#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 3:52 GMT TreeBASE (cc) 1994-2008 Study reference: Yamaguchi K., Chuaseeharonnachai C., Huhtinen S., Tsurumi Y., Sri-indrasutdhi V.-., Boonyuen N.-., Okane I., Hosoya T., & Nakagiri A. 2020. Phylogeny and taxonomic revision of the genus Candelabrum, aero-aquatic fungi. Mycoscience, 61(6): 265-281. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22592] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=67; TAXLABELS '"Crocicreas diapensiae" DQ008442' '"Lophiostoma" heterosporum AY016369' Achroceratosphaeria_potamia_GQ996538 Achroceratosphaeria_sp._AF132325 Arachnomyces_minimus_AB075350 Aspergillus_ruber__U29556 Aureobasidium_pullulans_AJ507454_ Bipolaris_maydis_AY544645_ Bisporella_citrina_AY789385 Bulgaria_inquinans_DQ470960 Cainia_graminis_AF431949 Candelabrum_brocchiatum_NBRC_30048 Candelabrum_clathrosphaeroides_NBRC_101134_ Candelabrum_desmidiaceum_NBRC_101133 Candelabrum_japonense_NBRC_108749 Candelabrum_microsporum_NBRC_108750 Candelabrum_microsporum_NBRC_108751 Candelabrum_sp._NBRC_109748 Candelabrum_spinulosum_NBRC_101903 Capronia_pilosella_DQ823099_ Cercophora_macrocarpa_AY780060 Chaetosphaeria_raciborskii_AY436402 Chlorociboria_cf_aeruginosa_AY544669_ Coccidioides_immitis_AY176713 Columnosphaeria_fagi_AY016359_ Delphinella_strobiligena_AY016358_ Dermatocarpon_miniatum_AY584644 Diamantinia_citrina_AY346278 Diaporthe_pustulata_AF408358 Humicola_sphaeralis_AF286407 Hyaloscypha_daedaleae_AY789415 Hyaloscypha_occulta_JN086754 Hyaloscypha_spiralis_AB546940 Hydrocina_chaetocladia_AY789412 Hysteropatella_clavispora_AY541493_ Lachnellula_occidentalis_KC492977 Lachnum_virgineum_AY544646 Lambertella_tubulosa_AY616237 Lecanora_hybocarpa_DQ782910 Melanconiella_spodiaea_AF408370 Melanochaeta_aotearoae_AF466082 Myriangium_duriaei_AY016365 Neocosmospora_haematococca_DQ119560 Neofabraea_malicorticis_AY544662 Neofusicoccum_luteum_AY928043 Ophiostoma_piceae_AJ538341 Oxydothis_frondicola_AY083835 Pezicula_ericae_AY442323 Peziza_badia_U42692 Peziza_vesiculosa_AF378367 Phoma_herbarum_AY293790 Pisorisporium_cymbiforme_KM588902 Pisorisporium_cymbiforme_KM588903 Pisorisporium_cymbiforme_KM588904 Porpidia_melinodes_DQ314985 Prosthemium_betulinum_AY004341 Ramularia_endophylla_DQ470968 Rhytisma_acerinum_AF356696 Schizothecium_curvisporum_AY346300 Sclerotinia_sclerotiorum_AF431951 Staphylotrichum_longicolleum_AF286408 Stictis_radiata_AY341361 Tolypocladium_capitatum_AY489721 Trichoderma_atroviride_AB646518 Tubeufia_cerea_AY856907 Verruculina_enalia_AY016363_ Xanthothecium_peruvianum_AB053453 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=49; TAXLABELS 'Candelabrum clathrosphaeroides NBRC 101134_2' Candelabrum_clathrosphaeroides_NBRC_102394 Candelabrum_clathrosphaeroides_NBRC_108187 Candelabrum_clathrosphaeroides_NBRC_108199 Candelabrum_clathrosphaeroides_NBRC_109729 Candelabrum_clathrosphaeroides_NBRC_109735 Candelabrum_clathrosphaeroides_NBRC_109742 Candelabrum_clathrosphaeroides_NBRC_109746 'Candelabrum desmidiaceum NBRC 101133_2' Candelabrum_desmidiaceum_NBRC_109736 Candelabrum_japonense_NBRC_106777 Candelabrum_japonense_NBRC_108046 'Candelabrum japonense NBRC 108749_2' Candelabrum_japonense_NBRC_6777 Candelabrum_japonense_NBRC_6844 'Candelabrum spinulosum NBRC 101903_2' Candelabrum_spinulosum_NBRC_102391 Candelabrum_spinulosum_NBRC_109731 Candelabrum_spinulosum_NBRC_109733 Candelabrum_spinulosum_NBRC_109734 Dematioscypha_castaneae_1 Dematioscypha_castaneae_2 Dematioscypha_delicata_ Hyalopeziza_nectrioides Hyalopeziza_sp.__NBRC_108584 Hyalopeziza_sp._NBRC_108587 Hyalopeziza_sp._NBRC_108591 Hyaloscypha_albohyalina1 Hyaloscypha_albohyalina2 Hyaloscypha_aureliella1 Hyaloscypha_aureliella2 Hyaloscypha_bicolor Hyaloscypha_bulbopilosa_2 Hyaloscypha_bulbopilosa1 Hyaloscypha_finlandica Hyaloscypha_hepaticicola Hyaloscypha_melinii Hyaloscypha_monodictys Hyaloscypha_occulta_NBRC_108595 Hyaloscypha_occulta_SANK_13397 Hyaloscypha_sp._NBRC_108580 Hyaloscypha_sp._NBRC_108581 Hyaloscypha_sp._NBRC_108592 Hyaloscypha_spiralis_2 Hyaloscypha_spiralis1 Hyaloscypha_variabilis Hyaloscypha_vitreola Hyaloscypha_vraolstadiae Olla_millepunctata ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=56; TAXLABELS Achroceratosphaeria_potamia_KM588908 Candelabrum_brocchiatum_NBRC_106788 Candelabrum_brocchiatum_NBRC_106791 Candelabrum_brocchiatum_NBRC_106792 Candelabrum_brocchiatum_NBRC_106799 Candelabrum_brocchiatum_NBRC_106802 Candelabrum_brocchiatum_NBRC_106803 Candelabrum_brocchiatum_NBRC_106805 Candelabrum_brocchiatum_NBRC_106808 Candelabrum_brocchiatum_NBRC_106813 Candelabrum_brocchiatum_NBRC_108053 Candelabrum_brocchiatum_NBRC_108059 Candelabrum_brocchiatum_NBRC_108060 Candelabrum_brocchiatum_NBRC_108076 Candelabrum_brocchiatum_NBRC_108086 Candelabrum_brocchiatum_NBRC_108095 Candelabrum_brocchiatum_NBRC_108096 Candelabrum_brocchiatum_NBRC_108097 Candelabrum_brocchiatum_NBRC_108098 Candelabrum_brocchiatum_NBRC_108146 Candelabrum_brocchiatum_NBRC_108160 Candelabrum_brocchiatum_NBRC_108189 Candelabrum_brocchiatum_NBRC_108190 Candelabrum_brocchiatum_NBRC_108827 Candelabrum_brocchiatum_NBRC_109730 Candelabrum_brocchiatum_NBRC_109732 Candelabrum_brocchiatum_NBRC_109737 Candelabrum_brocchiatum_NBRC_109741 Candelabrum_brocchiatum_NBRC_109744 Candelabrum_brocchiatum_NBRC_109745 Candelabrum_brocchiatum_NBRC_109747 Candelabrum_brocchiatum_NBRC_30048 Candelabrum_cf._brocchiatum_NBRC_108061 Candelabrum_cf._brocchiatum_NBRC_108065 Candelabrum_cf._brocchiatum_NBRC_108077 Candelabrum_cf._brocchiatum_NBRC_108103 Candelabrum_cf._brocchiatum_NBRC_108106 Candelabrum_cf._brocchiatum_NBRC_108171 Candelabrum_cf._brocchiatum_NBRC_108175 Candelabrum_cf._microsporum_NBRC_108054 Candelabrum_microsporum_NBRC_102397 Candelabrum_microsporum_NBRC_102398 Candelabrum_microsporum_NBRC_108099 Candelabrum_microsporum_NBRC_108151 Candelabrum_microsporum_NBRC_108161 Candelabrum_microsporum_NBRC_108178 Candelabrum_microsporum_NBRC_108750 Candelabrum_microsporum_NBRC_108751 Candelabrum_microsporum_NBRC_109667 Candelabrum_sp._NBRC_109738 'Candelabrum sp. NBRC 109748_2' Pisorisporium_cymbiforme_KM588905 Pisorisporium_cymbiforme_KM588906 Pisorisporium_cymbiforme_KM588907 Pseudonectria_buxi_DQ522459 Trichoderma_viride_EU711362 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53691] TITLE Candelabrum_Matrix_of_Fig._1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=479; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] '"Crocicreas diapensiae" DQ008442' AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAAATGCTTCGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCCTTGCCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACCCGTCATCATCTCAGGTTCTCCTGGTGCACTCGCGGGTCAGGCAGCATCGGTTTCGGGGTTGATAAGGCCTTGGGAATGTGGCTCCTCTGGGAGTGTTATAGCCTCGTGCAATGCACCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT '"Lophiostoma" heterosporum AY016369' AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAGGTGCTTTGGCGTTGCGTGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGCGCACCTCCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCTAGACGTGCTGGGTTATCAGCCGGGCTTTTGCCCGTGCACTCTCCTTGCAGGCAGCATCAGTTTGGGGGCTGATAAGGTCTGTTAAACGTGACTCCCTTGGGAAGCTTATAGGGAGACGACATGCACCGTCCGATGAGGTCCGCGCTTGCTAGGATGCTGGCGTAAT Achroceratosphaeria_potamia_GQ996538 AACAGCTCAGATTTGAAATCCGGTCCGCCCGAGTTGTAATCTGTAGGGTAGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCTATGTGAAGCTCATCCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGCGTGCCTTCTGGCTGCGTACTCCCCGGCCAGGCAGCATCGGTCTTCGGGGGGACAAGGCGCCGGGAACGTGGCTCTCTTGGGAGTGTTATAGCCGACCAGAATGCCCTGCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Achroceratosphaeria_sp._AF132325 AACAGCTCAGATTTTAAATCCGGGCCGCCAGAGTTGTAATCTGTAGGGTAGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCCGTGTGAAGCTCCTCCGACGAGTCGAGTAGTTTGGGAGTGCTGCTCAAAACGGGAGGTGAATGTCGTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCGTGACCAGACTTGGCCGGCGCTCCGTAGGCCTTCTGGCCGCGTACTCCCCGGCCAGGCAGCATCGGCCTCCGAGGGGACAAAACAGCGGGAACGTGGCCTCCTTGGGAGTGTTATAGCCGCTTAGAATTGCCTGCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Arachnomyces_minimus_AB075350 AAGAGCTCAAATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGCAGAGATGCTTCGGGCCCGCCCGTCTAAGTCCCCTGGAACGGGGCGTCACGGAGGGTGAGAATCCCGTCTGCGGCGCCGACCCGTGCGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGGGGCTCAGCCGGCATTCTTGCCGTGCACTCCCCGGGCGGGCAGCGTCGGTTTGGGGGTCGTCAAGGTCCCCGGAATGTGTCGCCTCTGGGCGTCTTATAGCCGGGCGCAATGCGCCGCCCGGCGAGGAACGCGCCGGCACGGACGCTGGCGTAAT Aspergillus_ruber__U29556 AAGAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGCTTCGGGTGCGCCCCTCTAAGTGCTCTGGAACGGGCCATCGGAGAGGGTGAGAATCCCGTCTGGGGTTCCGGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGTTCGGGGTTCAGCCGGCTTTCGGGCCGTGTACTTCCCGGGCGGGCAGCGTCGGTTTGGGGGCCGTCAAGGCCCCTGGAATGTAACGCCCCTGGGCGCCTTATAGCCGGGTGTCATGCGCCGCCTGGCGAGGAACGCGCTGGCACGGACGCTGGCATAAT Aureobasidium_pullulans_AJ507454_ AACAGCTCAAATTTGAAAGCTAGCCTGTTCGCATTGTAATTTGTAGAGATGATTTGGGGAAGCCCTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGAGGATGGCCCCTATGTAAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTAAACTTTCGGCCGGTCTTCTGACCGTTTACTCATTTGACAGGCAGCATCAGTTTCGGGGCCGATAAGGCTCTGGGAATGTGGCTCCACTTGGAGTGTTATAGCCAGGTGTAATACGCCGCCGGGTGAGGTCCGCGCTGGCTAGGATGCTGGCGTAAT Bipolaris_maydis_AY544645_ AACAGCTCAAATTTGAAATCTGGCTCATCCGAGTTGTAATTTGCAGAGGCGCTTTGGCTTTGCGCGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGCGCACTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTTCAGTTCTCATCCGGGCTTTTGCCCGTGCACTCTCTGAGCAGGCAGCATCAGTTTGGGGGTGGATAAGGTCTCTGTCACGTACCTCTCTTGGGAGCCTTATAGGGAGACGACATACCCCGCCTAGTGAGGTCCGCGCTTGCTAGGATGCTGGCGTAAT Bisporella_citrina_AY789385 AACAGCTCAAATTTGAAATCTGGTCCGCCCGAGTTGTAATTTGTAGAAATGCTTCGGGCGTGCCCGTCTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCCTCGCCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGCCGGTCATCATCCGGGGTTCTCCCCGTGCACTCGCCGGCCAGGCAGCATCGGTTTCGGGGTGGATAAGGCCTTGGGAATGTGGCTCCTCTGGGAGTGTTATAGCCTCGTGCAATGCCCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Bulgaria_inquinans_DQ470960 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGTTTCGGGCGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGACCTAGCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACTGGCCATCAACCGGTGTTCTCACCGTGCACTCGTTGGTCAGGCAGCATCGGTTTCGAGGTTGATAAGGCCCCGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCGGGTGCAATGCACCGTTGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Cainia_graminis_AF431949 AACAGCTCAAATTTGAAATCTGGCTCGCCCGAGTTGTAATTTGTAGAGATGCTTCTGGCGCGTCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGCGGCCCAAGCCTATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTCCGGCGATCATCCGGCGTTCTCGCCGTGCACTTCCCGGTAAGGCAGCATCGGTTTCCGAGGGGACAAAGCTTTGGGAACGTGGCTCCTTCGGGAGTGTTATAGCCTTTCATAATGCCCCCTGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Candelabrum_brocchiatum_NBRC_30048 AACAGCTCAGATTTGAAATCTGGTCCGCCCGAATTGTAATCTGTAGGGTGGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCTATGTGAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGTAGGCCTTCTGGCCGCGTTCTCCTCGGTCAGGCAGCATCGGTTTCCGAGGGGATAAAACGGCGGGAATGTGGCTCTCTCGGGAGTGTTATAGCCGTCTATAATGCCCTCTGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Candelabrum_clathrosphaeroides_NBRC_101134_ AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCCTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGATCTGTTATCATCCAGGTTTCTACCTGTGCACTCGCAGGTCAGGCAGCATCGGTTTCGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Candelabrum_desmidiaceum_NBRC_101133 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTACCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCTTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACTTGTTATCATCCGAGCTTTTGCCCGTGCACTCGCAGGTCAGGCAGCATCGGTTTCGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Candelabrum_japonense_NBRC_108749 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCCTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGATCTGTTATCATCCAGGTTTCTACCTGTGCACTCGCAGGTCAGGCAGCATCGGTTTCGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Candelabrum_microsporum_NBRC_108750 AACAGCTCAGATTTGAAATCTGGTCCGCCCGAATTGTAATCTGTAGGGTAGCTTCGGGCGCGCTCTTTTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCTATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGTAGGCCTTCTGGCCGCGTTCTCCTCGGTCAGGCAGCATCGGTTTCCGAGGGGACAAAACGGTGGGAATGTAGCTCTCTTGGGAGTGTTATAGCCATCTATAATGCCCTCCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Candelabrum_microsporum_NBRC_108751 AACAGCTCAGATTTGAAATCTGGTCCGCCCGAATTGTAATCTGTAGGGTGGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCTATGTGAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCTGGCGTTCCGTAGGCCTTCTGGCCGCGTTCTCCTCTGTCAGGCAGCATCGGTTTCCGAGGGGACAAAGCGGTGGGAATGTGGCTCTCTTGGGAGTGTTATAGCCATCTACAATGCCCTCCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Candelabrum_sp._NBRC_109748 AACAGCTCAGATTTGAAATCTGGTCCGCCCGAATTGTAATCTGTAGGGTGGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTACGCGACCTAAGCCTATGTGAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGTTCCGTAGGCCTTCTGGCCGCGTTCTCCTCGGTCAGGCAGCATCGGTTTCCGAGGGGACAAAGCGGCGGGAATGTGGCTCTCTCGGGAGTGTTATAGCCGTCTACAATGCCCTCCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Candelabrum_spinulosum_NBRC_101903 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTACCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCTTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACCTGTTATCATCCGAGATTTTTCCCGTGCACTCGCAGGTCAGGCAGCATCGGTTTTGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Capronia_pilosella_DQ823099_ AACAGCTCAAATTTGAAATCTGGCCTGTCCGAGTTGTAATTTGTAGAGATGTTTCGGGTACCCCCGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTGCGGGTAGGGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGCCGGCGTTCCCCCTTCCTTTTGGTTGGTTACTCCCCGGTCAGGCAATATCGGTTTTGGGGTCGTCAAGGCGTTGGGAATGTACCTACCCTCGTAGACTTATAGCCAGCTGTCATGCGCCCCCGGGCGAGGAACGCGCTGGCTCGGATATTGGCGTAAT