#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:18 GMT TreeBASE (cc) 1994-2008 Study reference: Murakami N., & Sato H. 2009. Strobilomyces verruculosus sp. nov. from Japan. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2245] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Aureoboletus_thibetanus_ar001 Austroboletus_subvirens_a002 Boletellus_emodensis_b033 Boletus_edulis_BEAF002153 Boletus_pseudocalopus_bl002 Heimiella_japonica_h003 Russula_rosacea_AF002160 Strobilomyces_verruculosus_Lineage_1 Strobilomyces_verruculosus_Lineage_10 Strobilomyces_verruculosus_Lineage_13 Strobilomyces_verruculosus_Lineage_14 Strobilomyces_verruculosus_Lineage_2 Strobilomyces_verruculosus_Lineage_3 Strobilomyces_verruculosus_Lineage_4 Strobilomyces_verruculosus_Lineage_6 Strobilomyces_verruculosus_Lineage_7 Strobilomyces_verruculosus_Lineage_8 Strobilomyces_verruculosus_Lineage_9 Strobilomyces_verruculosus_s10 Strobilomyces_verruculosus_s7 Suillus_granulatus_AF002149 Tylopilus_ferrugineus_t003 Xerocomus_chrysenteron_AF002155 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3391] TITLE Strobilomyces_cox3; LINK TAXA = Taxa1; DIMENSIONS NCHAR=571; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aureoboletus_thibetanus_ar001 TGTAATGTATATGCAAGGTTACTATTCTGGAGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGAGGTATGATATTTTGGTTTAGAGATGTAGGAAATGAAGCAGCTTTAGGAGGACATCATACAAAACAAGTTAAAAAAGGGTTAGAAATAGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATGCAAGTTTATCACCAGCAATTGAAATAGGAGGTGTTTGGCCACCTCAAGGTATTACACCATTAAATCCATTTGCTATACCATTATTAAATACAATTTTATTAGTATCTTCAGGTGCTTTTGTAACTTATGGTCACCATGCTTTAATAAATGGAAACAGAAAAGATACTTTAAGAGGATTGGAGTTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCAATATCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCCACAGGTTTACATGGTATTCATGTAATAGTAGGGACTATATTTA-------------- Austroboletus_subvirens_a002 TGTAATGTACATGCAAGGTTACTATTCTGGTGATCTTGTATTAGAATTAGGATTCATATTAACTTTAGGTGGTATGGCTTTCTGGTTTAGAGATGTAGGAAATGAAGCAACTTTAGGAGGACATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATGCTAGTTTATCTCCTGCAATCGAAATAGGAGGAGTATGGCCACCACAAGGAATAACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTAACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTGGAATTAACTGTATTATTTGCTGTTCTTTTCACTTTCTTACAATACTTAGAATATGCTAATTCATCTTTCTCAATATCAGATTCAGTATTCGGTAGTGCTTTCTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATCTTTATCGTAGTTCAATTA Boletellus_emodensis_b033 TGTAATGTATATGCAAGGTTACTATTCTGGAGATCTTATCTTAGAATTAGGATTTATCTTAACTTTAGGGGGAATGATTTTCTGGTTTAGAGATGTAGGAAATGAAGCTACTTTAGGAGGACACCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATATTCTGGGCTTTCTTCCATGCTAGTTTATCACCAGCAATAGAGATAGGTGGTGTTTGGCCTCCTCAAGGAATTACTCCTTTAAATCCTTTTGCAATACCATTATTAAATACAATATTATTAGTATCTTCAGGAGCTTTTGTAACTTATGGTCACCATGCTTTAATTAATGGAAACAGAAAAAATACATTAAGAGGGTTAGAATTAACTGTATTATTCGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCATCTTTCTCAATATCAGATTCAGTATTTGGAAGTGCATTCTTCTGTTCAACAGGTTTACATGGTATTCATGTAATAGTAGGAACTATATTTATCACAGTACAATTA Boletus_edulis_BEAF002153 TGTAATGTATATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGTGGTATGACTTTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGACATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCATACTTTTTGTTGTTAGTGAAATTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATTGAAATAGGAGGAGTATGGCCACCTCAAGGTATAACACCTTTAAATCCTTTTGCTATCCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTAACTTTTGGTCACCATGCATTAATTAATGGTAACAGAAAAAACACTTTAATAGGATTAGAATTAACTGTTTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCAATATCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCAACTGGATTACATGGTATTCATGTAATAGTTGGAACTATCTTTATTGTTGTACAATTA