC------CGCTACGAT-------------CGCCGGCTGACTTTTAACACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC------------CGCACG---------------TTAATATCACTCGAT-GGCA-AT-----TCTGACGAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGG-CT------CCA------GATATGGT-AGA---------GGCATGAAGAGGGAAATGGTTAGAATGGGCGGAAACAAGACAC----AGGCTGA-TAT-CTACACA------ATATAGCGTTGAGCACGGCGACGTCACTGTTGTGGCTGTCAACGACCCCTTCATTGAGCCTCACTACGCGGTATGCAGCATT--------------------------------------------GGGTTGAC---TGAGA--------TC-ATAAAAGCT---ATTCTGACACGTGT----CTAGGCCTACATGCTCAAGTACGACTCGACCCACGGCGTCTTCAACGGCACCATCGAGGTCGACGGCGACAATGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCATTTGAAGGGCGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCGCCCA-GCC-----------------------ATG-ACTTCACTGC------CG--CGC-----------TG-------CAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTG--TTTG-AGA---TTTTTGCTTGGCACT-----CATGACCTCACA-C-----CACC-AA---AATGCCTTGCTG-GCTTC----------AACG-CCCG-----CAGCA-CTCCATCC-------CGC----ACATGT---------------------------------------------------------------------------------AGCTC-GTGTTTC------------------TACAACAATGCTGACCA-CT-TTACTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATTGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_osterici_CBS_141116 GCCTCCACACTATCCCATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTATGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTGTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACTGAAACACTGCGTTCGCTGCGAAGAAAAGGCCTGCTCAGTTTTGAAGTCACCATCATTCGTGATGTGAGAGAGCGCGAAATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGCCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCACAGTGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAGGATAGGGCGGAGCATACCTACGGCTGGATGGGATTGGTCAACGACGGTGTGGTGGAGTACCTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCAA----TATGTGCC-CATCAGCTGAC-CC-ATCACAGCATCCATTGTTGGCCGACCGCGTCACCATGGGT-ATGCCCCTTC-----CCACCCATCCTCT---------------------CCACGCAAT-GGCA-AC-----TCTGACAAAAATGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GAGGGGTGGG--------------------------AATCAGA----GAGCTGA-CAA-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCTAAATA--------------------------------------------GGACA--A---GACAG--------AA-ATGATTTTC---TCACTAACAACACC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACTGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATCCCCGTTATCT?????GAGAAGGTAAGC-AATCCCC-AGTACAC-------------------TCC-CCATCACTGT------CC--CGC-GCCT------T-------ACAAAAA----TTGCTT-CA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTCATTCTTGGCAT------CATGACCTCACT-T-----CACCCAA---AAAGCTTCGCTG-GCCAC----------AACA-CCAG-----CCTCA-CTCAACTC------CTCC----ACTTAC---------------------------------------------------------------------------------CGCGTCGAACATC--------------TTC-CACAA-AAAGCTGACGA-CC-TCCCTC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_osterici_CPC_10751_ GCCTCCACACTATCCCATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTATGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTGTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACTGAAACACTGCGTTCGCTGCGAAGAAAAGGCCTGCTCAGTTTTGAAGTCACCATCATTCGTGATGTGAGAGAGCGCGAAATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGCCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCACAGTGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAGGATAGGGCGGAGCATACCTACGGCTGGATGGGATTGGTCAACGACGGTGTGGTGGAGTACCTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCAA----TATGTGCC-CATCAGCTGAC-CC-ATCACAGCATCCATTGTTGGCCGACCGCGTCACCATGGGT-ATGCCCCTTC-----CCACCCATCCTCT---------------------CCACGCAAT-GGCA-AC-----TCTGACAAAAATGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GAGGGGTGGG--------------------------AATCAGA----GAGCTGA-CAA-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCTAAATA--------------------------------------------GGACA--A---GACAG--------AA-ATGATTTTC---TCACTAACAACACC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACTGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATCCCCGTTATCT?????GAGAAGGTAAGC-AATCCCC-AGTACAC-------------------TCC-CCATCACTGT------CC--CGC-GCCT------T-------ACAAAAA----TTGCTT-CA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTCATTCTTGGCAT------CATGACCTCACT-T-----CACCCAA---AAAGCTTCGCTG-GCCAC----------AACA-CCAG-----CCTCA-CTCAACTC------CTCC----ACTTAC---------------------------------------------------------------------------------CGCGTCGAACATC--------------TTC-CACAA-AAAGCTGACGA-CC-TCCCTC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_osterici_CPC_10752_ GCCTCCACACTATCCCATTTGAGGAGAACGAACACACCTATCGGCCGTGATGGAAAGATCGCCAAGCCAAGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCATTGATGTGCTATGTCTCGGTTGGAACACCCGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAGGAATACGACCCTGTTCTGGAGCCCAAGTCAACCAAGGTGTTTATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGTCAGCTTACTGAAACACTGCGTTCGCTGCGAAGAAAAGGCCTGCTCAGTTTTGAAGTCACCATCATTCGTGATGTGAGAGAGCGCGAAATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGGCCGCTTTTCGTTGTCGACAACAAGCCCGACTCCGCTGAGCGTGGCAGCCTCGTACTGAAGCAGGATCAGGTCGCCAAACTCCACAGTGACCAAGAGGCCGCAGCATCGCTCCGAGGCG---TGAGTGAAGAGGATAGGGCGGAGCATACCTACGGCTGGATGGGATTGGTCAACGACGGTGTGGTGGAGTACCTGGACGCAGAAGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGCAAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGACC-------CCAGA-----TAACAGC-------TT--CCAA----TATGTGCC-CATCAGCTGAC-CC-ATCACAGCATCCATTGTTGGCCGACCGCGTCACCATGGGT-ATGCCCCTTC-----CCACCCATCCTCT---------------------CCACGCAAT-GGCA-AC-----TCTGACAAAAATGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CA------GCTTCAGC-ATT---------GAGGGGTGGG--------------------------AATCAGA----GAGCTGA-CAA-TCTACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGCTAAATA--------------------------------------------GGACA--A---GACAG--------AA-ATGATTTTC---TCACTAACAACACC----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACTGAGCGTGACCCCGCCAACATCCCATGGGCTGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATCCCCGTTATCT?????GAGAAGGTAAGC-AATCCCC-AGTACAC-------------------TCC-CCATCACTGT------CC--CGC-GCCT------T-------ACAAAAA----TTGCTT-CA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTCATTCTTGGCAT------CATGACCTCACT-T-----CACCCAA---AAAGCTTCGCTG-GCCAC----------AACA-CCAG-----CCTCA-CTCAACTC------CTCC----ACTTAC---------------------------------------------------------------------------------CGCGTCGAACATC--------------TTC-CACAA-AAAGCTGACGA-CC-TCCCTC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_parietariae_CBS_123730__ GCATCCACGCTCTCCCATTTGCGGAGAACCAACACTCCTATTGGTCGTGATGGTAAAATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCCGAAACGCCCGAGGGACAGGCTTGTGGGCTGGTGAAAAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACGGATGCTGGACGTGTCTGCCGGCCACTGTTCGTGGTCGATAATAAGCCTGACTCTGCCGAGCGCGGCAGTCTCGTGCTAAGACGGGACCAGGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTGCGAGGGG---TCAGCGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGCGTTGTGGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCCTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGGA--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CTA------GCGTTTC-CGCCAGCTGACACT-GTCCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGACACC-----CCTCCAATCCCCA---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGGGTGAGTTTG-AT-------CA------AGCGCAGC-TTC---------AGTATAG---------------------------GTGGAATGC----GAGCTGA-CAT-GGATATA------ATACAGCGTTGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTCC--------------------------------------------CAAGAAGA---GTCGC--------AT-GCGGAAAAC---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGTCTGATCGTCAACGGAAAGAAGGTCCGCTTCCACACTGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACCTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTT-----------------------ACC-CCATCACCGT------CG--CAC-GTTG------CGC-------AAAAA----CTC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGATTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CTCC-AA---AATGCC-CGCTG-GCCAC----------AA------------CACCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATTCTC-------------TCCG-AGAGACATCACTGACAA-TGTTTTTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_parietariae_CBS_123731__ GCATCCACGCTCTCCCATTTGCGGAGAACCAACACTCCTATTGGTCGTGATGGTAAAATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCCGAAACGCCCGAGGGACAGGCTTGTGGGCTGGTGAAAAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTGACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACGGATGCTGGACGTGTCTGCCGGCCACTGTTCGTGGTCGATAATAAGCCTGACTCTGCCGAGCGCGGCAGTCTCGTGCTAAGACGGGACCAGGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTGCGAGGGG---TCAGCGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGCGTTGTGGAGTATCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCCTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGGA--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GC--CTA------GCGTTTC-CGCCAGCTGACACT-GTCCCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGACACC-----CCTCCAATCCCCA---------------------TCACCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTTTG-AT-------CA------AGCGCAGC-TTC---------AGTATAG---------------------------GTGGAATGC----GAGCTGA-CAT-GGATATA------ATACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTCC--------------------------------------------CAAGAAGA---GTCGC--------AT-GCGGAAAAC---CATCTAACTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGTCTGATCGTCAACGGAAAGAAGGTCCGCTTCCACACTGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACCTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTT-----------------------ACC-CCATCACCGT------CG--CAC-GTTG------CGC-------AAAAA----CTC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGATTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CTCC-AA---AATGCC-CGCTG-GCCAC----------AA------------CACCA-CTCCACCT------CATC----ACATGC---------------------------------------------------------------------------------CGCTC-AATTCTC-------------TCCG-AGAGACATCACTGACAA-TGTTTTTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA 'Ramularia phacae-frigidae CBS 234.55 ' GCCTCCACACTCTCCCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGAAAGATTGCCAAGCCGAGACAACTCCACAATACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAACGTGGTATGGATCTTCTTGAAGAGTACGATCCTGTCCTGGAGCCCAAGTCCACCAAGGTGTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAACGCTGGTGCACTCACTGAGACCTTGCGATCACTGCGGAGAAAGGGCCTCCTCAGCTTCGAGGTCACCATCATTCGTGATGTGCGAGAACGCGAGATCCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTGGTCGACAACAACACCAATTCTGCCGAGCGTGGCAGTCTTGTGCTGAGACGGGACCAGGTTGAGAGACTCCAAAGCGATCAGGAGGCTGCGGCATCGTTACGAGGAATCCTCAGTGAAGATGAGAAAGCAGGAAAAACCTACGGCTGGATGGGTCTGGTCAATGAGGGTGTTGTCGAGTACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGATT---ATAGTACATCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTACGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGT--TCGGC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATACTGT-------GT--CTA------GCGGGCC-CGCCAGCTGACTTC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGAATTACC-----TCACCTATCCCCA---------------------ATCCCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG????????????TGCGTGAGTAGA-CT-------CA------AGAGCAGC-ATC---------AACATGG---------------------------ACGGAATAT----GAGCTGA-CAT-GGATAC--------CCCAGCGTCGAGCACGGCGACGTCAACGTTGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCTTTTC--------------------------------------------CAGAAAGA---GGCGC--------TC-TCAACACAC---CCACTAACACGACA--ATCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAGCATCCCGTGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCTAAGAAGGTCGTCATCTCTGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-CTC-----------------------ACT-CCGTCACCGT------CG--CGC-GCCC------GGC------GAAAAA--TCTCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CAGC-AA---AATGCCTCGCTG-GCCAC----------AACG-GCAG-----CATCA-CTGCACAT------CTTC----ACATGC---------------------------------------------------------------------------------CGCTC-GATCACT-------------ACCC-GAGAAAATTACTGACAA-TG-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_plurivora__CPC_16123_ GCCTCCACACTTTCCCATTTGCGGAGAACGAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTAGGAACACCGGGCGAGCCACTGACAGATTTTATGCGACAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCTAAATCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAACGCTGGTCAGCTCACTGAGACCTTGCGGTCACTGCGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGACCGCTTTTCGTCGTCGACAACAAGCCTGATTCTGCTGAGCGTGGTAGTCTTGTATTGCGGCAAGACCAAGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAAGAAGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCT------CCCACG-----ATCGGCC-------AC--CCA------GCAGGAC-CGCAAGCTGACTCT-ATCTTAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCTCCC---------------------ACACTCGTT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CT------CCATTAGC-ATT---------GGCAGGA-----------------------------GGAAAAT----GAGCTGA-CTG-GATACC-------TTACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCTG--------------------------------------------ACTGA--A---AGCTT--------CA-ATTGATTCA---ATACTGACACAAACA-TCCAAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-ATTCCCC-TCACCAC----AA-------------CAT-CCATCACCGCGC----CG--CGC-GCCTC-----TG-------CAAAAA----TCA-CT-TA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCTCTTGGCACTTGAGACATGACCTCACC-G-----CATC-AA---AATGCCTCGTTG-GCAACAT--------CACA-CCAG-----CATCA-CTTTACTA------CGCC----GCATGT---------------------------------------------------------------------------------CACAG-AAATATG--------------TGT-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_plurivora__CPC_16124_ GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTAGGAACACCGGGCGAGCCACTGACAGATTTTATGCGACAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCTAAATCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAACGCTGGTCAGCTCACTGAGACCTTGCGGTCACTGCGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGACCGCTTTTCGTTGTCGACAACAAGCCTGATTCTGCTGAGCGTGGTAGTCTTGTATTGCGGCAAGACCAAGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAAGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCT------CCCACG-----ATCGGCC-------AC--CCA------GCAGGAC-CGCAAGCTGACTCT-ATCTTAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCTCCC---------------------ACACTCGTT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CT------ACATCAGC-ATT---------GGCAGGA-----------------------------GGAAAAT----GAGCTGA-CAG-GATACC-------TTACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCTC--------------------------------------------ATTGC--A---AGCTG--------CA-ATTGATTCA---CTACTGACACAAAAA-TCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ATTCCCC-TCACCAC----AA-------------CAT-CCATCACCGCGC----CG--CGC-GCCTC-----TG-------CAAAAA----TCA-CT-TA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCTCTTGGCACTTGAGACATGACCTCACC-G-----CATC-AA---AATGCCTCGTTG-GCAACAT--------CACA-CCAG-----CATCA-CTTTACTA------CGCC----GCATGT---------------------------------------------------------------------------------C{AG}CAG-AAATATG--------------TGT-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_plurivora_CBS_118693 GCCTCCACACTTTCCCATTTGCGGAGAACAAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTAGGAACACCGGGCGAGCCACTGACAGATTTTATGCGACAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCTAAATCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAACGCTGGTCAGCTCACTGAGACCTTGCGGTCACTGCGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGACCGCTTTTCGTTGTCGACAACAAGCCTGATTCTGCTGAGCGTGGTAGTCTTGTATTGCGGCAAGACCAAGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAGGAAGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCT------CCCACG-----ATCGGCC-------AC--CCA------GCAGGAC-CGCAAGCTGACTCT-ATCTTAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCTCCC---------------------ACACTCGTT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CT------ACATCAGC-ATT---------GGCACGA-----------------------------GGAAAAT----GAGCTGA-CAG-CATATC-------TTGCAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCTC--------------------------------------------ATTGC--A---AGCTG--------CA-ACTGATTCA---CTACTGACACAAAAA-TCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTCATTGTCAACGGCAAGAAGGTTCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ATTACCC-TCATCAC----AA-------------CAT-CCATCACCGCCG----TG--CGC-GCCTC-----TG-------CAAAAA----TCG-CT-TA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCTCTTGGCATTTGAGACATGACCTCACC-G-----CATC-AA---AATGCCTCGCTG-TCAACAT--------CACA-CCAG-----CATCA-TTCCACTC------CCCC----ACGTGC---------------------------------------------------------------------------------TGCAG-AAACATC--------------TGT-CACAACAATGCTGACGA-CC-TAACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_plurivora_CBS_118743 