Cercophora_macrocarpa_AY780060 AACAGCTCAAATTTGAAATCTGGCCTGCCCGAGTTGTAATTTGCAGAGTGGCTTTGGGAGAGCCCGTCCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGCGGCCCAATCCTGTGTAAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCTGGCGATCATCCGGTGTTCTCACCGTGCACTCCCCAGCCAGGCAGCATCAGTTCTCGGGGGGATAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCAGGTGCAATGCCCTGCGGGGTGAGGTATGCGCTTGCAAGGATGCTGGCGTAAT Chaetosphaeria_raciborskii_AY436402 AACAGCTCAAATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGCAGAGATGCTTCGGGCGCGCCCTTCCAAGTCCCCTGGAACGGGGCGCCAGAGAGGGTGAGAGCCCCGTACTCGGCCCAAGCCTATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAGACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGACAAGGCATCATCTGGCGTTCTCGCCGTGCACTCGCTCGTCAGGCAGCGTCGGTTCGCGGGGGGATAAGGCTCTGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCAGTTGTCATGCCCTGTGTGGCGAGGTTCGCGCTTGCAAGGACGCTGGCGTAAT Chlorociboria_cf_aeruginosa_AY544669_ AACAGCTCAAATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGGAGAAATGCTTTGGGTGCGCCGGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTATGTGGTCCCGGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGTCGGCCGTCACCTGGTGCTCGCACCGGGCACTGGTCGGCCAGGCAGCATCGGTTTGGGGGTTGAGAAGGCCGGGAGAACGTGGCTCCCCTGGGAGTGTTACAGCTCCGCGCCATGCACCACCCAGCGAGGACCGCGCCGGCTAGGATGCTGGCGTAAT Coccidioides_immitis_AY176713 AAAAGCTCAAATTTGAAATCTGCTCCACCCGAGTTGTAATTTGGAGAGACACTTCGGGTGCGCACGCATAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGCGACCGGCCCATGCGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCTGGGGCTCAGCGGGCATGCGTGCCGTGTACTCCCCAGTCGGGCAGCATCAGTTCTGGGGTTGTTAAGGCCTCTGGAATGTATCGTCCTCGGACGTCTTATAGCCGGGCGCAATGCGCCGCCGGGTGAGGAACGCGCTGGCACGGATGCTGGCATAAT Columnosphaeria_fagi_AY016359_ AACAGCTCAAATTTGAAAGCTAGCCTGTTCGCATTGTAATTTGTAGAGATGATTTGGGGAAGCCCTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGAGGATGGCCCCTATGTAAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTAAACTTTCGGCCGGTCTTCTGACCGTTTACTCATTTGACAGGCAGCATCAGTTTCGGGGCCGATAAGGCTCTGGGAATGTGGCTCCACTTGGAGTGTTATAGCCAGGTGTAATACGCCGCCGGGTGAGGTCCGCGCTGGCTAGGATGCTGGCGTAAT Delphinella_strobiligena_AY016358_ AATAGCTCAAATTTGAAAGCTGGCCTGTCCGCATTGTAATTTGTAGAGATGCTTTTAGGCAGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGCCCTTCTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCCGGTTTTCAACCGGTCTTTTGACCGCCTATTCATCGGGCAGGCAGCATCAGTTTCGGGGCCGATAAGGCCTTGGGAATGTGGCTCTCCTGGGAGTGTTATAGCCAGGTGTAATACGTCGCCGGGTGAGGTCCGCGCTGGCTAGGATGCTGGCGTAAT Dermatocarpon_miniatum_AY584644 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGCTTCGGGCAAGCGCGTCTAATTTGCTTGGAACAGCAAGTCACAGAGGGTGAGAGTCCCGTCTGCGTGGCCGGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGGGTGACGTTCCCCCGGTCTTCTGACCGGCTATTCCTCAGTCAGGCAGCATCGGTTTGGGGGCCGTGAAGACCCCGGGAATGTATCTACCTCGGTCGACTTATAGCCGGGTGCAATGCGCCACCCGGCGAGGAACGCGCTGGCCCGGATGCTGGCGTAAT Diamantinia_citrina_AY346278 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGCTTTTGGCGCGCCCTTCCAAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGTGGCCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTTGCTGGCGATCATCCGGTGTTCTCACTGTGCACTTCCCTGTGAGGCAGCATCGGTTTCCAAGGGGACAAGGCGCCGGGAATGTAGCACCCCTGGGTGTGTTATAGCCGGTTGTAATACCCCGCGGGGCGAGGTACGCGCTCGCAAGGATGCTGGCGTAAT Diaporthe_pustulata_AF408358 AACAGCTCAAATTTGAAATCTGGCCTGCCCGAGTTGTAATTTGCAGAGATGCTTCTGGCGCGTCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGCGGCCCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGGCGCTCATCAGGGGTTCTCCCCGTGCACTCCCCCGCCAGGCAGCATCGGTTCTCGGGGGGACAAACCGCCGGGAACGTAGCACCCCCGGGTGTGTTATAGCCGGCGACGATACCCTGCGGGGCGAGGTTCGCGCTCGCAAGGATGCTGGCGTAAT Humicola_sphaeralis_AF286407 AACAGCTCAAATTTGAAATCTGGCTTGCCCGAGTTGTAATTTGCAGAGAAGCTTTGGGCGCGCCCGACTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATACGGCCTAAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCTGGCTATCATCCGGTGTTCTCACCGTGCACTCTCCAGCCAGGCAGCATCGGTTCTCGGGGGGATAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCAGGTGCAATGCCCTGCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Hyaloscypha_daedaleae_AY789415 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCCTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGGTTATCATCCGAGCTTTTGCCCGTGCACTCGTCGCTCAGGCAGCATCGGTTTTGGGGGTGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Hyaloscypha_occulta_JN086754 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCCTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGATCTGTTATCATCCAGGTTTCTACCTGTGCACTCGCAGGTCAGGCAGCATCGGTTTCGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Hyaloscypha_spiralis_AB546940 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGAGTGTACCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGTCTTTGCTCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGATCTGTTATCATCCGAGATTTTTCCCGTGCACTCGCAGATCAGGCAGCATCGGTTTTGGGGGCGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCGCCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Hydrocina_chaetocladia_AY789412 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTCGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCCTTGCTCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCCGTCATCATCCGGGGTTCTCCCCGTGCACTCGCGGGTCAGGCAGCATCGGTTTCGGGGTGGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCCCCCCCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Hysteropatella_clavispora_AY541493_ AACAGCTCAAATTTGAAATCTGGCCTGTCCGAGTTGTAATTTGTAGAGATGCTTCGGAGTCGCCCGTCTAAGTGCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGCGGCCCTTCTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGGTTCTCAACCGGCCTTTTGCTCGTGCACTCTCCGGGCAGGCAGCATCGGTTCGGGGGTCGATAAGGCCTTGGGAATGTAGCACCCTTGGGTGTGTTATAGCCTCGCGCAATGCGCCGCCTGGCGAGGTCCGCGCTGGCTAGGATGCTGGCGTAAT Lachnellula_occidentalis_KC492977 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGCGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGACTTTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGAGCCGTCATCATCCGGGGTTCTCCCCGTGCACTCGCGGTTCGGGCAGCATCGGTTTGGGGGTGGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCCCCACCCGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Lachnum_virgineum_AY544646 AACAGCTCAAATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGTGCCTGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTAGTCCTTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTATTCTGCCATCATCCAGGGTTCTCCCTGTGCACTCGTAGATTAGGCAGCATCGGTTTGGGGGTGGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCCCCACCCGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Lambertella_tubulosa_AY616237 AACAGCTCAGATTTGAAATCTGGCTCGTCCGAGTTGTAATTTGTAGACATGCTTTGGGTGTGTCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCCTTGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGCGTCGCATCATCCGGGGCTTGCCCCGTGCACTTGGGCGCCAGGCAGCATCAGTTTCGGGGTGGATAAGGCCTTGGGAATGTAGCTTCTTTGGGAGTGTTATAGCCTCGTGCAATGCCCCACTGGGTGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Lecanora_hybocarpa_DQ782910 AACAGCTCAAATTTGAAATCTGGCTCGCCCGAGTTGTAATTTGGAGAGGTGTTTCGGGCGCGCCCGTCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGCGGCGCCAGCCCATGCGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCTGGGCATCAGCCTCCGTTCTCGGGGTGCACTCGTCGGACAGGCAGCATCGGTTCGAGGGCGGATAAGGCCTTGGGAACGTAGCTCCCCTGGGAGTGTTATAGCCTCGTGCAATGCCCCGCCCGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Melanconiella_spodiaea_AF408370 AACAGCTCAAATTTGAAATCTGGCCTGCCCGAGTTGTAATTTGCAGAGATGCTTCTGGCGCGTCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGCGGCCCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGGCGCTCATCAGGGGTTCTCCCCGTGTACTCCCCCGTCAGGCAGCATCGGTTCTCGCGGGGATAAAACGGTGGGAACGTGGCTCCCTCGGGGGTGTTATAGCCGCCTACGATATCCTGCGGGGCGAGGTTCGCGCTCGCAAGGATGCTGGCGTAAT Melanochaeta_aotearoae_AF466082 AATGGCTCAAATTTGAAATCTGACCCGTCCGAGTTGTACTTTGCAGAGATGCTTTTGGCGAGCTCGCCCAAGTCCCCTGGAACGGGGCGCCGGAGAGGGTGAGAGCCCCGTACGCGAACCGAGCCTGTGCAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGTGGGAGGTAGACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACGTGGCGGGGTCTCCGTGGGCGTTCTCGCCGCGTACTCGCCCGCCAGGCAGCGTCGGTTCGGAGGGGGATAAGGCGCCTGGGACGTGGCTCCTCCGGGAGTGTTATAGCCGGCTGTCATGCCCCGCCCGGCGAGGTTCGCGTTTGCAAGGACGCTGGCGTAAT Myriangium_duriaei_AY016365 AACAGCTCAAATTTGAAATCTGGCCTGTCCGAATTGTAATTTGGAGAGATGTTTTGGGTGTCCCCGCCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGAGGTACCCTCCGTAAAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGTCTCGCGCGGCCTTCGGCCTCTCTTCTGAGTGTTTATTCGTCGCGCGGGCAGCATCAGTTTCGGGGTTGATAAGGTTGTGGGAATGTGGCCCCCTCGGGGGTGTTATAGCCACTCGTAATACACCGCTGGGTGAGGTCCGCGCTGGCTAGGATGCTGGCAAAAT Neocosmospora_haematococca_DQ119560 AACAGCTCAAATTTGAAATCTGGCTCGCCCGAGTTGTAATTTGTAGAGATGCTTTTGGTGAGTCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGTGGCCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCTGGTTATCATCCGGGGTTCTCCCCGTGCACTCTCCGGCCAGGCAGCATCAGTTCGCCCTGGGATAAGGCATCGGGAACGTGGCTCTCTCGGGAGTGTTATAGCCGTTCGTAATACCCTCGGCGGTGAGGTTCGCGCTCGCAAGGATGCTGGCGTAAT Neofabraea_malicorticis_AY544662 AACAGCTCAAATTTGAAATCTGGGTCGTCCGAGTTGTAATTTGTAGAAATGCTTCGGGTGCGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCTTGGCCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGTTCGTCATCATCCGGGGTTCTCCCCGTGCACTCGCTTACCAGGCAGCATCGGTTTCGGGGTTGATAAGGCCTTGGGAATGTAGCTCCTCTGGGAGTGTTATAGCCTCGTGCAATGCACCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Neofusicoccum_luteum_AY928043 AACAGCTCAAATTTGAAAGCTGGCCCGTCCGCGTTGTAATTTGTAGAGATGATTCGGCGACGCCCCCCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGGGGCGCCTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCAGTTCTCAGCTTGTCTCCTGACAGCGTACTCTCTGGGCAGGCAGCATCAGTTCGGGGGTCGATAAGACCTGGGGAATGTAGCTCCTCTGGGAGTGTTATAGCCTGGTGCAATGCGCCGCCTGGTGAGGATCTCGCTGGCTAGGATGCTGGCGTAAT Ophiostoma_piceae_AJ538341 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGGAGAGATGCTTTTGGCGCGCCCGTCCGAGTTCCTTGGAACAGGACGCCATAGAGGGTGAGAGCCCCGTACGCGGCCCTAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGGCCGTGATCATCCGGTGTTCTTACCGTGCACTCCCGGCTCAGGCAGCATCGGTTTTCCAGGGGATAAGGTCGCGGGAACGTAGCTCCCTCGGGAGTGTTATAGCCGTGCGTCATGCCTCGGGGGGCGAGGACCGCGCTGGCAAGGATGCTGGCGTAAT Oxydothis_frondicola_AY083835 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGCTTTTGGCGCGTCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGTGGCCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTCAGGCGATCATCCGGTGTTCTCACCGTGCACTTCCCTGTTAGGCAGCATCGGTTTCCGGGGGGAGAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCGTTCATAATACCCTGCGGGGCGAGGTTCGCGCTTGCAAGAATGCTGCCGTAAT Pezicula_ericae_AY442323 AACAGCTCAAATTTGAAATCTGGGTCGTCCGAGTTGTAATTTGTAGAAATGCTTTGGGTGCGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGGCTTGGCCCGTGTAAAGCTCTTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGCGGGTTATCATCCGGGGTTCTCCCCGTGCACTCGCCTGCCAGGCAGCATCGGTTTCGGGGTTGATAAGGCCTTGGGAATGTGACTCCTCTGGGAGTGTTATAGCCTCGTGCAATGCACCACCGGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Peziza_badia_U42692 AAAAGCTCAGATTTGAAATCTGGCCACGCCGAGTTGTAGTCTGTAGAGTGTATTCGAGTGTGCTTGCTTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTTAGCTTGCTTAGCTCATGTGAATCTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCAAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTCTGAACAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTCCGACCAGACGCATTCAGCCATCAATCTTCATTCTTGAGGTGCACTCGTTGCTTGGGTAGCATCAGTTATGGGGTGGAAAAGACTAAGGGAATGTGGCTCCTTTGGGAGTGTTATAGCCTTGTGCAATGCTCCGCTGTGTGAGGACCGCGCTGGTGAGGATGCTGGCATAAT Peziza_vesiculosa_AF378367 AAAAGCTCAGATTTGAAATCTGGTCACTCCGAGTTGTAATCTGTAGAGAGTATTCGAGTGTGCCTGCTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTTAGCTTGCTTAGCTCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCAAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTCTGAACAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGCTACCAGACACGCTTAGTTATCAACCTCCATTCTTGGTGTGCACTCACTAAGTGGGTAGCATCAGTTACGGGGTGGATAAGACCTGGGGAATGTAGCTTCTTTGGAAGTGTTATAGCCTGGTGTAATACCCCGCTGTGTGAGGCCCGCGCTGGCGAGGATGCTGGCATAAT Phoma_herbarum_AY293790 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGCAGAGGTGCTTTGGCGATGCGTGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGCGCCGCCTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACATGCTTAGTTCTCACCGGGGCTCTTGCCCGGGCACTCTCTAGGCAGGCAGCATCAGTCCGGGGGTTGATAATGCCTGCTACATGTACCTCTCTTGGGAGACTTATAGGGTAGCGACATACACCGCCTGGTGAGGTCCGCGCTTGCTAGGATGCTGGCGTAAT Pisorisporium_cymbiforme_KM588902 AACAGCTTAGATTTGAAATCTGGCCCGCCCGAGTTGTAATCTGCAGGGAAGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCAGAGAGGGTGAGAGCCCCGTACGCGACCCCAGCCCATGTGAAGCTCCTCCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGCCTGTCTTCTGGCAGCTCACTCCCCGGCCAGGCAGCATCGGTTTTCGAGGGGACAAAGCGGTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCGCCCAGAATACCCTCTGGAGCGAGGTCCGCGCCTGCAAGGATGCTGGCGTAAT Pisorisporium_cymbiforme_KM588903 AACAGCTTAGATTTGAAATCTGGCCCGCCCGAGTTGTAATCTGCAGGGAAGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCAGAGAGGGTGAGAGCCCCGTACGCGACCCCAGCCCATGTGAAGCTCCTCCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGCCTGTCTTCTGGCAGCTCACTCCCCGGCCAGGCAGCATCGGTTTTCGAGGGGACAAAGCGGTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCGCCCAGAATACCCTCTGGAGCGAGGTCCGCGCCTGCAAGGATGCTGGCGTAAT Pisorisporium_cymbiforme_KM588904 AACAGCTTAGATTTGAAATCTGGCCCGCCCGAGTTGTAATCTGCAGGGAAGCTTCGGGCGCGCTCTTCTGAGTCCCCTGGAACGGGGCGCCAGAGAGGGTGAGAGCCCCGTACGCGACCCCAGCCCATGTGAAGCTCCTCCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCCGGCGCTCCGCCTGTCTTCTGGCAGCTCACTCCCCGGCCAGGCAGCATCGGTTTTCGAGGGGACAAAGCGGTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCGCCCAGAATACCCTCTGGAGCGAGGTCCGCGCCTGCAAGGATGCTGGCGTAAT Porpidia_melinodes_DQ314985 AACAGCTCAAATTTGAAATCTGACCCGCCCGAGTTGTAATTTGTAGAGATGCTTCGGGTGCGTCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCGCCACCCCGTGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGAGCATCAGCCGTTATTCTTAGCGTGCACTCGCCGGACAGGCAGCATCGGTTCGGGGGCCGATAAGGCCTCGGGAATGTAGCTCCCCCGGGAGTCTTATAGCCGGGTGCAATGCGCCGCCCGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Prosthemium_betulinum_AY004341 AATAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGCAGAGGCGCTTTGGAGTTGCGCACCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGCTCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCAGTTCTCATCCGGGGTTCTCCCCGTGCACTCTCTGGGCAGGCAGCATCAGTTCGGGGGTTGAGAAGACCTGTGTCATGTAGCTGTTCTGGCAGTGTTATAGGGAGGTGGAATGCACCGCTCGATGAGGTCCGCGCTTGCTAGGATGCTGGCGTAAT Ramularia_endophylla_DQ470968 AACAGCTCAAATTTGAAATCTGGCGCACCCGAGTTGTAATTTGTAGAGATGCTTCAGGTAGCACCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCACCTTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCAGCAGTGTTCCGCCGGTCTTTTGACCGTCTACTCTCTGCTGAGGCAACATCATCTGGGACGCCGATAAGACCTTAGGAATGTAGCTCCCCTGGGAGTGTTATAGCCCTGTGATGCGGCCGCTCGGGTGAGGTCCGCGCTGGCAAGGATGTTGGCGTAAT Rhytisma_acerinum_AF356696 AACAGCTCAAATTTGAAATCTGGCTTGTCCGAGTTGTAATTTGTAGAAATGCTTCGGGTGTGCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCCTCGCCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGACCTGCCATCATCTGGGGTTCTCTCCGTGCACTCGTTGGTCAGGCAGCATCGGTTTGGGGGTTGATAAGGCCTTGGGAATGTAGCTTCCTTGGGAGTGTTATAGCCTCGTGCAATGCATCATCCGGCGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Schizothecium_curvisporum_AY346300 AACAGCTCAAATTTGAAATCTGGCCTGCCCGAGTTGTAATTTGCAGAGAAGCTTCTGGTGCGCCCGTCCGAGTCTCCTGGAACGGAGCGCCATAGAGGGTGAGAGCCCCGTATGCGGCCCAAACCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGCCGGCGATCATCCGGTGTTCTCACCGTGCACTCCCCGGCCGGGCAGCATCGGCTTCCGCGGGGACAAGGTCCCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCGGGCGCAATGCCCCGCGGGGCGAGGACCGCGCTTGCAAGGATGCTGGCGTAAT Sclerotinia_sclerotiorum_AF431951 AAAAGCTCAAATTTGAAATCTGGCTCATCCGAGTTGTAATTTGTAGAAATGCTTCGGGTGTGTCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCCTAGCTCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGACTTGGTTTCATCAGGGTTTCGTCCCGTGTACTTCTCAGTCAGGCAGCATCAGTTTGAGGGTTAATAAGGCTTGGAGAATGTGGCCCTCTTGGGGGTGTTATAGCTCAGTGCAATGTACCACTTGGTGAGGACCGCGCTGGCTAGGATGCTGGCGTAAT Staphylotrichum_longicolleum_AF286408 AACAGCTCAAATTTGAAATCTGGCCTGCCCGAGTTGTAATTTGCAGAGAAGCTTTGGGCGCGCCCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGCGGCCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCCGGCTATCATCTGGTGTTCTCACCGTGCACTCTCCGGCCAGGCAGCATCGGTTCTCGGGGGGACAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCAGGCGTAATGCCCTGCGGGGCGAGGTTCGCGCTTGCAAGGATGCTGGCGTAAT Stictis_radiata_AY341361 AACAGCTCAAATTTGAAATCTGGCTCGCCCGAGTTGTAATTTGTAGAGATGCTTCGGGTGCGCCCGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTACGCGGTGCCACCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCGGGGTATCAGCCGTCCTTTTGGGCGTGCACTTTCCCGGCGGGCAGCATCGGTTCGGGGGTCGACAAGGTTCCGGGAATGTAACTCCCCTGGGAGTGTTATAGCCGGGCGTAATGCGCCGCCTGGCGAGGACCGCGCTTGCTAGGATGCTGGCGTAAT Tolypocladium_capitatum_AY489721 AGCAGCTCAGATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGCAGAGATGCTTTTGGCGCGCCCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGCGGCCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGCCGGTGATCATCCAGCGTTCTCGCCGTGCACTTCCCGGCCAGGCAGCATCAGTCCGCCCGGGGACAAGGCGTCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCGTCCGCAATGCCCTGGGCGGTGAGGTTCGCGCTCGCAAGGATGCTGGCGTAAT Trichoderma_atroviride_AB646518 AACAGCTCAAATTTGAAATCTGGCCCGTCCGAGTTGTAATTTGTAGAGATGCTTTTGGTGAGTCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGTGGCCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCCGGCGATCATCCGGGGTTCTCCCCGTGCACTTCCCGGTCAGGCAGCATCAGTTCGGCCGGGGAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCGTTCATAATACCCTCGCTGGTGAGGACCGCGCTTGCAAGGATGCTGGCGTAAT Tubeufia_cerea_AY856907 AACAGCTCAAATTTGAAATCTGGTCCGCCCGAATTGTAATTTGTAGAGATGCTTCGGCTTACCCCGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTTTGCGGCGCTTCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGCCCGGATCTCCGCCGGTCCTCCGACCGTGTACTCTCCGGGCAGGCAGCATCAGTTCGGGGGTCGATAAGGCCTCGGGAATGTAGCTCTCTTGGGAGTGTTATAGCCTTGTACAATACGCCGCCTGGTGAGGAACGCGCTGGCCAGGATGCTGGCGTAAT Verruculina_enalia_AY016363_ AACAGCTCAAATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGTAGAGGCGCTTTGGTGTTGCCCGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGCGGGCCTTCGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTAGTTCTCACCTGGGCTCTTGCCCGCGCACTCTCTGGGCAGGCAGCATCAGTTCAAGGGTCGACAAAGCCCTAGGAATGTGGCTCCTTCGGGAGTGTTATAGCCAGGCATAATGCGCCGCTTGGTGAGGTCCGCGCTTGCTAGGATGCTGGCGTAAT Xanthothecium_peruvianum_AB053453 AAGAGCTCAAATTTGAAATCTGGCCCGCCCGAGTTGTAATTTGCAGAGATGCTTCGGGTTCGCCCGTCTAAGTCCCCTGGAACGGGGCGTCATGGAGGGTGAGAATCCCGTCTGCGACGCCGACCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGGGGCTCAGCCGGCATTCTTGCCGTGCACTCCCCGGGCGGGCAGCGTCGGTTTGGGGGTCGTCAAGGTCCCCGGAATGTGTCGCCCCTGGGCGTCTTATAGCCGGGCGCAATGCGCCGCCCGGCGAGGAACGCGCTGGCACGGACGCTGGCGTAAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53731] TITLE Candelabrum_Matrix_of_Fig._3; LINK TAXA = Taxa3; DIMENSIONS NCHAR=933; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Achroceratosphaeria_potamia_KM588908 CTGTTCCGAGGCATCATTCGTCGCCTGACGGGTGATCTGACCAACTACCTGAGGCGATGCGTCGAGACGGGCCGCATCTTCACACTCACTCTGGGCGTCAAGTCGCAGACGCTCTCGAACGGCATGAAGTACTCGCTGGCGACAGGCAATTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCCGGCGTGTCTCAGGTCTTGAACAGATACACGTTTGCTTCCACGCTGTCACATTTGCGGCGAACCAACACACCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGGCAACTGCACAACACCCACTGGGGCCTGGTCTGTCCGGCAGAGACGCCCGAAGGCCAGGCGTGTGGCCTCGTCAAGAACCTTTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGACCCGATCAACGACTTCCTGATCAACAGAGGCATGGAGGTCCTCGAGGAGTACGAACCACTTCGCCACCCGAATGCGACAAAGGTGTTTGTCAACGGCGTGTGGGTTGGCGTCCACCAGGATCCCAAGCATCTGGTCACCGTGGTTCAAGGCCTTCGCAGGACGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGATATTCGAGACCGAGAGTTCAAGATCTTCTCTGATGCTGGACGCGTCATGCGTCCGCTTTTCGTCGTTGAGCAGACCGACAACTCTCCATCGGGTGTGGAGAAGGGTCAGCTGATTGTCACCAAGGAACACATAATGCAGCTTTACATGGGATGGGACGGCCTGACCCAAGTTGGCGCAGTCGAGTTCCTTGACGCCGAGGAGGAAGAAACAGCTATGATCTGTATGACTCCCGAGGACTTGGAAGGTTTCCGACAGAGCAAGGTGGCGACACATATGTACACGCACTGCGAGATCCATCCGAGCATGATCTTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_106788 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGCTGTCCCACTTGCGGCGGACCAACACGCCGATCGGCCGCGACGGCAAGCTGGCAAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTAGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTCAGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_106791 CTGTTTCGAGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTATCTGAGGCGGTGTGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCCGGCGTGTCCCAGGTGCTGAACCGGTACACGTTTGCTTCGACGCTGTCTCACCTGCGGCGAACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCGGAAGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGCTGATGTGCTACGTGAGCAACGGGTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTCGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCGAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGCCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATTCGAGATCGAGAGTTCAAGATCTTCTCCGATGCCGGGCGCGTCATGCGGCCGCTCTTCGTGGTCGAACAAGAGGACAACTCCGAGTCGGGGGTGGAGCGCGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGCATCTGCGCC Candelabrum_brocchiatum_NBRC_106792 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGGTACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGTGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTTGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_106799 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAATAGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAATACGCCAATCGGTCGTGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTTTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTTGGCCTGATCCAGAGACTCCGCAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGTGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACACCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_106802 CTGTTTCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGTCGCATCTTCACGCTCACTCTTGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACGTTTGCCTCGACGCTGTCCCACTTGCGGCGAACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCGGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTGTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCTAAGCATCTGGTGGGCCTGATCCAGCGGCTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGCCGAGTCATGCGTCCGCTCTTCGTCGTCGAACAGGACGACAACGCCGAGTCGGGGGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAACTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCAGAAAGAGCAAGGCAGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_106803 CTGTTCCGCGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTTGCGTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGGGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCCGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGGAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_106805 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCCTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGCCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCACCTGGTTGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTGGATGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_106808 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTTACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTTGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAAGAGACCGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_106813 CTGTTTCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTATCTGAGGCGGTGTGTCGAGATGGGCCGCATCTTCACGCTCACTCTTGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACTTTTGCTTCGACGCTGTCCCACTTGCGGCGAACCAACACGCCAATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGGCTGGTCTGCCCTGCCGAGACGCCGGAAGGCCAGGCCTGTGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAATGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCTAAGCATCTGGTTGGCCTGATCCAGCGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATTCGAGACCGAGAATTCAAGATCTTCTCCGATGCCGGACGTGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCAGAAAGAGCAAGGCAGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATATGCGCC Candelabrum_brocchiatum_NBRC_108053 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGCTGTCCCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCAAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTCAGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108059 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTTGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108060 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAATTATCTAAGGCGATGTGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTAGCAACGGGCAATTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCTGGCGTGTCCCAGGTGCTGAACCGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTTCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAAGTTCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTGGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCTCTCGTGCGGGACATTCGAGATCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGACGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAAGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_108076 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTCAACAGATACACGTTTGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCCGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTAAGCAACGGCTCCAACGCGGAGCCCATCAACGATTTCCTCATCAGCCGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATTAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108086 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGACGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTTGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108095 CTGTTCCGCGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACTCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGTCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCCGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGGGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCCGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGGAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108096 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGACGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTTGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108097 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTTGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108098 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAATTATCTAAGGCGATGTGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTAGCAACGGGCAATTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCTGGCGTGTCCCAGGTGCTGAACCGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTTCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAAGTTCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGATCCCAAGCATCTGGTGGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCTCTCGTGCGGGACATTCGAGATCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGACGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAAGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_108146 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTCAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCGATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTTGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTGTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGATGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACATATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_108160 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAATTATCTAAGGCGATGTGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTAGCAACGGGCAATTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCTGGCGTGTCCCAGGTGCTGAACCGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTTCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAAGTTCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGATCCCAAGCATCTGGTGGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCTCTCGTGCGGGACATTCGAGATCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGACGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAAGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_108189 