Boletus_pseudocalopus_bl002 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATCAACTTTAGGTGGTATGACTTTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGAGGACATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATGCTAGTTTAGTTCCTGCTATTGAAATAGGAGGAGTATGGCCACCTCAAGGAATAACTCCATTAAATCCTTTTGCTATACCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTAACTTATGGTCATCATGCATTGATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTTTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCATCTTTCTCAATATCAGATTCAGTATTTGGAAGTGCTTTCTACTGTTCAACTGGTTTACATGGTATTCATGTAATAGTTGGTACTATCTTTATCGCAGTACAATTA Heimiella_japonica_h003 TGTAATGTATATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGTGGTATGATTTTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGACATCATACAAAACAAGTTAAAAAAGGATTAGAAATAGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTCGCTTTTTTAAGTATTTTCTGGGCTTTCTTCCATGCAAGTTTATCACCAGCAATAGAAATAGGAGGAGTATGGCCACCACAAGGTATTACACCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTCGTAACTTATGGTCACCATGCTTTAATAAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACAGTATTATTTGCTGTACTTTTCACATTCTTACAATACTTAGAATACGCAAATTCAACATTTTCAATATCAGATTCAGTATTTGGAAGTGCATTCTATTGTTCAACAGGATTACACGGAATCCATGTAATAGTAGGAACAATATTTATAGTAGTACAATTA Russula_rosacea_AF002160 AGTTATGTATATGCAAGGTTTTAATCATGGAGGACAATTAATAAGTTTAGGTTTTACTTTAACAGTTTGTGGTATGATACTTTGATTTAGAGATATTATAACAGAAGGTACTTATTTAGGACATCATACAATACAAGTTCAAAAAGGTTTAACTATTGGAGTAGTATTATTTATTATTAGTGAAGTATTTGCTTTTTTAAGTGTATTCTGAGCTTTCTTTCATTCTAGTTTATCACCTACAATAGAAATAGGAGGAATATGACCACCACAAGGTATAACACCTTTAGATCCTTTTGCAATCCCTTTATTAAATACTATTTTATTATTATCATCTGGTGCTTTTGTAACTTATGGTCATCATGCTTTAATTCAAGGAGATAGAAGAGGAGCTATCTTAGGAACATTATTAACAATAATTTTTGCTATAATATTTACTGCTTTACAATATTATGAATATTCAGAATCTAGTTTTACAATGAGTGATTCAGTATATGGTACTGTATTTTATGCTTCAACTGGATTACATGGATTACATGTAATTATAGGTACATTATTTATTTTAGTAGGTTTT Strobilomyces_verruculosus_Lineage_1 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGAAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATAGGAGCAGTATGGCCACCTCAAGGAATAACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGTTTAGAATTAACTGTATTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCTACAGGTTTACATGGTATCCATGTAATAGTAGGAACTATATTTATTGTAGTACAATTA Strobilomyces_verruculosus_Lineage_10 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGTGGTATGGCATTCTGGTTTAGAGATGTTGGTAATGAAGCTACTTTAGGTGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATTACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTGACTTATGGTCACCATGCATTAATAAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCTATATCAGATTCAGTATTTGGAAGTGCTTTCTACTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_13 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGAGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTAGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATTACACCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCGGGTGCTTTTGTTACTTATGGTCACCACGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCTACTTTCTCTATATCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTAGGAACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_14 TGTTATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCAACTTTAGGAGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTATGGCCACCTCAAGGAATTACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCTTTAATAAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCAATATCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGTACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_2 