#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:02 GMT TreeBASE (cc) 1994-2008 Study reference: Minoshima A., Walker D.M., Takemoto S., Hosoya T., Walker A.K., Ishikawa S., & Hirooka Y. 2018. Pathogenicity and taxonomy of Tenuignomonia styracis gen. et sp. nov, a new monotypic genus of Gnomoniaceae on Styrax obassia in Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22653] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=38; TAXLABELS Ambarignomonia_petiolorum_AR4082 Amphiporthe_hranicensis_CBS119289 'Apiognomonia borealis CBS799_79' 'Apiognomonia hystrix CBS911_79' 'Apiognomonia veneta CBS897_79' Cryphonectria_cubensis_CBS101281 Cryphonectria_nitschkei_AR3466 Cryptosporella_confusa_AR3966 Cryptosporella_hypodermia_CBS109753 Cryptosporella_suffusa_CBS121077 Cryptosporella_wehmeyeriana_AR3806 Discula_destructiva_CBS109771 Ditopella_ditopa_AR3423 'Gnomonia fructicola CBS208_34' 'Gnomonia gnomon CBS199_53' 'Gnomonia ischnostyla CBS837_79' Gnomonia_pseudoamoena_AR4318 'Gnomoniopsis comari CBS806_79' Gnomoniopsis_macounii_AR3866 Melanconis_marginalis_AR3442 Melanconis_stilbostoma_AR3501 'Occultocarpon ailaoshanense LCM524_01' 'Ophiognomonia alniviridis CBS782_79' 'Ophiognomonia padicola CBS845_79' Ophiognomonia_rosae_AR4382 Plagiostoma_devexum_AR3838 Plagiostoma_fraxini_AR2789 Plagiostoma_petiolophilum_AR3821 Plagiostoma_robergeanum_AR3982 Pleurocera_soregonense_AR4333 'Pleurocera spleurostylum CBS906_79' Pleurocera_stenellum_AR4159 'Tenuignomonia styracis DMW320_2' 'Tenuignomonia styracis DMW329_2' 'Tenuignomonia styracis DMW411_3' Tenuignomonia_styracis_HM16001C Tenuignomonia_styracis_HM16002C 'Tenuignomonia styracis HM16003C_ef' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46495] TITLE Tenuignomonia; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1546; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ambarignomonia_petiolorum_AR4082 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCTGGTACTGGTGAGTTCGAGGCTGGTATATCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCATGAAAGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTCAGTGAGGGCAAGCACTTTGACCTCGCCCTGGGCATCCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTTGCGACAGGAAATTGGGGCGAGCAGAAGAAGGCGAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTGAATCGGTACACATTCTCGTCCACACTCTCTCACTTGCGGCGCACCAACACTCCAATCGGTCGCGATGGAAAATTGGCCAAGCCCCGTCAGCTGCACAACACGCACTGGGGTCTTGTCTGTCCCGCAGAAACTCCAGAGGGTCAAGCCTGTGGTCTCGTCAAGAACCTTTCGCTCATGTGCTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGTTGCTGGAAGAGTACGAGCCTGGCACCAGTCCCGA Amphiporthe_hranicensis_CBS119289 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCCTGACCAACGGCCTCAAGTACTCTCTTGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACACTTTCTCACTTGCGGCGAACCAACACTCCCATCGGACGTGATGGCAAATTGGCCAAGCCTCGGCAGCTGCACAACACACACTGGGGTCTCGTCTGTCCTGCAGAAACACCTGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTTATGGTGCAGCGGAACATGGAGTTGCTCGAAGAGTATGAACCTGGTTCCAGTCCCGA 'Apiognomonia borealis CBS799_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTTCCCATCTCCGGATTCAACGGCGACAACATGATTGAGGGTGAGACCCTCGACCCCCGTGCCAAGGCTTGGTAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTGGCTCTCCTTCGGGGGAGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGTTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATTCGCCACTCCACTCTGACAAACGGACTCAAGTACTCTCTTGCGACGGGAAATTGGGGTGAGCAAAAGAAAGCCAGCAGCTCCACTGCTGGTGTTTCTCAGGTACTCAACCGGTACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAATACTCCCATCGGACGTGATGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACCCACTGGGGTCTCGTGTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTTGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTGGGTTCGCCTGCTGAGCCCATCAAAGAGTTTATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCCGA 'Apiognomonia hystrix