CTGTTCCGAGGCATCATCCGCCGCCTGACCGGCGACCTGACCAATTATCTAAGGCGATGTGTCGAGATGGGCCGTATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTAGCAACGGGCAATTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCTGGCGTGTCCCAGGTGCTGAACCGATACACCTTCGCTTCGACGCTGTCTCACTTGCGGCGGACCAACACGCCAATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTTCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAAGTTCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTGGGCCTGATCCAGAGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCTCTCGTGCGGGACATTCGAGATCGAGAGTTCAAGATCTTTTCCGACGCCGGGCGTGTCATGCGCCCGCTCTTCGTCGTCGAGCAGGACGACAACTCCGAGTCGGGCGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTCGGCTGGGACGACCTGACCAAAGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_108190 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_108827 CTGTTCCGAGGCATCATCCGCCGCTTGACTGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACTCTTGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTAGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAGTTCAACCGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACACTGTCGCACTTGCGGCGAACCAACACGCCAATCGGCCGAGACGGCAAGCTGGCAAAGCCGCGCCAGCTCCACAACACTCATTGGGGCCTGGTCTGCCCTGCCGAGACGCCGGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTTCGACACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCTAAGCATCTGGTCGGCCTGATCCAGCGACTCCGTAGGCAGCACGTGCTCGAATTCGAGCTCTCGCTCGTGCGGGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGACGCGTCATGCGTCCGCTCTTTGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTTGAGAGGGGCCAGTTGATTGTCACCAAGGAACACATCAGAAAACTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCCGAAAGAGCAAGGCAGAGACGCACATGTATACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGCGCC Candelabrum_brocchiatum_NBRC_109730 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTCAACAGATACACGTTTGCCTCGACGCTGTCCCATTTGCGGCGGACCAACACGCCCATCGGCCGTGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGTTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGATCCCAAGCATCTCGTCGGCTTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTTGAGCTCTCCCTCGTCCGGGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTAATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATTGAGTTCCTCGACGCCGAGGAAGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109732 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCACAGGTGCTCAACAGATATACCTTCGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCTATCGGCCGCGACGGCAAGCTAGCGAAGCCGCGCCAGCTCCACAATACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACAAAGGTGTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGGCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGCGCGGTCAGCTGATCGTCACCAAGGAGCACATCAGACGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109737 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109741 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109744 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109745 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGTGTGTCCCAGGTGCTCAACAGATACACGTTTGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCATTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTCAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATTCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGGGACATTCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_109747 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTATCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGTGTGTCCCAGGTGCTCAACAGATACACGTTTGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCATTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTCAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATTCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGGGACATTCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_brocchiatum_NBRC_30048 CTGTTCCGGGGCATCATCCGCCGCCTGACCGGCGACCTGACCAACTACCTGAGGCGGTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTGCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGGGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_cf._brocchiatum_NBRC_108061 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCTTCGACGCTGTCTCACCTGCGGCGAACCAACACGCCGATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTCGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTACACCAGGATCCTAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGGCGTGTCATGCGGCCGCTCTTCGTCGTCGAACAAGACGACAACTCCGAGTCGGGGGTGGAGCGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGCATTTGCGCC Candelabrum_cf._brocchiatum_NBRC_108065 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTACGGCGATGCGTCGAGATGGGTCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGTTGTCTCACCTGCGGCGAACCAACACACCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGGCTGGTCTGTCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGAGTCTGGGTAGGCGTACACCAGGATCCTAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATCCGAGACCGGGAGTTCAAGATCTTTTCCGACGCCGGACGCGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_cf._brocchiatum_NBRC_108077 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTACGGCGATGCGTCGAGATGGGTCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTCGCTTCGACGTTGTCTCACCTGCGGCGAACCAACACACCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGGCTGGTCTGTCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGAGTCTGGGTAGGCGTACACCAGGATCCTAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATCCGAGACCGGGAGTTCAAGATCTTTTCCGACGCCGGACGCGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTCGAGAGGGGCCAGCTGATCGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_cf._brocchiatum_NBRC_108103 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCTTCGACGCTGTCTCACCTGCGGCGAACCAACACGCCGATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTCGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTACACCAGGATCCTAAGCACCTGGTCGGCCTCATCCAGCGGCTCCGTCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGCCGTGTCATGCGGCCGCTCTTCGTCGTCGAACAAGACGACAACTCCGAGTCGGGGGTGGAGCGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGCATTTGCGCC Candelabrum_cf._brocchiatum_NBRC_108106 CTGTTTCGAGGCATCATCCGCCGCTTGACCGGCGACTTGACCAACTATCTGAGGCGGTGTGTCGAGATGGGCCGCATCTTCACGCTCACTCTTGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACTGCCGGCGTGTCCCAGGTGCTGAACAGATACACCTTTGCTTCAACGCTGTCCCACTTGCGGCGAACCAACACGCCAATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCGGAAGGTCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATTAACGACTTCCTCATCAGCAGGAACATGGAGGTTCTGGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCTAAGCATCTGGTTGGCCTGATCCAGCGACTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGACGTGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTCGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCTGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAGGATCTCGAGGGCTTCAGAAAGAGCAAGGCAGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATATGCGCC Candelabrum_cf._brocchiatum_NBRC_108171 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCTTCGACGCTGTCTCACCTGCGGCGAACCAACACGCCGATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTCGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTACACCAGGATCCTAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGTCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGGCGTGTCATGCGGCCGCTCTTCGTCGTCGAACAAGACGACAACTCCGAGTCGGGAGTGGAGCGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGCATTTGCGCC Candelabrum_cf._brocchiatum_NBRC_108175 CTGTTCCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTTGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACCGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCTTCGACGCTGTCTCACCTGCGGCGAACCAACACGCCGATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCTGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAATCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCCGGAACATGGAGGTTCTCGAGGAGTACGAGCCGCTTCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTACACCAGGATCCTAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTCGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGAGACATTCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGGCGTGTCATGCGGCCGCTCTTCGTCGTCGAACAAGACGACAACTCCGAGTCGGGAGTAGAGCGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAAGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGCATTTGCGCC Candelabrum_cf._microsporum_NBRC_108054 CTGTTCCGTGGCATCATCCGCCGCCTAACGGGTGACCTGACCAACTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTCAACAGGTACACGTTCGCCTCGACGCTGTCCCACCTGCGGCGAACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTTTCGTTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAAGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCTAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGATATCCGCGACCGGGAGTTCAAGATCTTCTCCGACGCCGGACGTGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGATAACTCGGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGGAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCAAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_102397 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTACTTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCGCAGGTGCTCAACAGATACACCTTCGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAATGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGGCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGCGCGGCCAGCTGATCGTCACCAAGGAGCACATCAGACGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_microsporum_NBRC_102398 CTGTTCCGCGGCATCATCCGCCGCCTGACGGGCGACCTGACCAACTACCTGAGACGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCGCAGGTGCTCAACAGATACACCTTCGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGCGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGTCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACAAAGGTCTTCGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTCCGGCGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGGCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGCGCGGCCAGCTGATCGTCACCAAGGAGCACATCAGACGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGGAAGAGCAAGGCCGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_microsporum_NBRC_108099 CTGTTCCGAGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTACCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTTGCTACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAAGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTGGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGACGCGTCATGCGTCCGCTGTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGATGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_108151 CTGTTCCGAGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTACCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTTGCTACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAAGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTGGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGACGCGTCATGCGTCCGCTGTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGATGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_108161 CTGTTCCGAGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTACCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTGAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTTGCTACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGGTACACGTTCGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAAGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTGGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGACGCGTCATGCGTCCGCTGTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGATGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_108178 CTGTTCCGAGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTATCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTAAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTTGCGACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGTGTGTCCCAGGTGCTGAACAGGTACACGTTCGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAAGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGACGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGATGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_108750 CTGTTCCGCGGCATCATCCGCCGCCTGACCGGCGACCTGACCAATTACCTGAGGCGATGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTCAAGTCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTGAACAGATACACGTTTGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGTAAGCTGGCCAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCCGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTGCGGCACCCCAACGCGACAAAGGTCTTTGTCAACGGCGTCTGGGTCGGCGTGCACCAGGACCCCAAGCACCTGGTCGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTTGAGCTCTCGCTCGTGCGGGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAGGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAAGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATCTGCGCC Candelabrum_microsporum_NBRC_108751 CTGTTCCGAGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTATCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACCCTCGGCGTAAAATCGCAGACCATGTCGAACGGCATGAAGTACTCGCTTGCGACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGTGTGTCCCAGGTGCTGAACAGGTACACGTTCGCCTCGACGCTGTCCCATCTGCGGCGGACCAACACGCCCATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTCGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTGATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAAGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGACGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGATGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_microsporum_NBRC_109667 