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATCTTAGAATTAGGATTTATTTTAACTTTAGGAGGGATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATTGAAATAGGAGGAGTATGGCCACCTCAAGGAATAACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCCGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCCACAGGTTTACATGGTATCCATGTAATAGTAGGAACTATATTTATTGTAGTACAATTA Strobilomyces_verruculosus_Lineage_3 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATCTTAGAATTAGGATTTATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTATCTCCTGCTATAGAAATAGGAGGAGTATGGCCACCTCAAGGAATAACACCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCGGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTCTACTGTTCCACAGGTTTACATGGTATCCATGTAATAGTAGGAACTATATTTATTGTTATACAATTA Strobilomyces_verruculosus_Lineage_4 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTTATATTAACTTTAGGAGGTATGACATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCAGCTATTGAAATAGGAGGAGTATGGCCACCTCAAGGAATAACACCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCCACAGGTTTACATGGTATCCATGTAATAGTAGGAACTATATTTATTGTAGTACAATTA Strobilomyces_verruculosus_Lineage_6 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATAACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACTATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCTTTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCTATCTCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCTACAGGTTTACATGGTATCCATGTTATAGTTGGAACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_7 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGAGGTATGACATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATAACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATAAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCTATATCAGATTCAGTATTTGGAAGTGCTTTCTTTTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_8 TGTAATGTTTATGCAAGGTTATTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGAGGTATGGTATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATAACACCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCTATATCAGATTCAGTATTTGGAAGTGCTTTCTACTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATTATAGTACAATTA Strobilomyces_verruculosus_Lineage_9 TGTAATGTTTATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGAGGTATGGCATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGGTATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCTAGTTTAACTCCTGCTATAGAAATCGGAGGTGTCTGGCCACCTCAAGGAATTACTCCATTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATAAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTATTATTTGCAGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCAACTTTCTCTATATCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATTACAGTTCAATTA Strobilomyces_verruculosus_s10 TGTAATGTTTATGCAAGGTTACTATTCAGGTGATCTTGTATTAGAATTAGGATTTGTATTAACTTTAGGAGGTATGACATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCAAGTTTAACTCCTGCGATAGAAATAGGAGGAGTGTGGCCACCCCAAGGAATAACACCATTAAATCCCTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTGTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTTTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATAGTAGTACAATTA Strobilomyces_verruculosus_s7 