CBS911_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCTGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGATTCAACGGCGACAACATGATTGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTCTGTCGGGGGATAAGAACAGTAGGAACGTAGCTCTCCTTCGGGAGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATCCGCCACTCCACCCTGACAAACGGACTCAAGTACTCTCTTGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAATACTCCCATCGGACGTGACGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACGCACTGGGGTCTCGTGTGTCCTGCAGAAACACCAGAGGGTCAAGCTTGTGGCCTTGTCAAGAATTTATCTCTCATGTGCTACGTCAGTGTGGGTTCGCCTGCCGAGCCCATCAAGGAGTTTATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCCGA 'Apiognomonia veneta CBS897_79' ATCAAGAACATGATCACGGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATCGCCTCCGGCACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACCGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCGGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGATTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTTGTCGGAGGATAAGAATAGTAGGAACGTAGCTCTTCCTCGGAAGAGTGTTATAGCCTATTATACGATACTTTGATAGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTCTGGGAATTCGCCACTCCACTCTGACAAACGGACTCAAGTATTCTCTTGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACTGCGGGTGTCTCCCAGGTTCTCAACCGCTACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAACACTCCCATCGGACGTGACGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACGCACTGGGGCCTCGTGTGTCCTGCAGAAACACCAGAGGGTCAAGCTTGTGGCCTTGTCAAGAATTTGTCGCTCATGTGCTACGTCAGCGTGGGTTCGCCTGCAGAGCCCATCAAGGAGTTTATGGTACAGCGTAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCTGA Cryphonectria_cubensis_CBS101281 ------------------------------------TGCGCTATCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGGAGGCCCGTTTCGAGGAGATCAAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCTTTCGTCCCTATCTCCGGCTTCAACGGCGACAACATGATTGAGAAGGAGTCCCTCGACAAGCGTGCC---TCTTGGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACTAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCCGTACGATACCCTGACGGGGACCGAGGTTCGCGCTCC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGCGTCAGCGAGGGCAAGCATTTCGACCTCGCGTTAGGCATCCGCCACTCTACCCTTACAAATGGCCTCAAGTATTCCTTGGCAACTGGCAACTGGGGTGAGCAGAAGAAGGCCATGAGCTCCACTGCTGGTGTTTCTCAGGTTCTGAACCGATACACTTTTGCCTCTACACTGTCTCACTTGCGGCGCACAAACACTCCTATTGGACGTGATGGCAAGTTGGCCAAGCCTCGCCAACTGCACAACACTCACTGGGGTTTGGTCTGTCCCGCAGAGACTCCTGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTATCGCTCATGTGCTACGTCAGTGTCGGATCACCAGCGGAGCCTATCAAGGACTTCATGGTGCAACGCAATATGGAAGTGTTGGAGGAATACGAGCCTGGCGCCAGCCCTGA Cryphonectria_nitschkei_AR3466 ------------------------------------------GTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTTAGGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCTGAGTGGAAGGAGGCCCGTTTCGAGGAGATCAAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGAAGGAGTCTCTGGACAAGCGTGCC---TCTTGGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGTTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCCGTACGATACCCTGACGGGGACCGAGGTTCGCGCTCC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTGCGTTGGGCATCCGCCACTCCACACTCACAAACGGTCTCAAATACTCCCTTGCGACCGG-AACTGGGGTGAGCAGAA-AAGGCTATGAGTTCTACGGCTGGTGTTTCTCAGGTTCTGAACCGATACACCTTCGCCTCGACACTGTCTCACTTGCGACGCACAAACACTCCCATTGGGCGTGATGGTAAGCTGGCGAAGCCTCGCCAGCTGCACAATACCCACTGGGGCTTGGTCTGTCCTGCAGAGACCCCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAATCTGTCGCTTATGTGCTACGTCAGTGTCGGATCCCCAGCGGAGCCTATCAAGGACTTCATGGTCCAACGCAACATGGAAGTGCTGGAGGAATACGAGCCCGGCGCCAGCCCTGA Cryptosporella_confusa_AR3966 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTTATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTAGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACGGCTGGTGTTTCACAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGCCGCACCAATACTCCCATCGGCCGCGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAACGTAACATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAACCCTGA Cryptosporella_hypodermia_CBS109753 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTTGGCTACAACCCCAAGACTGTCGCCTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGCGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAGCCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGAAAGCACTTCGATCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGTTCCACCGCTGGTGTCTCACAGGTGCTCAACCGGTACACCTTCTCGTCAACCCTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGCGATGGTAAACTAGCCAAGCCTCGTCAGCTCCACAACACCCATTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGGTCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAACATGGAGTTGCTCGAGGAGTATGAGCCTGGCTCCAACCCAGA