GCCTCCACACTTTCCCATTTGCGGAGAACGAACACACCCATCGGTCGTGATGGAAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTAGGAACACCGGGCGAGCCACTGACAGATTTTATGCGACAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCTAAATCGACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAACGCTGGTCAGCTCACTGAGACCTTGCGGTCACTGCGGAGAAAGGGCTTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACCGATGCTGGTCGTGTCTGCCGACCGCTTTTCGTCGTCGACAACAAGCCTGATTCTGCTGAGCGTGGTAGTCTTGTATTGCGGCAAGACCAAGTCGCGAAGCTTCACCAAGATCAAGAGGCTGCGGCGTCCCTTCGAGGCA---TCAGCGAAGAGGACAGAGCACAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTTGAATATCTCGACGCAGAAGAAGAAGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCT------CCCACG-----ATCGGCC-------AC--CCA------GCAGGAC-CGCAAGCTGACTCT-ATCTTAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATTAC-----TACCCCATCTCCC---------------------ACACTCGTT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-TT-------CT------CCATTAGC-ATT---------GGCAGGA-----------------------------GGAAAAT----GAGCTGA-CTG-GATACC-------TTACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCTG--------------------------------------------ACTGA--A---AGCTT--------CA-ATTGATTCA---ATACTGACACAAACA-TCCAAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCTCCATCCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-ATTCCCC-TCACCAC----AA-------------CAT-CCATCACCGCGC----CG--CGC-GCCTC-----TG-------CAAAAA----TCA-CT-TA-T---CGCCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCTCTTGGCACTTGAGACATGACCTCACC-G-----CATC-AA---AATGCCTCGTTG-GCAACAT--------CACA-CCAG-----CATCA-CTTTACTA------CGCC----GCATGT---------------------------------------------------------------------------------CACAG-AAATATG--------------TGT-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_pratensis_var._pratensis_CBS_122105__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCCAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGGATGGACCTTCTCGAAGAATACGATCCTGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGACAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCCGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGATCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CTCATA-----TGATAGC-------AT--CCA------GCGTGCA-GGCCAGCTGACTCC-ACCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCAACATC-----CTATCCACCTTTA---------------------CCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????????CAATGCGTGAGTCTC-TC-------CG------GTATCAAG-AAT---------GATCGGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GATAAC-------TCACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTTCGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACATCGT---CCACTAACATCATT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGTTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-ATTTCCA-CCACTTC-------------------ATT-CCATTGCCGT------CG--CGC-GCCT------GGT------CAAAAT----TCG-CC-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------CACG-CTAG-----CCACTACCCCAACC------CTCC----ACATGC---------------------------------------------------------------------------------CGACC-AAACACC--------------ATG-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_pratensis_var._pratensis_CPC_16868_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCCAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGGATGGACCTTCTCGAAGAATACGATCCTGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGACAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCCGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGATCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGACAGC-------AT--CCA------GCGTGCA-CGCCAGCTGACTCC-ACCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCAACATC-----CTATCCACCTTTA---------------------CCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTC-TC-------CG------GTATCAAG-AAT---------GATCGGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GATAAC-------TCACAGCGTCGAGCACGGCGACTTCAATGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTTCGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACATCGT---CCACTAACATCATT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGTTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-ATTTCCA-CCACTTC-------------------ATT-CCATTGCCGT------CG--CGC-GCCT------GGT------CAAAAT----TCG-CC-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------CACG-CTAG-----CCACTACCCCAACC------CTCC----ACATGC---------------------------------------------------------------------------------CGACC-AAACACC--------------ATG-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_pratensis_var._pratensis_CPC_19448_ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCCAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGGATGGACCTTCTCGAAGAATACGATCCTGTTTTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGACAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCCGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGATCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGACAGC-------AT--CCA------GCGTGCA-CGCCAGCTGACTCC-ACCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCAACATC-----CTATCCACCTTTA---------------------CCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTC-TC-------CG------GTATCGAGTAAT---------GATCGGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GATAAC-------TCACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTTCGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACATCGT---CCACTAACATCATT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGTTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-ATTTCCA-CCACTTC-------------------ATT-CCATTGCCGT------CG--CGC-GCCT------GGT------CAAAAT----TCG-CC-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------AACG-CTAG-----CCACTACCCCAACC------CTCC----ACATGC---------------------------------------------------------------------------------CGACC-AAACACC--------------ATG-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_pusilla_CBS_124973__ GCCTCCACACTTTCCCATTTACGGAGAACAAACACACCCATTGGTCGTGATGGTAAGATTGCCAAGCCGCGACAACTGCACAACACCCATTGGGGTCTTGTGTGTCCAGCAGAGACTCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGACCTTCTTGAAGAATACGACCCCGTTCTGGAGCCCAAATCGACCAAGGTGTTTATCAACGGTACTTGGGTTGGTGTGCACAAAAACGCTGGCCAACTTACGGAAACCTTGCGATCCCTACGAAGAAAGGGTCTGTTGAGCTTCGAGGTCACCATCATTCGTGATGTTCGAGAGCGTGAAATTCGAGTCTTTACTGATGCTGGGCGTGTTTGCCGGCCGCTGTTTGTGGTTGACAACAAGCCGGACTCTGCAGATCGCGGCAGTCTTGTGCTGAAGCAAGATCAGATCGAGAAGCTGCATGCAGATGAGGCTGCCGCAGCATCTCTCCGGGGTA---TCAGCGAAGAGGATAGGGCCGAGCATACCTACGGCTGGATGGGTTTGGTCCGCGATGGTGTGGTAGAGTACCTGGATGCAGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGTGCAAACGGCATTCCCCCCGGAGG--CTATT-CAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGAT-------CTCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTCA------CTCAAT-----ACACGGC-------GC--CCA------CCATGCT-CACATGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCATCCGCC-CACCCACCCATCCTCC---------------------ACCTTCAAT-GGCA-AT-----TCTGACAAGAGCACAGTATTATGATCGGTATGGG???????????????????????????------???------????????????---------???????????-------------------------???????----???????-???-??????-------??????????????????????????????????????????????????????????????????????????????????--------------------------------------------????????--??????--------????????????---??????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGAAGGTAAGA-CTCCCTC-CTCACTTT------------------GTT-GTATTGCCGC------CG--CGC-GCCG------GGC-----AAAAAAA---TTCG-AC-CA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---CTTG-AGA--TTTTTGCCTTGGCGT------CATGACCTCACA-C-----CAAACAA---AATGCCTCGCTC-GCAC-----------AACA-CCGG-----CTTCA-CTTCGCTC------CTCC----ATATGC---------------------------------------------------------------------------------CGCGA-GGATATT-----------CTCCAC-CAACACAATGCTGACAA-CC-TCACCC--CTAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_rhabdospora_CBS_118415__ GCCTCCACGCTCTCCCATTTGCGGAGAACCAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGGCTCGTGAAGAACTTGTCGCTTATGTGCTACGTCTCGGTGGGAACACCGGGCGAGCCACTCACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGGGTGCACAAAAACGCCGGTGCACTTACAGAGACTCTGCGGGCGTTGCGGAGAAAGGGTCTGCTAAGTTTTGAGGTCACCATCATTCGTGATGTTCGCGAGCGCGAGATTCGGGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTATTCGTTGTTGACAACAAACCAGATTCTGCCGAGCGCGGCAGTCTCGTACTCCGACGGGACCAGGTTGAGAAGCTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTGCGAGGGG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGCTGGATGGGTCTAGTCGGTGATGGTGTTGTTGAGTACCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACCAATATCGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TAATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG-TTCGGC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TCTTTCC---------------ACACGGC-------GCA-CC-------GTGGGCA-TGCCAGCTGACATT--TCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATGTC-----CCACCTGTCCTCG---------------------ACCTTGAAC-GGCA-AT-----TCTGACAAAAGAGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTACA-TC-------CA------AGAGCAGC-ATCACAT-----TAGATGA---------------------------TCGAGCTAT----AAGCTGA-CAT-ACACCC-------TCACAGCGTTGAGCACGGCGACGTCACGGTTGTGGCCGTCAACGACCCTTTCATCGAGCCCTCCTACGCTGTATGCATATCC--------------------------------------------CGAAAGAGCTGGCTGG--------CT-TCAACACAC---CCGCTAACACCCCG---CTCAGGCCTACATGCTCAAGTACGACTCCACTCACGGAGTCTTCAAGGGCACCATCGACGTCGACGGCGACAAGGGCCTGATTGTCAACGGAAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGAGTCAACAACAAGACCTACACCTCTGACATCCCTGTCATCT?????GAGAAGGTAAGA-CTCCGAA-TCC-----------------------TGT-CCGTCCCTGT------CG--CGC-GCGC------TGC------GAAAAC----TCG-CA-TG-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTG-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAGAA-CTCCACCA------TTTC----ACATGT---------------------------------------------------------------------------------CACTC-GATCACT-------------CCCG-AGAAATATTGCTGACAA-CA-TCGATT--ATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_rhabdospora_CBS_312.92__ GCCTCCACGCTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACACCGGGCGAACCACTCACAGACTTTATGCGACAGCGTGGCATGGATCTTCTCGAAGAGTACGATCCTGTTTTGGAGCCCAAGTCGACCAAGGTGTTCATCAATGGTACTTGGGTCGGTGTGCACAAAAACGCCGGTGCACTTACAGAGACTTTGCGGGCGTTGAGGAGGAAGGGTCTGCTAAGTTTTGAGGTGACCATCATTCGTGATGTTCGAGAGCGCGAGATTCGAGTCTTTACCGATGCTGGGCGTGTTTGCCGGCCGCTATTCGTTGTTGACAACAAGCCAGATTCTGTCGAGCGCGGCAGTCTCGTACTGAGACGGGACCAGGTTGAGAAGCTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTGCGAGGGG---TCAGTGAAGAGGATAGAGCACAGCACATCTACGGCTGGATGGGTCTAGTCGGTGATGGTGTTGTTGAGTACCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACTAATACTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TAATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG-TTTGGC-GCGGCCGTT-AAATCCTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCGGTCTTCCGTGAG-----TCTACCG---------------ACACGGC-------GCA-CC-------GTAGGCA-TGCCAGCTGACATT--TCACAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGACGTC-----CCACCTGTCCTCG---------------------GCCTTGAAT-GGCA-AT-----TCTGACAAAGGAGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------CA------AGAGCAGC-ATCATAC-----CAGAGGG---------------------------TCGAGCCAC----AAGCTGA-TAT-GCACCC-------TCACAGCGTTGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATCGAGCCCAGCTACGCTGTATGCATATCC--------------------------------------------CGAAAGAGCTGGCTAG--------AC-TCAACACGC---CCACTAACACCCTG---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATCGTCAACGGCAAGAACATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTATTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCCCCCATGTTCGTTATGGGAGTCAACAACAAGACCTACACCTCTGACATCCCTGTCATCT?????GAGAAGGTAAGG-CTGCGAA-TCC-----------------------TAT-TCATCCCCGT------CG--CGC-GCGC------TGT------GAAAAC----TCG-CA-TG-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTC-TTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCGG-----CAGAC-CTGCACCA------CTTC----ACATGT---------------------------------------------------------------------------------CAGTC-GACCAAT-------------ATCG-GGAAATATTGCTGACAA-CA-TCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_rubella_CBS_114440__ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGCC-ATTTTATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCT------------------------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAAGACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CBS_120161__ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--ACGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCTCACTTGCT----------------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CBS_141117 GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCTCACTTGCTCACTTGCTCACTTGCTCCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_15748_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAACAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGCC-ATTTTATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCTCACTTGCTCACTTGCT--------------------------------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_15749_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGCC-ATTTTATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCGGCTTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCTCACTTGCTCACTTGCT--------------------------------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_15750_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGCC-ATTTTATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCTCACTTGCTCACTTGCT--------------------------------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_15821_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCTCACTTGCTCACTTGCT--------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_19471_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCTCACTTGCTCACTTGCT--------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTTCGAGACGCCCAA Ramularia_rubella_CPC_19472_ GCCTCCACACTCTCCCATTTACGGAGAACAAATACACCCATCGGCCGTGATGGCAAGATTGCCAAACCAAGACAACTCCACAACACCCACTGGGGTCTCGTGTGCCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTAGTGAAGAACCTCTCGCTCATGTGCTACGTCACGGTGGGAACGCCCGGTGAACCGCTCACAGACTTCATGCGACAGCGCGGAATGGATCTCCTCGAAGAATACGACCCCGTATTGGAGCCCAAGGCGACCAAAGTCTTCATCAACGGCACTTGGGTCGGCGTGCACAAAAATGCCGGACATCTTACCGAAACATTGCGGTCGCTGCGGAGAAAGGGTTTGCTCAGTTTTGAAGTCACCATCATTCGTGACGTCCGAGAACGCGAAATTCGCGTCTTCACCGATGCGGGGCGCGTCTGCCGGCCGCTGTTTGTGGTTGACAATAAGCCAGATTCTGCCGAGCGCGGTAGCCTTGCATTGCGGCAGGACCAGGTCGCGAAACTCCACCACGACCAAGAGGCTGCAGCATCTTTACGGGGCA---TTAGCGAAGAAGATCGAGCTCAGCATATCTACGGGTGGATGGGCCTGGTCAATGAAGGTGTCGTGGAATACTTGGACGCAGAGGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------ATCCGTCCCG-ACCTCCAACCCTTTGTGAACCCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATTCCTACGTCGGAGTAAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTC--GGAG--CCGTC-GCGGCCGTT-AAATCTTTTACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCCGTCTTCCGTGAG-----TACACCCG---CCGATA-----GGGCGCC-------GC--CCA------GCGGACC-CGCCAGCTGACTTG-ATCAAAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATATC-----CAATCCCCGCTTC----------------CACCCCCCTCCCAT-GGTC-ATTCCATTCTGACACGAGCACAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCGC-ACGTCTC--CATCAACCAGCTCGGC-TTG---CTCGCGAGAGTGGGTGGAA---------------------ACAGGCCATGCCCCGGCTGA-CAT-GATGATACT---GCTACAGCGTCGAGCACAGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATCGAGCCTACCTACGCGGTATGTCGTTGC--------------------------------------------ATGCCAGC---GGAGAC----------ACTGCTCCA---AGACTAACACCCCA--CCGCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGAACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACGGAGCGCGATCCCGCCAACATCCCATGGAAGGACTCTGGCGCGGAGTACATTGTGGAGTCGACGGGTGTCTTCACCACCACGGAAAAGGCATCGGCCCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCGGCTCCTTCGGCCGACGCTCCCATGTTCGTCATGGGGGTCAACAACAAGACGTACACGTCGGACATTCCCGTCATCT?????GAGAAGGTAAGA-CAAATCC-CCGTCTT-------------------CGT-ATGCCGTCATGCCGTGCGCACGC-GCGC------TG-------CAGATA----TCGCTC-CA-T---CACCCCTCTG--------CGGGTGGGC----------------------TGGT--GGGG----TTGCAGA--TTTTCTGCTTGGCACGA----CGAGATTTCACC-C-----CTCC-AA---AATGCCTCACTG-GCCAC----------TACG-CCA------CATTA-CCCCACTT------GCCC----ACTTGCTCACTTGCCCACTTGCTCACTTGCTCACTTGCTCACTTGCTCACTTGCT--------CCTCCCCACGCCGAAACTTCCCTCGTGCGAAATTCATTGC---ACGCACGACAATACGAAGATGACTGACCA-CG-TCACCCATATAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTCGACAAGCTGAAGGCTGAGCGTGAGCGTGGTATCACCATTGATATCGCGCTCTGGAAGTACGAGACGCCCAA Ramularia_rufibasis_CBS_114567__ GCCTCCACACTCTCTCATTTGCGAAGAACCAACACGCCCATTGGTCGTGACGGCAAGATTGCAAAGCCAAGACAACTTCATAATACCCACTGGGGACTTGTATGTCCAGCAGAAACGCCCGAAGGACAGGCCTGTGGTTTGGTGAAAAATCTGTCGCTGATGTGCTACGTTACGGTGGGAACGCCGGGTGAGCCTCTGACAGACTTTATGCGACAACGTGGTATGGATCTGCTCGAAGAATACGACCCTGTGCTGGAGCCCAAGTCCACAAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGGCAACTCACAGAAACATTGCGCGGGCTGCGTAGGAAAGGTCTGCTCAGCTTCGAGGTCACCATCATTCGGGATGTCCGAGAACGTGAGATCCGAGTCTTCACCGACGCTGGACGTGTGTGTCGGCCGTTGTTCGTCGTCGACAACAAGCCGGATTCTACAGAGCGTGGCAGTCTCGTCTTGCGCCGGGATCAGGTCGAGAAACTACAACACGATCAGGAGGCAGCAGCATCTTTAGCAGGCA---TCAGCGAGGAAGACAGAGCCGAGCACACCTACGGCTGGATGGGCCTGGTCAACGATGGTGTTGTGGAGTACCTCGATGCGGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACCCATCACGTTGCTTC-GGGGGCGACCCTGCCTCT--TCTGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGTGGG--ACCCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTTTTCCGTGAG-----TACCA-------CCAGAA----ACACCGTT----------TCA------AGCGACC-CGTGAGCTGACTCC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAATCCC-----CGGCGTGCTGCAT---------------------TAGTACGAT-AACA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGAG-CTCCCATTTCA------AGATCAGA-CTGGGTGGAATCGGTGCAG---------------------------AAAGGACAC----GGGCTGA-CGA-GCTACCA------TCACAGCGTTCAGCACGGCGACGTCGAGGTTGTGGCCGTCAATGACCCGTTCATTGAGCCTACCTACGCGGTATGTAGTGCT--------------------------------------------GAGTTGAA-CAACCGT--------CC-CATCATCAC---CCTCTAACGTCTCT---CCCAGGCATACATGCTCAAATACGACTCGACCCACGGCGTGTTCGACGGCACCATCGAGGTTGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCCTGGGCCGAGTCCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCGGACATTCCCGTAATCT?????GAGAAGGTAAGA-CACCGCC-CTGACTT-------------------CAC-TTCACACCGT------CG--CGC-GCACGCAAGCTGT------TCAAAA----ACG-CC-TA-T---CACCCCTCGC--------ATGGTGGGC----------------------TGGT-GGGGTCT-TTTG-AGA---TTTCGGCTTGGCAC------CATGACCTCACA-A-----CGAG-AA---AATGCCTCGCT---CCCC----------AACA-CCAG-----CATCA-CCCCACGC------GAAT----CAATAC---------------------------------------------------------------------------------TGCGC-AAATACAG-ACAGCCGCAAGAATG-AAGAGCAACGCTGACGA-CT-CGACCT--ATAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_rumicicola_CBS_141118 GCCTCCACACTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCTAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACACCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCATTAACAGACTTTATGCGACAGCGTGGGATGGATCTTCTCGAAGAATACGATCCCGTTTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCATAAGAACGCTGGTCAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGATTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCTGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGACCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGATAGC-------AA--CCA------GTGGGCA-CGCCAGCTGACTCC-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCATCCTC-----CCACCCACCTTCA---------------------CCATTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGGGTCTC-TC------CCA------AAATCGAG-ATT---------GATCAGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GACAAC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACACCGT---CCACTAACATCAAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCATTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGCAAGC-AATTCCA-TCACTTC-------------------ACT--CCATGCCGT------CG--CGC-GCCT------GGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCT-------TTGGTGGGT----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------AACG-CTAG-----CTACTACCCCAGTC------CTCC----ACATGC---------------------------------------------------------------------------------CGAAC-AAACACT--------------ATG-CCCAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_rumicicola_CPC_11295_ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCTAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACACCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCATTAACAGACTTTATGCGACAGCGTGGGATGGATCTTCTCGAAGAATACGATCCCGTTTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCATAAGAACGCTGGTCAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGATTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCTGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGACCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGATAGC-------AA--CCA------GTGGGCA-CGCCAGCTGACTCC-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCATCCTC-----CCACCCACCTTCA---------------------CCATTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGGGTCTC-TC------CCA------AAATCGAG-ATT---------GATCAGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GTCAAC-------TCACAGCGTCGAGCACGGGGCCGTCAAGGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACACCGT---CCACTAACATCAAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCATTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGCAAGC-AATTCCA-TCACTTC-------------------ACT-CCATTGCCGT------CG--CGC-GCCT------GGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCT-------TTGGTGGGT----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------AACG-CTAG-----CTACTACCCCAGTC------CTCC----ACATGC---------------------------------------------------------------------------------CGAAC-AAACACT--------------ATG-CCCAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_rumicicola_CPC_11296_ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAAATTGCTAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTGTGTCCGGCAGAAACACCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCATTAACAGACTTTATGCGACAGCGTGGGATGGATCTTCTCGAAGAATACGATCCCGTTTTGGAGCCAAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCATAAGAACGCTGGTCAACTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGATTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTGTTTGTGGTTGACACCAAGCACGACTCCGCTGAGCGCGGCAGTCTCGTACTGCGTCGGGATCAGGTCACGAAGCTTGAACAAGACCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCACATTTACGGCTGGATGGGCCTGGTCAACGAGGGTGTGGTAGAATATCTTGACGCAGAAGAGGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGATAGC-------AA--CCA------GTGGGCA-CGCCAGCTGACTCC-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCATCCTC-----CCACCCACCTTCA---------------------CCATTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGGGTCTC-TC------CCA------AAATCGAG-ATT---------GATCAGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GACAAC-------TCACAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTACCA--------------------------------------------TGCAATCC--ATCCAG--------CC-TTACACCGT---CCACTAACATCAAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCACCATCCCCTGGGGCGAGTCCAAGGCCGACTACATCGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCATTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGCAAGC-AATTCCA-TCACTTC-------------------ACT-CCATCGCCGT------CG--CGC-GCCT------GGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCT-------TTGGTGGGT----------------------TGGT-GGGGG---TTTG-AGA--TTTTCAGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTTTCTG---CCC----------AACG-CTAG-----CTACTACCCCAGTC------CTCC----ACATGC---------------------------------------------------------------------------------CGAAC-AAACACT--------------ATG-CCCAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_rumicis_CBS_114300__ GCCTCCACGCTCTCCCATTTGCGGAGAACGAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCACGACAACTCCACAACACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCCGAAGGACAAGCTTGTGGTCTGGTGAAGAATTTGTCGTTGATGTGCTATGTCTCGGTCGGAACCCCAGGCGAGCCACTAACCGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGCACTTGGGTCGGGGTGCACAAGAACGCGGGTCAATTGACTGAAACCCTGCGGTCGCTGCGGAGGAAGGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTTACCGATGCTGGGCGTGTCTGCCGGCCGCTCTTCGTCGTCGACAACAAGCCCGAGTCCGCTGACCGTGGCAGCCTTGCACTGCGGCGGCACCAGGTCACCAAGCTCGAGCAAGACCAGGAGGCCGCAGCATCTCTCAGAGGCA---TCAGTGAGGAAGATAGGGCCGAGCATATTTACGGCTGGATGGGCTTGGTTAATGAGGGCGTGGTAGAATACCTCGACGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--CCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCACATGTAGCGATAGC-------AT--ACA------ATGTGCC-CGCAAGCTGACCCC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCAA-ATC-----CCACCCACCTTCC---------------------CCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTT-TC-------CA------ATGCCATG-ATT---------GATATGGGAGG-------------------------AGCAGAA----GAGCTGA-CGG-GATATC-------ACACAGCGTCGAGCACGGCGACGTCACTGTCGTTGCCGTCAACGACCCTTTCATTGAGCCCACCTATGCCGTATGTTCAACC--------------------------------------------ATAGCACA--ATCCAT--------TC-CTCTTCCAT---CCACTGACATCGAT----CCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGGGCGAGTCCAAGGCCGACTACATCGTGGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTGAACAACAAGACCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGC-GCCGCCC-TCACTCCC------------------ACT-CCATCACTGT------CG-GCGC-GCCT------GGT------CAAAA-----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-GGA--TTTTCTGCTTGGCGT------CATGACCTCACA-C-----CACC-GA---ATTGCTTCTCTG-GCCAC----------AACG-CTAG-----CACAA-GCCAACAC-----CCTTC--ACACATAC---------------------------------------------------------------------------------CGCCC-AAATTAA---------------TG-CCCAACACCGCTGACGA-CC-TCACCT--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_sp._A_CBS_114566__ GCCTCCACACTCTCACATTTGAGAAGAACAAATACGCCCATTGGGCGTGATGGCAAGATCGCCAAGCCCAGACAGCTTCACAACACACATTGGGGTCTCGTATGTCCGGCAGAAACGCCAGAAGGACAGGCTTGCGGTTTGGTAAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAGTACGACCCCGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACATGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACTGAGACCTTGCGATCGCTAAGAAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGAGTCTTTACTGATGCGGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAATAAACCTGACTCTGCTGAGCGCGGCAGTCTCGTGTTAGTGAGGAATCAAGTTGAAAAGCTCCAACACGATCAAGAGACTGCAGCGTCTCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGAACACTTACGGCTGGATGGGGTTGGTCAACGATGGCGTGGTAGAATACCTCGATGCTGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTGATTCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-AATTTCGCGGTGGAGTT--CGGG--TCGTT-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGGG-----TGTTC------CCCACG-----CAGAAGC-------AT--ACA------ATGTACA-TACCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ACGCAGCGTC-----CCACCCATCCCCC---------------------TCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTCATT-------CA------GCTGCAAC-ATA---------TACAATGATGAA------------------------GAAGAAA----GAGCTGA-CAA-GATACC-------TCACAGCGTCGAGCATGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCATGAC--------------------------------------------TTACAAGA---GATGGT------ATC-ATACAACAC---CCTCTAACACTATCCATCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCATTTGAAGGGAGGCGCTAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCGGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTTCACT-CCCT-TC-------------------ACT-ACATCACTGT------CG--CGC-GCGCA----ATGC------AATAAA----TCG-CA-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-G-----AAAC-AA---ACTGCCTCGCTG-CCCAC----------AACA-TCAG-----CAGCGCATCACCGT------CCAC----ATATGC---------------------------------------------------------------------------------CGCTC-CATTA---------------GTGC-CATGACAAAACTGACGA-CC-TCACCC--ATAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_sp._B_CBS_114568__ GCCTCCACGCTCTCCCATTTACGGAGAACAAACACCCCCATCGGCCGTGATGGAAAGATTGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCGTGTGGTCTGGTGAAGAACTTGTCTCTCATGTGCTACGTCTCGGTTGGGACACCAGGCGAGCCTTTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTGGAAGAATACGACCCTGTCCTGGAGCCCAAATCAACCAAGGTCTTCATCAACGGTACCTGGGTTGGTGTGCACAAAAACGCTGGCCAACTCACCGAGACTTTGCGATCACTCCGGAGGAAGGGCTTGCTCAGTTTCGAGGTTACCATTATTCGTGACGTGAGAGAACGTGAAATCCGGGTGTTTACCGATGCTGGTCGTGTCTGCCGGCCACTGTTCGTGGTCGACAACAAGCCAGACGCGGTTGAGCGTGGCAGTCTTGTGCTGAGGCGGGACCAAGTCGAAAAGCTCCAAGCCGATCAAGAGTCTGCGGCGTCCCTCCGAGGCA---TCAGCGAGGAGGACAGAGCAGAGAACACCTACGGCTGGATGGGCTTGGTCAATGATGGTGTAGTCGAATACCTCGACGCAGAGGAAGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTT-GGGGGCGACCCTGCCGCTC-CGCGGCATTCCCCCCAAAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCCACA-----ACAGGCC-------AT--CCC------ACGAGCT-CTCCAGCTGACCAG-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCACGGGT-ATGCGATCAC-----TACCTCGTCCTCC------------------TTCCCACTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTGC-TT-------CC------ATGTAAGA-GTC---------GATATGGCGTG-------------------------GAAAAAA----AGGCTGA-CAG-GACACC-------TCTCAGCGTCGAGCACGGCGACGTCAACGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAGCGA--------------------------------------------AGCACTGA--ATGCTA--------TC-TAAAATGAT---TAGCTGACCACAGT----TCAGGCCTACATGCTCAAGTACGACTCCACCCACGGTGTTTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCTTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCTCCATCCCATGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACCACAAGACTTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-GCACGCC-CGCA------CCGTA-----------TAA-TCATCACCAC------CT--CTC-GCGTC-AC-TGCC------AAATAA----TCG-CT-TA-T---CACCCCTCG---------CTGGTGGGC---------------------CTGGT-GGGGG---TTTG-AGA---TTTTCTCTTGGCACTCGAGGCATGACCTCACA-G-----GAGG-AA---AATGCCTCGTTG-GGCAT----------GATA-TTAG------ATCG-CTTCACTC------TCAC-----CAGCC---------------------------------------------------------------------------------CGCAC-AAACGAT-------------GTTT-GAGAACGACGCTGACGA-CC-TCGCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAATATGCCTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_sp._C_CBS_299.49__ GCCTCCACACTCTCCCATTTGAGGAGAACGAATACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAACTTCACAACACCCATTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTTGTGAAGAATTTGTCACTTATGTGCTACGTCTCGGTTGGAACACCCGGCGAGCCCCTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACTTGGGTTGGTGTACACAAGAATGCCGGCCAACTGACAGAAACCCTGCGATCACTGCGAAGAAAGGGCTTGCTCAGTTTTGAGGTTACCATCATTCGCGATGTGCGAGAACGTGAAATCCGAGTCTTCACTGACGCTGGTCGCGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCCGCTGATCGCGGCGGTCTCGTTCTGAGACAGGACCAAGTCGCGAAGCTTCATAGTGATCAGGAAGCCGCGGCCTCTCTACGGGGCA---TCAGTGAAGAGGATCGAGCCGCGCATATCTACGGCTGGATGGGCTTGGTCAACGATGGCGTGGTAGAATACCTTGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCGATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATT-CCCCCGGAGG--CCATC-AAAACGCTGCATCCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGTAAC-CA-TTCGCAGAGGAGTT--CGAG--TCGCC-GCGGCCGTT-AAATCTTTCACAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTGAG-----TGTTT------CTCACG-----ATATGTT-------AC--CCA------GCGAGCC-CGCAAGCTGACTTG-ATGACAGCATCCATTGTCGGTCGACCGCGCCACCATGGGT-ATGCGATATC-----CTCCTCATGCTCC---------------------ACCCTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG???????CGCAATGCTTGAGTCTC-TT-------CA------ACACGAGG-ATT---------GTCATGAAG---------------------------GAGAGAT----GGGCTGA-TAAGAACACC-------TCACAGCGTCGAGAACCCTGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCAATCA--------------------------------------------TGCAAAGA---ACCCAC-------CT-CCGCCACCA---TTTCTGAACATAAT----ACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCGTCGAGGTCGACGGCGACCAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCTTGGGGTGCGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACTGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTGGTCATCTCCGCTCCATCTGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-TCATTTC-CTCGCA----TCACT-----------CTC-TCATCACTGC------CG--CGT-GCTT------GGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---ATTG-AGA---TTTTCGCTTGGCAC------GATGACCTCAGC-C-----CAAC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CATCG-CCCTACTT------CTCCACATGCATGC---------------------------------------------------------------------------------CACGC-AAATGTC-----------CTTCGA-GACAACAATGCTGACGG-AT-TCACTC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTTAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_sp._D_CBS_135.23__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTTGTATGTCCGGCAGAAACGCCTGAAGGACAGGCTTGTGGATTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACTCCAGGCGAGCCATTGACGGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTCCACAAAAACGCTGGAGCACTTACCGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTCTTGAGTTTCGAGGTCACCATCATTCGCGATGTCAGAGAACGCGAGATCCGGGTGTTCACAGATGCTGGCCGTGTCTGCCGGCCGCTATTCGTGGTCGACAATAAGCCTGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGGGCACAGCACATCTACGGATGGATGGGCCTGGTCAATGAAGGTGTTGTAGAATACCTCGACGCAGAAGAAGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGGA--TTAAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCATAC----ATGCGGC-------GT--CTA------GCGTATC-CGCCAGCTGACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAATCCCTA---------------------ACCGCTAAT-GGCA-AT-----TCTGACAAGAGCGTAGCATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTAAA-GT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTATGCCGTATGCCTTGAC--------------------------------------------CAAGAAGA---ATAGC--------AT-TCGAAAACC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------CCC-TCATCATCGT------CG--CAC-GACT------CGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAG----------AA------------CACCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTC-GACCA-T-------------ACCA-AGAAACATTACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCGAA Ramularia_sphaeroidea_CBS_112891__ ???????????????????????????????????????????????????????????????????????????????????????????GGGGCCTCGTGTGTCCTGCAGAAACCCCAGAAGGACAGGCTTGTGGGCTGGTGAAGAATTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGTATGGATCTTCTTGAAGAGTATGACCCCGTCCTCGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGCGTGCACAAGAATGCTGGGCAGCTGACCGAAACCTTGCGATCGCTGCGGAGAAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAGCGTGAGATTCGAGTGTTTACCGATGCCGGACGTGTTTGCCGGCCGCTTTTCGTGGTCGACAACAAGCCTGACTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAAGTCACAAAGCTCCAACAAGATCAAGAGACAGCAGCGTCCCTCCGAGGTG---TAAGTGAAGAGGACAGAGCAGAGCATACCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGATGCCGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTC-GGGGGCGACCCTGCCGTTCGCGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTCGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGGG--TCGTG-GGGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCTCGCGCTGTCTTCCGTGAG-----TGTTT------CTCAGG-----CAGAAGC-------AT--ACA------ATGGACA-TGCCAGCTGACTTC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCACAATC-----CCA-TCATCCTCT---------------------CCACTCAAC-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTTGC-TG-------TG------GCTATACC-ATT---------CATTAGAGAGGCGG--------------------AAGAAGGAT----GATCTGA-CAG-AGCACC-------TCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGTCGTTCA--------------------------------------------ATACAAGA---GTCTG---------A-TCACAACAC---CCTCTAACACCACCAATCCCAGGCCTACATGCTCAAGTATGACTCCACCCACGGAGTCTTCCAGGGCACCATCGAAGTCGACGGCGACAAGGGTCTCATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGGCCGAGTCCAAGGCCGACTACATTGTCGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCATCCGCCGATGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGATATCCCCGTCATCT?????GAGAAGGTAAGA-ACTCACT-CCCA-TC-------------------ACT-GCATCACTGT------CG--CGC-ACCT------TGC------AAAAAT----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTTTTGGCTTGGCGT------CATGACCTCACT-C-----CAAG-AA---AAAGCCTGCCTG-GCCAC----------AACA-CGAG-----CACCA-ATCCTACT------CTGC----ACATGC---------------------------------------------------------------------------------CATCC-CATTATT--------------TAC-CACAACCATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_stellariicola_CBS_130592 GCTTCCACCCTTTCCCATTTGAGGAGAACCAACACCCCCATCGGGCGTGATGGCAAGATCGCAAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAAAACCTGTCGTTGATGTGCTACGTCTCTGTTGGAACACCAGGCGAACCGCTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTAGAAGAGTATGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGCACTTGGGTTGGTGTGCATAAGAATGCTGGTCAGCTTACCGAAACCCTGCGATCGCTACGGAGGAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGTCCGCTGTTCGTTGTCGACAACAAGCCTGATTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAAAAGCTTCAACACGATCAGGAGACTGCAGCGTCCCTCCGGGGGA---TAAGCGAAGAGGATAGGGCAGAGCATACCTATGGCTGGATGGGCTTGGTCAACGAGGGCGTGGTAGAATACCTCGACGCAGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCAAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTT-GGGGGTGACCCTGCCGTTCGTTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------TCCTCGCGCGCCTCAAAGT-CTCCGGCCGGGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCATA-----TCCTTGC-------GC--CCA------CAGCACC-CACCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CCACCCATCATATTC----------CTTCCCCCTTCCAGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-GT-------CA------GATATAGC-ATT---------GATGTGGAG---------------------------GAGGAAT----GAGCTGA-CGG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGTCATTCA--------------------------------------------ATACAGAT---GATGGC------TTT-CCACCAATC---CTCCTAACATCACC---TCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGATCCCGCCAACATCCCCTGGAGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACAACCGAGAAGGCATCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTTAACAACAAGACCTATACCTCCGATATCCCCGTCATTT?????GAGAAGGTAACA-TCTCCCC-CCGCC---------------------ATC-ATACCGCTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGG----------------G----------------------TGGT-GGGGG---TTTG-AGA---TTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAT-GA---AATGTCCCGTTGGGCCAC----------AACA-CCAG-----CAGCA----CTTCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATT-CACAGCC--------------TGC-AATAACAATGCTGACGA-CC-TCACCT--GTAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_stellariicola_CPC_11298_ GCTTCCACCCTTTCCCATTTGAGGAGAACCAACACCCCCATCGGGCGTGATGGCAAGATCGCAAAGCCGAGACAGCTTCACAATACCCACTGGGGTCTTGTGTGTCCAGCAGAAACGCCAGAAGGACAGGCTTGTGGTTTGGTGAAAAACCTGTCGTTGATGTGCTACGTCTCTGTTGGAACACCAGGCGAACCGCTGACAGACTTCATGCGACAGCGTGGTATGGATCTTCTAGAAGAGTATGACCCCGTCCTGGAGCCCAAGTCGACCAAGGTTTTCATCAATGGCACTTGGGTTGGTGTGCATAAGAATGCTGGTCAGCTTACCGAAACCCTGCGATCGCTACGGAGGAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGCGAGATCCGAGTCTTTACTGATGCTGGGCGTGTCTGCCGTCCGCTGTTCGTTGTCGACAACAAGCCTGATTCTGCTGAGCGCGGCAGTCTCGTGCTGGTTCGGAATCAGGTTGAAAAGCTTCAACACGATCAGGAGACTGCAGCGTCCCTCCGGGGGA---TAAGCGAAGAGGATAGGGCAGAGCATACCTATGGCTGGATGGGCTTGGTCAACGAGGGCGTGGTAGAATACCTCGACGCAGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCAAACCTCCAACCCTTTGTGAACGCATCTCGTTGCTTT-GGGGGTGACCCTGCCGTTCGTTCGGCATTCCCCCCAGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTATA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---CCGCGAGT-------TCCTCGCGCGCCTCAAAGT-CTCCGGCCGGGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CTCATA-----TCCTTGC-------GC--CCA------CAGCACC-CACCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCATT-----CCACCCATCATATTC----------CTTCCCCCTTCCAGCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTCGC-GT-------CA------GATATAGC-ATT---------GATGTGGAG---------------------------GAGGAAT----GAGCTGA-CGG-GATACC-------TCACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTACGTCATTCA--------------------------------------------ATACAGAT---GATGGC------TTT-CCACCAATC---CTCCTAACATCACC---TCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGATCCCGCCAACATCCCCTGGAGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACAACCGAGAAGGCATCCGCTCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTTAACAACAAGACCTATACCTCCGATATCCCCGTCATTT?????GAGAAGGTAACA-TCTCCCC-CCGCC---------------------ATC-ATACCGCTGT------CG--CGC-GCCT------TGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGG----------------G----------------------TGGT-GGGGG---TTTG-AGA---TTTTGGCTTGGCGT------CATGACCTCACT-T-----CAAT-GA---AATGTCCCGTTGGGCCAC----------AACA-CCAG-----CAGCA----CTTCC------CTCC----ACATGC---------------------------------------------------------------------------------CGATT-CACAGCC--------------TGC-AATAACAATGCTGACGA-CC-TCACCT--GTAGGAAGCTGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_stellenboschensis_CBS_130600 GCCTCCACACTCTCCCATTTACGGAGAACAAACACACCCATCGGTCGTGATGGTAAGATTGCAAAGCCAAGACAACTTCACAACACCCACTGGGGTCTTGTGTGTCCTGCAGAAACGCCTGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTTGGAACACCAGGCGAGCCACTTACAGACTTCATGCGGCAGCGTGGTATGGATCTTCTCGAAGAATACGACCCCGTTCTGGAGCCCAAGTCAACCAAGGTGTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAATGCTGGTCAGCTTACGGAAACTCTGCGCTCACTCCGGAGAAAAGGTCTTCTCAGTTTCGAGGTCACCATCATTCGTGATGTACGAGAACGTGAGATTCGAGTCTTTACGGATGCTGGGCGTGTCTGCCGGCCACTGTTCGTGGTCGACAATAAGCCCGACTCAGCAGAGCGTGGCAGTCTTGTGTTAAGGCGGGATCAGGTGGAGAAGCTTCAAAACGATCAAGAGGCCGCGGCGTCCCTCCGAGGCA---TCAGCGAGGAAGACAGAGCGGAGCACACTTATGGCTGGATGGGCTTGGTCAACGATGGTGTGGTAGAATACCTCGACGCCGAAGAAGAGGAAACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGCTCCGGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAACGGTTC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTC------CCCATA-----TGATAAC-------GC--CCA------GCGTAAC-CGCCAGCTGACCCC-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCACCCCC-----CCGCACATCCTCC---------------------CTCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAACGCGTGAGTCTC-TT-------CA------GTTTCAGC-TTG---------AGGAAAGG----------------------------AGTGGTA----GAACTGA-CAA-GATACC-------TCACAGCGTCGAGCACGGCGATGTCCACGTCGTGGCTGTCAACGACCCTTTCATTGAGCCACACTACGCGGTATGCTCCGTT--------------------------------------------AATACAGC---GTCGA--------AA-CTCATCCAG---TCACTGACAACGAG----ACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATTGTCAACGGCCAGAAGGTCCGCTTCCACTCCGAGCGTGAGCCAGCCAGCATTCCTTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGGCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCTTCCGCCGATGCTCCCATGTTCGTCATGGGTGTAAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????????????????