TGTAATGTTTATGCAAGGTTACTATTCAGGTGATCTTGTATTAGAATTAGGATTTGTATTAACTTTAGGAGGTATGACATTCTGGTTTAGAGATGTAGGTAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATTGGATTCTTACTTTTTGTTATTAGTGAAGTTTTTGCTTTCTTAAGTATTTTTTGGGCTTTCTTCCATTCAAGTTTAACTCCTGCGATAGAAATAGGAGGAGTGTGGCCACCCCAAGGAATAACACCATTAAATCCCTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTTACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAAGAGGATTAGAATTAACTGTGTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCAAATTCAACTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTTTTCTGTTCAACAGGTTTACATGGTATCCATGTAATAGTTGGAACTATATTTATAGTTGTACAATTA Suillus_granulatus_AF002149 AGTAATGTACATGCATGGATATGTTAATGGTGGTAACTTATTAACTACAGGTTTCATTTTAACAGCTTATGGAATGGGGCTTTGGTTTAGAGATGTAGTAACAGAAGGAACTTATTTAGGTGATCATACAAAACAAGTTAAAAAAGGTATACAAATAGGAGTAATTTTATTTATTGTTAGTGAAATTTTTGCTTTCTTAAGTGTATTCTGGGCATTCTTCCATGCTAGTTTATCACCATCTATAGAAATTGGAGGTGTATGGCCACCACAAGGTATAACACCTTTAGATCCTTTTGCTATTCCACTACTTAATACTATATTATTAGTTTCATCTGGTGCATTTGTTACTTATGGACATCATGCTTTAGTAAATGGAAATAGAAGAGGTTCTATCATAGGTATGTTCTTAACTATATTATTTGCTGTTATTTTTACTATTTTACAGTATGTTGAATATTCTGAAGCTGCATTTACTATGTCTGATTCAGTTTATGGTAGTGCTTTTTATGCAAGTACAGGTTTACACGGAATGCACGTAATAGTTGGGACAATATTCATTTTGGTAGCTTTT Tylopilus_ferrugineus_t003 TGTAATGTATATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGATTCATATTAACTTTAGGTGGAATGGCTTTCTGGTTCAGAGATGTAGGTAATGAAGCTACTTTAGGAGGGCATCATACGAAACAAGTTAAAAAAGGATTAGAAATTGGATTCATACTTTTTGTAGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATTCTAGCTTATCTCCTGCTATTGAAATAGGGGGAATATGGCCACCACAAGGAATAACACCCTTAAATCCTTTTGCTATTCCATTATTAAATACAATATTATTAGTATCTTCAGGTGCTTTTGTAACTTATGGTCACCATGCATTAATTAATGGTAACAGAAAAGATACTTTAATAGGCTTAGAGTTAACTGTTTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATGCATCTTTCTCAATCTCAGATTCAGTATTTGGAAGTGCTTTCTTCTGTTCAACTGGTTTACATGGTATCCATGTAATAG{AT}TGGAACTATTTTTATTACAGTACAATTA Xerocomus_chrysenteron_AF002155 TGTAATGTATATGCAAGGTTACTATTCTGGTGATCTTATATTAGAATTAGGTTTTATATTAACTTTAGGTGGTATGATTTTCTGGTTTAGAGATGTAGGAAATGAAGCTACTTTAGGTGGATATCATACAAAACAAGTTAAAAAAGGTTTAGAAATCGGATTCTTACTTTTTGTTGTTAGTGAAGTTTTTGCTTTCTTAAGTATTTTCTGGGCTTTCTTCCATGCTAGTTTATCTCCTGCTATTGAAATAGGAGGAGTATGGCCACCTCAAGGAATAACACCCTTAAATCCATTTG{CG}TATCCCATTATTAAATACAATATTATTAGTATCTTCAGGAGCTTTTGTAACTTATGGTCACCATGCATTAATCAATGGTAACAGAAAAGATACTTTAAGAGGGTTAGAATTAACTGTTTTATTTGCTGTTCTTTTCACTTTCTTACAATATTTAGAATATGCTAATTCATCTTTCTCAATATCAGATTCAGTATTTGGAAGTGCTTTCTACTGTTCAACTGGTTTACACGGTATTCATGTAATAGTTGGAACTATCTTTATTGTAGTACAATTA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Strobilomyces_cox3) = N: 1-571; CODONPOSSET CodonPositions (CHARACTERS = Strobilomyces_cox3) = N: 1-571; END; BEGIN TREES; TITLE Tb9487; LINK TAXA = Taxa1; TRANSLATE 1 Aureoboletus_thibetanus_ar001, 2 Austroboletus_subvirens_a002, 3 Boletellus_emodensis_b033, 4 Boletus_edulis_BEAF002153, 5 Boletus_pseudocalopus_bl002, 6 Heimiella_japonica_h003, 7 Russula_rosacea_AF002160, 8 Strobilomyces_verruculosus_Lineage_1, 9 Strobilomyces_verruculosus_Lineage_10, 10 Strobilomyces_verruculosus_Lineage_13, 11 Strobilomyces_verruculosus_Lineage_14, 12 Strobilomyces_verruculosus_Lineage_2, 13 Strobilomyces_verruculosus_Lineage_3, 14 Strobilomyces_verruculosus_Lineage_4, 15 Strobilomyces_verruculosus_Lineage_6, 16 Strobilomyces_verruculosus_Lineage_7, 17 Strobilomyces_verruculosus_Lineage_8, 18 Strobilomyces_verruculosus_Lineage_9, 19 Strobilomyces_verruculosus_s10, 20 Strobilomyces_verruculosus_s7, 21 Suillus_granulatus_AF002149, 22 Tylopilus_ferrugineus_t003, 23 Xerocomus_chrysenteron_AF002155; TREE Fig._1 = [&R] ((1,3),(((2,((5,23),(4,22))),(((19,20),(14,((12,13),8))),((16,(18,9),15,10,17),11))),(6,(7,21)))); END;