Cryptosporella_suffusa_CBS121077 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGT{AT}AAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCACAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGTGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACTCATTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAATATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAATCCTGA Cryptosporella_wehmeyeriana_AR3806 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACCGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCTACCGCAGGTGTCTCGCAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGCGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAACATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAACCCTGA Discula_destructiva_CBS109771 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGTCTCGTTACGACGAGATCAAGGGTGAGACCGAGAAGTTCATCAAGAAGGTCGGCTACAACCCCGCCACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGTCTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTCGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTACTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGTGTTAGCGAAGGCAAGCATTTTGACCTTGCCTTGGGCATTCGCCACTCTACCCTGACGAACGGCCTCAAGTACTCTCTCGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCAAGCAGCTCGACCGCTGGCGTATCCCAGGTGCTCAACCGGTACACATTCTCATCAACACTTTCCCATTTGCGACGCACCAACACCCCCATCGGTCGTGATGGCAAGCTTGCCAAGCCTCGTCAGCTCCACAACACACACTGGGGCCTTGTCTGTCCAGCAGAAACACCCGAGGGACAAGCCTGTGGCCTCGTCAAAAATCTGTCGCTTATGTGTTATGTCAGCGTGGGGTCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAGTACGAGCCGGGTTCAAGCCCCGA Ditopella_ditopa_AR3423 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTGCCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGACACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTGTCGTTGGGGGATAAGAACAGTACGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGCGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCCTACATGAAGCGGTGCGTGAGCGAAGGGAAGCATTTCGACCTGGCCCTGGGTATCCGCCACTCTACCCTGACGAACGGCCTCAAGTACTCCCTTGCGACGGGAAACTGGGGCGAGCAGAAAAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACGCTTTCTCATTTGCGTCGTACCAACACTCCCATTGGACGTGATGGCAAACTGGCCAAGCCCCGCCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCCGAAACGCCCGAGGGTCAAGCTTGTGGCCTCGTCAAGAATCTGTCACTTATGTGTTACGTCAGTGTGGGTTCGCCTGCAGAGCCCATCAAGGAGTTCATGGTGCAGCGGAACATGGAGTTGCTTGAAGAGTACGAGCCTGGCTCCAGTCCCGA 'Gnomonia fructicola CBS208_34' ATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGGGTGAGTCCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGCAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATCCGCCACTCCACACTCACCAATGGTCTCAAGTACTCGCTTGCAACAGGAAACTGGGGCGAGCAAAAGAAAGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACAGATACACATTCTCGTCCACGCTTTCTCACTTGCGGCGCACCAACACGCCAATAGGTCGTGATGGCAAATTGGCGAAGCCTCGTCAGTTGCACAACACCCACTGGGGTCTTGTCTGCCCTGCGGAAACCCCCGAAGGCCAAGCTTGTGGCCTTGTGAAAAACCTTTCTCTCATGTGTTATGTCAGTGTGGGATCCCCTGCGGAACCTATCAAGGAGTTCATGGTTCAGCGCAACATGGAGTTGCTCGAAGAGTACGAACCAGGGTCTAGTCCCGA 'Gnomonia gnomon CBS199_53' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGTCCGACACCCTCGACCCCCGTGGCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAACGTAGCTCTCTTC--GGAGAGTGTTATAGCCTATTGTACGATACCCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATATATGAAGCGTTGTGTCAGCGAGGGCAAGCACTTCGACCTCGCGTTGGGCATTCGCCACTCTACCCTGACAAACGGTCTCAAGTACTCTCTTGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACTTTCTCGTCGACACTTTCTCACTTGCGGCGAACTAACACTCCAATCGGACGTGATGGCAAACTGGCCAAGCCTCGTCAGCTGCACAACACTCACTGGGGTCTCGTCTGTCCCGCAGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTGTCTCTCATGTGTTACGTCAGTGTGGGTTCCCCTGCCGAGCCTATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAATACGAGCCTGGCTCGAGTCCCGA 'Gnomonia ischnostyla