#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:58 GMT TreeBASE (cc) 1994-2008 Study reference: Minoshima A., Walker D.M., Takemoto S., Hosoya T., Walker A.K., Ishikawa S., & Hirooka Y. 2018. Pathogenicity and taxonomy of Tenuignomonia styracis gen. et sp. nov, a new monotypic genus of Gnomoniaceae on Styrax obassia in Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22781] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=44; TAXLABELS Ambarignomonia_petiolorum_AR4082 Amphiporthe_hranicensis_CBS119289 'Apiognomonia borealis CBS799_79' 'Apiognomonia hystrix CBS911_79' 'Apiognomonia veneta CBS897_79' Asteroma_alneum_CBS109840 Cryptosporella_confusa_AR3966 Cryptosporella_hypodermia_CBS109753 Cryptosporella_suffusa_CBS121077 Cryptosporella_wehmeyeriana_AR3806 Disculadestructiva_CBS109771 Ditopella_ditopa_AR3423 Ditopellopsis_CBS121471 'Gnomonia comari CBS806_79' 'Gnomonia fructicola CBS208_34' 'Gnomonia gnomon CBS199_53' 'Gnomonia ischnostyla CBS837_79' Gnomonia_pseudoamoena_AR4318 Gnomoniella_fraxini_AR2789 Gnomoniella_fraxini_AR3999 Gnomoniopsis_macounii_AR3866 Marsupiomyces_epidermoidea_MFLU152921 Marsupiomyces_quercina_MFLU170876 Melanconis_marginalis_AR3442 Melanconis_stilbostoma_AR3501 'Occultocarpon ailaoshanense LCM524_01' Ophiognomonia_AR4382 'Ophiognomonia alniviridis CBS782_79' 'Ophiognomonia padicola CBS845_79' Phragmoporthe_conformis_MFLUCC140567 Plagiostoma_devexum_AR3838 Plagiostoma_petiolophilum_AR3821 Plagiostoma_robergeanum_AR3982 Pleurocera_soregonense_AR4333 'Pleurocera spleurostylum CBS906_79' Pleurocera_stenellum_AR4159 Sirococcustsugae_CBS119626 'Tenuignomonia styracis DMW320_2' 'Tenuignomonia styracis DMW329_2' 'Tenuignomonia styracis DMW411_3' Tenuignomonia_styracis_HM16001C Tenuignomonia_styracis_HM16002C Tenuignomonia_styracis_HM16003C Valsalnicola_oxystoma_AR4833 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46496] TITLE Gnomoniaceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=763; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ambarignomonia_petiolorum_AR4082 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Amphiporthe_hranicensis_CBS119289 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Apiognomonia borealis CBS799_79' TAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTGGCTCTCCTTCGGGGGAGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Apiognomonia hystrix CBS911_79' CAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTCTGTCGGGGGATAAGAACAGTAGGAACGTAGCTCTCCTTCGGGAGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Apiognomonia veneta CBS897_79' CAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTTGTCGGAGGATAAGAATAGTAGGAACGTAGCTCTTCCTCGGAAGAGTGTTATAGCCTATTATACGATACTTTGATAGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Asteroma_alneum_CBS109840 TAGAGGAAGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTT-------------------------- Cryptosporella_confusa_AR3966 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Cryptosporella_hypodermia_CBS109753 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAGCCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Cryptosporella_suffusa_CBS121077 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGT{AT}AAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Cryptosporella_wehmeyeriana_AR3806 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACCGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Disculadestructiva_CBS109771 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTCGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTACTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Ditopella_ditopa_AR3423 CAGAGGATGTTTATGGTGCGGTGCCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGACACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTGTCGTTGGGGGATAAGAACAGTACGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGCGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Ditopellopsis_CBS121471 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTT--GGGGGGTGTTATAGCCTACTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Gnomonia comari CBS806_79' CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTTTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Gnomonia fructicola CBS208_34' CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGCAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Gnomonia gnomon CBS199_53' CAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAACGTAGCTCTCTTC--GGAGAGTGTTATAGCCTATTGTACGATACCCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Gnomonia ischnostyla CBS837_79' CAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAATAGTAGGAACGTAGCTTTCTTC--GGAGAGTGTTATAGCCTATTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTACCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGACGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Gnomonia_pseudoamoena_AR4318 CAGAGGATGTTTATGGTGCGGTACCAACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCTGTGTGGCTCATCCGAGGTTCTCCTCGGTGCACTCCATGCAGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCTATTATACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Gnomoniella_fraxini_AR2789 TAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Gnomoniella_fraxini_AR3999 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Gnomoniopsis_macounii_AR3866 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Marsupiomyces_epidermoidea_MFLU152921 CAGAGGATGTTTATGGTGAGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGAATGAGAGCCCCGTCTGGTTGGATACCAAGCCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTGGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGTGGTTCTCCACGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTCGCCGGGGGATAAGAACAGCAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTGCTGTACGATACTCTGGTGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTGTGGGTGTCAAACCCGCACAAGTAAAGAAAGTG-AAATTGGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGTTTTAACGGAGGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGG-------------- Marsupiomyces_quercina_MFLU170876 CAGAGGATGTTTATGGTGAGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAGCCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGTGGTTCTCCACGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTCGCCGGGGGATAAGAACAGCAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTGCTGTACGATACTCTGGTGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Melanconis_marginalis_AR3442 CAGAGGATGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTATGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCATACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Melanconis_stilbostoma_AR3501 CAGAGGAAGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTGTGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATGGGGGCGAAAGACTAATCGA 'Occultocarpon ailaoshanense LCM524_01' CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGACTCAGGCCAACATCGGTTTTCGTCGGAGGAGAAGAATGCCAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTAGTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Ophiognomonia_AR4382 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Ophiognomonia alniviridis CBS782_79' TAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGTGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Ophiognomonia padicola CBS845_79' CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTCCAGGCCAGCATCGGTTTTCGCCGGGGGATAAGAACGGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTACCGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCATGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Phragmoporthe_conformis_MFLUCC140567 CAGAGGATGTTTATGGTGCGGTGCCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGACACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTGTCGTTGGGGGATAAGAACAGTAGGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGCGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCA--------------------- Plagiostoma_devexum_AR3838 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATATCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Plagiostoma_petiolophilum_AR3821 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTTTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGTTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TTGAGCATGGGGGCGAAAGACTAATCGA Plagiostoma_robergeanum_AR3982 CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTGCTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Pleurocera_soregonense_AR4333 CAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Pleurocera spleurostylum CBS906_79' CAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Pleurocera_stenellum_AR4159 CAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGCGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGTTCAGGCCAACATCGGTTTTCGTCGGAGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Sirococcustsugae_CBS119626 CAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTTAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Tenuignomonia styracis DMW320_2' CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Tenuignomonia styracis DMW329_2' CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA 'Tenuignomonia styracis DMW411_3' CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Tenuignomonia_styracis_HM16001C CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Tenuignomonia_styracis_HM16002C CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC-GGGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Tenuignomonia_styracis_HM16003C CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA Valsalnicola_oxystoma_AR4833 CAGAGGATGTATTTGGTGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCTTGTGTAATACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTATGGCTCATCCGAGGTTTTCCCCGGTGCACTCCATGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGAGAAGAACAGTAGGAACGTGGCTCTT--------GAGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTGTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA ; END; BEGIN TREES; TITLE Gnomoniaceae; LINK TAXA = Taxa1; TRANSLATE 1 Gnomoniella_fraxini_AR2789, 2 Gnomoniella_fraxini_AR3999, 3 Plagiostoma_devexum_AR3838, 4 Plagiostoma_robergeanum_AR3982, 5 'Apiognomonia borealis CBS799_79', 6 Cryptosporella_wehmeyeriana_AR3806, 7 Cryptosporella_confusa_AR3966, 8 Cryptosporella_hypodermia_CBS109753, 9 Cryptosporella_suffusa_CBS121077, 10 Ambarignomonia_petiolorum_AR4082, 11 Disculadestructiva_CBS109771, 12 Ditopellopsis_CBS121471, 13 Sirococcustsugae_CBS119626, 14 Plagiostoma_petiolophilum_AR3821, 15 Amphiporthe_hranicensis_CBS119289, 16 Gnomoniopsis_macounii_AR3866, 17 'Gnomonia comari CBS806_79', 18 'Gnomonia fructicola CBS208_34', 19 Ophiognomonia_AR4382, 20 'Ophiognomonia alniviridis CBS782_79', 21 'Ophiognomonia padicola CBS845_79', 22 Pleurocera_stenellum_AR4159, 23 'Tenuignomonia styracis DMW320_2', 24 'Tenuignomonia styracis DMW329_2', 25 'Tenuignomonia styracis DMW411_3', 26 Tenuignomonia_styracis_HM16001C, 27 Tenuignomonia_styracis_HM16003C, 28 Tenuignomonia_styracis_HM16002C, 29 'Apiognomonia veneta CBS897_79', 30 'Apiognomonia hystrix CBS911_79', 31 Pleurocera_soregonense_AR4333, 32 'Pleurocera spleurostylum CBS906_79', 33 'Gnomonia gnomon CBS199_53', 34 Gnomonia_pseudoamoena_AR4318, 35 'Gnomonia ischnostyla CBS837_79', 36 Ditopella_ditopa_AR3423, 37 'Occultocarpon ailaoshanense LCM524_01', 38 Marsupiomyces_quercina_MFLU170876, 39 Melanconis_stilbostoma_AR3501, 40 Melanconis_marginalis_AR3442, 41 Valsalnicola_oxystoma_AR4833, 42 Asteroma_alneum_CBS109840, 43 Phragmoporthe_conformis_MFLUCC140567, 44 Marsupiomyces_epidermoidea_MFLU152921; TREE PAUP_1 = [&R] ((42:0.032764,(43:0.008988,44:0.002218):0.009107):0.011737,(39:0.0,(40:0.0,41:0.019947):0.024357,(38:0.002998,(29:0.001485,30:0.001497,(31:0.009876,(32:0.0,33:0.0,34:0.0,35:0.0,36:0.0,37:0.0):0.003134):0.009986):0.001489,((22:0.004854,23:0.004848):0.001362,(28:0.001519,(24:0.001601,(27:0.001516,(25:0.001712,26:0.004629):0.001422):0.006559):0.00138):0.001526,(21:0.0,(((17:0.0,18:0.016472):0.001376,(19:0.001378,20:0.003242):0.003408):0.008569,(15:0.003363,16:0.024821,(((3:0.001488,(1:0.001471,2:0.0):0.001478):0.001567,(4:0.00557,(5:0.005756,(6:0.016911,7:0.001527):0.009055):0.003099):0.002202):0.00287,(14:0.020618,(13:0.021905,(12:0.006831,((8:0.0,9:0.001484):0.011908,(10:0.001498,11:0.0):0.015453):7.33E-4):0.001917):0.004075):0.002048):0.005124):0.003252):0.002922):0.004554):0.003014):0.001496):0.011737); END;