CTGTTCCGCGGCATCATCCGCCGCTTGACGGGCGACCTGACCAACTACCTGAGGCGCTGCGTCGAGATGGGCCGCATCTTCACGCTCACGCTCGGCGTGAAATCGCAGACCATGTCCAACGGCATGAAGTACTCGCTCGCGACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAACTCGACGGCCGGCGTGTCCCAGGTGCTCAACAGGTACACGTTCGCCTCGACGCTGTCCCACCTGCGGCGGACCAACACGCCCATCGGCCGGGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCCGCCGAGACGCCCGAAGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGCTCATGTGCTACGTGAGCAACGGCTCCAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAATGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTGGGCGTGCACCAGGACCCCAAGCATCTCGTGGGCCTGATCCAGCGGCTGCGCAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGCGACATCCGAGACCGCGAGTTCAAGATCTTCTCCGACGCCGGCCGCGTCATGCGTCCGCTCTTCGTCGTCGAGCAGGAGGACAACTCCGAGTCGGGCGTGGAGAGGGGCCAGCTGATCGTCACCAAGGAGCACATCAGAAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAGGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAGGACCTCGAGGGCTTCAGAAAGAGCAAGGCGGAGACGCACATGTACACGCACTGCGAGATCCACCCGAGCATGATTCTGGGAATTTGCGCC Candelabrum_sp._NBRC_109738 CTGTTTCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAATTACCTGAGGCGATGTGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCGGGCGTGTCCCAGGTGCTGAACAGGTACACCTTCGCCTCGACGCTGTCTCACTTGCGGCGAACCAACACGCCAATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCCGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGGCGTGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTGGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGGAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGTAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGCGCC 'Candelabrum sp. NBRC 109748_2' CTGTTTCGAGGCATCATCCGCCGCTTGACCGGCGACCTGACCAATTACCTGAGGCGATGTGTCGAGATGGGCCGCATCTTCACCCTCACCCTCGGCGTGAAGTCGCAGACCATGTCGAACGGCATGAAGTACTCGCTGGCAACGGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCGGGCGTGTCCCAGGTGCTGAACAGGTACACCTTCGCCTCGACGCTGTCTCACTTGCGGCGAACCAACACGCCAATCGGCCGAGACGGCAAGCTGGCGAAGCCGCGCCAGCTCCACAACACGCACTGGGGCCTGGTCTGCCCTGCCGAGACGCCTGAGGGCCAGGCCTGCGGCCTCGTCAAGAACCTCTCGTTGATGTGCTACGTGAGCAACGGCTCGAACGCGGAGCCCATCAACGACTTCCTCATCAGCAGGAACATGGAGGTCCTGGAGGAGTACGAGCCGCTCCGGCACCCCAACGCGACCAAGGTCTTCGTCAACGGCGTCTGGGTAGGCGTGCACCAGGACCCCAAGCATCTGGTCGGCCTGATCCAGCGGCTCCGTAGGCAGCACGTGCTCGAGTTCGAGCTCTCGCTCGTGCGGGACATCCGAGACCGAGAGTTCAAGATCTTTTCCGATGCCGGGCGTGTCATGCGTCCGCTCTTCGTCGTCGAACAGGAGGACAACTCCGAGTCGGGGGTGGAGAGGGGCCAGCTGATTGTCACCAAGGAACACATCAGGAAGCTCTACTTTGGCTGGGACGACCTGACCAAGGCCGGCGCCATCGAGTTCCTCGACGCCGAAGAGGAGGAGACGGCCATGATCTGCATGACGCCCGAAGATCTCGAGGGCTTCCGAAAGAGCAAGGCGGAGACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGCGCC Pisorisporium_cymbiforme_KM588905 TTGTTCCGCGGCATTATCCGCCGCGTGACTCAGGACCTGCACATGTACCTGAAGCGGTGCGTGGAGATGAACCGCATCTTCACGCTCACGCTGGGAATCAAGTCGCAGACGCTATCCAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACGGCCGGCGTGTCGCAGGTGCTGAACCGCTACACGTTCGCATCGACGCTGTCCCACCTGCGGCGAACCAACACACCCATTGGGCGTGATGGCAAGCTGGCAAAGCCCCGACAGTTACACAACACGCACTGGGGCCTCGTGTGCCCGGCCGAGACGCCCGAGGGCCAGGCTTGTGGCCTCGTGAAGAACCTTTCGCTCATGTGCTACGTCAGCAACGGCTCCAACGCCGAGCCCGTCATTGACTTCCTCATAGCAAGGAACATGGAGGTACTCGAGGAGTACGAGCCGCTGCGGCACCCCAACGCTACCAAGGTGTTTGTGAATGGCGTGTGGGTCGGCGTGCACCAGGACCCAAAGCACTTGGTCAGCCTGATCCAGCGTCTACGTCGGCAGCACGTCCTGGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGCGACCGCGAGTTCAAGATCTTCTCCGATGCGGGCCGCGTCATGCGTCCGCTCTTTGTGGTCGAGCAGGAAGAAAACTCGTCCACGGGCGTACCGAAGGGTTCGCTCATCCTCACCAAGGAACACATTCATCGGCTGTTCTTCGGATGGGACGGCCTGACCCAGGCCGGCGTCATCGAGTATCTCGACGCAGAGGAAGAGGAGACGGCGATGATCTGCATGACGCCCGAAGACCTGGAGAACTACAAGCTGCAGAAGATGGGTACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGTGCT Pisorisporium_cymbiforme_KM588906 TTGTTCCGCGGCATTATCCGCCGCGTGACTCAGGACCTGCACATGTACCTGAAGCGGTGCGTGGAGATGAACCGCATCTTCACGCTCACGCTGGGAATCAAGTCGCAGACGCTATCCAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACGGCCGGCGTGTCGCAGGTGCTGAACCGCTACACGTTCGCATCGACGCTGTCCCACCTGCGGCGAACCAACACACCCATTGGGCGTGATGGCAAGCTGGCAAAGCCCCGACAGTTACACAACACGCACTGGGGCCTCGTGTGCCCGGCCGAGACGCCCGAGGGCCAGGCTTGTGGCCTCGTGAAGAACCTTTCGCTCATGTGCTACGTCAGCAACGGCTCCAACGCCGAGCCCGTCATTGACTTCCTCATAGCAAGGAACATGGAGGTACTCGAGGAGTACGAGCCGCTGCGGCACCCCAACGCTACCAAGGTGTTTGTGAATGGCGTGTGGGTCGGCGTGCACCAGGACCCAAAGCACTTGGTCAGCCTGATCCAGCGTCTACGTCGGCAGCACGTCCTGGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGCGACCGCGAGTTCAAGATCTTCTCCGATGCGGGCCGCGTCATGCGTCCGCTCTTTGTGGTCGAGCAGGAAGAAAACTCGTCCACGGGCGTACCGAAGGGTTCGCTCATCCTCACCAAGGAACACATTCATCGGCTGTTCTTCGGATGGGACGGCCTGACCCAGGCCGGCGTCATCGAGTATCTCGACGCAGAGGAAGAGGAGACGGCGATGATCTGCATGACGCCCGAAGACCTGGAGAACTACAAGCTGCAGAAGATGGGTACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGTGCT Pisorisporium_cymbiforme_KM588907 TTGTTCCGCGGCATTATCCGCCGCGTGACTCAGGACCTGCACATGTACCTGAAGCGGTGCGTGGAGATGAACCGCATCTTCACGCTCACGCTGGGAATCAAGTCGCAGACGCTATCCAACGGCATGAAGTACTCGCTGGCCACGGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACGGCCGGCGTGTCGCAGGTGCTGAACCGCTACACGTTCGCATCGACGCTGTCCCACCTGCGGCGAACCAACACACCCATTGGGCGTGATGGCAAGCTGGCAAAGCCCCGACAGTTACACAACACGCACTGGGGCCTCGTGTGCCCGGCCGAGACGCCCGAGGGCCAGGCTTGTGGCCTCGTGAAGAACCTTTCGCTCATGTGCTACGTCAGCAACGGCTCCAACGCCGAGCCCGTCATTGACTTCCTCATAGCAAGGAACATGGAGGTACTCGAGGAGTACGAGCCGCTGCGGCACCCCAACGCTACCAAGGTGTTTGTGAATGGCGTGTGGGTCGGCGTGCACCAGGACCCAAAGCACTTGGTCAGCCTGATCCAGCGTCTACGTCGGCAGCACGTCCTGGAGTTTGAGCTCTCGCTCGTGCGCGACATCCGCGACCGCGAGTTCAAGATCTTCTCCGATGCGGGCCGCGTCATGCGTCCGCTCTTTGTGGTCGAGCAGGAAGAAAACTCGTCCACGGGCGTACCGAAGGGTTCGCTCATCCTCACCAAGGAACACATTCATCGGCTGTTCTTCGGATGGGACGGCCTGACCCAGGCCGGCGTCATCGAGTATCTCGACGCAGAGGAAGAGGAGACGGCGATGATCTGCATGACGCCCGAAGACCTGGAGAACTACAAGCTGCAGAAGATGGGTACGCACATGTACACGCATTGCGAGATCCATCCGAGCATGATCCTGGGAATTTGTGCT Pseudonectria_buxi_DQ522459 CTGTTCCGTGGCATTGTTCGTCGGATGAACACTGAGCTTTCCAACTACCTGAAGCGATGCGTTGAGGGTAACCGTCACTTCAACCTGGCTGTCGGAATCAAGCCGGGCACCTTGTCCAACGGATTGAAGTACTCTCTTGCTACCGGTAACTGGGGAGATCAGAAGAAGGCCGCCAGCTCCACGGCTGGTGTCTCTCAGGTGTTGAACAGATACACATTCTCCTCTACCTTGTCGCATTTGCGACGAACCAACACTCCCATCGGACGAGATGGCAAGCTGGCCAAGCCGCGCCAGTTGCACAACACTCACTGGGGCTTGGTGTGCCCGGCTGAGACGCCCGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCACTGATGTGTTATGTCAGTGTCGGCTCTCCATCCGAGCCCTTGATTGAATTCATGATCAACCGAGGTATGGAGGTCGTTGAGGAGTACGAGCCGCTGAGATACCCCCATGCCACAAAGATCTTTGTCAACGGAACGTGGGTGGGTGTTCATCAAGACCCCAAGCACTTGGTTGGCCAGGTTCTAGACACTCGTCGAAAGTCGTACTTGCAATACGAGGTGTCGCTTGTGCGAGATATCCGAGACCGAGAGTTCAAGGTCTTTTCGGATGCTGGTCGTGTCATGAGACCGGTGTTTACGGTGCAGCAAGAGGACGACCTCGACACAGGAATCGCCAAGGGATCGCTGGTGCTGACCAAGGAACTCGTCAACAGACTTAAGATTGGCTGGGAGGGCCTGATTCGTGCGGGTGCCATTGAGTATCTCGATGCGGAAGAGGAGGAGACGTCCATGATTTGCATGACGCCAGAAGACCTGGATCTATATCGTCTGCAGAAGGCTGGGACTCACATGTATACCCACTGCGAGATTCATCCCAGTATGATTCTAGGCATCTGCGCC Trichoderma_viride_EU711362 CTGTTCCGTGGTATTATGCGCAGAATGAATACTGAACTGGCCAACTACTTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTAAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTAATGTGCTACGTTAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCCAAGCATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTTTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCAGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGAATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGAAGCTCGGATGGGAGGGGCTGATTAGAGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAAAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53692] TITLE Candelabrum_Matrix_of_Fig._2; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1380; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Candelabrum clathrosphaeroides NBRC 101134_2' ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGATCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCGCTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTTGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTTCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCTGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_102394 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGATCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCGCTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTTGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_108187 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTACGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCTAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCCGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTAGATATTTCGAGACAACTCCAGACCGTGTCTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_108199 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCTAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACTGTCCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCTAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGGTTGATCAATGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTCTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_109729 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_109735 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGATCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCGCTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTTGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCTGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_109742 ATCGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCTAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTAAGGACTGTCCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCTAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGGTTGATCAATGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTCTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_clathrosphaeroides_NBRC_109746 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT 'Candelabrum desmidiaceum NBRC 101133_2' ATCGAATTCATGATCCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCGCCCAACGCTACCAAAGTCTTCGTTAACGGTGTTTGGGTCGGCGTTCATAGAGACCCAGCTCATCTTGTCAAGACTGTCCAGCATCTTCGAAGATCTCACTTGATTTCTCATGAAGTCTCTTTGATTCGAGACATTCGGGACCGAGAATTCAAGATATTCACCGATGCCGGCAGAGTCTGCAGGCCGCTCTTTGTCATTGACAACGATCTCGATAGCCCCAATAAAGGCAATCTGGTTCTCAACAAGGATCACATTCGAAGATTGGAAGATGATCAAGCCATGGCCGCCAATATGGATGCAGACGCAAAGGCAGAGCAAGGTTACTTCGGCTTCCAAGGCTTGATTAACGAAGGTGTAGTGGAATATGTTGACGCTGAGGAAGAAGAGACAGTTATGATCGTCATGACCCCGGAAGATTTGGATATTTCAAGACAACTTCAGACCGTGTATACATACCTTGTTGCTTTGGCGGGCCGCCTTTTGGCGTCGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTTCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTACAGAGTCAGGTGGTTACCTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGTTGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_desmidiaceum_NBRC_109736 ATCGAATTCATGATCCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCGCCCAACGCTACCAAAGTCTTCGTTAACGGTGTTTGGGTCGGCGTTCATAGAGACCCAGCTCATCTTGTCAAGACTGTCCAGCATCTTCGAAGATCTCACTTGATTTCTCATGAAGTCTCTTTGATTCGAGACATTCGGGACCGAGAATTCAAGATATTCACCGATGCCGGCAGAGTCTGCAGGCCGCTCTTTGTCATTGACAACGATCTCGATAGCCCCAATAAAGGCAATCTGGTTCTCAACAAGGATCACATTCGAAGATTGGAAGATGATCAAGCCATGGCCGCCAATATGGATGCAGACGCAAAGGCAGAGCAAGGTTACTTCGGCTTCCAAGGCTTGATCAACGAAGGTGTAGTGGAATATGTTGACGCTGAGGAAGAAGAGACAGTTATGATCGTCATGACCCCGGAAGATTTGGATATTTCAAGACAACTTCAGACCGTGTATACATACCTTGTTGCTTTGGCGGGCCGCCTTTTGGCGTCGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTTCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTACAGAGTCAGGTGGTTACCTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGTTGTTGATCATCCGAGCTTCTGCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_japonense_NBRC_106777 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGATCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCGCTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTTGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCTGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_japonense_NBRC_108046 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTCAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCTAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCTGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTACTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCTTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT 'Candelabrum japonense NBRC 108749_2' ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCCAATATGGATGCAGAGGTCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_japonense_NBRC_6777 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCCAATATGGATGCAGAGGTCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_japonense_NBRC_6844 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGACCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCACTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGACCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAGGGCTTGATCAACGCAGGTGTAGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATTGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT 'Candelabrum spinulosum NBRC 101903_2' ATCGAATTCATGATTCAGCGGAATATGGAAGTTCTGGAAGAGTATGAACCTTTACGATCACCCAACGCCACAAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTTCACAGAGACCCAGCTCATCTTGTCAAGACTGTCCAGAATCTTAGAAGATCCCACTTAATCTCTCATGAAGTTTCTTTGATTCGAGATATTCGAGACCGAGAGTTCAAGATTTTCACAGATGCTGGCAGAGTTTGCAGGCCGCTTTTCGTGATTGATAACGATCTCGATAGCGCCAATAAAGGCAATCTAGTTCTCAACAAGGATCATATTCGAAGACTGGAAGATGATCAGGCCATGGCGGCCAATTTGGACGCAGAAGCAAAAGCAGAGCAAGGCTACTTCGGTTTCCAAGGCTTAATCAACGAAGGTGTAGTAGAATATGTTGATGCCGAGGAAGAAGAGACGGTCATGATTGTCATGACACCGGAAGATTTGGATATTTCGAGGCAACTTCAGACCGTGTTTACATACCTTGTTGCTTTGGCGGGCCGCCGCTCGGCGTTGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_spinulosum_NBRC_102391 ATCGAATTCATGATTCAGCGGAATATGGAAGTCCTTGAGGAGTATGAACCTTTACGATCACCCAACGCCACAAAAGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCACAGAGATCCAGCCCATCTTGTTAAGACTGTTCAGAATCTTAGAAGATCTCACTTAATCTCTCATGAAGTTTCTTTGATTCGAGACATTCGAGACCGAGAGTTCAAGATTTTCACGGATGCCGGCAGAGTCTGCAGGCCACTCTTCGTCATTGACAACGATCTTGACAGCGCCAACAAAGGCAATCTAGTTCTCAATAAGGATCACATTCGAAGATTGGAAGATGATCAAGCCATGGCCGCAAATTTGGATGCAGAAGCAAAAGCAGAACAAGGCTACTTCGGTTTCCAGGGCTTAATCAACGAAGGTGTAGTAGAATATGTTGATGCCGAGGAAGAAGAGACAGTCATGATTGTCATGACCCCAGAAGATTTGGATATTTCGAGACAACTTCAGACCGTGTTTACATACCTTGTTGCTTTGGCGGGCCGCCGATCGGCGTTGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTATTGGGGACCGCGATCTCGCGGCCCTTAAAATCAGTGGCGGTGCCATCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGAGTCCGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_spinulosum_NBRC_109731 