-???????????????-------------------????????????GTG-----CG--CGC-GCAT------TGCA-----GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA-TTTCTTTTCTTGGCGT------CATGACCTCACT-T-----CCCC-AA---AACGCTTCGCTG-GCCAC----------AACCACGAG-----CGGCA-CTCCACTC------CTCC----ACATGC---------------------------------------------------------------------------------CGCGC-AAACATG--------------CTC-GACAATAATGCTGACAA-TC-TAATCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tovarae_CBS_113305__ GCCTCCACACTCTCTCATCTGCGAAGAACCAATACACCCATCGGCCGAGATGGTAAAATTGCGAAGCCGCGACAACTTCACAACACCCACTGGGGTCTGGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTGTCGGTGGGAACCCCTGGCGATCCACTGATCGACTTCATGCGACAGCGTGGTATGGATCTCCTCGAAGAGTACGATCCTGTTCTGGAGCCGAAGTCGACCAAGGTCTTCATCAACGGTACGTGGGTTGGTGTGCATAAGAACGCGGGCCAACTTACAGAGACCCTGCGGGTGCTGCGGAGGAAAGGCGCCATCAGCTTCGAGGTCACCATCATTCGTGATGTTCGAGAACGCGAGATTCGAGTCTTTACCGATGCTGGCCGTGTCTGCCGGCCGCTATTCGTGGTCGACAACAAGCCGGACTCAACCGACCGCGGCAGTCTCGTACTGAGGCAGGATCAAGTCGCGAAGCTTCACGCTGATCACGAAGCTGCGGCGTCTCTGCGAGGCA---TCAGTGAGGAGGACAGGGCCAAGCACACCTACGGCTGGATGGGCTTGGTCAACGAAGGCGTCGTAGAGTATCTGGATGCGGAAGAGGAAGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACACATCATGTTGCTTC-GGGGGCGACCCTGCCGTC--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGCC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTAT------CCCGCA-----TCAGGCC-------AC--CAA------ATATGCT-CGTCCGCTGACTCC-ATCATAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATCGT-----CCTCTCATCCTCC---------------------TCTTTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTC-GT-------CC------AGCAGGAAGATT-------------------------------------------CTACAATAT----GTATTGA-CAG-TATA-CC------TCACAGCGTCGAGCACGGCGATGTCACTGTTGTGGCCGTTAACGACCCCTTCATTGAGCCCACTTACGCGGTATGCGAGCAT--------------------------------------------ATCCAAGC---ATGGCC------TGC-GTTAATCTT---ACACTGACATCAAC---AACAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACTATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAATGGCAAGAAGATTCGCTTCCACACCGAGCGCGACCCAGCCAACATTCCCTGGGGCGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATCTCCGCTCCCTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCGGACATTCCTGTCATCT?????GAGAAGGTAAGA-ACTCACC-CTCACATA------------------ACT-TTTTCACCTTT-----CT--GGC-GCCT------C-CA-----AAAAGA----CCG-CT-TA-T---CACCCCTCCGCCAC----TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGATTTTCACGGCTTGGCGT------CATGACCTCACC-TCACTTTCCT-AA---AATGCCTCGTTG-GCCAC----------CACA-CCAG-----CCTCC-ACTCGGCA-----------------------------------------------------------------------------------------------------TACTCCAAACATT--------------CTT-CAAAACAATGCTAACCA-CC-CCACCC--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACGCCCAA Ramularia_tricherae_CBS_108973__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCGTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGATCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGC-------GT--CCA------ATGTGCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGCATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCTCA--G-TCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACCGT------CG--CGC-GCCT------CGC------AAAATC----TCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_108974__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCGTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCGCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGATCACGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCACAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGC-------GT--CCA------ATGTGCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGCATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCTCA--G-TCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACCGT------CG--CGC-GCCT------CGC------AAAATC----TCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_108989__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGACCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTACATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGC-------GT--CCA------ATGTTCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCTACCTACGCCGTACGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCCCA--A--CAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACCGT------CG--CGC-GCCT------CGC------AAAATC----TCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGATAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_108990__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGACCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTACATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGC-------GT--CCA------ATGTTCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCTACCTACGCCGTACGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCCCA--A--CAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TCC-----------------------ACT-TC-TCACCGT------CG--CGC-GCCT------CGC------AAAATT---CTCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGATAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_108994__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCGTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGATCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGT-------GT--CCA------ATGTGCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCTCA--G-TCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCAACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACTGT------CG--CGC-GCCT------CGC------AAAATC----TCG-AT-CG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_108995__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCGTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGATCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGT-------GT--CCA------ATGTGCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCCACCTACGCCGTATGTCTGACT--------------------------------------------TGGAAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCTCA--G-TCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCAACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACTGT------CG--CGC-GCCT------CGC------AAAATC----TCG-AT-CG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTCCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_tricherae_CBS_236.73__ GCCTCCACACTCTCTCATTTGCGGAGAACAAACACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTTCACAACACCCACTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGGCTGGTCAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACGGACTTTATGCGCCAGCGTGGTATGGACCTTCTTGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTTATCAACGGTACCTGGGTGGGTGTGCACAAGAATGCTGGCCAATTGACCGAGACCCTGCGGGCGTTGCGGAGGAAGGGTCTGTTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAACGCGAGATTCGGGTCTTTACCGATGCCGGCCGTGTCTGCCGGCCGCTGTTCGTGGTCGACAACAAGCCCGACTCTCCCGAGCGTGGCAGTCTTGTCCTAAGACGGGACCAGGTCGAGAAGCTCCAAGGCGACCAGGAGGCCGCGGCGTCACTACGAGGGGTCCTGAGTGAAGAGGAGAAAGCACAACAGACATATGGCTGGATGGGCCTGGTCAATGATGGTGTTGTGGAGTACCTCGATGCAGAAGAGGAGGAGACCGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGCGGATT---ATAGTACATCCA-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGTG--TCGGC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGACGCGCCCCGCGCTGTCTTTCGTGAG-----TGCTC-------CCACCT----ATGCGGC-------GT--CCA------ATGTTCC-CGGCAGCTGACTCT-TTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCTACTCCCA---------------------ATCCACAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATTGGTATGGG?????TCCGCAATGCGTGAGTACA-CC-------GC------AGAGCAGC-ATT----GT----AATGAT---------------------------TGTAATTGC----GAGCTGA-CAT-GGA-TA--------CACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCTACCTACGCCGTATGTCTGACT--------------------------------------------CGGTAGAG-----AAG--------CC-TCAGTCTAC---CCACTAACACCCCA--A--CAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATTGAGGTCGACGGCGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCATCCGCCCACTTGAAGGGAGGCGCCAAGAAAGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCAC-TTC-----------------------ACT-TC-TCACCGT------CG--CGC-GCCT------CGT------AAAATC----TCG-AT-TG-T---CACCCCTCGCC-------TTGGTGGGT----------------------TGGT-GGGGT---TTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACT-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACC-CCAG-----CATTA-CTTCACTC------TTTC----ACATGA---------------------------------------------------------------------------------CATTC-AATTACC-------------CTCG-AGAACTATCACTGACAA-TG-CCACCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGATAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_trigonotidis_CBS_141119 GCCTCCACACTGTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAACTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCTGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCACTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTACACAAAAACGCTGGCCAACTTACCGAGACTTTGCGGTCATTGCGGAGAAAGGGTCTTTTAAGTTTCGAAGTCACGATCATTCGGGATGTTCGAGAACGCGAGATCCGTGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTTTTCGTGGTCGACAATAAGCCAGATTCCGCTGATCGTGGCAGTCTCGTACTAAAACAGGATCAGGTCGCTAAACTACACAACGATCAGGAGGCCGCGGCGTCTTTACAAGGCA---TCAGTGAAGAAGACAAAGCTCAACATACCTATGGCTGGATGGGTTTAGTCAATGACGGTGTTGTGGAGTACTTGGACGCGGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGG-------AGCGATCCCG-ACCTCCAACCCTGTGTGAACACATCTCGTTGCTTC-GGGGGTGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATCCTTACGTCGGAGTGAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCCTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTCT-------CCAGTG----ATACATC-------GC--TCA------GCGTGCA-CGCCCGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----CTACCCATCCTCC---------------------ATTCGCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGAA-AT-------TC------ACATCAGC-ATT----GTATCAGCAGGA---------------------------GAGGGCACT----GAGCTGA-CAT-GTACGT--------CACAGAGTCGAGCATGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTGCAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAACCCGC---CCATTAATACAAAA--TCTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATTGTAAACGGAAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAAGGTGGCGCTAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCTAAC-CTCA----------------------CTT-TCTTCACTGT------TT--CGC-GCTCT-----TGT------GAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTAGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CAT--AA---AATGCCTCGCTG-GCCAC----------TACA-CCAG-----CATCA-CTCCACTT------CTTC----ACATGA---------------------------------------------------------------------------------CGCGC-AAACATC-------------GCTC-AAAATCATGACTGACAA-CA-TCCTCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_trigonotidis_CPC_14765_ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAACTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCTGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCACTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTACACAAAAACGCTGGCCAACTTACCGAGACTTTGCGGTCATTGCGGAGAAAGGGTCTTTTAAGTTTCGAAGTCACGATCATTCGGGATGTTCGAGAACGCGAGATCCGTGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTTTTCGTGGTCGACAATAAGCCAGATTCCGCTGATCGTGGCAGTCTCGTACTAAAACAGGATCAGGTCGCTAAACTACACAACGATCAGGAGGCCGCGGCGTCTTTACAAGGCA---TCAGTGAAGAAGACAAAGCTCAACATACCTATGGCTGGATGGGTTTAGTCAATGACGGTGTTGTGGAGTACTTGGACGCGGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGG-------AGCGATCCCG-ACCTCCAACCCTGTGTGAACACATCTCGTTGCTTC-GGGGGTGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATCCTTACGTCGGAGTGAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCCTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTCT-------CCAGTG----ATACATC-------GC--TCA------GCGTGCA-CGCCCGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----CTACCCATCCTCC---------------------ATTCGCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGAA-AT-------TC------ACATCAGC-ATT----GTATCAGCAGGA---------------------------GAGGGCACT----GAGCTGA-CAT-GTACGT--------CACAGAGTCGAGCATGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTGCAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAACCCGC---CCATTAATACAAAA--TCTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATTGTAAACGGAAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAAGGTGGCGCTAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCTAAC-CTCA----------------------CTT-TCTTCACTGT------TT--CGC-GCTCT-----TGT------GAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTAGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CAT--AA---AATGCCTCGCTG-GCCAC----------TACA-CCAG-----CATCA-CTCCACTT------CTTC----ACATGA---------------------------------------------------------------------------------CGCGC-AAACATC-------------GCTC-AAAATCATGACTGACAA-CA-TCCTCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_trigonotidis_CPC_14766_ GCCTCCACACTGTCTCACTTGCGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAACTTCACAATACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCTGAAGGACAGGCTTGCGGTCTTGTGAAGAACCTGTCACTCATGTGCTACGTCTCGGTGGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGCGGTATGGATCTTCTCGAAGAGTACGATCCTGTTCTGGAGCCCAAATCGACCAAGGTTTTCATCAACGGTACCTGGGTTGGTGTACACAAAAACGCTGGCCAACTTACCGAGACTTTGCGGTCATTGCGGAGAAAGGGTCTTTTAAGTTTCGAAGTCACGATCATTCGGGATGTTCGAGAACGCGAGATCCGTGTCTTCACCGATGCTGGACGTGTGTGCCGGCCGCTTTTCGTGGTCGACAATAAGCCAGATTCCGCTGATCGTGGCAGTCTCGTACTAAAACAGGATCAGGTCGCTAAACTACACAACGATCAGGAGGCCGCGGCGTCTTTACAAGGCA---TCAGTGAAGAAGACAAAGCTCAACATACCTATGGCTGGATGGGTTTAGTCAATGACGGTGTTGTGGAGTACTTGGACGCGGAAGAGGAGGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGG-------AGCGATCCCG-ACCTCCAACCCTGTGTGAACACATCTCGTTGCTTC-GGGGGTGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-CAAACACTGCATCCTTACGTCGGAGTGAA-AAGTTAATTGAAC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCGGTGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCCTTTCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTAGG-----TGTCT-------CCAGTG----ATACATC-------GC--TCA------GCGTGCA-CGCCCGCTGACTCC-ATCACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCGATACC-----CTACCCATCCTCC---------------------ATTCGCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGAA-AT-------TC------ACATCAGC-ATT----GTATCAGCAGGA---------------------------GAGGGCACT----GAGCTGA-CAT-GTACGT--------CACAGAGTCGAGCATGGCGATGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCTGCAC--------------------------------------------TTGAAAGA---GCCGC--------CT-TCAACCCGC---CCATTAATACAAAA--TCTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATTGTAAACGGAAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTTTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAAGGTGGCGCTAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCTGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCTAAC-CTCA----------------------CTT-TCTTCACTGT------TT--CGC-GCTCT-----TGT------GAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTAGTGGGC----------------------TGGT-GGGG----TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CAT--AA---AATGCCTCGCTG-GCCAC----------TACA-CCAG-----CATCA-CTCCACTT------CTTC----ACATGA---------------------------------------------------------------------------------CGCGC-AAACATC-------------GCTC-AAAATCATGACTGACAA-CA-TCCTCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_trollii_CBS_109118__ GCCTCCACACTTTCCCATCTGCGGAGAACGAACACGCCTATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTCGTGTGTCCTGCGGAAACGCCAGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAACCAAAGTCGACCAAGGTTTTCATCAATGGTACTTGGGTGGGTGTGCACAAGAATGCTGGACAATTGACTGAGACATTGCGGTCACTGCGGAGGAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGTGTCTTTACTGACGCCGGGCGTGTCTGCCGGCCACTGTTCGTCGTTGACAACAAGCCTGACTCAGCGGAGCGCGGCAGTCTTGTGTTGAGGCAAGATCAGATTGCAAAACTCCAACGCGATCAAGAGAACGCAGCGTCTCTCCGTGGCA---TAAGCGAAGAGGACAAAGCAGAGCATACCTACGGATGGATGGGCTTGGTCAACGAAGGCGTGGTAGAATACCTCGACGCAGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACTCATCATGTTGCTTC-GGGGGCGACCCTGCCGTTCCGACGGCATTCTCCCCGGAGG--TCATC-AAAACACTGCATTCATACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCAGA-----TAGCAGC-------GC--CCA------ATGTGCA-CCCCAGCTGATCCA-ATCACAGCTTCCATCGTCGGCCGACCGCGTCACCATGGGT-ATGCAACATT-----CCACCCATCATCC----------------TCCTCACCCTCAAT?GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTCC-TT-------CA------CCTTCAGC-ATT---------GTCAATACATGGGAA---------------------GAGGAAA----GAGCTGA-CAG-GATATCTAC---CTCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCCTTCATTGAGCCAAAATACGCCGTATGTCCATCA--------------------------------------------AATGA--A---GACAA--------CA-ATACATCAC---ACACTAACACAAGCTATTCTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGTACCATCGAGGTTGACGGCGAGAACGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAGCCAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCTCACT-TCCA------TCACCA----------CTC-CCGTCACTGTCG----CG--CGC-GCAT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGGT--TTTG-AGA--TTTCTGGCTTGGCGTC-----CATGACCTCACT-C-----CAAC-AA---AATGTCTCGCTG-GCCTC----------AGCA-CCAG-----CGTCGCTTTTGCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGTGC-AAATT---------------CACT-CACAACAATGCTGACGA-CC-TCA-CC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAAACCCCAAA Ramularia_trollii_CBS_109119__ GCCTCCACACTTTCCCATCTGCGGAGAACGAACACGCCTATCGGCCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTCGTGTGTCCTGCGGAAACGCCAGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTTTCGGTTGGAACACCAGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAAGAATACGACCCTGTTCTGGAACCAAAGTCGACCAAGGTTTTCATCAATGGTACTTGGGTGGGTGTGCACAAGAATGCTGGACAATTGACTGAGACATTGCGGTCACTGCGGAGGAAGGGACTGCTCAGTTTCGAGGTTACCATCATTCGTGATGTGAGAGAACGTGAGATTCGTGTCTTTACTGACGCCGGGCGTGTCTGCCGGCCACTGTTCGTCGTTGACAACAAGCCTGACTCAGCGGAGCGCGGCAGTCTTGTGTTGAGGCAAGATCAGATTGCAAAACTCCAACGCGATCAAGAGAACGCAGCGTCTCTCCGTGGCA---TAAGCGAAGAGGACAAAGCAGAGCATACCTACGGATGGATGGGCTTGGTCAACGAAGGCGTGGTAGAATACCTCGACGCAGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCG-ACCTCCAACCCTTTGTGAACCCATCATGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCTCCCCGGAGG--TCATC-AAAACACTGCATTCATACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGGGT-------CCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGCGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT-------CCAGA-----TAGCAGC-------GC--CCA------ATGTGCA-CCCCAGCTGATCCA-ATCACAGCTTCCATCGTCGGCCGACCGCGTCACCATGGGT-ATGCAACATT-----CCACCCATCATCC----------------TCCTCACCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTTCC-TT-------CA------CCTTCAGC-ATT---------GTCAATACATGGGAA---------------------GAGGAAA----GAGCTGA-CAG-GATATCTAC---CTCACAGCGTCGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCCTTCATTGAGCCAAAATACGCCGTATGTCCATCA--------------------------------------------AATGA--A---GACAA--------CA-ATACATCAC---ACACTAACACAAGCTATTCTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAACGGTACCATCGAGGTTGACGGCGAGAACGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAGCCAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCCCCATCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCTGTCATCT?????GAGAAGGTAAGA-CCTCACT-TCCA------TCACCA----------CTC-CCGTCACTGTCG----CG--CGC-GCAT------CGC------AAAAAA----TCG-CT-TA-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGGT--TTTG-AGA--TTTCTGGCTTGGCGTC-----CATGACCTCACT-C-----CAAC-AA---AATGTCTCGCTG-GCCTC----------AGCA-CCAG-----CGTCGCTTTTGCTC------CTCC----ACATGC---------------------------------------------------------------------------------CGTGC-AAATT---------------CACT-CACAACAATGCTGACGA-CC-TCA-CC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAAACCCCAAA Ramularia_unterseheri_CBS_117879 GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGACGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCACTGACGGACTTTATGCGACAGCGCGGTATGGATCTTCTGGAAGAATACGATCCTGTGCTCGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGTCGGCCGCTCTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTCGTGCTGAGGCAAGACCAGATCGCTAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTTTACGAGGCA---TCAGTGAAGAAGACAAAGCTCTGCATTCCTACGGTTGGATGGGCTTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCCGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACTTATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCT------CAAGAA-----ACACTGC-------AT--CGA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CACTCCATCCTCA---------------------CCCCCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-AT-------CA------AGAGCAGC-ATC---------AGAATAG---------------------------AGGGTTAAT----GGACTGA-CGT-GGACCCC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGT---GTTTC--------CC-CCAACAAGC---CACTAACACGATCC--TCCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCGGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCC------------------------A-TCACTCGCCG------CTTGCGC-GCTC------TGC------AAAAAA----TCGCTT-TA-T---CACCCCACTGG-------TGGGGGTGC------------------------GC-CTTG------------------CGCCTTGGCAC------CATGACCTCACA-------CATC-AA---AATACCTCGCTG-GCTTC----------AACA-CCAC-----CACAT-CACATCA-------CATC----ACTCGC---------------------------------------------------------------------------------------TCGCACC-------------ACACAAACAACAATGCTGACGA-CT-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_unterseheri_CBS_124826__ GCCTCCACACTCTCCCATTTGCGGAGAACGAACACACCCATCGGCCGTGACGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCACTGACGGACTTTATGCGACAGCGCGGTATGGATCTTCTGGAAGAATACGATCCCGTGTTGGAGCCAAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTGACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGCGGCAGTCTCGTGCTGAGGCAAGACCAGATCGCTAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTTTACGAGGCA---TCAGTGAAGAAGACAAAGCTCTGCATTCCTACGGTTGGATGGGCTTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCCGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACATATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CAAGAA-----ACACTGC-------AT--CGA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CACTCCATCCTCA---------------------CCCCCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-AT-------CA------AGAGCAGC-ATC---------AGAATAG---------------------------AGGGTTAAT----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGT---GTTTC--------CC-CCAACAAGC---CACTAACAAGATCC--TCCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCGGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCC------------------------A-TACTTGCCGC------CG--CGC-GCTG------TGC------AAAAAA----TTGCTT-TA-T---CACCCCTCGCC-------TGGGGC-------------------------TGGT-GGGGT---ATTT-TTT---CGCCTTCTTGGCAC------CATGACCTCACA-AA----CATC------------------------------------AA-CCAC-----CACAA-CATCAC---------TTA----ACTCGC---------------------------------------------------------------------------------------TCGCACC-------------ACACTGCCAACAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_unterseheri_CBS_124838__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCAGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACCTGTCGTTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCACTGACAGACTTTATGCGACAGCGCGGTATGGATCTTCTGGAAGAATACGATCCTGTGCTCGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGGTCGCTGCGTAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGTCGACCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTCGTGCTGAGGCAAGACCAGATCGCTAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTTTACGAGGCA---TCAGTGAAGAAGACAAAGCTCTGCATTCCTACGGTTGGATGGGCTTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCCGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACATATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CAAGAA-----ACACTGC-------AT--CGA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CACTCCATCCTCA---------------------CCCCCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-AT-------CA------AGAGCAGC-ATC---------AGAATAG---------------------------AGGGTTAAT----GGACTGA-CGT-GGACCCC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCAGTATGCCTTCAT--------------------------------------------ATTGAAGT---GTTTC--------CC-CCAACAAGC---CACTAACACGATCC--TCCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCGGCCTCCATCCCATGGAAGGAGTCTGGTGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCCCAT-------------------CAC-TCGCCGTCGC------CGTCCGC-GCTC------TGC------AAAAAT----TCGCTT-TA-T---CACCCCTCGCT-------TTGGTG--C----------------------TGGT-GGGG------------------TCGCTTGGCAC------CATGACCTCACA-CAA---CATCAAA---AATGCCTCGCTG-GCTTC----------AACA-CCAC----------------------------------TTCAC---------------------------------------------------------------------------------------TCGCACC-------------GCAC-CAAAACCATGCTAACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_unterseheri_CBS_124884__ GCCTCCACACTCTCACATTTGCGGAGAACGAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGCGGCAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTAATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACTGACTTTATGCGACAGCGTGGTATGGATCTTCTGGAAGAATACGATCCTGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACCGAGACTTTGCGGTCGCTGCGGAGAAAGGGCCTGCTCAGTTTTGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCCGAGCGCGGCAGTCTCGTGCTGAGGCAAGACCAGATCGCTAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTTTACGAGGCA---TCAGTGAAGAAGACAAAGCTCTGCATTCCTACGGTTGGATGGGCTTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCCGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACATATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CAAGAA-----ACACTGC-------AT--CGA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CACTCCATCCTCA---------------------CCCCCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-AT-------CA------TGAGCAGC-ATC---------AGAATAG---------------------------AGGGTTAAT----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAACGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGT---GTTTC--------CC-CCAACAAGC---CACTAACACGATCC--TCCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCGGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCC------------------------A-TCACTCGCCG------CT--TGC-GCTC------TGC------AAAAAA----TCG-CT--------------------------ATGGTGGGA----------------------TGGT-GGGGG-------------ATCTTCGCTTGGCAC------CATGACCTCACA-------CATC-AA---AATACCTCGCTG-GCTTC----------AACA-CCAC-----CACAT-CACATC-------ACATC----ACTCGC---------------------------------------------------------------------------------------TCGCACC-------------ACACAAACAACAATGCTGACGA-CT-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_unterseheri_CBS_130721__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATCGGCCGTGACGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTAAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCACTGACGGACTTTATGCGACAGCGCGGTATGGATCTTCTGGAAGAATACGATCCTGTGCTCGAGCCGAAATCAACCAAGGTCTTTATTAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGGTCGCTGCGGAGGAAGGGTCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGTCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTCGTGCTGAGGCAAGACCAGATCGCTAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTTTACGAGGCA---TCAGTGAAGAAGACAAAGCTCTGCATTCCTACGGTTGGATGGGCTTGGTCAACGAAGGTGTGGTGGAATACCTCGACGCCGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTAGGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TA-TTCGCAGAGGAGTT--CGAG--TCGTC-GTGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CAAGAA-----ACACTGC-------AT--CGA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CACTCCATCCTCA---------------------CCCCCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-AT-------CA------AGAGCAGC-ATC---------AGAATAG---------------------------AGGGTTAAT----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGT---GTTTC--------CC-CCAACAAGC---CACTAACACGATCC--TCCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCGGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCTCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCT------------------------A-TCACTCGCCG------CT--TGC-GCTC------TGC------AAAAAA----TCG-CC--------------------------ATGGTGGGA----------------------TGGT-GGGGGG------------ATCTTCGCTTGGCAC------CATGACCTCACA-------CATC-AA---AATACCTCGCTG-GCTTC----------AACA-CCAC-----CACAT-CACATC-------ACATC----ACTCGC---------------------------------------------------------------------------------------TCGCACC-------------ACACTGCCAACAATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CBS_131769__ GCCTCCACACTGTCTCACTTACGAAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTATGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACCTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCTGTAAATCGTGGCAGTCTTGTAGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAAA--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGT------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCC-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CBS_131770__ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------CCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAAA--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGT------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCC-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CBS_131771__ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACTATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAGCACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--TGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAACTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAAA--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTCCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CBS_141120 GCCTCCACACTGTCTCACTTACGAAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTATGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGACCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTATTTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ACATGTC-------GT--CCA------GCGTGCA-CGCCAGCTGACTTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GTAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAGA--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATTCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GGGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGT------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACCC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CBS_179.68__ GCCTCCACACTGTCTCATTTACGAAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAACCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTATGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAAGG---AAAGC--------CT-CGTGCATAC---CGTCTAACAAGAGA--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGT------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACCC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CPC_11481_ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTATGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATCAAAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTG-TGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAAA--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGT--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCTTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CPC_11482_ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTATGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATCAAAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTCGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAATG---AAAGC--------CT-CGTACATAC---CGTCTAACAAGAAA--CTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGT--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCTTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CPC_12491_ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAAGG---AAAGC--------CT-CGTGCATAC---CGTCTAACAAGAAA--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CPC_12492_ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCA????????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAAGG---AAAGC--------CT-CGTGCATAC---CGTCTAACAAGAAA--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_uredinicola_CPC_12493_ GCCTCCACACTGTCTCACTTACGGAGAACAAACACACCCATCGGCCGTGATGGCAAGATTGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGCCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAAAACTTGTCGCTCATGTGTTACGTCTCGGTGGGAACGCCAGGCGAGCCGTTGACCGACTTTATGCGACAGCGCGGTATGGATCTCCTTGAAGAGTACGATCCTGTTCTGGAGCCCAAGTCGACCAAAGTCTTCATTAACGGTACTTGGGTCGGTGTGCACAAGAATGCTGGCCAACTCACAGAGACTTTGCGGTCATTGCGAAGGAAGGGTTTGCTAAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAAATCCGGGTCTTCACCGACGCTGGACGTGTCTGCCGGCCGCTGTTCGTCGTTGACAATAAGCCAGATGCCGTAAATCGTGGCAGTCTTGTGGTGCAGCGAGAGCAGCTCCAAAAGCTCGAACATGACCAGGAGATCAAGTCATCTCTGTTAGGCG---TCAGTGAGGAGGATAGAGCACAGCACACATATGGCTGGATGGGTTTGGTCAACGATGGTGTTGTCGAGTACCTGGACGCAGAAGAGGAGGAGACTGCCATG??????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------ATCAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTT-GGGGGCGACCCTGCCGCT--CGCGGCATTCCCCCCAGAGA--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--CCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCTCGTGCTGTCTTCCGTAGG-----TGTTC-------CCATGT----ATATGTC-------AT--CCA------GCGTGCA-CGCCAGCTGAATTC-TTTACAGCATCCATTGTTGGCCGACCGCGCCACCATGGGT-ATGCAATGAT-----CGACCCATCCTCA-------------------CCACCTCGAAT-GGCA-AT-----TCTGACAAGAGCACAGTATCATGATCGGTATGGG?????TTCGCAATGCGTGAGTAGG-AT-------CA------GGAACAGC-TTCA---CTGTGGATATCG---------------------------ATTAGCTGT----GAGCTGA-CAA-CATTGCT------TCTCAGAGTCGAGCACGGCGATGTCACTGTTGTGGCCGTCAACGATCCTTTCATTGAGCCAAGCTACGCGGTATGCAATAC---------------------------------------------CTGGAAGG---AAAGC--------CT-CGTGCATAC---CGTCTAACAAGAAA--TTTCAGGCATACATGCTCAAGTACGACTCCACCCACGGCGTATTCAACGGCACCATTGAGGTCGACGGCGACAAGGGTCTGATTGTCAATGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCCGCGAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTTGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAT-TTC-----------------------GAA-TCTTCGCCGC------CG--CGC-GCTC------TGT------GAAAAA----TCG-CT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-T-----CACC-AA---AATGCCTCGCCG-CCCAC----------AACA-ACAG-----CATAA-TTCCACTC------CTTT----ACACGT---------------------------------------------------------------------------------CGCGC-ATGCGCT-------------CCCC-CAAAATTTTACTGACAA-TG-CCACCT--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCATGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_urticae_CBS_105.26__ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATCGCCAAGCCGAGACAGCTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCCTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGGACGCCCGGCGAGCCACTGACAGACTTTATGCGACAGCGTGGAATGGATCTACTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGAGCACTTACTGAAACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTGAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAGCGTGAGATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTCGTGGTCGATAACAGGCCGGATTCTGCCGAGCGCGGCAGTCTTGTGCTAAGACGGGACCAAGTCGAGAAACTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGATGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATC-CCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TTGGC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCACAC----ATGCAGC-------GC--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATGTC-----CCACCAATCCCCA---------------------ATACGCCAT-GGCA-AT-----TCTGACAGGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTGGA-GT-------CG------GGAGCAGC-TTC---------AGAACAG---------------------------GTGGAATGT----GAGCTGA-CAT-GGAGACA------ATGCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTGTGC--------------------------------------------CACGAAGA---GTCGC--------GT-ACCAGAA-C---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACCAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCGTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CTC-----------------------ACC-TCATCACCGT------TG--CGC-GCCC------TGC------AAAAAA----ATC-GC-CC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-TCCAC----------AACA-CCAG-----CAACA-CTCCACCT------CATC----ACACGT---------------------------------------------------------------------------------CGCTC-GATAGTT-------------TTCG-AGTAACATCACTGACAA-TGTTTCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_urticae_CBS_113974__ GCCTCCACACTCTCCCACTTGCGGAGAACTAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTGAGTTTCGAGGTTACCATCATTCGGGATGTCCGAGAACGTGAGATCCGGGTATTCACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTCCAAGCCGACCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTT-CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGTG---TCGCGAGT-------CCCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGGC-ACGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCAGC-------GC--CTA------GCGTATC-CGCCAGCTGACATT-GTCACAGCATCCATTGTCGGCCGACCACGCCACCATGGGT-ATGCGATGCC-----CCACCAATCCCCA---------------------ATCCTCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAACAGC-TTC---------AGAACAG---------------------------GTGGAATGT----GAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAA--------------------------------------------CACGAAGA---GTCGC--------GT-TCGAAAGCT---CATCTAACTCGATA--TCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CCC-----------------------ACC-TCATCACCGT------CG--CGC-GCAT------TGT-------AAAAA----ATC-GA-CC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAACA-CTCCAACT------CATC----ACACGT---------------------------------------------------------------------------------CGCTC-GATCCTT-------------TGCG-AGTAACATCACTGACAA-TGTTCCCCG--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_urticae_CBS_162.91__ GCCTCCACACTCTCCCATTTGCGGAGAACTAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAAAACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGCGGAGAAAGGGTCTTCTGAGTTTCGAGGTTACCATCATTCGGGATGTCCGAGAACGTGAGATCCGGGTATTCACAGATGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGAAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAACTCCAAGCCGACCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAATGATGGTGTCGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTTT-CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGTG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGGC-ACGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCAGC-------GC--CTA------GCGTATC-CGCCAGCTGACATT-GTCACAGCATCCATTGTCGGCCGACCACGCCACCATGGGT-ATGCGATGCC-----CCACCAATCCCCA---------------------ATCCTCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAACAGC-TTC---------AGAACAG---------------------------GTGGAATGT----GAGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAA--------------------------------------------CACGAAGA---GTCGC--------GT-TCGAAAGCT---CATCTAACTCGATA--TCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CCC-----------------------ACC-TCATCACCGT------CG--CGC-GCAT------TGT-------AAAAA----ATC-GA-CC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA-CCAG-----CAACA-CTCCAACT------CATC----ACACGT---------------------------------------------------------------------------------CGCTC-GATCCTT-------------TGCG-AGTAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_urticae_CPC_14807_ GCCTCCACACTCTCCCATTTGCGGAGAACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCACTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTCATCAACGGTACTTGGGTCGGTGTGCACAAGAACGCTGGAGCACTTACCGAGACTTTGCGGGCGCTGCGGAGGAAGGGTCTTCTCAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATTCGAGTCTTTACCGACGCTGGGCGTGTCTGCCGGCCGCTGTTCGTCGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTTGTGCTGAGACGGGACCAAGTCGAGAAGCTCCAAGCCGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAATGATGGTGTTGTAGAATACCTCGACGCAGAAGAGGAGGAGACCGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTCGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATCCTTACGTCGGAGTAGA-GAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACTACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTCCGATCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGGT-GGGGCCGTT-AAATCTTTCCAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGATGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------CCATAC----ATGCAGC-------GC--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATGTC-----CCACCAATCCCCA---------------------ATCTCCAAT-GGCA-AT-----TCTGACAAGAGCATAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGC-CT-------CA------AGAGCAAC-TTC---------AGAACAG---------------------------GTGGAATGT----GTGCTGA-CAT-GGATACA------ATACAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------GT-TCGAAAAGC---CATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATAGTCGAGTCCACCGGTGTCTTCACCACCACCGACAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CAC-----------------------ACC-TCATCACCGT------CG--CGC-GCTC------CGC------AAAAAA----ATC-AC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGCTGTTTTCG-AGA---TTTTCGCTTGGCGT------CATGACTTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AA------------CACCA-CTCCACCT------CATC----ACACGT---------------------------------------------------------------------------------CGCTC-GATCCTT-------------TTCG-AGTAACATCACTGACAA-TGTTCCCCA--ACAGGAAGCTGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_valerianae_var._valerianae_CBS_109122__ GCCTCCACACTCTCCCATTTGCGGAGGACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAACCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAACACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGAGAAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGACGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGACAATAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCTGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATATACGGATGGATGGGCCTGGTCAATGATGGTGTCGTAGAATATCTCGATGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTCTGTGAACACATCTCGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGGA--TTGCT-ACGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCC-------CCATAC----ATGCGGC-------AC--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATATA-----ACACCAATCCCCA---------------------ACTCCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGTAGC-GCT---------ATAACGA---------------------------TTGGAACAC----AAGCTGA-CAC-GGATACA------ATACAGCGTTGAGCACGGCGACGTCCATGTTGTCGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAGAAAG---AATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCCAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTAGTCATCTCCGCTCCTTCCACCGATGCCCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CTC-GTTT------TGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTTTTTCCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AACATGATGCCTCGATG-GCCAC----------AACA-CCAG-----CGTCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GACCA-T-------------GCCG-AGAAACATCACTGACAA-TG-TCCCCT--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_valerianae_var._valerianae_CBS_109123__ GCCTCCACACTCTCCCATTTGCGGAGGACCAACACGCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTCGTTTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAACCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTATGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTGCACAAACACGCTGGAGCACTTACTGAGACTTTGCGGGCGCTGAGAAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAGATCCGGGTGTTCACAGACGCTGGGCGTGTCTGCCGGCCGCTGTTTGTGGTCGACAATAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCTGATCAGGAGGCTGCGGCGTCGCTACGAGGAG---TCAGTGAAGAGGACAGAGCACAGCACATATACGGATGGATGGGCCTGGTCAATGATGGTGTCGTAGAATATCTCGATGCAGAAGAGGAGGAGACTGCTATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTCTGTGAACACATCTCGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTTGCGCGCCTTAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGGA--TTGCT-ACGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCCC-------CCATAC----ATGCGGC-------AC--CTA------GCGTATC-CGCCAGCTGACACT-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCGATATA-----ACACCAATCCCCA---------------------ACTCCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-GT-------CA------AGAGTAGC-GCT---------ATAACGA---------------------------TTGGAACAC----AAGCTGA-CAC-GGATACA------ATACAGCGTTGAGCACGGCGACGTCCATGTTGTCGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTCGC--------AT-TCGAGAAAG---AATCTAATTCGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCCAGAAGGTCCGCTTCCACACCGAGCGTGACCCCGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTAGTCATCTCCGCTCCTTCCACCGATGCCCCCATGTTCGTCATGGGTGTCAACCACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CCCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CTC-GTTT------TGC------AAAAAA----ATC-GC-TC-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGTTTTTCCG-AGA---TTTTCGCTTGGCGT------CATGACCTCACA-C-----CACC-AACATGATGCCTCGATG-GCCAC----------AACA-CCAG-----CGTCA-CTCCACCT------CATC----ACATGT---------------------------------------------------------------------------------CGCTT-GACCA-T-------------GCCG-AGAAACATCACTGACAA-TG-TCCCCT--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAA Ramularia_vallisumbrosae_CBS_271.38__ ????????ACTTTCCCATTTGAGGAGAACAAACACACCTATCGGTCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCAGAAGGACAAGCTTGTGGTCTGGTGAAGAATCTGTCGTTGATGTGTTACGTCTCGGTTGGAACACCAGGAGAGCCACTGACAGACTTTATGCGACAGCGTGGCATGGATCTTCTAGAAGAATATGATCCCGTACTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACATGGGTTGGTGTACACAAGAATGCCGGACAACTTACCGAAACCTTGCGATCACTTCGAAGGAAGGGCTTGCTCAGTTTCGAGGTTACTATCATTCGGGATGTGAGAGAACGTGAAATTCGGGTCTTTACGGATGCTGGACGTGTCTGCCGACCGCTCTTCGTGGTCGACAACAAGCCCGACTCTGCTAATCGTGGCAGTCTCGTGCTGGTGCGAGAGCAGATCGAAAAACTCCGACACGATGAAGAGACTGCAGCGTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCACACTTACGGCTGGATGGGCTTGGTCAACGATGGCGTGGTAGAGTACCTCGACGCCGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAAGA-----TAGCAAC-------AC--CGA------TCATGCT-TACCAGCTGACTCC-ATCGCAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCACC-----CCACCCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATTGGTATGGG????????GCAATGCGTAAGTTGC-TT-------AA------GCTGTATC-ATT---------GATATGGAGG--------------------------AAGGAAT----GAGCTGACAAA-GATACC-------TCACAGCGTTGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGAGAAGCA--------------------------------------------ACAAA--G---TCACG--------CC-TTTAATACT---CCACTAACAATTTT---GTTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACTTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-ATCACCCT---------------CTCCAT-CCATCAATGT------CG--CGC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGGT--TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CTAC-AA---CGTGTCCCGCTG-GGGTC----------GACA-TCAG-----CAGCATCTTTACCT------CCAC----TCGTGT---------------------------------------------------------------------------------CGTAC-CAATATA--------------CCC-GACGACAATGCTGACGA-TC-CCACCT--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vallisumbrosae_CBS_272.38__ ????????ACTTTCCCATTTGAGGAGAACAAACACACCTATCGGTCGTGATGGTAAGATCGCCAAGCCGAGACAGCTTCACAACACCCATTGGGGTCTTGTGTGTCCGGCAGAAACGCCAGAAGGACAAGCTTGTGGTCTGGTGAAGAATCTGTCGTTGATGTGTTACGTCTCGGTTGGAACACCAGGAGAGCCACTGACAGACTTTATGCGACAGCGTGGCATGGATCTTCTAGAAGAATATGATCCCGTACTGGAGCCCAAGTCGACCAAGGTTTTCATCAACGGTACATGGGTTGGTGTACACAAGAATGCCGGACAACTTACCGAAACCTTGCGATCACTTCGAAGGAAGGGCTTGCTCAATTTCGAGGTTACTATCATTCGGGATGTGAGAAAACGTGAAATTCGGGTCTTTACGGATGCTGGACGTGTCTGCCGACCGCTCTTCGTGGTCGACAACAAGCCCGACTCTGCTAATCGTGGCAGTCTCGTGCTGGTGCGAGAGCAGATCGAAAAACTCCGACACGATGAAGAGACTGCAGCGTCCCTCCGAGGCA---TAAGCGAGGAGGACAGAGCAGAGCACACTTACGGCTGGATGGGCTTGGTCAACGATGGCGTGGTAGAGTACCTCGACGCCGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTAGGG-------AGCAATCCCGAACCTCCAACCCTTTGTGAACGCATCATGTTGCTTC-GGGGGCGACCCTGCCGTTTCGACGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGTTT------CCAAGA-----TAGCAAC-------AC--CGA------TCATGCT-TACCAGCTGACTCC-ATCGCAGCGTCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCAGCACC-----CCACCCATCCTCC---------------------TCCCTCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG????????GCAATGCGTAAGTTGC-TT-------AA------GCTGTATC-AAT---------GATAAGGAGG--------------------------AAGGAAT----GAGTTGACAAA-GATACC-------TCACAGCGTTGAGCACGGCGACGTCACTGTCGTGGCTGTCAACGACCCTTTCATTGAGCCAACCTACGCTGTATGAGAAGCA--------------------------------------------ACAAA--G---TCACG--------CC-TTTAATACT---CCACTAACAATTTT---GTTAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTTGACGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCGCCAACATCCCCTGGGCGGAGTCCAAGGCCGACTACATTGTTGAGTCGACCGGTGTCTTCACCACCACCGAAAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTTGTCATTTCCGCTCCATCCGCCGACGCTCCCATGTTCGTCATGGGCGTCAACAACAAGACCTACACTTCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-ACACACC-ATCACCCT---------------CTCCAT-CCATCAATGT------CG--CGC-GCCT------TGC------GAAAAA----TCG-CT-TA-T---CACCCCTCGCC-------TTGGTGGGC----------------------TGGT-GGGGGT--TTTG-AGA--TTTTTGGCTTGGCGT------CATGACCTCACT-T-----CTAC-AA---CGTGTCCCGCTG-GGGTC----------GACA-TCAG-----CAGCATCTTTACCT------CCAC----TCGTGT---------------------------------------------------------------------------------CGTAC-CAACATA--------------CCC-GACGACAATGCTGACGA-TC-CCACCT--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_variabilis_CBS_141121___ GCCTCCACACTCTCCCATCTGCGGAGAACCAACACTCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTCTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTAGGTGTGCACAAAAACGCTGGAGCACTGACTGAGACTCTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAAATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGGG---TCAGTGAAGAGGATCGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAACGAGGGTGTTGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------ACATAC----ATGTGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-TT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATATAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTTGC--------AT-TCGAAAACT---CATCTAACACGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCAT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AATATCCAG-----CATCA-TTCCACCT------CATC----ATATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_variabilis_CPC_16865_ GCCTCCACACTCTCCCATCTGCGGAGAACCAACACTCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTCTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTAGGTGTGCACAAAAACGCTGGAGCACTGACTGAGACTCTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAAATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGGG---TCAGTGAAGAGGATCGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAACGAGGGTGTTGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------ACATAC----ATGTGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-TT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATATAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTTGC--------AT-TCGAAAACT---CATCTAACACGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCAT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AATATCCAG-----CATCA-TTCCACCT------CATC----ATATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_variabilis_CPC_16866_ GCCTCCACACTCTCCCATCTGCGGAGAACCAACACTCCTATTGGTCGTGATGGTAAGATTGCCAAGCCGAGACAGCTTCACAACACCCACTGGGGTCTTGTCTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGGCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACGCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGAATGGATCTTCTCGAAGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTGTTTATCAACGGTACTTGGGTAGGTGTGCACAAAAACGCTGGAGCACTGACTGAGACTCTGCGGGCGCTGCGGAGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATTCGCGATGTCCGAGAACGCGAAATCCGGGTGTTCACAGATGCTGGGCGTGTCTGCCGGCCGCTATTCGTGGTCGATAACAAGCCGGATTCTGCCGAGCGCGGCAGTCTCGTGCTGAGACGGGACCAAGTTGAGAAACTTCAAGCCGATCAAGAGGCTGCGGCGTCGCTACGAGGGG---TCAGTGAAGAGGATCGAGCACAGCACATCTACGGATGGATGGGTCTCGTCAACGAGGGTGTTGTGGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGACAA---ATTTCGCAGTGGAGTT--CGAG--TCGAC-ATGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTC-------ACATAC----ATGTGGC-------GC--CTA------GCGTATC-CGCCAGCTAACACA-GTCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGATATC-----CCACCAACCCTTA---------------------ACCTCCAAT-GGCA-AT-----TCTGACAAGAGCGTAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGA-TT-------CA------AGAGCAGC-TTT---------GGAATGG---------------------------TTGGAACGT----GAGCTGA-CAT-GGATACA------ATATAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGCCTTTAC--------------------------------------------CAAGAAGA---GTTGC--------AT-TCGAAAACT---CATCTAACACGATA--TTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGACGGCGACAAGGGTCTGATCGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCTGCCAACATCCCCTGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCTGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCGAC-CTC-----------------------ACC-TCATCACCGT------CG--CAC-GCCT------CGC-------AAAAA----ATC-GC-TC-T---CACCCCTCGC--------TTGGTGGGC----------------------TGGT-GGGGTGTTTTTG-AGA---TTTTCGCTTGGCAT------CATGACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AATATCCAG-----CATCA-TTCCACCT------CATC----ATATGC---------------------------------------------------------------------------------CGCTA-AATAATC-------------TTCG-AGGAACATCACTGACAA-TGCTCCTCA--ACAGGAAGCCGCTGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_veronicicola_CBS_113981__ GCCTCCACTCTGTCACATTTGCGGAGAACAAATACTCCCATTGGCCGTGATGGTAAGATTGCCAAGCCGAGACAACTCCACAACACCCACTGGGGTCTTGTGTGTCCGGCAGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTCATGTGCTACGTCTCGGTGGGAACTCCAGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGTATGGATCTTCTCGAGGAGTACGACCCTGTTCTGGAGCCCAAGTCGACCAAGGTCTTCATCAACGGTACTTGGGTCGGTGTACACAAGAACGCCGGGGCACTTACCGAGACCTTGCGATCGTTGCGGCGAAAGGGTCTCCTGAGTTTCGAGGTCACCATCATCCGTGATGTTCGAGAGCGCGAGATTCGGGTCTTTACCGACGCTGGGCGTGTCTGTCGACCGCTCTTTGTGGTCGACAATAAGCCCGATTCTGCCGAACGCGGCAGTCTTGTGCTGAGGCGGGACCAGGTTGAAAAGCTTCAAGGCGATCAGGAGGCTGCCGCGTCGTTGCGAGGAATTCTCAGTGAAGAGGAAAAAGCACAACAAACCTACGGCTGGATGGGTCTGGTCAACGATGGCGTGGTAGAATACCTCGACGCAGAAGAGGAGGAGACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG------TTAAAAGCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTCTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGGC-ATGGCCGTT-AAATCTTTTAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTCCT-----CCATAC----ATACGGT-------TC--GCT------GCGGACC-CGCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCCATAC------CCACCTATTCTCC-------------------ACCCCTCCAGG-GGCA-AT-----TCTGACAGGAGCGTAGTATCATGATCGGTATGGG???????CGCAATGCGTGAGTAGA-CT-------CC------AGATTGGC-ATC---------AGAATGG---------------------------ATGGAATGT----GAGCTGA-CAT-GGATAT--------TCCAGCGTCGAGCACGGCGACGTCACTGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCCGTATGTCTTCAC--------------------------------------------CGGAAAGA---GTGGC--------CT-CCCATAC-C---CCACTAACATCATA--TCCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTCTTCAAGGGCACCATCGAGGTGGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATTGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATTTCCGCACCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACAACAAGACGTACACCTCAGACATTCCCGTCATCT?????GAGAAGGTAAGA-GTCCGAC-GTTATA--------------------TCA-TCACTGTCGT------CG--CGC-GCCA------GGCA-----AAAAAA----TCG-AT-TG-T---CACCCCTCGC--------CTGGTGGGC----------------------TGGT-GGGGGT--TCCG-AGA---TTTTCGCTTGGCGT------CATTACCTCACA-C-----CACC-AA---AATGCCTCGCTG-GCCAC----------AACA---------ACATCA-CTCCACTT-------TTC----ACATGC---------------------------------------------------------------------------------CGGTC-GATTACA-------------AGCCGAGAACATCAACTGATAC-TG-TCACCT--GCAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_115981__ GCCTCCACACTCTCACATTTGCGGAGAACGAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAGCTCACAGAGACTTTACGGTCTCTGAGGAGAAAGGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGGCAAGACCAGGTTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCGTCTCTACGAGGCA---TCAGCGAAGAAGACAAAGCTCTTCATTCTTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACAAATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CTAGAA-----ACAATGCG-----TAT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAACC-----CACTCCATCATCA--------------------ACCCGCAAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AG-------CA------AGGGTAGC-ATG---------ATAATGG---------------------------AGGAATGGC----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CCAACATCC---AACTAATGTGATGT--GTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTTC------------------------A-TCACTTTCGT------CG--CGC-GCTC------TGC------AAAAAA----TTGCTTATC-A---CCCCTCTCGCC-------TTGGTGGGC---------------------ATGGT-GGGG-----------------TTCGCTTGGCAC------CATGACCTCACA-CAA---CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCAC-----CACAA-CACCAC-----------------TTCAC---------------------------------------------------------------------------------------TCGCACC-------------GCAC-CAAAACCATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_115982__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGGCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTGGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACTTTGCGGTCTCTGAGGAGAAAGGGCCTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCAGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGGCAAGACCAGATTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTCTACGAGGCA---TTAGTGAAGAAGACAAAGCTCTGCATTCCTACGGCTGGATGGGCCTGGTGAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------TCAGAA-----ACAATGC-------AT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAATC-----CACTCCATCATCA--------------------ACCCACAAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-CG-------CA------AGAGTAGC-ATG---------AGAATGG---------------------------AGGAATGGC----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CCAACATCC---AACTAAGGTGATGT--GTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCC------------------------A-TCACTTTCGT------CG--CGC-GCTC------TGC------AAAAAT----TCGCTT-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG------------------TCGCTTGGCAC------CATGACCTCACA-CAA---CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCAC-----CACAA-CACCAC-----------------TTCAC---------------------------------------------------------------------------------------TCGCACC-------------GCAC-CAAAACCATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_117798 GCCTCCACACTCTCACATTTGCGGAGAACGAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAGCTCACAGAGACTTTACGGTCTCTGAGGAGAAAGGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGGCAAGACCAGGTTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCGTCTTTACGAGGCA---TCAGCGAAGAAGACAAAGCTCTTCATTCTTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACAAATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------TCAGAA-----ACAATGC-------AT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAATC-----CACTCCATCATCA--------------------ACCCACAAAT-GGCA-AC-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AG-------CA------AGAGTAGT-ATG---------AGAATGA---------------------------AGGAATGGT----GGACTGA-CGT-GGACACC------TCGCAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CTAAAATCC---AACTAATGTGATTT--CTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCTATC-------------------ATT-CGCCGTCGGT------AG--CGC-GCTC------TGC------AAAAAA----TCACCC---CT---CTCTGGTGGGC-------ATGGTGGGG----------------------TGTT-CGAGA---TTTT-CGC---TTGTCGCTTGGCAC------CATGACCTCACA-A-----CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCAC-----CACAA-CACCAC--------CACAA------------------------------------------------------------------------------------------------CATCACC-------------GCAT-CAAAACCATGCTGACGA-CC-TTCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_117871 GCCTCCACACTCTCACATTTGCGGAGAACGAACACACCCATTGGCCGTGACGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAGCTCACAGAGACTTTACGGTCTCTGAGGAGAAAGGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGGCAAGACCAGGTTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCGTCTCTACGAGGCA---TCAGCGAAGAAGACAAAGCTCTTCATTCTTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------TCAGAA-----ACAATGC-------AT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAATC-----CACTCCATCATCA--------------------ACCCACAAAT-GGCA-AC-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-AG-------CA------AGAGTAGT-ATG---------AGAATGA---------------------------AGGAATGGT----GGACTGA-CGT-GGACACC------TCGCAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CTAAAATCC---AACTAATGTGATTT--CTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACATACACATCCGACATTCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCC------------------------A-TCACTTTCGT------CG--CGC-GCTC------TGC------AAAAAT----TCGCTT-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG------------------TCGCTTGGCAC------CATGACCTCACA-CAA---CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCTT-----AACAC-CACTTC----------------ACTCGC---------------------------------------------------------------------------------------TCGCACC-------------ACA--CAAAACCATGCTGACGA-CC-TTCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_117872__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGGCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAACAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGCGGCATGGATCTTCTCGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCACAAGAACGCTGGTCAACTCACAGAGACATTGCGGTCTCTGAGGAGAAAGGGCTTGCTCAGTTTTGAGGTTACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGGCGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGACAAGACCAGATTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCATCTCTACGAGGTA---TTAGTGAAGAAGACAAAGCTCTGCACTCCTACGGCTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACAAATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTTAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------TCAGAA-----ACAATGC-------AT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAATC-----CACTCCATCATCA--------------------ACCCACAAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTAAGTAGT-CG-------CA------AGAGTAGC-ATG---------AGAATGG---------------------------AGGAATGGC----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CCAACATCC---AACTAATGTGATGT--GTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTTC------------------------A-TCACTTTCGT------CG--CGC-GCTC------TGC------AAAAAT----TCGCTT-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGG------------------TCGCTTGGCAC------CATGACCTCACA-T-----CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCAC-----CACCA-TATCATCA------CTTC----ACTCAC---------------------------------------------------------------------------------------TCGCACC-------------ACA--CAAAACCATGCTGACGA-CC-TCACCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_vizellae_CBS_130601 GCCTCCACACTCTCACATTTGCGGAGAACGAACACACCCATTGGCCGTGATGGCAAGATTGCCAAGCCGCGACAGCTCCACAACACTCATTGGGGTCTCGTGTGTCCGGCCGAAACGCCCGAAGGACAGGCTTGCGGTCTGGTGAAGAACTTGTCGCTGATGTGCTACGTTACGGTTGGAACACCTGGCGAGCCATTGACAGACTTTATGCGACAGCGTGGCATGGATCTTCTCGAAGAATACGATCCCGTGTTGGAGCCGAAATCAACCAAGGTCTTTATCAACGGTACTTGGGTTGGTGTGCATAAGAACGCTGGTCAGCTCACAGAGACTTTACGGTCTCTGAGGAGAAAGGGCCTGCTCAGTTTCGAGGTCACCATCATTCGTGATGTCCGAGAACGCGAGATCAGAGTCTTTACCGATGCTGGACGTGTTTGCCGGCCGCTTTTCGTGGTTGACAACAAGCCAGATGCCGCTGAGCGTGGCAGTCTTGTGCTGAGGCAAGACCAGGTTGCGAAGCTGCAGCAAGATCAGGAGAATGCTGCGTCTCTACGAGGCA---TCAGCGAAGAAGACAAAGCTCTTCATTCTTACGGTTGGATGGGCTTGGTCAATGAAGGTGTGGTAGAGTACCTCGACGCTGAAGAGGAAGAAACTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTTCGGGGGC-AATCCCAGTCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTATTACGTCGGAGTAAA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGTTTGACCC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TTGGA-TCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTCTTCCGTGAG-----TGCTT------CTAGAA-----ACAATGCG-----TAT--CCA------GCGTGCC-CGCTTGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ATGCGAAACC-----CACTCCATCATCA--------------------ACCCGCAAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTAGT-CG-------CA------AGAGTAGC-ATG---------AGAATGG---------------------------AGGAATGGC----GGACTGA-CGT-GGACACC------TCACAGCGTCGAGCACGGCGACGTCAATGTTGTGGCCGTCAACGACCCTTTCATTGAGCCAACCTACGCGGTATGCCATCAT--------------------------------------------ATTGAAGC---TTCTT--------CC-CCAACATCC---AACTAATGTGATGT--GTCCAGGCATACATGCTCAAGTACGACTCGACCCACGGCGTGTTCAACGGCACCATCGAGGTCGACGGCGAGAAGGGCCTGATTGTCAACGGCAAGAAGATCCGCTTCCACACCGAGCGCGACCCAGCCTCCATCCCATGGAAGGAGTCTGGCGCCGACTACATTGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCCAAGAAGGTCGTCATCTCCGCTCCCTCCGCCGATGCGCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACATCCGACATCCCCGTCATCT?????GAGAAGGTAAGA-CTCCCGC-CTCTATC-------------------ATT-CGCCGTCGGT------CG--CGC-GCTC------TGC------AAAAAA----TCACCC---CT---CTCTGGC-GGC-------ATGGTGGGG----------------------TGTT-TGAGA---TTTT-CGC---TTGTCGCTTGGCAC------CATGACCTCACA-T-----CATC-AA---AATGCCTCGCTG-GCTTC----------AACA-CCAC------ACAA-TATCAC--------ATCA----CTTCAC---------------------------------------------------------------------------------------TCGCACC-------------ACAT--AAAACAACGCTGACGA-CC-TTCCCC--ACAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAA Ramularia_weberiana_CBS_136.23__ GCCTCCACACTCTCCCATTTGCGGAGAACAAACACACCCATTGGCCGTGATGGTAAGATTGCCAAGCCACGTCAACTCCACAACACCCACTGGGGACTCGTATGTCCGGCAGAAACGCCCGAAGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCGTTGATGTGCTACGTCTCGGTCGGAACACCAGGCGAGCCACTAACAGACTTTATGCGACAGCGTGGGATGGACCTTCTCGAAGAATACGATCCTGTTTTGGAGCCAAAGTCAACCAAGGTCTTCATCAACGGTACTTGGGTTGGTGTGCATAAGAACGCTGGTCAACTGACCGAGACCCTGCGGTCGCTGCGTAGGAAGGGTCTGCTCAGTTTCGAGGTCACTATCATTCGTGATGTGAGAGAACGTGAGATCCGAGTTTTCACCGATGCTGGACGTGTCTGCCGGCCGTTGTTTGTGGTTGATACCAAGCACGACTCCGCTGAGCGCGGCAGTCTCATACTGCGTCGGGATCAGGTCACGAAACTTGAACAAGATCAGGAGGCCGCCGCATCTTTAAGAGGTA---TCAGTGAGGAAGACAGAGCCGAGCATATCTATGGCTGGATGGGTCTGGTCAATGAGGGTGTGGTGGAATACCTCGACGCAGAAGAGGAGGAGACGGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGG-------AGAAATCCCG-ACCTCCAACCCTTTGTGAACACATCTTGTTGCTTC-GGGGGCGACCCTGCCGTT--CGCGGCATTCCCCCCGGAGG--TCATC-AAAACACTGCATTCTTACGTCGGAGTATA-AAGTTAATTTAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCG---TCGCGAGT-------CTCTCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTTC-GTCTCCCAGCGTTGTGGCAAC-TATTTCGCAGTGGAGTT--CGAG--TCGTC-GCGGCCGTT-AAATCTTTCAAAGGTTGACCTCGGATCAGGTAGGGATA?????TTTCGCCGGTGACGATGCGCCCCGCGCTGTTTTCCGTGAG-----TGTTT------CCCATA-----TGATAGC-------AT--CCA------GCGTGCA-CGCCAGCTGACTCC-ATCACAGCATCCATTGTCGGCCGACCGCGCCACCATGGGT-ACGCAACATC-----CCACCCACCTTTC---------------------CCACCCAAT-GGCA-AT-----TCTGACAAGAGCGCAGTATCATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTC-TC-------CA------GTATCAAC-ATT---------GATCAGGAAGG-------------------------AGCAGAA----GAGCTGA-CAG-GATAAC-------ATACAGCGTCGAGCACGGCGACGTCAATGTCGTGGCTGTCAACGACCCTTTCATCGAGCCCACCTACGCCGTATGTCCACCA--------------------------------------------ATACAACC--ATCCAG--------TC-TTGTATCATCCACCACTAACATCAAT----CTAGGCCTACATGCTCAAGTACGACTCCACCCATGGAGTCTTCAAGGGCACCATCGAGGTCGACGGTGACAAGGGCCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGCGACCCCTCTACCATTCCCTGGGGCGAGTCCAAGGCCGACTACATCGTCGAGTCGACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGAGGCGCCAAGAAGGTCGTCATCTCCGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACAACAAGACCTACACCTCCGACATCCCCGTCATCT?????GAGAAGGTAAGC-ATTCTCA-TCACTTC-------------------CCT-CCATTGCTGT------CG--CGC-GCCT------GGT------CAAAAA----TCG-CT-TA-T---CACCCCTCGCT-------TTGGTGGGC----------------------TGGT-GGGGG---TTTG-AGA--TTTTCCGCTTGGCGT------CATGACCTCACA-C-----CAGC-GA---ATTGCTTCTCTG---CCC----------AACG-CTAG-----CCATTATTCCAACT------CTCC----ACATGC---------------------------------------------------------------------------------CGACC-AAACAAT--------------TTG-CACAACAATGCTGACGA-CC-TCACCC--ATAGGAAGCCGCCGAGCTTGGCAAGGGCTCTTTCAAGTATGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATCGCCCTCTGGAAGTTCGAGACCCCTAA Zymoseptoria_halophila_CBS_128854 GCCTCCACATTGAGTCATTTGCGGCGAACGAACACTCCTATCGGCCGTGATGGCAAGATTGCGAAGCCGCGACAGTTGCACAACACTCATTGGGGGCTTGTATGCCCGGCCGAAACGCCCGAAGGACAAGCCTGTGGATTGGTGAAGAACCTGTCACTGATGTGCTATGTGACTGTCGGAACCCCCGGCGAGCCCATCGTTGACTTCATGCGGCAACGTGGAATGGATCTCCTAGAAGAGCACGATCCGAACCAGGTCAAGGATGCGACGAAGGTCTTCCTGAACGGTACCTGGGTGGGTGTACACAAGAATGCCGGACAGCTCACAGAGACGTTGCGACAACTCCGGCGAAAGGGTCTGCTCAGTTTCGAAGTGACCATCATTCGGGATGTGCGCGAACGTGAGATTCGGGTCTTTACAGATGCCGGCCGTGTCTGCCGACCTTTGTTCGTGGTGGACAACAATCCCAAATCACTAGAGCAGGGCACACTCGTGTTGAAGCAGGAACACGTTGAGAGACTCCAGCAAGATCAGGAGCTTCTTGCCTCGCTCGAAGGCG---TCAGTGAAGAAGACCGCGAGCAGCAGCTTTTCGGCTGGAAGGGCCTAGTCACCAGTGGTGTTGTGGAGTACCTTGATGCCGAAGAGGAGGAAGTTGCCATGA?????TAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGG-----CCTCCGGGTCCG-ACCTCCAACCCTTTGTGAACACATCCCGTTGCTTC-GGGGGCGACCCTGCCGGG--CG--------CCCCCGGAGG-ACCATCAAAAACGCTGCATCTCTGCGTCGGAGTTTACGAGTAAATCGAAACAAAACTTTCAACAACGGATCTCTTGGTTCAGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCCGTTCGAGCGTCATTACACCACTCCAGCCTCGCTGGGTATTGGGCGTCTTCGCGGGGGAGCAATCCCCCGCGCGCCTCAAAGT-CTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCATCACGTCTCGCCGCGGAGTTTTCGAG--CCCTT-ACGGCCGTTAAATCACACCTCAGGTTGACCTCGGATCGGGTAGGGATA?????TTTCGCCGGTGACGATGCACCCCGCGCTGTCTTCCGTGAG-----TCTCA------ACAACAGGTCAACACACT--------------------CAGCGCC-AGCTAGCTGACCCT-CCCACAGCATCCATTGTCGGCCGACCGCGCCACCACGGGT-ATGCGATACT------CACTCTTCCTTC---------------------GCATTCGAC-GACTCAA-----CTAACCCCACCTACAGAATTATGATCGGTATGGG?????TCCGCAATGCGTGAGTCTT-TG-------GA------GAATGAGC-ATG---------GAAGTGA-----------------------------GAGCAAG----AGACTGA-CGA-TACA-TC---------CAGCGTCGAGCACGGCGATGTCACCGTCGTCGCTGTCAACGATCCTTTCATTGAGCCAACCTACGCCGTGAGTGAACTCCACAC--------------------------------TCGTCAAGAGGAAGA---GCAGCGACAAGGACG-AGCATCAGC---AGACTGACCACATA---CCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGAGTGTTCAAGGGCACCATCGAGGTCGATGGCGACAAGGGTCTGATTGTCAACGGCAAGAAGGTCCGCTTCCACACCGAGCGTGACCCGGCCAACATCCCATGGAAGGAGTCCGGCGCCGACTACATCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTTCCGCCCACTTGAAGGGTGGCGCGAAGAAGGTCGTCATCTCCGCCCCATCCGCCGATGCTCCCATGTTCGTCATGGGCGTGAACAACAAGACCTACACCTCCGACATTCCCGTGATCT?????GAGAAGGTGAGCAATTCATT-CCT-------------------------G-GCGCCTTTGCGC----TG-CCATCACAA---------------CGAAAAATTCTCGCCT-CG-T---CACCCCTCT------------GCGGGCGGAGGGGCAATCTTCGTATTT-TGGT-GGGG----TTTG-AGATTTTTGGCGCTTGACCGCT----TTGGGTCTCCGC-C-----TCCA-AT--CCCAGCCCCACCA-ATCGCCTCGCCGTCGGGCA-GCAA-----CACAA-TATCATTC-----ACTTG--ATGCCTGT---------------------------------------------------------------------------------CACAT-GCGAAAT------------------AAAAAAATCGTTACTGA-CA-ATCATT--TCAGGAAGCCGCCGAGCTTGGCAAGGGCTCCTTCAAGTATGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACTATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45217] TITLE Combined_LSU_and_rpb2_alignment; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1367; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Acrodontium_crateriforme_CBS_144.33_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACACTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATACGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CBS_151.58_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTCCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTATCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACATTCGGCTGGCACGGGCTCGTCAAACAAGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CBS_840.71_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACACTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATACGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CBS_842.71_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACACTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTTTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCAATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CBS_985.70_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACACTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATACGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CPC_11509_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGCCTGGTCTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CPC_11519_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGCCTGGTCTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CPC_22172_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGCCTGGTTTGTCCGGCCGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTAGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGTTACTTGAAGAATACGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACTTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CPC_25894 AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGTCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTCAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCATTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAGTCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_crateriforme_CPC_25895 AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCAG-CTG-GCACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-CGACAGGCCAGCATCGTTTGGGATCGCCGGATAAAGGCCCTGGAAATGTAGCTCCTC------GGAGTG-TTATAGTCCTAGGCACAATACGGCGCATCCCGAGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTCGGGTGTTAAACCCCTACGCGCAATGAAAGTGAACGGAGGTGGGAACT---TTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCAAAACCTCGACAACTGCACAACACACATTGGGGCCTGGTTTGTCCGGCTGAAACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAAAACTTGGCTCTCATGTGCTACGTCTCGGTTGGAACACCTGGTACTCCTCTGATTGACTACATGCGATACAGAGGCATGGAGCTACTTGAAGAATATGACCCAGTCGTCAACCCGAACGCCACAAAGGTCTTCCTTAACGGAACCTGGGTTGGTGTTCATAATAACGCCACTCAATTGACGGATGCTCTCAAGGATCTTCGGCGAAAGGGA---------ACCATCGGCTTCGAAGTCACCATCATTCGCGACGTGCGTGAGCGCGAGATCAAGGTCTTCACAGATGCCGGCCGTGTGTGCCGTCCTCTCTTTGTCGTTGATAA---CGCAAAGTCAAGTCCAAATCGTGGCAATCTAGCTTTAAAACAGGAGCACATTACCCGATTGGACCAAGACCGAGCAGTGATAAAAGAAATGGAAGGCCAATCCATGAGCGAGGAAGACAGGAAAGAAAGGACCTTCGGCTGGCACGGGCTCGTCAAACAGGGTGTCATCGAATACTTGGATGCCGAAGAAGAAG