CBS837_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCATCGCTATGAACAAGATGGACATCGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCAAGAAGGAGACCTCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGGTCGTTCCCTTCGTTCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAATAGTAGGAACGTAGCTTTCTTC--GGAGAGTGTTATAGCCTATTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTACCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGACGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTTAGCGAGGGCAAGCACTTCGACCTCGCCCTGGGCATCCGCCACTCTACCCTGACCAACGGTCTCAAGTACTCTCTTGCCACTGGCAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCTACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTCTCGTCCACCCTCTCTCATTTACGTCGCACCAACACGCCCATCGGACGTGATGGCAAATTGGCCAAGCCCCGTCAACTGCACAATACGCACTGGGGTCTCGTCTGTCCAGCAGAGACACCCGAGGGGCAAGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTTGAAGAGTACGAGCCCGGCTCTAGTCCGGA Gnomonia_pseudoamoena_AR4318 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCTTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTTGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGTCCGACACCCTCGACCCCCGCGGCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCAACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCTGTGTGGCTCATCCGAGGTTCTCCTCGGTGCACTCCATGCAGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCTATTATACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTTAGCGAGGGGAAGCACTTTGACCTTGCGCTGGGTATCCGCCACTCAACCCTGACCAACGGTCTCAAGTACTCTCTTGCAACAGGAAATTGGGGTGAGCAGAAGAAGGCCAGCAGCTCCACCGCGGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACGCTTTCTCACTTGCGGCGAACCAACACTCCAATCGGACGCGATGGAAAATTGGCCAAGCCTCGTCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGCGGTCTCGTCAAGAACCTGTCTCTCATGTGTTATGTTAGCGTAGGTTCGCCTGCCGAGCCTATCAAGGAATTCATGGTACAGCGGAACATGGAGTTGCTCGAAGAATATGAGCCCGGCTCGAGTCCCGA 'Gnomoniopsis comari CBS806_79' ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCGGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTTTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGTTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGTATCCGTCACTCTACACTTACGAATGGTCTCAAGTACTCGCTTGCAACAGGAAACTGGGGCGAGCAAAAGAAGGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACCGATACACGTTCTCGTCCACACTTTCTCACTTGCGGCGCACCAACACGCCAATAGGCCGTGATGGCAAACTCGCGAAGCCCCGTCAATTGCACAACACGCACTGGGGTCTTGTCTGCCCTGCAGAAACCCCCGAGGGCCAAGCTTGTGGCCTCGTCAAAAACCTGTCCCTCATGTGTTACGTCAGTGTGGGTTCCCCTGCCGAGCCTATCAAGGAGTTCATGGTGCAACGCAACATGGAGTTGCTCGAAGAGTATGAACCCGGCTCTAGTCCCGA Gnomoniopsis_macounii_AR3866 ATCAAGAACATGATCACTGGTACCTCTCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGTGACAACATGATCGAGGGCGAGTCTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGTGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGTATCCGCCACTCTACACTCACGAACGGTCTCAAGTACTCGCTTGCCACAGGAAATTGGGGCGAGCAAAAGAAGGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACCGATACACATTCTCGTCCACGCTTTCTCACTTGCGGCGCACCAACACTCCAATAGGCCGTGATGGCAAATTGGCGAAGCCTCGTCAATTGCACAACACGCACTGGGGTCTTGTCTGCCCTGCAGAAACCCCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTATCGCTCATGTGTTACGTCAGTGTGGGATCCCCTGCCGAACCTATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTATGAACCCGGTTCCAGTCCCGA Melanconis_marginalis_AR3442 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAAATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGGCAAGGCCTGGCAGAGGATGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTATGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCATACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGCGTCAGCGAGGGCAAACATTTCGATCTAGCCTTGGGTATTCGCCACTCTACCCTCACGAACGGTCTGAAGTACTCTCTTGCAACCGGGAACTGGGGCGAGCAGAAGAAAGCTAGTAGCTCTACGGCTGGTGTGTCTCAGGTGCTCAACCGATACACATTCTCGTCCACGCTCTCTCATTTGCGGCGCACCAACACTCCAATTGGACGTGATGGCAAATTGGCCAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTCGTCTGCCCTGCAGAAACACCCGAAGGTCAAGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGTTATGTCAGTGTCGGCTCCCCTGCCGAACCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAATACGAGCCTGGCACCAGCCCCGA Melanconis_stilbostoma_AR3501 