ATCGAATTCATGATTCAGCGGAACATGGAAGTTCTTGAGGAGTATGAGCCTTTACGATCACCCAATGCTACAAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTTCACAGAGACCCAGCTCATCTTGTCAAGACTGTCCAGAATCTTAGAAGATCTCACTTGATTTCTCATGAAGTTTCTTTGATTCGAGATATTCGAGACCGAGAGTTCAAGATTTTCACGGATGCTGGCAGGGTTTGCAGACCGCTTTTCGTCATTGATAACGATCTGGATAGCGCCAATAAAGGCAATCTAGTTCTCAATAAGGATCATATTCGAAGACTGGAAGATGATCAGGCCATGGCGGCCAATTTGGATGCAGAAGCAAAAGCAGAGCAGGGCTACTTCGGCTTCCAAGGCTTGATCAATGAAGGTGTGGTAGAATATGTTGATGCCGAGGAAGAAGAGACTGTCATGATTGTCATGACACCAGAAGATTTGGATATTTCGAGACAACTTCAGACCGTGTTTACATACCTTGTTGCTTTGGCGGGCCGCCGTTCGGCGTTGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGGTGGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGCGCTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_spinulosum_NBRC_109733 ATCGAATTCATGATTCAGCGGAATATGGAAGTTCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCCACAAAAGTCTTTGTCAATGGTGTCTGGGTTGGCGTTCACAGAGACCCAGCTCATCTTGTCAGGACTGTTCAGAATCTTAGAAGATCCCACTTAATTTCTCACGAAGTTTCTTTGATTCGAGATATTCGAGATCGAGAGTTTAAGATTTTCACGGATGCTGGCAGGGTCTGTAGACCGCTTTTCGTCATTGATAACGATCTCGATAGCGCCAATAAAGGCAATCTAGTTCTCAATAAGGATCATATTCGAAGACTGGAAGACGATCAAGCAATGGCGGCCAATTTGGATGCAGAGGCAAAAGCAGAACAGGGCTATTTCGGGTTCCAAGGCTTAATCAACGAAGGTGTAGTAGAATACGTTGATGCTGAAGAAGAAGAGACAGTCATGATTGTCATGACCCCAGAAGATTTGGATATTTCGAGGCAACTTCAGACCGTGTTTACATACCTTGTTGCTTTGGCGGGCCGCCGTTCGGCGTTGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGGTGGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Candelabrum_spinulosum_NBRC_109734 ATCGAATTCATGATTCAGCGGAATATGGAAGTTCTGGAAGAGTATGAACCTTTACGATCACCCAACGCCACAAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTTCACAGAGACCCAGCTCATCTTGTCAAGACTGTCCAGAATCTTAGAAGATCTCACTTAATTTCTCACGAAGTTTCTTTGATTCGAGATATTCGAGACCGAGAGTTCAAGATTTTCACGGATGCTGGCAGAGTTTGCAGACCGCTTTTCGTCATTGATAACGATCTCGATAGCGCCAATAAAGGCAATCTAGTTCTCAATAAGGATCATATTCGAAGACTGGAAGATGATCAGGCCATGGCGGCCAATTTGGACGCAGAAGCAAAAGCAGAGCAAGGCTACTTCGGTTTCCAAGGCTTAATCAACGAAGGTGTAGTAGAATATGTTGATGCCGAGGAAGAAGAGACGGTCATGATTGTCATGACACCGGAAGATTTGGATATTTCGAGGCAACTTCAAACCGTGTTTACATACCTTGTTGCTTTGGCGGGCCGCCGCTCGGCGTTGGCTCCGGCTGACTGCCCGCCAGAGGACCACATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Dematioscypha_castaneae_1 ATTGAATTTATGATTCAACGAAACATGGAGGTACTAGAGGAGTACGAGCCTTTAAGGTCTCCCAATGCTACTAAGGTTTTCGTCAATGGTGTCTGGGTCGGCGTTCACCGAGATCCTGCCCATCTTGTCAAAACTGTGCAACATCTTCGCCGATCTCATTTGATTTCTCACGAAGTCTCCCTTATCAGAGACATCAGAGACCGAGAGTTTAAGATCTTTACTGATGCTGGTAGAGTTTGTAGACCTCTTTTCGTTATTGATAATGATCATGATAGTCCTAACAAGGGCAACTTGGTTCTCAACAAAGATCATATCAGACGATTAGAAGAAGACCAACTTATGCCCGCTAACTTAGATGCTGAAGCAAGGGAACAGCAAGGATACTTTGGCTTCCAGGGTCTTATAAACGAGGGTGTGGTTGAATATGTAGACGCTGAGGAAGAGGAGACTGTCATGATTGTCATGACTCCAGAAGATTTGGATATTTCACGTCAACTTCAACCCTTGAATACAAACTATGTTGCTTTGGCGAGCCGCCGCAAGGCATCGGCTTCGGCTGACTGCCCGCCAAAGGACCCATTCGTTTAGTAATGTCTGAGTACATTTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAGTACCAAATCAGTGCTTGGTGTTGGGGTTCGCTATTCAGCGGCCCTTAAACTCAGTGGCGGTGCTGCCGAGCTCTAAGCGTAGTAATTTTCTCGCTATAGAGTTCGGGAGATGTCTGCCATAAGGCTCTTGGGTCCGAATTGTAATTTGTAGAAGATGCTTCGAGTGTTAGCCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTAGTGCTCTCGCTCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGCACGCCGTCGATCATCCGAGGTTTTCCCCGGTGCACTCGGCGGCGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCTGGACCGAGGACCGCGCTTCGGCTAGGATGCT Dematioscypha_castaneae_2 ATTGAATTTATGATTCAACGAAACATGGAGGTACTAGAGGAGTACGAGCCTTTAAGGTCTCCCAATGCTACTAAGGTTTTCGTCAATGGTGTCTGGGTCGGCGTTCACCGAGATCCTGCCCATCTTGTCAAGACTGTGCAACATCTTCGCCGATCTCATTTGATTTCTCACGAAGTCTCCCTTATCAGAGACATCAGAGACCGAGAGTTTAAGATCTTTACTGATGCTGGTAGAGTTTGTAGGCCTCTTTTCGTTATTGATAATGATCATGATAGTCCTAACAAGGGCAACTTGGTTCTCAACAAAGATCATATCAGACGATTAGAAGAAGACCAACTTATGCCCGCTAACTTAGATGCTGAAGCAAGGGAACAGCAAGGATACTTTGGCTTCCAGGGTCTTATAAATGAGGGTGTGGTTGAATATGTAGACGCTGAGGAAGAGGAGACTGTCATGATTGTCATGACTCCAGAAGATTTGGATATTTCACGTCAACTTCAACCCTTGAATACAAACTATGTTGCTTTGGCGAGCCGCCGCAAGGCATCGGCTTCGGCTGACTGCCCGCCAAAGGACCCATTCGTTTAGTAATGTCTGAGTACATTTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAGTACCAAATCAGTGCTTGGTGTTGGGGTTCGCTATTCAGCGGCCCTTAAACTCAGTGGCGGTGCTGCCGAGCTCTAAGCGTAGTAATTTTCTCGCTATAGAGTTCGGGAGATGTCTGCCATAAGGCTCTTGGGTCCGAATTGTAATTTGTAGAAGATGCTTCGAGTGTTAGCCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTAGTGCTCTCGCTCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGCACGCCGTCGATCATCCGAGGTTTTCCCCGGTGCACTCGGCGGCGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCTGGACCGAGGACCGCGCTTCGGCTAGGATGCT Dematioscypha_delicata_ ATTGAGTTCATGATCCAACGAAACATGGAAGTTCTTGAAGAGTACGAGCCGTTAAGATCTCCTAATGCTACGAAGGTTTTCGTCAATGGTGTTTGGGTTGGTGTTCACCGAGATCCTGCCCACCTTGTCAAGACTGTCCAGCATCTTCGCCGATCTCACTTGATTTCTCACGAAGTCTCCCTCATTAGAGATATCAGAGACAGAGAGTTTAAAATTTTCACTGATGCCGGTAGAGTCTGTAGGCCTCTTTTCGTTATTGATAATGATCATGACAGTCCCAATAAGGGCAACTTGGTTCTCAATAAGGATCATATCAGACGACTGGAAGAAGATCAACTTATGCCTGCCAATTTAGATGCTGAAGCAAAGGAACAGCAAGGATACTTTGGCTTCCAAGGTCTGATTAATGAAGGTGTGGTTGAATATGTTGACGCCGAGGAAGAGGAGACTGTCATGATCGTCATGACTCCTGAAGATTTGGATATTTCACGGCAACTCCAGCCCTTGAATATATACTATGTTGCTTTGGCGGGCTGCCACAAGGCATCGGCCCTGGCTGATTGCCCGCCAAAGGACCCCATCATTAAGTGATGTCTGAGTACATTTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAGTACCAAATCAGTGCTTGGTGTTGGGGCTCGCCGTTAGGCGGCCCTTAAACTCAGTGGCAGTGCTGCCGGGCTCTAAGCGTAGTAACTTTCTCGCTATAGGGTCCGGGAGATACCCGCCAGAAGGCTCTCGGGTCCGAATTGTAATTTGTAGAAGATGCTTCGAGTGTTAGCCTGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTAGTGCTCTCGCTCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGCATGCCGTCGATCATCCGAGGTTTTCCCCGGTGCACTCGGCGGTGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyalopeziza_nectrioides ATTGAGTTTATGATCCAGCGGAACATGGAGGTTCTCGAAGAATACGAACCCTTACGATCTCCCAATGCAACTAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTTCACCGAGACCCTGCCCATCTTGTCAAGACTGTTCAGCATCTTCGAAGATCTCATTTGATCTCTCATGAAGTCTCCTTAATTAGAGATATCCGAGACAGAGAGTTCAAGATCTTTACCGATGCCGGCCGAGTCTGCAGACCCCTCTTCGTCATTGACAACGATCTCGAGAGCCCCAACAAGGGCAATCTGGTTCTGAACAAGGATCATATTCGACGATTAGAAGATGACCAAGCAATGGCTGCTAATATGGATGCAGAGGCCAGAGAACAGTCAGGATACTTCGGTTTCCAAGGATTGATCAATGAGGGTGTAGTAGAGTACGTTGATGCTGAGGAAGAGGAGACTGTCATGATTGTCATGACTCCTGAAGACTTGGACATCTCGAGACAACTCCAGCCCTTGAATACAAACTTCGTTGCTTTGGCGGGCCGCCTTCGGGCGTCGGCCTCGGCTGACAGCCTGCCAGGGGACCAAATCGTTCAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAAACACATCCTTAAGGGGTCTTGGGGCTCGCCTTCTAGCGGCTCTTAAAATCAGTGGCGGCGCCATCTGGCTCTAAGCGTAGTAATTTCCTCGCTATAGGGTCCGGTGGATGCTTGCCAGAAGGCTTCTGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGTGGCTCCGGTCTAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCCTTCGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGTGGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGATCACGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyalopeziza_sp.__NBRC_108584 ATTGAGTTTATGATCCAGCGGAACATGGAAGTTCTCGAAGAGTACGAGCCTCTGCGATCTCCCAATGCAACAAAAGTTTTCGTAAATGGTGTCTGGGTTGGTGTACATCGAGACCCTGCCCACCTTGTCAAGACTGTTCAGCATCTCCGAAGATCTCATTTGATCTCTCATGAAGTCTCCTTGATTAGAGATATTCGAGACAGAGAGTTTAAGATTTTCACCGATGCCGGCAGAGTCTGCAGACCACTCTTTGTCATTGACAACGATCTCGAGAGTCCCAACAAGGGTAATCTAGTTCTTAATAAGGATCATATTCGGCGATTGGAAGATGACCAAGCCATGGCCGCCAACATGGATGCAGAGGCTAGAGAACAATCCGGGTACTTCGGCTTCCAAGGATTGATCAACGAGGGTGTAGTAGAATACGTTGATGCTGAGGAAGAAGAGACTGTCATGATTGTCATGACTCCGGAAGATTTGGATATCTCAAGACAGCTTCAACCCTTGAATACATAACTTGTTGCTTTGGCGGGCCGCCTTCGGGCGTCGGCCCCGGCTGACTGCCCGCCAGGGGATCACATCGTTTAGTGATGTCTGAGTATTATAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTAATCACATCCCCACGGGGTCTTGGGGCTCGCCTCCTGGCGGCCCTCAAAATCAGTGGCGGCGCCTTCTGGCTCTAAGCGTAGTAATTTCCTCGCTATAGGGTCTGGTGGATGCTTGCCAGAAGGCTCTTGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCCTTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGTGGTTGATCATCCGAGGTTTTCCTCGTTGCACTTGATCACATTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTAGCTTCCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyalopeziza_sp._NBRC_108587 ATTGAGTTCATGATTCAGCGAAATATGGAAGTCCTCGAGGAATATGAGCCCTTGCGGTCTCCGAATGCAACAAAGGTGTTCGTTAATGGTGTCTGGGTTGGTGTCCACCGAGACCCTGCCCATCTTGTGAAAACCGTGCAACATCTCCGAAGATCTCATTTGATCTCCCACGAAGTCTCTTTGATTAGAGACATTCGAGACCGAGAGTTCAAGATCTTTACCGACGCCGGCAGAGTCTGCAGACCTCTCTTTGTCATTGACAACGATCCCGAGAGTGACCGTAAGGGCAATCTGGTGCTCACCAAGGGTCATATTCAACGATTGGAAGATGACGCGGCCATGGCAGCCAACATGGATCCAGAGACCAGAGCTGAATCTGGATACTTTGGCTTTCAAGGATTGATCAACGAAGGTGTGGTCGAGTACGTTGATGCTGAGGAAGAAGAGACCGTTATGATTGTTATGACTCCTGAAGATCTAGACATCTCAAGACAGCTGCAACCCTTGAATACAAACCTTGTTGCTTTGGCGGGCTGCCTCCAGGCGTCGGCCCCGGCTGATTGCCCGCCAGAGGACAAAATCGTTTAGTGGAGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAAACACATCCCTACGGGGTCTTGGGACCCGCCTCCGGGCGGTCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTTCCTCGCTATAGATGCAGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGTAGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGATTGCGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTAGCTCCTCTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyalopeziza_sp._NBRC_108591 ATCGAATTCATGATTCAACGAAACATGGAAGTCCTGGAAGAATACGAACCTTTGCGGTCTCCGAATGCCACAAAGGTGTTCGTCAATGGTGTCTGGGTCGGTGTCCATCGAGACCCCGCTCATCTTGTCAAAACTGTGCAGCATCTCCGAAGATCTCATTTGATCTCCCACGAAGTCTCCTTGATTAGAGATATTCGAGACAGAGAGTTCAAGATCTTTACCGACGCGGGTAGAGTCTGCAGACCGCTGTTTGTCATTGACAACGATCTCGAAAGTCTTCAGAAGGGCAATCTGGTTTTGAACAAGAACCATATTCGACGATTGGAAGATGACGCAGCCATGGCTGCCAATATGGACGCAGAGGCTAGAGCTGAATCCGGATACTTTGGCTTCCAAGGATTGATCAACGAAGGTGTGGTCGAGTATGTTGATGCCGAGGAAGAAGAGACGGTCATGATTGTCATGACTCCTGAAGATTTGGACATCTCAAGACAGCTTCAACCCTTGATTACAAACTTAGTTGCTTTGGTGGGCCGCCTTCGAGCGCTGGCCTCGGCCTGCTGCCCGCCGGAGGACAAAATCGTTTAGTGAAGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAAACACATCCCTACGGGGTCTTGGGATCCGCCAACTGGCGGTCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATCTCCTCGCTACAGACCCAGGCGGTTGCTTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGTAGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGATTGCGTTCAGGCCAGCATCGGTTTGGGTGGCTGGATAAAGGCCTTGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_albohyalina1 ATTGAGTTTATGATTCAGCGGAACATGGAAGTGCTCGAAGAGTACGAACCTTTACGCTCTCCTAATGCAACCAAGGTTTTCGTCAATGGTGTCTGGGTTGGTGTTCACCGAGACCCTGCTCATCTTGTCAAGACTGTCCAGCATCTTCGAAGATCCCACTTGATCTCTCATGAAGTCTCCTTGATTAGAGATATTCGAGACAGAGAATTCAAGATTTTCACGGATGCCGGCAGAGTTTGCAGACCCCTATTTGTCATCGACAACGATATCGATAGTCCTAATAAGGGCAATTTAGTTCTGAACAAGGATCATATCCGACGATTGGAAGATGACCAAGCTATGGCTGCCAATATGGATGCGGAGGCTAAGGCAGACCAAGGGTACTTTGGTTTTCAAGGATTAATCAACGAGGGTGTAGTAGAATATGTTGATGCTGAGGAGGAAGAGACAGTCATGATCGTCATGACTCCTGAAGATTTGGATATTTCAAGACAACTCCAGCCCTTGAATATACACCTTGTTGCTTTGGCGGGCCGCGCTTGCGCGTTGGCTCTGGCTAACTGCCCGCCAGAGGACCCTATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTACTTGGTATTGGGGTACGCGGTCTCGCGCCCCCTAAAATCAGTGGCGGCGCCATCTGGCTCTAAGCGTAGTAATTTCCTCGCTATAGAGTCTGGTGGATGCTTGCCAGAAGGCTCTTGGGTCCGAATTGTAATTTGTAGAAGATGCTTTGAGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCACTGTTGATCATCCGAGGTTTTCCTCGGTGCACTCAGCAGTGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACTAGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_albohyalina2 ATTGAGTTTATGATTCAGCGGAACATGGAAGTGCTCGAAGAGTACGAACCTTTACGCTCTCCTAATGCAACCAAGGTTTTCGTCAATGGTGTCTGGGTTGGTGTTCACCGAGACCCTGCTCATCTTGTCAAGACTGTCCAGCATCTTCGAAGATCCCACTTGATCTCTCATGAAGTCTCCTTGATTAGAGATATTCGAGACAGAGAATTCAAGATTTTCACGGATGCCGGCAGAGTTTGCAGACCCCTCTTTGTCATCGACAACGATATCGATAGTCCTAATAAGGGCAATTTAGTTCTGAACAAGGATCATATCCGACGATTGGAAGATGACCAAGCTATGGCTGCCAATATGGATGCGGAGGCTAAGGCAGACCAAGGGTACTTTGGTTTTCAAGGATTAATCAACGAGGGCGTAGTAGAATATGTTGATGCTGAGGAGGAAGAGACAGTCATGATCGTCATGACTCCTGAAGATTTGGATATTTCAAGACAACTCCAGCCCTTGAATATACACCTTGTTGCTTTGGCGGGCCGCGCTTGCGCGTTGGCTCTGGCTAACTGCCCGCCAGAGGACCCTATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTACTTGGTATTGGGGTACGCGGTCTCGCGCCCCCTAAAATCAGTGGCGGCGCCATCTGGCTCTAAGTGTAGTAATTTCCTCGCTATAGAGTCTGGTGGATGCTTGCCAGAAGGCTCTTGGGTCCGAATTGTAATTTGTAGAAGATGCTTTGAGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCACTGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACTAGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_aureliella1 ATTGAGTTTATGATCCAGCGGAACATGGAAGTCCTCGAGGAGTATGAACCTTTGCGATCCCCTAACGCTACTAAAGTCTTTGTTAACGGTGTTTGGGTTGGTGTTCACCGAGACCCGGCTCATCTTGTCAAGACTGTCCAGCACCTGCGAAGATCCCACTTGATTTCTCATGAAGTCTCCTTGATTCGAGATATTCGAGACAGAGAGTTCAAGATTTTCACTGATGCCGGAAGAGTTTGTAGACCGCTCTTCGTCATCGACAACGATCTCGACAGTCCTAATAAAGGCAATTTGGTTCTGAACAAGGATCATATTCGACGGTTGGAAGATGATCAAGCAATGGCTGCCAACATGGACGCGGAGGCGAAAGCAGAGCAAGGATACTTTGGTTTTCAAGGATTGATCAACGAAGGTGTAGTAGAATACGTTGATGCCGAGGAAGAAGAGACCGTCATGATTGTCATGACTCCTGAGGATTTGGATATTTCCAGACAACTCCAACCCTTGAATACCTACCTTGTTGCTTTGGCGGGCCACGTCCGCGTGCCGGCTTCGGCTGGTTGCCCGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTGCTTGGTGTTGGGGTCCGCGGTCCCGCGGCCCTTAAAATCAGTGGCGGCGCCATCTGGCTCTCAGCGTAGTAATATCCTCGCTACAGGGTCCGGTGGCTGCTTGCCAGAAGGCTCCTGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGAGCGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCCTCCGTTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCTGCTGATCATCCGAGGTTCTCCCCGGTGCACTCGGCAGCGATCAGGCCAGCATCGGTTCTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_aureliella2 ATTGAGTTTATGATCCAGCGGAACATGGAAGTCCTCGAGGAGTATGAACCTTTGCGATCCCCTAACGCTACTAAAGTCTTTGTTAACGGTGTTTGGGTTGGTGTTCACCGAGACCCGGCTCATCTTGTCAAGACTGTCCAGCACCTGCGAAGATCCCACTTGATTTCTCATGAAGTCTCCTTGATTCGAGATATTCGAGACAGAGAATTCAAGATTTTCACTGATGCCGGAAGAGTTTGTAGACCGCTCTTCGTCATCGACAACGATCTCGACAGTCCCAATAAAGGCAATTTGGTTCTGAACAAGGATCATATTCGACGATTGGAAGATGATCAAGCAATGGCTGCCAACATGGACGCGGAGGCGAAAGCAGAGCAAGGATACTTTGGTTTCCAAGGATTGATCAACGAAGGTGTAGTAGAATACGTTGATGCCGAGGAAGAAGAGACCGTCATGATTGTCATGACTCCTGAGGATTTGGATATTTCCAGACAACTCCAACCCTTGAATACCTACCTTGTTGCTTTGGCGGGCCACGTCCGCGTGCCGGCTTCGGCTGGTTGCCCGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTGCTTGGTGTTGGGGTCCGCGGTCCCGCGGCCCTTAAAATTAGTGGCGGCGCCATCTGGCTCTCAGCGTAGTAATATCCTCGCTACAGGGTCCGGTGGCTGCCTGCCAGAAGGCTCCTGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGAGCGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCCTCCGTTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCTGCTGATCATCCGAGGTTCTCCCCGGTGCACTCGGCAGCGATCAGGCCAGCATCGGTTCTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_bicolor