Acrodontium_fagicola_CBS_714.79_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG-TTGTGCACCCTACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGACGGTGTTCCCCCGGTCTTCTGACCGGGTCACTCGCCGC-CGACAGGCCAGCATCATCTGGGACCGCCGGATAAAGGCCACGGGAATGTAGCTCCTC------GGAGTA-TTATAGCCCGCGGCACAATACGGCGCGCCCCGGGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGGAATGAAAGTGAACGGAGGTGGGACCCG--CAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCTAAACCTCGACAGCTGCACAATACACACTGGGGTCTTGTATGTCCAGCCGAGACACCGGAAGGACAAGCTTGTGGCCTTGTCAAGAATTTGGCGCTCATGTGTTATGTTTCAGTCGGCACTCCCGGTACGCCTCTCATTGATTACATGCGATACAGGGGAATGGAACTCTTGGAGGAATACGACCCTGTTGTCAATCCAAACGCGACCAAGGTATTCCTCAACGGAACATGGGTGGGTGTGCACAGCAATGCCACGCAATTAACGGAAGCCCTTCGAGATCTGAGACGAAAGGGA---------ACCATCGGTTTCGAAGTCACTATCATTCGCGATGTCCGTGAGCGCGAGATTAAGGTTTTTACCGACGCCGGTCGTGTCTGTCGCCCTCTGTTCGTTGTCGACAA---TGCCAAGTCGAGTCCCAACCGTGGCAACCTCGCGTTGAAGCAAGAGCATATCTCACGACTTGTGGAGGACCAGTCAATAATTTCAGGCATGGAAGGTCAAGCGATGAGTGAAGAAGCAAGGAGAGAACTCACGTTCGGCTGGCACGGTCTTGTGAAACAGGGTGTCATCGAATACCTGGATGCAGAGGAAGAAG Acrodontium_luzulae_CBS_839.71_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG-TTG-GCACCTGTAACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGTGTTCCCCCGGTCTTCTGACCGGGTCACTCGCCGC-CGGCAGGCCAGCATCATCTGGGAGCGCCGGATAAAGGTTGGGGAAATGTAGCTCCTC------GGAGTA-TTATAGTCCCCGGCACAATACGGCGCCTCCCGGGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCCAAACCCCGACAACTGCACAACACTCATTGGGGTCTTGTGTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTCAAAAATTTGGCACTCATGTGCTACGTCTCCGTCGGTACCCCAGGTACCCCTCTCATCGACTACATGCGATACAGAGGAATGGAGCTTCTTGAGGAGTACGATCCGGTCGTTAATCCGAATGCGACAAAGGTATTCCTTAACGGAACGTGGGTCGGTGTCCACAGCAATGCCACACAGTTGACAGAAGCCCTTCGCGATCTCAGACGAAAGGGT---------ACCATTGGTTTCGAAGTCACGATTATTCGAGACGTCCGTGAACGCGAGATCAAGGTCTTCACTGATGCTGGTCGTGTCTGCCGTCCCCTTTTCGTCGTTGACAA---TGCCAAGTCAAGCCCGAACCGTGGCAATCTTGCTCTGAAGCAAGAGCACATTGCACGCCTTGTCGACGACCAGGCTATCATCTCGGGCATGGAAGGCCAAGCCATGAGCGAAGAGGAGAGAAGAGAGCTCACGTTCGGCTGGCATGGCCTCGTTAAACAGGGTGTCATCGAGTATCTGGATGCCGAGGAAGAAG Acrodontium_luzulae_CBS_841.71_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG-TTG-GCACCTGTAACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGTGTTCCCCCGGTCTTCTGACCGGGTCACTCGCCGC-CGGCAGGCCAGCATCATCTGGGAGCGCCGGATAAAGGTTGGGGAAATGTAGCTCCTC------GGAGTA-TTATAGTCCCCGGCACAATACGGCGCCTCCCGGGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCCAAACCCCGACAACTGCACAACACTCATTGGGGTCTTGTGTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTCAAAAATTTGGCACTCATGTGCTACGTCTCCGTCGGTACCCCAGGTACCCCTCTCATCGACTACATGCGATACAGAGGAATGGAGCTTCTTGAGGAGTACGATCCGGTCGTTAATCCGAATGCGACAAAGGTATTCCTTAACGGAACGTGGGTCGGTGTCCACAGCAATGCCACACAGTTGACAGAAGCCCTTCGCGATCTCAGACGAAAGGGT---------ACCATTGGTTTCGAAGTCACGATTATTCGAGACGTCCGTGAACGCGAGATCAAGGTCTTCACTGATGCTGGTCGTGTCTGCCGTCCCCTTTTCGTCGTTGACAA---TGCCAAGTCAAGCCCGAACCGTGGCAATCTTGCTCTGAAGCAAGAGCACATTGCACGCCTTGTCGACGACCAGGCTATCATCTCGGGCATGGAAGGCCAAGCCATGAGCGAAGAGGAGAGAAGAGAGCTCACGTTCGGCTGGCATGGCCTCGTTAAACAGGGTGTCATCGAGTATCTGGATGCCGAGGAAGAAG Acrodontium_pigmentosum_CBS_111111_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-TTG-GCACCCTACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGTGTTCCCCCGGTCTTCTGACCGGGTCACTCGCCGC-CGGCAGGCCAGCATCATCTGGGACCGCCGGATAAAGGCCACGGGAATGTAGCTCCTC------GGAGTA-TTATAGCCCGCGGCACAATACGGCGCGCCCCGGGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCTAAACCTCGACAGCTGCACAACACTCATTGGGGTCTTGTATGTCCCGCCGAGACGCCTGAAGGCCAAGCTTGTGGTCTGGTAAAGAATTTGGCTCTCATGTGTTACGTTTCAGTCGGCACGCCCGGTACGCCTCTCATTGATTACATGCGATACAGAGGTATGGAACTTTTGGAGGAATACGACCCTGTTGTCAATCCAAATGCGACCAAGGTTTTCCTCAACGGAACATGGGTGGGTGTGCACAGCAATGCCACACAATTGACGGAAGCCCTTCGAGATTTGAGACGAAAGGGC---------ACCATCGGTTTCGAAGTCACTATCATTCGCGATGTCCGAGAGCGCGAGATTAAGGTCTTCACTGACGCCGGTCGTGTCTGTCGCCCTCTGTTCGTTGTCGACAA---TGCCAAGTCAAGTCCCAATCGTGGCAACCTCGCCTTAAAACAAGAGCATATCACGAGACTTGTGGAGGACCAATCGATCATTTCAAGCATGGAGGGTCAAGCAATGAGTGAAGAAGAAAGGAGGGAACTGACGTTCGGTTGGCACGGCCTTGTAAAACAGGGTGTCATCGAATACCTGGATGCAGAGGAAGAAG Aseudocercosporella_trigonotidis__CBS_131890 AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTTAGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCTATGGTG--ATGCGGCGAGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGGAAAATCGCAAAGCCACGCCAGCTGCACAACACCCATTGGGGTCTCGTATGTCCGGCAGAGACGCCCGAAGGACAAGCTTGCGGCTTGGTAAAGAATTTGTCTCTTATGTGTTACGTTACTGTCGGAACGCCAGGTGCTCCTCTTATCGACTTTATGCGGCAGCGCGGGATGGATCTCCTAGAAGAGTACGATCCTGTCATGAACCCAAGAGCGGCGAAAGTCATGCTCAACGGTACGTGGGTTGGTGTTCACCGCAATGCGGGTCATCTTGCAGATACGCTTCGATCACTCAGACGTAAGGGC---------TTGCTGAGTTTCGAGGTGACTATCATTCGTGATGTCCGCGAGCGAGAGATCAGAGTCTTCACAGATGCTGGACGTGTGTGTCGTCCACTCTTCGTGGTTGACAA---CGATCCTAAGAGCTCGAACCGAGGCAATCTTGTGCTCAAGCAAGAACAGGTCGAGAGATTGCAAAACGACCAGGAGATTCTCGCCAATCTCGAAGGCG------TTAGCGAAGAAGAGCGCGAGAAATCCATTTACGGCTGGAAGGGTCTGGTTGATGAGGGCGTCGTCGAGTATCTCGACGCAGAGGAGGAGG Aseudocercosporella_trigonotidis_CPC_10865_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTTAGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCTATGGTG--ATGCGGCGAGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGGAAAATCGCAAAGCCACGCCAGCTGCACAACACCCATTGGGGTCTCGTATGTCCGGCAGAGACGCCCGAAGGACAAGCTTGCGGCTTGGTAAAGAATTTGTCTCTTATGTGTTACGTTACTGTCGGAACGCCAGGTGCTCCTCTTATCGACTTTATGCGGCAGCGCGGGATGGATCTCCTAGAAGAGTACGATCCTGTCATGAACCCAAGAGCGGCGAAAGTCATGCTCAACGGTACATGGGTTGGTGTTCACCGCAATGCGGGTCATCTTGCAGATACGCTTCGATCACTCAGACGTAAGGGC---------TTGCTGAGTTTCGAGGTGACTATCATTCGTGATGTCCGCGAGCGAGAGATCAGAGTCTTCACAGATGCTGGACGTGTGTGTCGTCCACTCTTCGTGGTTGACAA---CGATCCTAAGAGCTCGAACCGAGGCAATCTTGTGCTCAAGCAAGAACAGGTCGAGAGATTGCAAAACGACCAGGAGATTCTCGCCAATCTCGAAGGCG------TTAGCGAAGAAGAGCGCGAGAAATCCATTTACGGCTGGAAGGGTCTGGTTGATGAGGGCGTCGTCGAGTATCTCGACGCAGAGGAGGAGG Caryophylloseptoria_lychnidis_CBS_109102_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTCGGCCCGCCGGAT-AAGACCTGAGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGCGGCTGGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATTGCCAAGCCGAGACAGCTGCACAATACCCATTGGGGTCTTGTGTGTCCTGCGGAAACGCCTGAAGGACAAGCTTGTGGCCTGGTGAAGAATTTGTCCCTCATGTGCTATGTTACTGTCGGAACTCCCGCATCTCCTCTTATCGACTTTATGCGACAACGTGGCATGGATCTCTTGGAGGAGTACGACCCAGTCATGAATCCTCGAGCCACCAAAGTATTTTTGAACGGTACTTGGGTGGGTGTCCACCGCAATGCTGGACATCTGACGGATACTCTACGCCAGCTACGGAGAAAGAGT---------CTGCTCAGTTTCGAGGTCACCATCATCCGCGATGTAAGAGAACGTGAAATTCGAGTCTTCACAGATGCCGGTCGTGTCTGCCGCCCGTTGTTTGTGGTTGACAA---CGACCCCAAAAGCCCGAATCGTGGCAATCTCGTCCTGACTCGAGAACAAGTGACGAAGGTCAGCATGGACGCAAATATTCTTGCCGAGCTAGAAGGAA------TTAGCGAAGAAGAACGCGAGAGCGCCATCTACGGCTGGAAAGGCCTTGTTGACGAAGGCGCCGTTGAGTATCTTGACGCCGAGGAGGAGG Caryophylloseptoria_pseudolychnidis_CBS_128614_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGCAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGC-CGCGAGGCCATCATCGTCTCGGCCCGCCGGAT-AAGACCTGAGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCTCTGGTG--ATACGGCGCGGCTGGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGCAAGATCGCCAAGCCGAGACAGCTGCACAATACCCATTGGGGTCTTGTGTGCCCTGCGGAAACGCCCGAAGGACAAGCTTGTGGCCTGGTGAAGAACTTGTCACTCATGTGCTACGTTACTGTCGGAACCCCCGCGTCTCCTCTTATCGACTTTATGCGACAACGTGGCATGGATCTCTTGGAGGAGTATGACCCAGTCATGAATCCCCGAGCGACCAAAGTATTTTTGAACGGTACTTGGGTCGGTGTCCACCGAAATGCTGGACACCTGACAGATACTCTACGCCAGCTACGGAGAAAGAGT---------CTGCTCAGTTTCGAGGTGACCATCATCCGTGATGTGAGAGAACGTGAAATTCGAGTCTTCACCGACGCTGGTCGTGTCTGCCGCCCGTTGTTCGTGGTTGACAA---CGATCCGAAAAGCCCAAATCGTGGCAATCTTGTGCTGACTCGAGAACAAGTGACGAAGGTCAGCATGGACGCGAACATTCTTGCCGAGCTAGAAGGAA------TTAGCGAAGAAGAACGCGAGAGCGCCATCTACGGCTGGAAAGGCCTTGTTGATGAAGGCGCTGTTGAGTATCTTGACGCGGAAGAGGAGG Cercospora_campi_silii_CBS_132615 AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACACATTGGGGACTTGTATGCCCTGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTCAAGAATTTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTAGAAGAGTATGACCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCGGGACAGCTTGCAGACACCCTCCGCGCATTGAGACGCAAGGGT---------CTCCTGAGTTTCGAGGTCACAATCATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGGCGTGTCTGTCGTCCGCTCTTCGTCGTTGACAA---CGACCCCAAGAGTCTCAATCGAGGAAGCCTCGTGTTGAAGCAGGATCACCTCGAGAAATTGGCGCTCGACCAAGAGATTCTCGCAAATCTGGAGGGCG------TAAGCGAAGAGGAGCGCGACAATTCTATCTTTGGCTGGAAAGGTCTTGTGGACGCAGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_cf._chenopodii_CBS_132677_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--TAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTTGTATGTCCTGCAGAGACGCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTCGAAGAATATGATCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCCGGACAGCTTGCAGATACCCTGCGAGCATTGAGGCGCAAGGGT---------CTCCTGAGCTTCGAGGTCACAATTATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGTCGTGTCTGCCGTCCGCTCTTCGTCGTTGATAA---CGATCCCAAGAGTCTCAACAGAGGCAGCCTCGTGTTGAAGCAAGATCACCTCGAGAAACTGGCGCTCGACCAAGAGATTCTCGCGAATCTGGAGGGCG------TCAGCGAAGAGGAGCGCGATAATTCTATCTTTGGCTGGAAAGGTCTCGTGGACGCGGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_cf._chenopodii_CPC_12450_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--TAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTTGTATGTCCTGCAGAGACGCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTCGAAGAATATGATCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCCGGACAGCTTGCAGATACCCTGCGAGCATTGAGGCGCAAGGGT---------CTCCTGAGCTTCGAGGTCACAATTATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGTCGTGTCTGCCGTCCGCTCTTCGTCGTTGATAA---CGATCCCAAGAGTCTCAACAGAGGCAGCCTCGTGTTGAAGCAAGATCACCTCGAGAAACTGGCGCTCGACCAAGAGATTCTCGCGAATCTGGAGGGCG------TCAGCGAAGAGGAGCGCGATAATTCTATCTTTGGCTGGAAAGGTCTCGTGGACGCGGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_dubia_CPC_15600_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--TAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTTGTATGTCCTGCAGAGACGCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTCGAAGAATATGATCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCCGGACAGCTTGCAGATACCCTGCGAGCATTGAGGCGCAAGGGT---------CTCCTGAGCTTCGAGGTCACAATTATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGTCGTGTCTGCCGTCCGCTCTTCGTCGTTGATAA---CGATCCCAAGAGTCTCAACAGAGGCAGCCTCGTGTTGAAGCAAGATCACCTCGAGAAACTGGCGCTCGACCAAGAGATTCTCGCGAATCTGGAGGGCG------TCAGCGAAGAGGAGCGCGATAATTCTATCTTTGGCTGGAAAGGTCTCGTGGACGCGGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_sojina_CBS_132615 AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACACATTGGGGACTTGTATGCCCTGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTCAAGAATTTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTAGAAGAGTATGACCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCGGGGCAGCTTGCAGACACCCTCCGCGCATTGAGACGCAAGGGT---------CTCCTGAGTTTCGAGGTCACAATCATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGGCGTGTCTGTCGTCCGCTCTTCGTCGTTGACAA---CGACCCCAAGAGTCTTAATCGAGGAAGCCTCGTGTTGAAGCAGGATCACCTCGAGAAATTGGCGCTCGACCAAGAGATTCTCGCAAATCTGGAGGGCG------TAAGCGAAGAGGAGCGCGACAATTCTATCTTTGGCTGGAAAGGTCTTGTGGACGCAGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_sojina_CPC_11422_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATTGCAAAGCCTCGCCAGCTGCACAACACACATTGGGGACTTGTATGCCCTGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTCAAGAATTTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCACTCATCGATTTCATGCGACAGCGTGGTATGGATCTGCTAGAAGAGTATGACCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGTGTGCATCGCAATGCGGGGCAGCTTGCAGACACCCTCCGCGCATTGAGACGCAAGGGT---------CTCCTGAGTTTCGAGGTCACAATCATTCGCGATGTCCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGGCGTGTCTGTCGTCCGCTCTTCGTCGTTGACAA---CGACCCCAAGAGTCTTAATCGAGGAAGCCTCGTGTTGAAGCAGGATCACCTCGAGAAATTGGCGCTCGACCAAGAGATTCTCGCAAATCTGGAGGGCG------TAAGCGAAGAGGAGCGCGACAATTCTATCTTTGGCTGGAAAGGTCTTGTGGACGCAGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercospora_sorghi_CBS_478.92_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGTGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGAGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAAATCGCGAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTTGTTTGTCCAGCAGAGACTCCAGAAGGGCAAGCTTGTGGTCTGGTCAAGAATCTGTCGCTGATGTGCTATGTTTCCGTTGGTACTCCTGGCGCTCCACTCATTGATTTCATGCGGCAGCGTGGGATGGATCTCCTCGAAGAGTACGACCCGGTGATGAATCCGCGAGCTACGAAGATCATGCTCAACGGAACATGGGTTGGTGTGCACCGCAATGCGGGACAACTCGCAGATACTCTCCGAGCATTGAGACGCAAGGGC---------CTTCTCAGTTTCGAGGTCACAATCATTCGCGATGTCCGAGAGCGCGAGATTAAGATTTTTACAGACGCAGGACGCGTCTGTCGTCCATTGTTCGTCGTTGATAA---CGACCCCAAAAGTCTAAACCGGGGCAGTCTTGTGTTGAAGCAAGACCACATCGAGCGACTGGCCAACGACCAAGAGATCCTTGCCAACCTGGAAGGCG------TAAGTGAAGAGGAGCGCGACAACTCAATTTTTGGCTGGAAAGGCCTTGTGGACGCAGGCGTGGTTGAATATCTCGATGCAGAAGAGGAAG Cercospora_sp._CBS_220.31_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG-CCC-GCACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGAT-AAGACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTG-TTATAGCCTCTGGTG--ATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGCAAGATCGCAAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTTGTATGCCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTCATGTGCTACGTTTCTGTGGGTACTCCTGGCGCACCGCTCATCGATTTCATGCGACAGCGTGGTATGGATTTACTCGAAGAGTATGATCCGGTGATGAACCCACGAGCAACGAAGATTATGCTCAACGGAACATGGGTCGGCGTGCATCGCAATGCGGGACAGCTTGCAGACACCCTGCGAGCATTGAGGCGCAAGGGT---------CTCTTGAGTTTCGAGGTCACAATTATTCGCGATGTTCGAGAGCGCGAGATCAGAATTTTCACAGACGCAGGTCGTGTCTGCCGCCCGCTCTTCGTCGTTGATAA---CGATCCCAAGAGTCTCAACAGAGGAAGTCTCGTGCTGAAGCAAGATCACCTCGAGAAACTGGCGCTCGACCAAGAGATAGTCGCGAATCTGGAGGGCG------TAAGCGAAGAGGAGCGCGATAATTCTATCTTTGGCTGGAAAGGTCTCGTGGACGCGGGTGTGGTCGAGTACCTTGATGCAGAGGAGGAAG Cercosporella_catenulata_CBS_355.73_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCTACTCTCTGT-CGCGAGGCCATCATCGTCCGGGCCCGTCGGAT-AAGACCTTAGGAATGTAGCTCACCTCCGGGGGAGTG-TTATAGCCTGTGGTG--ATGCGACGCGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GACGGAAAGATCGCCAAGCCCAGGCAATTGCACAATACTCACTGGGGCCTTGTATGTCCGGCAGAAACGCCCGAAGGACAGGCTTGTGGACTGGTGAAGAACTTGTCGCTCATGTGTTACGTTACCGTCGGAACGCCTGGAACGCCACTGATTGACTTCATGCGGCAAAGAGGCATGGATCTGCTCGAAGAGTACGATCCCGTGATGAATCCTAGAGCTACTAAGGTCTTCCTCAATGGTACCTGGGTCGGAGTACACAGAAACGCTGGGCACTTGACAGACACACTTCGCTCGCTCAGACGGAAGGGA---------TTGCTTTCATTCGAGGTCACGATCATTCGAGATGTCAGAGAGCGCGAGATCCGCGTGTTCACGGACGCTGGTCGTGTGTGTCGCCCGCTCTTTGTTATTGAGAA---CAACCCAAATTCGCCAGAGCGTGGCAGCCTGGTGTTGAATCAGGAGCATCTCGCACAGCTGCAAAACGACCAGATCGTCCTAGGTGACCTTGAGCACG------TCAGCGAAGAAGAGCGCGAGAAGGCAATCTACGGCTGGAAGGGGCTTGTGGATCACGGTGTCGTCGAGTATCTTGATGCTGAAGAAGAGG Cercosporella_dolichandrae_CBS_138101_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCGCTGC-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCCCAGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCTGTGGTG--ATGCGACGCGGCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGGAAGATCGCCAAGCCCAGGCAGTTGCACAATACTCATTGGGGTCTTGTTTGTCCGGCAGAAACGCCGGAAGGACAGGCCTGTGGGCTGGTGAAGAATTTATCGCTCATGTGTTACGTTACCGTCGGAACGCCCGGCACGCCACTGATTGACTTCATGCGGCAAAGGGGCATGGATCTGCTCGAGGAATACGATCCCGTGATGAACCCTAGAGCTACTAAGGTGTTCCTCAATGGTACTTGGGTCGGAGTACACAGAAACGCTGGGCACTTGACAGACACGCTTCGATCGCTGAGACGGAAGGGA---------TTGCTTTCGTTTGAAGTCACGATCATTCGCGACGTCAGAGAGCGCGAAATTCGTGTCTTCACGGACGCTGGTCGTGTGTGTCGGCCACTTTTTGTTGTTGATAA---CAACCCAAACTCGCCTGATCGCGGCAGTCTAGTGCTGAATCAGGAACATCTCGCACAATTGCAAAACGACCAGGCGGTCCTAGGTGATCTTGAGCATG------TCAGCGAGGAAGAGCGCGAGAAGGCCATATACGGCTGGAAGGGGCTTGTGGATCATGGTGTGGTCGAGTACCTTGATGCTGAAGAGGAAG Cercosporella_sp._CPC_19492_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTCCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCCTGGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCCATGGTG--ATGCGACGCGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGGAAGATCGCCAAACCCAGACAGCTGCACAACACCCACTGGGGTCTTGTTTGCCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGGCTAGTGAAGAATCTGTCGCTGATGTGTTACGTTACTGTCGGAACACCTGGTACGCCATTGATTGACTTCATGCGGCAACGAGGTATGGAACTGCTCGAAGAGTACGATCCTGTGATGAACCCCAGAGCTACCAAAGTCTTTCTGAACGGTACTTGGGTTGGTGTACATCGGAACGCTGGACATTTGACGGACACGCTCCGATCGCTGAGGCGGAAGGGT---------CTACTTTCCTTCGAGGTCACGATTATTCGCGACGTCAGAGAGCGGGAGATTCGTGTCTTCACAGACGCTGGTCGCGTGTGTCGGCCACTTTTCGTGGTTGAGAA---CAACCCCAACTCGCCGGAGCGCGGCAGCCTTGTGCTGAATCAAGAACACCTTGCACAACTGCAAAATGATCAGATTGTTTTGAGTGAGCTTGAGCATG------TGAGCGAGGAAGAGCGTGAGAGGGCCATTTACGGCTGGAAAGGTCTGGTCGATCACGGTGTGGTTGAATACCTTGACGCCGAGGAGGAGG Cercosporella_virgaureae_CBS_113304_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCTTGGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCCATGGTG--ATGCGACGCGGCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGGAAGATCGCCAAACCCAGACAGCTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGGCTAGTGAAGAATCTGTCGCTGATGTGTTACGTTACTGTCGGAACACCTGGTACGCCATTAATTGACTTCATGCGGCAGCGAGGTATGGAACTGCTCGAAGAGTACGATCCTGTGATGAACCCCAGAGCTACCAAAGTCTTTCTGAACGGTACTTGGGTTGGTGTACATCGGAACGCTGGACATTTGACGGACACGCTCCGATCGCTGAGGCGGAAGGGT---------CTACTTTCCTTCGAGGTCACGATTATTCGCGACGTCAGAGAGCGGGAGATTCGTGTCTTCACAGACGCTGGTCGCGTGTGTCGGCCACTTTTCGTGGTTGAGAA---CAACCCCAACTCGCCGGAGCGCGGCAGCCTTGTGCTGAATCAAGAACACCTTGCACAACTGCAAAATGATCAGATTGTTTTGGGTGAGCTTGAGCATG------TGAGCGAGGAAGAGCGTGAGAAGGCCATTTACGGCTGGAAAGGTCTGGTCGATCACGGTGTGGTTGAATACCTTGACGCCGAGGAGGAGG Cercosporella_virgaureae_CPC_10286_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCTTGGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCCATGGTG--ATGCGACGCGGCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGGAAGATCGCCAAACCCAGACAGCTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGGCTAGTGAAGAATCTGTCGCTGATGTGTTACGTTACTGTCGGAACACCTGGTACGCCATTAATTGACTTCATGCGGCAGCGAGGTATGGAACTGCTCGAAGAGTACGATCCTGTGATGAACCCCAGAGCTACCAAAGTCTTTCTGAACGGTACTTGGGTTGGTGTACATCGGAACGCTGGACATTTGACGGACACGCTCCGATCGCTGAGGCGGAAGGGT---------CTACTTTCCTTCGAGGTCACGATTATTCGCGACGTCAGAGAGCGGGAGATTCGTGTCTTCACAGACGCTGGTCGCGTGTGTCGGCCACTTTTCGTGGTTGAGAA---CAACCCCAACTCGCCGGAGCGCGGCAGCCTTGTGCTGAATCAAGAACACCTTGCACAACTGCAAAATGATCAGATTGTTTTGGGTGAGCTTGAGCATG------TGAGCGAGGAAGAGCGTGAGAAGGCCATTTACGGCTGGAAAGGTCTGGTCGATCACGGTGTGGTTGAATACCTTGACGCCGAGGAGGAGG Cercosporella_virgaureae_CPC_10287_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCTTGGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCCATGGTG--ATGCGACGCGGCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGT?????GATGGGAAGATCGCCAAACCCAGACAGCTGCACAACACCCACTGGGGTCTTGTTTGTCCGGCAGAAACGCCAGAAGGACAGGCTTGTGGGCTAGTGAAGAATCTGTCGCTGATGTGTTACGTTACTGTCGGAACACCTGGTACGCCATTAATTGACTTCATGCGGCAGCGAGGTATGGAACTGCTCGAAGAGTACGATCCTGTGATGAACCCCAGAGCTACCAAAGTCTTTCTGAACGGTACTTGGGTTGGTGTACATCGGAACGCTGGACATTTGACGGACACGCTCCGATCGCTGAGGCGGAAGGGT---------CTACTTTCCTTCGAGGTCACGATTATTCGCGACGTCAGAGAGCGGGAGATTCGTGTCTTCACAGACGCTGGTCGCGTGTGTCGGCCACTTTTCGTGGTTGAGAA---CAACCCCAACTCGCCGGAGCGCGGCAGCCTTGTGCTGAATCAAGAACACCTTGCACAACTGCAAAATGATCAGATTGTTTTGGGTGAGCTTGAGCATG------TGAGCGAGGAAGAGCGTGAGAAGGCCATTTACGGCTGGAAAGGTCTGGTCGATCACGGTGTGGTTGAATACCTTGACGCCGAGGAGGAGG Cercosporella_virgaureae_CPC_10288_ AAATTTGAAATCTGG-----CGCAAG-CCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG-CGC-GCACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCCACTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGTCGGAT-AAGACCTTGGGAATGTAGCTCACCTTCGGGGGAGTG-TTATAGCCCATGGTG--ATGCGACGCGGCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGGGAACCG--CAAGGTGCACCATCGACCGATCCTGATGTCCTCG