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGGCAAGGCCTGGCAGAGGAAGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTGTGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGTGTCAGCGAGGGCAAGCACTTCGATCTCGCCTTGGGTATTCGCCACTCTACCCTCACAAACGGTCTCAAGTACTCCCTTGCAACTGGAAACTGGGGCGAGCAAAAGAAGGCTAGCAGCTCTACGGCAGGTGTGTCTCAGGTGCTCAACCGATACACATTCTCGTCCACTCTTTCTCATTTGCGCCGCACCAACACTCCGATTGGACGTGATGGCAAATTGGCCAAGCCTCGCCAGCTGCACAACACGCATTGGGGTCTCGTCTGCCCCGCAGAAACCCCCGAAGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTATGTCAGTGTCGGTTCCCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAATACGAGCCTGGCACCAGCCCCGA 'Occultocarpon ailaoshanense LCM524_01' ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATGAACAAGATGGACATCGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCTAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGGTCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGACTCAGGCCAACATCGGTTTTCGTCGGAGGAGAAGAATGCCAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTAGTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCCTGACGAACGGTCTGAAGTATTCTCTTGCGACAGGAAACTGGGGCGAGCAGAAAAAAGCCAGTAGTTCCACTGCCGGTGTCTCCCAGGTGCTCAATCGATACACCTTCTCGTCAACTCTGTCTCATTTGCGTCGCACCAACACTCCCATCGGACGCGATGGCAAGTTGGCCAAGCCTCGTCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGCGGTCTCGTCAAGAACCTATCGCTCATGTGCTATGTCAGTGTGGGGTCGCCTGCCGAACCCATCAAGGAATTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCCAGTCCTGA 'Ophiognomonia alniviridis CBS782_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCTTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGACATTGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCAAGAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCTCGTCCCCTTCGTCCCGATCTCCGGCTTCAACGGCGACAACATGATTGAGAGTGACAGTCTCGACCCCCGCGGCAAGGCCTGGTAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGTGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGCTGCGTTAGCGAGGGCAAGCATTTCGACCTTGCTTTGGGCATCCGTCACTCCACCCTGACGAATGGTCTCAAGTACTCCCTCGCCACTGGCAATTGGGGCGAACAGAAGAAAGCTAGTAGCTCGACCGCTGGTGTCTCCCAAGTGCTCAACCGATACACATTCTCGTCCACCCTCTCTCACTTGCGGCGCACCAACACGCCCATCGGGCGGGATGGCAAGTTGGCCAAGCCCCGCCAACTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCATGTGGTCTCGTCAAGAATCTGTCACTCATGTGCTACGTCAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGTTGCTTGAAGAGTATGAGCCTGGCTCCAGTCCAGA 'Ophiognomonia padicola CBS845_79' ATCAAGAACATGATCACTGGCACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCACTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGATATCGCGGAGTGGAAGGAGGAGCGCTACAAGGAGATCCAGAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGGTTGTTCCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGATCGAGAGCGAGTCTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTCCAGGCCAGCATCGGTTTTCGCCGGGGGATAAGAACGGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTACCGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCATGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCCTACATGAAGCGGTGCGTTAGCGAGGGCAAGCACTTTGACCTGGCTTTGGGCATTCGTCACTCTACCCTGACCAACGGCCTCAAGTACTCTCTCGCCACTGGCAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTTTCGTCTACCCTGTCTCATTTGCGTCGCACCAACACGCCCATTGGACGTGATGGCAAACTGGCCAAGCCTCGTCAGCTGCACAACACTCATTGGGGTCTCGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGTGGTCTAGTCAAAAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCGCCTGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAACATGGAGCTGCTTGAAGAGTATGAACCCGGCTCTAGTCCGGA Ophiognomonia_rosae_AR4382 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGACATCGCTGAGTGGAAGGAGGACCGTTACAAGGAGATCATGAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGGTTGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGCGAGACTCTCGACCCCCGTGCCAAGTCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTGGCCTTGGGCATCCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTTGCCACTGGCAACTGGGGCGAACAGAAGAAAGCCAGCAGCTCCACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTCTCGTCCACCCTGTCTCATTTGCGCCGCACCAATACGCCCATCGGACGTGATGGCAAATTGGCCAAGCCCCGTCAGCTGCACAACACTCATTGGGGTCTTGTCTGTCCTGCAGAAACGCCGGAAGGTCAAGCTTGTGGTCTGGTCAAAAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCCCCTGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAACATGGAGCTGCTTGAAGAGTATGAGCCCGGCTCTAGTCCGGA