ATCGAGTTTATGATCCAGCGGAACATGGAAGTTCTTGAGGAATACGAACCTTTGCGGTCGCCGAACGCCACCAAAGTCTTCGTTAATGGTGTCTGGGTGGGTGTTCACAGAGACCCAGCCCACCTCGTCAAGACTGTTCAGAATCTTCGAAGATCCCACTTAATTTCTCATGAAGTCTCTCTGATTCGAGATATTCGAGATCGAGAGTTCAAGATTTTCACAGATGCCGGGAGAGTTTGCAGGCCGCTATTTGTCATCGACAACGATGTCGATAGCCCTAATAAAGGCAACCTAGTTCTGAACAAGGATCATATTCGAAGATTGGAAGATGACCAGGCCATGGCCGCCAATTTGGATGCGGAGGCAAAAGCAGAGCAAGGCTACTTCGGTTTCCAAGGACTGATCAATGAGGGTGTAGTGGAGTATGTTGATGCCGAGGAGGAAGAGACAGTCATGATCGTCATGACCCCAGAAGATTTGGATATTTCAAGACAACTCCAGACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTTTAGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATGTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTTCGCGGTCTCGCGTCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCCTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCGTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTCTCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_bulbopilosa_2 ATCGAGTTCATGATCCAACGGAACATGGAAGTTCTGGAGGAGTACGAACCTTTACGATCGCCGAACGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGCGTTCACAGAGACCCTGCTCATCTTGTCAAGACTGTCCAGAATCTTCGAAGATCCCACTTGATCTCTCACGAAGTCTCTTTGATTCGAGAGATTCGAGATCGGGAGTTTAAGATTTTCACAGATGCTGGGAGAGTTTGCAGGCCGCTCTTCGTCGTTGACAACGACATCGATAGTCCTAACAAGGGCAATCTAGTTCTGAACAAGGATCACATTCGACGTCTGGAGGACGATCAAGCCATGGCTGCAAATATGGATGCAGAGGCAAAAGCAGAGCAAGGCTACTTTGGTTTCCAGGGATTGATCAACGAGGGTGTTGTGGAATATGTCGATGCTGAGGAAGAGGAGACAGTCATGATCACCATGACCCCAGAAGATTTAGATATCTCAAGACAATTGCAACCCGTGTCTACCTACCTTGTTGCTTTGGCAGGCCGCCTTCGGGCGTCGGCTCCGGCTGACCGCCTGCCAGAGGTCCAAATCGTTTAGTGATGTCTGAGTACTATAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTACTTGGTATTGGGGTTCGCGTGCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGAGTCCGGCGGTTACTTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGCGGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGATCGTTCTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_bulbopilosa1 ATCGAGTTCATGATCCAACGGAATATGGAAGTTCTTGAGGAGTACGAACCTTTGCGATCGCCGAACGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGCGTTCACAGAGACCCTGCTCATCTTGTCAAGACTGTCCAGAATCTTCGAAGATCACACTTGATCTCTCACGAAGTCTCTCTGATTCGAGATATCCGAGATCGAGAATTTAAGATTTTCACGGATGCTGGGAGAGTTTGCAGGCCGCTCTTCGTCATTGACAACGACGTCGATAGTCCTAACAAGGGCAATCTAGTTCTGAACAAGGATCATATTCGACGACTGGAGGATGATCAAGCCCTGGCTGCAAATATGGATGCAGAGGCAAAAGCAGAGCAAGGCTACTTTGGTTTCCAAGGATTGATCAACGAAGGTGTCGTGGAATATGTCGATGCCGAGGAGGAGGAGACAGTCATGATCACCATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTCTACCTACCTTGTTGCTTTGGCGGGCCGCCTTCGGGCGTCGGCTCCGGCTGACCGCCTGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTACTTGGTATTGGGGTTCGCGTGCCCGCGGCCCTTAAAATCAGTGGCGGTGCTGTCTGGCTCTAAGCGTAGTAATTTTATCGCTACAGGGTCGGGCGGTTGCTTGCCAGAAGGCTCTCGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGCGGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGATCGTTCACAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_finlandica ATCGAGTTTATGATCCAGCGGAACATGGAGGTTCTTGAGGAATACGAACCTTTGCGATCGCCGAATGCCACCAAAGTCTTCGTTAATGGTGTCTGGGTAGGTGTCCACAGAGACCCAGCCCACCTCGTCAAGACTGTTCAGAATCTTCGAAGATCTCACTTAATTTCTCATGAAGTCTCTCTGATTCGAGATATTCGAGATCGAGAGTTCAAGATTTTCACAGATGCCGGGAGAGTTTGCAGGCCGCTATTTGTCATCGACAACGATGTTGATAGCCCTAATAAAGGCAACCTAGTTCTGAACAAGGATCATATTCGAAGATTGGAAGATGACCAGGCCATGGCCGCCAATTTGGATGCAGAGGCAAAAGCAGAGCAAGGCTACTTCGGTTTCCAAGGACTGATCAATGAGGGTGTAGTGGAGTATGTTGATGCCGAGGAGGAGGAGACAGTCATGATCGTCATGACCCCAGAAGATTTGGATATTTCAAGACAACTCCAGACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTTTAGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTTCGCGGTTTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGACCACCTGCCATAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGGCAGCGCTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTCTCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_hepaticicola ATTGAATTTATGATCCAACGGAACATGGAAGTCCTCGAGGAGTACAAACCTTTGCGATCTCCCAATGCCACCAAAGTCTTCGTCAATGGTGTGTGGGTTGGTGTTCATAGAGACCCGGCTCATCTTGTTAAGACTGTTCAAAATCTCCGAAGATCTCACTTGATCTCTCACGAAGTCTCTTTGATTCGAGATATTCGAGACCGAGAATTCAAGATTTTCACGGATGCCGGGAGAGTCTGCAGACCGCTCTTTGTTATCGATAACGACATCGATAGCCCCAATAAAGGCAATCTAGTTCTGAATAAGGATCACATTCGCAGATTGGAAGATGATCAAGCGATGGCCGCCAATTTAGATGCTGAGGCAAAGGCCGAGCAAGGCTATTTTGGTTTCCAAGGGTTGATCAACGAGGGTGTAGTAGAATATGTTGATGCCGAGGAAGAGGAGACTGTCATGATTGTCATGACCCCAGAAGATCTGGATATCTCAAGACAACTCCAAACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTTCGGGCGTCGGCTCACGCTGACCGCCTGTCAGAGGACCCAATCATTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTACTTGGTATTGGGGTTCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCATCTGGCTCTAAGCGTAGTAATTATCTCGCTATTGGGTCCGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGCTTCTGCCCGGTGCACTCGACAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_melinii ATCGAGTTCATGATTCAGCGGAACATGGAGGTTCTTGAGGAGTACGAACCTTTAAGATCGCCGAACGCCACCAAAGTCTTCGTAAATGGTGTATGGGTTGGCGTTCATAGAGACCCTGCTCACCTTGTCAAGACTGTCCAGAATCTCCGAAGATCTCACTTGATCTCTCACGAAGTCTCTCTGATTCGAGATATCCGAGATCGAGAGTTTAAGATTTTCACGGATGCTGGGAGAGTTTGCAGGCCGCTCTTCGTCATTGACAACGACATTGATAGTCCGAACAAGGGCAATTTAGTTCTGAACAAGGATCACATTCGACGACTAGAAGATGATCAGGCCATGGCTGCCAATATGGATGCAGAGGCAAAGGCAGAGCAAGGCTACTTTGGTTTCCAAGGATTGATCAACGAAGGTGTTGTGGAATATGTTGATGCCGAGGAAGAAGAAACAGTCATGATCACGATGACCCCAGAAGATTTGGATATTTCAAGACAACTCCAGACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTCCGGGCGTCGGCTCCGGCTGATAGCCTGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTACTTGGTATTGGGGTTCGCGTGTTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAAATCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGAGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCGGTTGATCATCCGAGCTTCTGCCCGGTGCACTCGATCGTATTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_monodictys ATCGAGTTTATGATCCAGCGGAACATGGAGGTCCTTGAGGAGTACGAACCTTTACGATCTCCAAACGCTACCAAAGTCTTCGTCAATGGTGTCTGGGTCGGCGTTCACAGAGACCCGGCTCACCTTGTCAAGACTGTCCAGCATCTCCGAAGATCTCACTTGATTTCTCATGAAGTCTCTTTGATTCGAGATATTCGAGACCGAGAGTTCAAGATCTTCACGGATGCCGGGAGAGTTTGCAGGCCACTTTTTGTCATCGACAACGATATCGATAGTCCTAATAAAGGCAACTTGGTTCTGAACAAGGATCACATTCGACGATTGGAAGATGACCAAGCCATGGCCGCCAATATGGATGCTGAGGCAAAGGCAGAGCAAGGTTATTTCGGTTTCCAAGGCTTGATCAACGAAGGTGTAGTAGAATATGTCGATGCTGAGGAAGAGGAGACAGTCATGATCGTCATGACCCCAGAAGATTTGGATATTTCAAGACAACTTCAGACCGTGTCTACCTACCTTGTTGCTTTGGCGGGCCGCCTTTAGGCGTTGGCTAACGCTAACTGCCCGCCAGAGGATCCAATCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTACTTGGTATTGGGGTTCGCCGTCCTGCGGCCCTTAAAATCAGTGGCGGTGCTGCCTAGCTCTAAGCGTAGTAATTTTCTCGCTACAGGGTCGGGTGGTTACTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGCTGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGAAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_occulta_NBRC_108595 ATTGAATTCATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTATGAACCTTTGCGATCACCCAACGCAACCAAAGTCTTTGTGAATGGTGTTTGGGTCGGCGTTCACCGAGATCCAGCTCATCTTGTTAGGACCGTTCAAAATCTCCGAAGATCTCACTTAATCTCCCACGAAGTCTCTTTGATTCGAGACATTCGAGATCGAGAATTTAAGATTTTCACAGATGCTGGTAGAGTCTGCAGACCGCTCTTCGTCATTGACAACGATCTCGACAGTCCCAACAAAGGCAATCTGGTTCTTAACAAGGATCATATTCGAAAGCTGGAAGATGATCAAGCTATGGCCGCCAATATGGATGCAGAGGCCAAAATAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGCAGGTGTTGTGGAATATGTTGATGCTGAGGAAGAAGAGACGGTTATGATCGTTATGACCCCAGAAGATTTGGATATTTCGAGACAACTCCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_occulta_SANK_13397 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCATTCGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCCATCGTTTAGTATTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTCCGCGGTCTCGCGGCTCCTAAATCCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCAGGTTTCTACCTGGTGCACTCGGCAGTGTTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_sp._NBRC_108580 ATCGAGTTTATGATACAGCGGAATATGGAGGTCCTCGAGGAGTATGAACCTCTGCGATCGCCAAACGCTACCAAAGTCTTCGTTAATGGTGTTTGGGTTGGCGTGCACAGAGACCCAGCTCACCTTGTCAAGACCGTTCAGAATCTCCGAAGATCTCACTTGATTTCTCATGAGGTATCTCTGATTAGAGATATTCGAGACCGAGAATTCAAGATTTTCACGGATGCCGGGAGAGTTTGCAGGCCGCTCTTTGTCATCGACAATGATATCGAGAGCCCTAACAAAGGCAATCTGGTTCTGAACAAGGATCACATCCGAAGATTAGAAGACGACCAGGCCATGGCTGCCAATTTGGATGCAGAGGCAAAAGCAGACCAAGGTTACTTCGGTTTCCAAGGATTGATTAACGAGGGTGTAGTAGAATATGTTGATGCTGAGGAAGAAGAGACGGTGATGATCGTCATGACTCCAGAAGATTTGGATATTTCAAGACAACTTCAGACCGTGTTTACATACCTTGTTGCTTTGGCAGGCCGCCTCTAGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCAATCGTTTATTATCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTGCTTGGTATTGGGGTTCGCGGTCTCGCGGCTCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATACTCTCGCTATAGGGTCAGGTGGCTGCTTGTCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGTATTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_sp._NBRC_108581 ATCGAGTTTATGATACAGCGTAATATGGAAGTTCTCGAGGAGTACGAACCTCTGCGATCGCCAAACGCTACCAAAGTCTTCGTTAATGGTGTTTGGGTTGGTGTGCACAGAGACCCAGCTCACCTTGTCAAGACTGTCCAGAATCTCCGAAGGTCTCACTTGATTTCTCATGAGGTCTCTCTGATTCGAGATATTCGAGACCGAGAATTTAAGATTTTTACGGATGCCGGGAGAGTTTGCAGGCCGCTTTTCGTCGTCGACAACGATATCGAGAGTGCTAATAAAGGCAATCTGGTTCTGAACAAGGAACATATCCGAAGATTAGAAGATGACCAAGCCATGGCTGCCAATTTAGATGCAGAGGCCAAAGCAGATCAAGGCTACTTCGGTTTCCAAGGACTGATTAACGAAGGTGTGGTGGAATATGTTGATGCTGAGGAGGAAGAGACAGTTATGATTGTCATGACCCCAGAGGATCTGGATATTTCAAGACAAATTCAAACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTCTGGGCGTCGGCTCCGGCTGACTGCCTGCCAGAGGACCCAATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTCTTGGGGTGCGAGGTTTCTCGGCCCTTAAAATCAGTGGCGGTGCCATCTGGCTCTAAGCGTAGTAATTTTCTCGCTACAGAGTCGGGTGGTTGCTTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGAGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGTATTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_sp._NBRC_108592 ATCGAATTCATGATTCAACGGAACATGGAGGTGCTCGAGGAGTACGAACCTTTGCGATCTCCCAACGCAACCAAGGTTTTCGTCAATGGTGTCTGGGTTGGCGTGCACAGAGATCCAGCGCATCTGGTGAGGACTGTCCAGAATCTCAGAAGATCTCACTTAATCTCTCACGAAGTTTCTTTGATCCGAGATATTCGAGATCGAGAATTCAAGATCTTCACAGATGCTGGGAGAGTTTGCAGGCCGCTCTTCGTCATTGACAACGACATTGACAGTGCTAATAAAGGCAATCTGGTTCTCAACAAGGATCACATTCGTAGATTGGAAGACGACCAAGCCATGGCCGCCAATATGGATGCAGAGGCAAAGGAAGCGCAGGGCTACTTTGGTTTCCAAGGGTTGATCGATGGGGGTGTCGTGGAATATGTCGATGCCGAGGAGGAAGAAACAGTCATGATCGTCATGACCCCAGAAGATTTGGATATCTCAAGACAACTCCAGCCCGTGTCTACCTACCTTGTTGCTTTGGCGGGCCGCCTTCGGGCGTCGGCTCCGGCTGACAGCCCGCCAGAGGACCCCATTATTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATGACCACTCAACTACTTGGTATTGGGGCTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCAGTGCCGTCTGGCTCTAAGCGTAGTAATTTTCTCGCTACAGAGTTGGGTGGTAGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGCTCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGCTGCTGATCATCCGAGCTTCTGCCCGGTGCACTCGGTAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCAGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_spiralis_2 ATTGAGTTTATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTACGAACCTTTGCGATCTCCGAACGCCACCAAAGTCTTCGTTAATGGTGTTTGGGTCGGCGTTCACAGAGACCCAGCACACCTTGTTAAGACCGTCCAAAATCTCCGAAGATCCCACTTGATCTCTCACGAAGTCTCATTGATTAGAGATATTCGAGACCGAGAATTTAAGATTTTCACGGATGCCGGAAGAGTGTGTAGGCCGCTCTTTGTCATTGACAACGATGTCGACAGCCCTAATAAAGGTAATTTGGTTCTCAACAAGGATCACATTCGAAGATTGGAAGATGACCAAGCCATGGCCGCCAATCTGGATGCAGAGGCAAAAGCAGAGCAAGGTTACTTCGGTTTCCAAGGATTGATCAACGAGGGTGTAGTGGAGTATGTTGATGCTGAGGAAGAAGAGACAGTCATGATCGTCATGACTCCAGAAGATTTGGATATTTCAAGACAAATTCAGACCGTGTATATATACCTTGTTGCTTTGGCGGGCCGCCCTTGGGCGTTGGCTTAGGCTAACCGCCCGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTGTATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTATTGGGGTCCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTTTCTCGCTATAGAGTCGGGCGGTTGCTTGTCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGAGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCGAGATTTTTCCCGGTGCACTCGGCAGTATTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACTGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_spiralis1 ATTGAGTTTATGATTCAGCGGAATATGGAGGTCCTTGAGGAGTACGAACCTTTGCGATCTCCGAACGCCACCAAAGTCTTCGTTAATGGTGTTTGGGTCGGCGTTCACAGAGACCCAGCACACCTTGTTAAGACTGTCCAAAATCTCCGAAGATCCCACTTGATTTCTCACGAAGTCTCATTGATTAGAGATATTCGAGACCGAGAATTTAAGATTTTCACGGATGCCGGAAGAGTGTGTAGGCCGCTCTTTGTCATTGACAACGATGTCGACAGCCCTAATAAAGGTAATTTGGTTCTCAACAAGGATCACATTCGAAGATTGGAAGATGACCAAGCCATGGCCGCCAATCTGGATGCAGAGGCAAAAGCAGAGCAAGGTTACTTCGGTTTCCAAGGATTGATCAACGAGGGTGTAGTGGAGTATGTTGATGCTGAGGAAGAAGAGACAGTCATGATCGTCATGACTCCAGAAGATTTGGATATTTCGAGACAAATTCAGACCGTGTATACATACCTTGTTGCTTTGGCGGGCCGCCCTTGGGCGTTGGCTTAGGCTAACCGCCCGCCAGAGGACCCAATCGTTTAGTAATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTATTGGGGTCCGCGGTCTCGCGGCCCTTAAAATTAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTTTCTCGCTATAGAGTCGGGCGGTTGCTTGTCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGAGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCTGTTGATCATCCGAGAGTTTTCCCGGTGCACTCGGCAGTATTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_variabilis ATCGAGTTTATGATTCAGCGGAACATGGAGGTCCTTGAGGAGTACGAACCTTTACGATCGCCGAACGCTACCAAAGTCTTCGTCAATGGTGTATGGGTTGGCGTTCATAGAGACCCTGCTCATCTTGTCAAGACTGTCCAGAATCTCCGACGATCTCACTTGATTTCACATGAAGTCTCTCTGATTCGAGATATCCGAGATCGAGAGTTCAAGATTTTCACAGATGCCGGGAGAGTTTGCAGGCCTCTCTTTGTCATTGACAACGACATCGATAGTCCTAACAAGGGAAATTTGGTTCTGAACAAGGATCATATTCGACGACTTGAAGATGATCAGGCCATGGCTGCCAATATGGATGCAGAGGCAAAAGCTGAGCAAGGCTACTTTGGATTCCAGGGATTAATCAACGAGGGTGTAGTGGAATACGTTGATGCTGAAGAAGAAGAAACTGTCATGATTACCATGACTCCAGAAGATTTGGATATTTCAAGACAACTCCAGACCGTGTCTACATACCTTGTTGCTTTGGCAGGCCGCCTTCGGGCGTCGGCTCCGGCTGATAGCCTGCCAGAGGACCCAATCGTTTAGTGATGTCTGAGTACTATATAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTATTGGGGTTCGCGTGTTCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCTGGTGGTTACTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTCCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCGGTTGATCATCCGAGCTTCTGCCCGGTGCACTCGATCGTATTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCCTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_vitreola ATCGAATTCATGATCCAGCGGAACATGGAGGTCCTTGAGGAGTACGAACCTTTACGATCGCCGAACGCTACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGCGTTCATAGAGACCCTGCTCACCTTGTCAAGACTGTCCAGAATCTCCGAAGATCTCACTTGATTTCTCACGAAGTCTCTCTGATTCGAGATATCCGAGATCGAGAATTCAAGATTTTCACGGATGCCGGGAGAGTTTGCAGGCCGCTCTTTGTCATTGACAATGATATCGATAGTCCTAATAAGGGCAATTTAGTTCTGAACAAGGATCACATTCGACGACTGGAAGATGATCAGGCCATGGCTGCCAATATGGATGCAGAGGCAAAAGCAGAGCAAGGCTACTTTGGTTTCCAGGGATTAATCAATGAGGGTGTCGTGGAATATGTTGATGCCGAGGAAGAAGAGACAGTCATGATCACCATGACCCCAGAAGATTTGGATATTTCAAGGCAACTCCAGACCGTGTATACATACCTTGTTGCTTTGGCAGGCCGCCTCCGGGCGTCGGCTCCGGCTGATTGCCTGCCAGAGGATCCAACCGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTACTTGGTATTGGGGTTCGCGTGCTCGCGGCTCTTAAAATCAGTGGCGGTGTCATCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCAGGTGGTTGCTTGTCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGAGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTCCGCTCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCATGCAGTTGATCATCCGAGCTTTTGCCCGGTGCACTCGATTGTATTCAGGCCAGCATCGGTTTCGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTATCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Hyaloscypha_vraolstadiae ATCGAGTTTATGATCCAGCGGAACATGGAAGTCCTTGAGGAGTACGAACCTTTACGATCTCCAAACGCCACCAAAGTCTTTGTCAATGGTGTCTGGGTCGGCGTTCATAGAGACCCAGCTCACCTTGTCAAGACTGTCCAGAATCTCCGAAGATCCCACTTGATTTCCCACGAAGTCTCTTTGATTCGAGATATTCGAGACCGAGAGTTCAAGATTTTCACGGATGCCGGGAGAGTTTGCAGGCCGCTCTTTGTCATCGACAACGACATTGATAGTCCCAATAAAGGAAATCTGGTTCTGAACAAGGATCACATCCGACGATTGGAAGATGACCAAGCCATGGCTGCCAATCTGGATGCTGAGGCAAAGGCAGAGCAAGGCTACTTCGGTTTCCAAGGCTTGATCAACGAGGGTGTAGTAGAATATGTCGATGCCGAGGAAGAGGAGACAGTCATGATTGTCATGACTCCAGAAGATTTGGATATTTCAAGACAACTCCAGACCGTGTATACATACCTTGTTGCTTTGGCGGGCCGCCTTCGGGCGTTGGCTTTAGCTGACTGCCCGCCAGAGGACCCAATCGTTTAATGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAACCACTCAACTGCTTGGTATTGGGGTTCGCGGTTCCGCGGCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCGGCGGTGGCTTGCCAGAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCTTTCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCTGTTGATCATCCGAGGTTTTCCCCGGTGCACTCGGCAGCGTTCAGGCCAGCATCGGTTTTGGTGGGCGGATAAAGGCCTTGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCCTCGGTGCAATGCGCCCTACCGGGACCGAGGACCGCGCTTCGGCTAGGATGCT Olla_millepunctata ATTGAGTTCATGATTCAGCGAAACATGGAAGTACTCGAAGAATACGAACCTTTGCGATCTCCGAATGCAACAAAGGTGTTCGTCAATGGTGTCTGGGTTGGTGTCCACCGAGACCCTGCCCATCTTGTCAAGACTGTGCAGCATCTCCGAAGATCTCATTTGATCTCCCACGAGGTCTCCTTGATTAGAGATATTCGAGACAGAGAATTCAAGATCTTTACCGACGCTGGTAGAGTATGCAGACCATTGTTTGTCATTGACAACGATCTCGAGAGTCCAAAAAAGGGTAATCTGGTTCTTGACAAGGAACATATTCGACGATTGGAAGATGACGCGGCCATGGCTGCCAACATGGACGCAGAGGCAAGAGCTGAATCTGGGTACTTTGGTTTCCAAGGATTGATCAATGAAGGTGTGGTCGAGTACGTTGATGCTGAGGAGGAAGAGACCGTCATGATTGTCATGACTCCTGAAGATTTGGACATCTCAAGACAGCTCCAACCCTTGAATATGAACTTCGTTGCTTTGGCGGGCCGCCTTTAGGCACTGGCCTCGGCTGGTTGCCCGCCAGAGGACAAAATCGTTTAGTGAAGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATATAAACACATCCCTACGGGGTCTTGGGATCCGCCTCCGGGCGGTCCTTAAAATCAGTGGCGGTGCCATCTGGCTCTAAGCGTAGTAATTTCCTCGCTATAGACCCAGGTGGTTGCTTGCCAAAAGGCTCTTGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACTGGTGCCTTCGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCACGTAGTTGATCATCCGGGGTTCTCCCCGGTGCACTCGATTGCGTTCAGGCCAGCATCGGTTTGGGTGGTTGGATAAAGGCCTTGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCTCGGTGCAATGCAGCCTATCCGGACCGAGGACCGCGCTTCGGCTAGGATGCT ; END; BEGIN TREES; TITLE 'Candelabrum Fig. 3 ML inferred from the RPB2 gene sequence data (933 positions).'; LINK TAXA = Taxa3; TRANSLATE 1 Candelabrum_brocchiatum_NBRC_109741, 2 Candelabrum_brocchiatum_NBRC_109744, 3 Candelabrum_brocchiatum_NBRC_108190, 4 Candelabrum_brocchiatum_NBRC_30048, 5 Candelabrum_brocchiatum_NBRC_109737, 6 Candelabrum_brocchiatum_NBRC_108059, 7 Candelabrum_brocchiatum_NBRC_108097, 8 Candelabrum_brocchiatum_NBRC_108086, 9 Candelabrum_brocchiatum_NBRC_108096, 10 Candelabrum_brocchiatum_NBRC_108095, 11 Candelabrum_brocchiatum_NBRC_106803, 12 Candelabrum_microsporum_NBRC_102397, 13 Candelabrum_microsporum_NBRC_102398, 14 Candelabrum_brocchiatum_NBRC_109732, 15 Candelabrum_brocchiatum_NBRC_109745, 16 Candelabrum_brocchiatum_NBRC_109747, 17 Candelabrum_brocchiatum_NBRC_109730, 18 Candelabrum_brocchiatum_NBRC_108076, 19 Candelabrum_microsporum_NBRC_108750, 20 Candelabrum_microsporum_NBRC_108151, 21 Candelabrum_microsporum_NBRC_108161, 22 Candelabrum_microsporum_NBRC_108099, 23 Candelabrum_microsporum_NBRC_108178, 24 Candelabrum_microsporum_NBRC_108751, 25 Candelabrum_microsporum_NBRC_109667, 26 Candelabrum_cf._microsporum_NBRC_108054, 27 Candelabrum_brocchiatum_NBRC_106791, 28 Candelabrum_cf._brocchiatum_NBRC_108061, 29 Candelabrum_cf._brocchiatum_NBRC_108175, 30 Candelabrum_cf._brocchiatum_NBRC_108171, 31 Candelabrum_cf._brocchiatum_NBRC_108103, 32 Candelabrum_cf._brocchiatum_NBRC_108077, 33 Candelabrum_cf._brocchiatum_NBRC_108065, 34 Candelabrum_brocchiatum_NBRC_106788, 35 Candelabrum_brocchiatum_NBRC_108053, 36 Candelabrum_brocchiatum_NBRC_106792, 37 Candelabrum_brocchiatum_NBRC_106808, 38 Candelabrum_brocchiatum_NBRC_106799, 39 Candelabrum_brocchiatum_NBRC_108146, 40 Candelabrum_brocchiatum_NBRC_106805, 41 Candelabrum_brocchiatum_NBRC_108160, 42 Candelabrum_brocchiatum_NBRC_108098, 43 Candelabrum_brocchiatum_NBRC_108189, 44 Candelabrum_brocchiatum_NBRC_108060, 45 Candelabrum_brocchiatum_NBRC_106802, 46 Candelabrum_brocchiatum_NBRC_106813, 47 Candelabrum_cf._brocchiatum_NBRC_108106, 48 Candelabrum_brocchiatum_NBRC_108827, 49 Candelabrum_sp._NBRC_109738, 50 'Candelabrum sp. NBRC 109748_2', 51 Achroceratosphaeria_potamia_KM588908, 52 Pisorisporium_cymbiforme_KM588906, 53 Pisorisporium_cymbiforme_KM588905, 54 Pisorisporium_cymbiforme_KM588907, 55 Trichoderma_viride_EU711362, 56 Pseudonectria_buxi_DQ522459; TREE Fig._3 = [&R] (((((((((1:0.0,(2:0.0,(3:0.0,(4:0.0,5:0.0):0.0):0.0):0.0):0.0,((6:0.0,7:0.0):0.0,(8:0.0,9:0.0):0.00127501):0.00127567):0.00832255,(10:0.00647914,11:0.00397783):0.00500327):0.00224308,((12:0.00253934,13:0.00253683):0.0,14:0.01029157):0.01589297):0.00662598,((((15:0.0,16:0.0):0.00632922,17:0.01432095):0.0,18:0.00761438):0.00603979,19:0.01102197):0.00126827):0.01835146,((((20:0.0,(21:0.0,22:0.0):0.0):0.00324464,(23:0.0,24:0.0):0.00451084):0.00929395,25:0.01316917):0.01255845,26:0.02860455):0.00480709):0.02084972,((27:0.03424239,((28:0.0,(29:0.00121633,30:0.00121464):0.00121998):0.0,31:0.00366837):0.01759123):0.01457453,((32:0.0,33:0.0):0.02654256,(((((34:0.00247437,35:0.0):0.00876119,(((36:0.00371274,37:0.00372741):0.0012032,38:0.01121474):0.0,39:0.00746491):0.0):5.1827E-4,40:0.01342962):0.00415945,((41:0.0,42:0.0):0.00119831,(43:0.00119936,44:0.0):0.0):0.02252678):0.0288016,((45:0.02158466,((46:0.00783955,47:0.00867127):0.00850526,48:0.03078807):8.7897E-4):0.01598649,(49:0.00129259,50:0.00120186):0.01874344):0.00538279):0.00661736):0.00466428):0.01359823):0.04224193,51:0.23645501):0.23425859,((52:0.0,53:0.0):0.0,54:0.0):0.15049353,(55:0.4395611,56:0.24622314):1.24338665); END; BEGIN TREES; TITLE 'Candelabrum Fig. 2 ML inferred from combined sequence data of the RPB2 gene, 5.8S-ITS and LSU rDNA (D1/D2 regions) (1380 positions).'; LINK TAXA = Taxa2; TRANSLATE 1 Candelabrum_spinulosum_NBRC_102391, 2 Candelabrum_spinulosum_NBRC_109733, 3 Candelabrum_spinulosum_NBRC_109731, 4 Candelabrum_spinulosum_NBRC_109734, 5 'Candelabrum spinulosum NBRC 101903_2', 6 Candelabrum_desmidiaceum_NBRC_109736, 7 'Candelabrum desmidiaceum NBRC 101133_2', 8 Hyaloscypha_occulta_SANK_13397, 9 Candelabrum_clathrosphaeroides_NBRC_109742, 10 Candelabrum_clathrosphaeroides_NBRC_108199, 11 Candelabrum_clathrosphaeroides_NBRC_108187, 12 Candelabrum_japonense_NBRC_108046, 13 Candelabrum_japonense_NBRC_6777, 14 'Candelabrum japonense NBRC 108749_2', 15 Candelabrum_clathrosphaeroides_NBRC_109746, 16 Candelabrum_japonense_NBRC_6844, 17 Candelabrum_clathrosphaeroides_NBRC_109729, 18 'Candelabrum clathrosphaeroides NBRC 101134_2', 19 Candelabrum_clathrosphaeroides_NBRC_109735, 20 Candelabrum_japonense_NBRC_106777, 21 Candelabrum_clathrosphaeroides_NBRC_102394, 22 Hyaloscypha_occulta_NBRC_108595, 23 Hyaloscypha_sp._NBRC_108580, 24 Hyaloscypha_sp._NBRC_108581, 25 Hyaloscypha_spiralis1, 26 Hyaloscypha_spiralis_2, 27 Hyaloscypha_sp._NBRC_108592, 28 Hyaloscypha_vitreola, 29 Hyaloscypha_variabilis, 30 Hyaloscypha_melinii, 31 Hyaloscypha_bulbopilosa1, 32 Hyaloscypha_bulbopilosa_2, 33 Hyaloscypha_finlandica, 34 Hyaloscypha_bicolor, 35 Hyaloscypha_monodictys, 36 Hyaloscypha_vraolstadiae, 37 Hyaloscypha_hepaticicola, 38 Hyaloscypha_albohyalina1, 39 Hyaloscypha_albohyalina2, 40 Hyaloscypha_aureliella1, 41 Hyaloscypha_aureliella2, 42 Hyalopeziza_sp.__NBRC_108584, 43 Hyalopeziza_nectrioides, 44 Hyalopeziza_sp._NBRC_108587, 45 Hyalopeziza_sp._NBRC_108591, 46 Olla_millepunctata, 47 Dematioscypha_castaneae_1, 48 Dematioscypha_castaneae_2, 49 Dematioscypha_delicata_; TREE Fig._2 = [&R] (((((((((1:0.01639576,(2:0.01541499,(3:0.0124677,(4:0.00184565,5:0.00468074):0.00622037):0.00257082):0.01235363):0.02204626,(6:5.6435E-4,7:8.3437E-4):0.02017032):0.00272144,(8:0.0,((9:0.00141066,10:0.0):0.00386378,(11:0.00307044,((12:0.00424898,((13:0.0,14:0.0):6.9869E-4,(15:0.0,(16:0.0,17:0.0):0.0):0.0):0.0):0.00141606,((((18:6.9991E-4,19:0.0):0.0,20:0.0):6.9898E-4,21:0.0):0.0,22:0.0):0.00285159):4.3933E-4):6.672E-4):0.0):0.05447177):0.01638513,((23:0.02176832,24:0.03401661):0.01828852,(25:0.00229188,26:0.00431769):0.03258703):0.0070957):0.0053827,27:0.06719224):0.00353102,(((28:0.01885179,(29:0.02637114,30:0.0132971):0.00528415):0.00366505,(31:0.01762495,32:0.01837202):0.02113467):0.02505433,(33:0.00977819,34:0.00621576):0.02736136):0.00502115):0.00441371,((35:0.03003445,36:0.01763656):0.00615808,37:0.04974241):0.00472393):0.03300467,((38:0.00282449,39:0.00150436):0.03972047,(40:0.0017931,41:0.00247296):0.05462676):0.0046472):0.0309027,((42:0.04159462,43:0.0400179):0.00417819,(44:0.04218974,(45:0.03792107,46:0.02054554):0.00648665):0.04847741):0.03972929,((47:0.00213917,48:0.0):0.05332203,49:0.02512247):0.14833156); END; BEGIN TREES; TITLE 'Candelabrum Fig. 1 NJ inferred from the LSU rDNA (D1/D2 regions) sequence data (479 positions).'; LINK TAXA = Taxa1; TRANSLATE 1 Chlorociboria_cf_aeruginosa_AY544669_, 2 Bulgaria_inquinans_DQ470960, 3 Capronia_pilosella_DQ823099_, 4 Bipolaris_maydis_AY544645_, 5 Prosthemium_betulinum_AY004341, 6 Verruculina_enalia_AY016363_, 7 Hysteropatella_clavispora_AY541493_, 8 Ramularia_endophylla_DQ470968, 9 Myriangium_duriaei_AY016365, 10 Columnosphaeria_fagi_AY016359_, 11 Aureobasidium_pullulans_AJ507454_, 12 Delphinella_strobiligena_AY016358_, 13 Ophiostoma_piceae_AJ538341, 14 Rhytisma_acerinum_AF356696, 15 Neofabraea_malicorticis_AY544662, 16 Hyaloscypha_daedaleae_AY789415, 17 Lachnum_virgineum_AY544646, 18 Pezicula_ericae_AY442323, 19 '"Crocicreas diapensiae" DQ008442', 20 Candelabrum_spinulosum_NBRC_101903, 21 Hyaloscypha_spiralis_AB546940, 22 Sclerotinia_sclerotiorum_AF431951, 23 Candelabrum_desmidiaceum_NBRC_101133, 24 Hyaloscypha_occulta_JN086754, 25 Candelabrum_japonense_NBRC_108749, 26 Candelabrum_clathrosphaeroides_NBRC_101134_, 27 Bisporella_citrina_AY789385, 28 Lachnellula_occidentalis_KC492977, 29 Hydrocina_chaetocladia_AY789412, 30 Lambertella_tubulosa_AY616237, 31 Xanthothecium_peruvianum_AB053453, 32 Arachnomyces_minimus_AB075350, 33 Aspergillus_ruber__U29556, 34 Dermatocarpon_miniatum_AY584644, 35 Phoma_herbarum_AY293790, 36 Tubeufia_cerea_AY856907, 37 Neofusicoccum_luteum_AY928043, 38 Porpidia_melinodes_DQ314985, 39 Lecanora_hybocarpa_DQ782910, 40 Stictis_radiata_AY341361, 41 Peziza_badia_U42692, 42 Peziza_vesiculosa_AF378367, 43 Coccidioides_immitis_AY176713, 44 Pisorisporium_cymbiforme_KM588903, 45 Pisorisporium_cymbiforme_KM588904, 46 Achroceratosphaeria_potamia_GQ996538, 47 Achroceratosphaeria_sp._AF132325, 48 Candelabrum_brocchiatum_NBRC_30048, 49 Candelabrum_sp._NBRC_109748, 50 Candelabrum_microsporum_NBRC_108751, 51 Candelabrum_microsporum_NBRC_108750, 52 Humicola_sphaeralis_AF286407, 53 Staphylotrichum_longicolleum_AF286408, 54 Schizothecium_curvisporum_AY346300, 55 Cercophora_macrocarpa_AY780060, 56 Melanochaeta_aotearoae_AF466082, 57 Chaetosphaeria_raciborskii_AY436402, 58 Pisorisporium_cymbiforme_KM588902, 59 Melanconiella_spodiaea_AF408370, 60 Oxydothis_frondicola_AY083835, 61 Diaporthe_pustulata_AF408358, 62 Diamantinia_citrina_AY346278, 63 Tolypocladium_capitatum_AY489721, 64 '"Lophiostoma" heterosporum AY016369', 65 Cainia_graminis_AF431949, 66 Neocosmospora_haematococca_DQ119560, 67 Trichoderma_atroviride_AB646518; TREE Fig._1 = [&R] ((41:0.0505,42:0.03335):0.08406,((2:0.03114,((14:0.02109,(22:0.06442,1:0.06805)614:0.00855)285:0.00293,((19:0.02381,((15:0.01352,18:0.01847)897:0.0118,27:0.02076)253:0.00104)362:0.00307,(29:0.01078,(30:0.04094,((17:0.02202,28:0.01654)503:0.00319,(16:0.01323,(((21:0.00724,20:0.00116)879:0.00371,23:0.00474)888:0.00713,((24:0.0,25:0.0)557:0.0,26:0.0)1000:0.0088)456:0.00276)905:0.01213)532:0.00293)315:0.00316)320:0.00327)406:0.00471)675:0.01168)788:0.01128,((((39:0.04394,38:0.03064)715:0.00697,40:0.0505)599:0.009,((3:0.07642,34:0.06356)937:0.01909,(((31:0.00491,32:0.00985)1000:0.03478,33:0.05008)960:0.018,43:0.08255)944:0.02168)846:0.02001)391:0.00695,((((((11:0.0,10:0.0)1000:0.04569,12:0.03594)974:0.0192,9:0.08618)890:0.01759,8:0.1092)523:0.0106,(((36:0.04686,37:0.05372)797:0.01447,7:0.0324)257:0.00206,(((4:0.03827,(35:0.04934,64:0.04639)446:0.0026)946:0.01886,5:0.05191)725:0.00841,6:0.05278)982:0.02705)442:0.00818)437:0.00797,(13:0.04991,(((57:0.03957,56:0.07286)959:0.02754,(((53:0.01084,52:0.01249)849:0.00759,55:0.0271)885:0.00808,54:0.03708)902:0.0137)205:0.00221,((67:0.03582,(63:0.03832,66:0.03398)667:0.00864)785:0.019,(((62:0.02493,60:0.03593)598:0.01243,65:0.03889)650:0.00808,((61:0.01949,59:0.01695)1000:0.03841,(((((48:0.00834,49)'-'):0.0043)500:0.002,50:0.00859)437:0.0017,51:0.00995)994:0.0174,(47:0.05146,46:0.02084)688:0.00651)801:0.01024,((45:0.0,44:0.0)501:0.0,58:0.0)1000:0.03695)1000:0.03585)407:0.0084)159:0.00416)188:0.00451)677:0.00942)1000:0.04674)217:0.0018)432; END;