Plagiostoma_devexum_AR3838 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATATCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTG-TTTGGGCATTCGCCATTCCACCTTGACGAACGGCCTCAAATATTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCTTCAACACTTTCTCATTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACTCATTGGGGTCTTGTCTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTGGTCAAGAACTTATCACTCATGTGCTACGTGAGTGTGGGGTCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAATATGGAGCTGCTTGAAGAGTATGAGCCTGGATCTAGCCCTGA Plagiostoma_fraxini_AR2789 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGTAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTGCTTTGGGCATTCGCCATTCCACCCTGACGAATGGTCTCAAATACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCTTCAACACTCTCTCACTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACTCATTGGGGTCTTGTTTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTTGTCAAGAACTTATCGCTCATGTGCTACGTGAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTATGAGCCTGGCTCTAGCCCCGA Plagiostoma_petiolophilum_AR3821 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTTGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTTTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGTTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGCATTCGCCATTCTACCCTGACGAACGGTCTCAAATATTCTCTTGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCTCAGGTGCTCAACCGATACACATTCTCTTCAACGCTTTCTCACTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACGCACTGGGGTCTTGTCTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTGGTCAAGAATCTATCGCTCATGTGCTACGTGAGTGTGGGATCGCCTGCCGAGCCCATTAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTATGAGCCTGGCTCTAGCCCCGA Plagiostoma_robergeanum_AR3982 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTGCTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTATATGAAGCGATGCGTCAGCGAGGGCAAGCACTTCGATCTCGCCCTGGGTATTCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGTAGCTCCACCGCCGGTGTCTCTCAGGTGCTCAACCGGTACACATTTTCGTCGACTCTTTCTCATTTGCGGCGCACCAACACACCCATTGGACGTGATGGCAAGTTGGCCAAGCCTCGTCAGCTTCACAACACTCACTGGGGTCTTGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGTGGCCTCGTCAAGAACCTATCTCTCATGTGCTATGTGAGTGTGGGATCGCCTGCCGAGCCCATCAAAGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTACGAGCCTGGCTCTAGCCCCGA Pleurocera_soregonense_AR4333 ATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCCGTCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACACGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACCTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGCTGTCCGGATTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTTGACCTCGCCTTAGGCATCCGCCACTCGACCCTAACGAATGGTCTGAAATACTCGCTGGCTACGGGAAACTGGGGCGAACAGAAGAAGGCGAGCAGCTCTACTGCAGGTGTCTCCCAGGTTCTGAATCGCTACACATTTTCATCGACACTTTCTCACTTGCGGCGTACAAACACGCCCATCGGACGAGATGGCAAGCTGGCCAAGCCACGTCAGCTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAGACACCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGCTATGTCAGCGTGGGCTCGCCTGCCGAGCCTATCAAAGAGTTCATGGTACAGCGCAACATGGAGTTGCTCGAGGAATACGAGCCTGGCTCTAGTCCCGA 'Pleurocera spleurostylum CBS906_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCCGTCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACCTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGCTGTCTGGATTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTTGACCTCGCCTTGGGCATCCGCCACTCGACCCTAACGAATGGTCTGAAATACTCGCTGGCTACGGGAAACTGGGGCGAACAGAAGAAGGCGAGCAGCTCTACTGCAGGTGTCTCCCAGGTTCTGAATCGCTACACATTTTCATCGACACTTTCTCACTTGCGGCGTACAAACACGCCTATCGGACGAGATGGCAAGCTGGCCAAGCCGCGTCAGCTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAGACACCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGCTATGTCAGCGTGGGCTCGCCTGCCGAGCCTATCAAAGAGTTCATGGTACAGCGCAATATGGAGTTGCTCGAGGAATACGAGCCTGGCTCTAGCCCCGA Pleurocera_stenellum_AR4159 ATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACTTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGTTGTCCGGCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTGCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACGCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGCGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGTTCAGGCCAACATCGGTTTTCGTCGGAGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTCAGCGAAGGCAAGCACTTTGATCTCGCACTGGGCATTCGCCACTCTACCCTGACGAATGGCCTCAAGTACTCTCTTGCTACAGGAAACTGGGGTGAGCAGAAGAAAGCCAGCAGCTCCACTGCCGGTGTCTCCCAGGTGCTGAACCGTTACACCTTTTCATCAACACTTTCTCACTTGCGGCGAACAAACACACCAATCGGGCGCGATGGCAAGCTGGCTAAACCTCGCCAGCTGCACAACACGCACTGGGGTCTCGTGTGCCCCGCAGAGACACCCGAAGGCCAAGCTTGTGGTCTTGTCAAAAATCTGTCGCTCATGTGCTACGTCAGTGTGGGCTCGCCTGCCGAGCCGATCAAGGAGTTCATGGTGCAGCGGAACATGGAGTTGCTCGAAGAGTACGAGCCAGGCTCCAGTCCTGA 'Tenuignomonia styracis DMW320_2' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCTCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis DMW329_2' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCGCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis DMW411_3' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCGCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA Tenuignomonia_styracis_HM16001C ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTC------------------------------------------------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA-------------------------------------------------------------------------------------------------------------------------------GCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCTCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA Tenuignomonia_styracis_HM16002C ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGAC---------------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC-GGGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis HM16003C_ef' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACA-----------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA ; END; BEGIN TREES; TITLE Tenuignomonia; LINK TAXA = Taxa1; TRANSLATE 1 Plagiostoma_fraxini_AR2789, 2 Ditopella_ditopa_AR3423, 3 Melanconis_marginalis_AR3442, 4 Cryphonectria_nitschkei_AR3466, 5 Melanconis_stilbostoma_AR3501, 6 Cryptosporella_wehmeyeriana_AR3806, 7 Plagiostoma_petiolophilum_AR3821, 8 Plagiostoma_devexum_AR3838, 9 Gnomoniopsis_macounii_AR3866, 10 Cryptosporella_confusa_AR3966, 11 Plagiostoma_robergeanum_AR3982, 12 Ambarignomonia_petiolorum_AR4082, 13 Pleurocera_stenellum_AR4159, 14 Gnomonia_pseudoamoena_AR4318, 15 Pleurocera_soregonense_AR4333, 16 Ophiognomonia_rosae_AR4382, 17 Cryphonectria_cubensis_CBS101281, 18 Cryptosporella_hypodermia_CBS109753, 19 Discula_destructiva_CBS109771, 20 Amphiporthe_hranicensis_CBS119289, 21 Cryptosporella_suffusa_CBS121077, 22 'Gnomonia gnomon CBS199_53', 23 'Gnomonia fructicola CBS208_34', 24 'Ophiognomonia alniviridis CBS782_79', 25 'Apiognomonia borealis CBS799_79', 26 'Gnomoniopsis comari CBS806_79', 27 'Gnomonia ischnostyla CBS837_79', 28 'Ophiognomonia padicola CBS845_79', 29 'Apiognomonia veneta CBS897_79', 30 'Pleurocera spleurostylum CBS906_79', 31 'Apiognomonia hystrix CBS911_79', 32 'Tenuignomonia styracis DMW320_2', 33 'Tenuignomonia styracis DMW329_2', 34 'Tenuignomonia styracis DMW411_3', 35 Tenuignomonia_styracis_HM16001C, 36 Tenuignomonia_styracis_HM16002C, 37 'Tenuignomonia styracis HM16003C_ef', 38 'Occultocarpon ailaoshanense LCM524_01'; TREE PAUP_1 = [&R] ((4:0.029449,17:0.019746):0.063586,((3:0.013215,5:0.00957):0.010043,((9:0.008077,(23:0.025248,26:0.011952):0.003857):0.020023,((32:0.0,35:0.0,(33:0.0,34:0.0,36:0.0,37:0.0):0.001275):0.043758,((12:0.029555,((19:0.059089,(13:0.03744,(15:0.002013,30:0.003346):0.037346):0.027019):0.005477,(24:0.037028,(27:0.028028,(16:0.007986,28:0.026354):0.017719):0.009185):0.020695):0.001914):0.00445,((38:0.03734,(20:0.011276,(21:0.002693,(18:0.012252,(6:0.004345,10:0.007337):3.31E-4):0.00423):0.017839):0.001595):0.003057,(2:0.037847,((14:0.038838,22:0.009411):0.023897,((25:0.015255,(29:0.025231,31:0.003826):0.007786):0.016919,(11:0.019069,(7:0.010935,(1:0.004907,8:0.008048):0.004846):0.010804):0.006028):0.007053):0.004733):4.72E-4):0.006586):0.001779):0.01854):0.019847):0.063586); END;