#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:09 GMT TreeBASE (cc) 1994-2008 Study reference: Minoshima A., Walker D.M., Takemoto S., Hosoya T., Walker A.K., Ishikawa S., & Hirooka Y. 2018. Pathogenicity and taxonomy of Tenuignomonia styracis gen. et sp. nov, a new monotypic genus of Gnomoniaceae on Styrax obassia in Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22792] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=39; TAXLABELS Ambarignomonia_petiolorum_CBS121227 Amphiporthe_hranicensis_CBS119289 'Apiognomonia borealis CBS799_79' 'Apiognomonia hystrix CBS911_79' 'Apiognomonia veneta CBS897_79' Cryphonectria_cubensis_CBS101281 Cryphonectria_nitschkei_CBS109758 Cryptosporella_confusa_CBS121063 Cryptosporella_hypodermia_CBS17169 Cryptosporella_suffusa_CBS121077 Cryptosporella_wehmeyeriana_CBS121085 Discula_destructiva_CBS109771 Ditopella_ditopa_CBS109748 Ditopellopsis_sp_CBS121471 'Gnomonia gnomon CBS199_53' Gnomonia_pseudoamoena_CBS121261 'Gnomoniopsis comari CBS806_79' 'Gnomoniopsis fructicola CBS208_34' Gnomoniopsis_macounii_CBS121468 Melanconis_marginalis_CBS109744 Melanconis_stilbostoma_CBS109778 Occultocarponailaoshanense_CBS129146 'Ophiognomonia alniviridis CBS782_79' 'Ophiognomonia ischnostyla CBS837_79' 'Ophiognomonia padicola CBS845_79' Ophiognomonia_rosae_CBS121267 Plagiostoma_devexum_CBS123201 Plagiostoma_fraxini_CBS109498 Plagiostoma_petiolophilum_AR3821 Plagiostoma_robergeanum_CBS121472 Pleuroceras_oregonense_CBS121260 'Pleuroceras pleurostylum CBS906_79' Pleurocerastenellum_CBS121082 'Tenuignomonia styracis DMW320_2' 'Tenuignomonia styracis DMW329_2' 'Tenuignomonia styracis DMW411_3' Tenuignomonia_styracis_HM16001C Tenuignomonia_styracis_HM16002C 'Tenuignomonia styracis HM16003C_ef' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M46499] TITLE Gnomoniaceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1546; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ambarignomonia_petiolorum_CBS121227 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCTGGTACTGGTGAGTTCGAGGCTGGTATATCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCATGAAAGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTCAGTGAGGGCAAGCACTTTGACCTCGCCCTGGGCATCCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTTGCGACAGGAAATTGGGGCGAGCAGAAGAAGGCGAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTGAATCGGTACACATTCTCGTCCACACTCTCTCACTTGCGGCGCACCAACACTCCAATCGGTCGCGATGGAAAATTGGCCAAGCCCCGTCAGCTGCACAACACGCACTGGGGTCTTGTCTGTCCCGCAGAAACTCCAGAGGGTCAAGCCTGTGGTCTCGTCAAGAACCTTTCGCTCATGTGCTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGTTGCTGGAAGAGTACGAGCCTGGCACCAGTCCCGA Amphiporthe_hranicensis_CBS119289 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCCTGACCAACGGCCTCAAGTACTCTCTTGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACACTTTCTCACTTGCGGCGAACCAACACTCCCATCGGACGTGATGGCAAATTGGCCAAGCCTCGGCAGCTGCACAACACACACTGGGGTCTCGTCTGTCCTGCAGAAACACCTGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTTATGGTGCAGCGGAACATGGAGTTGCTCGAAGAGTATGAACCTGGTTCCAGTCCCGA 'Apiognomonia borealis CBS799_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTTCCCATCTCCGGATTCAACGGCGACAACATGATTGAGGGTGAGACCCTCGACCCCCGTGCCAAGGCTTGGTAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTGGCTCTCCTTCGGGGGAGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGTTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATTCGCCACTCCACTCTGACAAACGGACTCAAGTACTCTCTTGCGACGGGAAATTGGGGTGAGCAAAAGAAAGCCAGCAGCTCCACTGCTGGTGTTTCTCAGGTACTCAACCGGTACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAATACTCCCATCGGACGTGATGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACCCACTGGGGTCTCGTGTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTTGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTGGGTTCGCCTGCTGAGCCCATCAAAGAGTTTATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCCGA 'Apiognomonia hystrix CBS911_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCTGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGATTCAACGGCGACAACATGATTGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTCTGTCGGGGGATAAGAACAGTAGGAACGTAGCTCTCCTTCGGGAGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATCCGCCACTCCACCCTGACAAACGGACTCAAGTACTCTCTTGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAATACTCCCATCGGACGTGACGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACGCACTGGGGTCTCGTGTGTCCTGCAGAAACACCAGAGGGTCAAGCTTGTGGCCTTGTCAAGAATTTATCTCTCATGTGCTACGTCAGTGTGGGTTCGCCTGCCGAGCCCATCAAGGAGTTTATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCCGA 'Apiognomonia veneta CBS897_79' ATCAAGAACATGATCACGGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATCGCCTCCGGCACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACCGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCGGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGATTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTTGTCGGAGGATAAGAATAGTAGGAACGTAGCTCTTCCTCGGAAGAGTGTTATAGCCTATTATACGATACTTTGATAGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTCTGGGAATTCGCCACTCCACTCTGACAAACGGACTCAAGTATTCTCTTGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACTGCGGGTGTCTCCCAGGTTCTCAACCGCTACACATTCTCGTCAACTCTTTCTCACTTGCGGCGCACCAACACTCCCATCGGACGTGACGGCAAGCTGGCCAAGCCTCGTCAACTCCACAACACGCACTGGGGCCTCGTGTGTCCTGCAGAAACACCAGAGGGTCAAGCTTGTGGCCTTGTCAAGAATTTGTCGCTCATGTGCTACGTCAGCGTGGGTTCGCCTGCAGAGCCCATCAAGGAGTTTATGGTACAGCGTAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCTAGCCCTGA Cryphonectria_cubensis_CBS101281 ------------------------------------TGCGCTATCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGGAGGCCCGTTTCGAGGAGATCAAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCTTTCGTCCCTATCTCCGGCTTCAACGGCGACAACATGATTGAGAAGGAGTCCCTCGACAAGCGTGCC---TCTTGGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACTAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCCGTACGATACCCTGACGGGGACCGAGGTTCGCGCTCC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGCGTCAGCGAGGGCAAGCATTTCGACCTCGCGTTAGGCATCCGCCACTCTACCCTTACAAATGGCCTCAAGTATTCCTTGGCAACTGGCAACTGGGGTGAGCAGAAGAAGGCCATGAGCTCCACTGCTGGTGTTTCTCAGGTTCTGAACCGATACACTTTTGCCTCTACACTGTCTCACTTGCGGCGCACAAACACTCCTATTGGACGTGATGGCAAGTTGGCCAAGCCTCGCCAACTGCACAACACTCACTGGGGTTTGGTCTGTCCCGCAGAGACTCCTGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTATCGCTCATGTGCTACGTCAGTGTCGGATCACCAGCGGAGCCTATCAAGGACTTCATGGTGCAACGCAATATGGAAGTGTTGGAGGAATACGAGCCTGGCGCCAGCCCTGA Cryphonectria_nitschkei_CBS109758 ------------------------------------------GTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTTAGGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCTGAGTGGAAGGAGGCCCGTTTCGAGGAGATCAAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGAAGGAGTCTCTGGACAAGCGTGCC---TCTTGGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGTTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCCGTACGATACCCTGACGGGGACCGAGGTTCGCGCTCC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTGCGTTGGGCATCCGCCACTCCACACTCACAAACGGTCTCAAATACTCCCTTGCGACCGG-AACTGGGGTGAGCAGAA-AAGGCTATGAGTTCTACGGCTGGTGTTTCTCAGGTTCTGAACCGATACACCTTCGCCTCGACACTGTCTCACTTGCGACGCACAAACACTCCCATTGGGCGTGATGGTAAGCTGGCGAAGCCTCGCCAGCTGCACAATACCCACTGGGGCTTGGTCTGTCCTGCAGAGACCCCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAATCTGTCGCTTATGTGCTACGTCAGTGTCGGATCCCCAGCGGAGCCTATCAAGGACTTCATGGTCCAACGCAACATGGAAGTGCTGGAGGAATACGAGCCCGGCGCCAGCCCTGA Cryptosporella_confusa_CBS121063 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTTATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTACTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTAGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACGGCTGGTGTTTCACAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGCCGCACCAATACTCCCATCGGCCGCGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAACGTAACATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAACCCTGA Cryptosporella_hypodermia_CBS17169 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTTGGCTACAACCCCAAGACTGTCGCCTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGCGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAGCCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGAAAGCACTTCGATCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGTTCCACCGCTGGTGTCTCACAGGTGCTCAACCGGTACACCTTCTCGTCAACCCTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGCGATGGTAAACTAGCCAAGCCTCGTCAGCTCCACAACACCCATTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGGTCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAACATGGAGTTGCTCGAGGAGTATGAGCCTGGCTCCAACCCAGA Cryptosporella_suffusa_CBS121077 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGT{AT}AAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCGACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCACAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGTGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACTCATTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAATATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAATCCTGA Cryptosporella_wehmeyeriana_CBS121085 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTCCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCTCGTTTCGACGAGATCCAGAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACCGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCTTGACCAACGGTCTCAAGTACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCTACCGCAGGTGTCTCGCAGGTGCTCAACCGTTACACCTTCTCGTCAACACTCTCTCACTTGCGGCGCACCAACACTCCCATCGGACGCGATGGTAAACTGGCCAAACCTCGTCAGCTCCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTACGTTAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAATTCATGGTGCAGCGTAACATGGAGTTGCTTGAGGAGTACGAGCCTGGCTCCAACCCTGA Discula_destructiva_CBS109771 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGTCTCGTTACGACGAGATCAAGGGTGAGACCGAGAAGTTCATCAAGAAGGTCGGCTACAACCCCGCCACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGTCTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTCGGGGGATAAGAACAGTAGGAACGTGGCCCCCCTC--GGGGGGTGTTATAGCCTACTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGTGTTAGCGAAGGCAAGCATTTTGACCTTGCCTTGGGCATTCGCCACTCTACCCTGACGAACGGCCTCAAGTACTCTCTCGCCACAGGAAACTGGGGCGAGCAGAAGAAAGCAAGCAGCTCGACCGCTGGCGTATCCCAGGTGCTCAACCGGTACACATTCTCATCAACACTTTCCCATTTGCGACGCACCAACACCCCCATCGGTCGTGATGGCAAGCTTGCCAAGCCTCGTCAGCTCCACAACACACACTGGGGCCTTGTCTGTCCAGCAGAAACACCCGAGGGACAAGCCTGTGGCCTCGTCAAAAATCTGTCGCTTATGTGTTATGTCAGCGTGGGGTCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAGTACGAGCCGGGTTCAAGCCCCGA Ditopella_ditopa_CBS109748 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTGCCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGACACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTGTCGTTGGGGGATAAGAACAGTACGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGATGGCGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCCTACATGAAGCGGTGCGTGAGCGAAGGGAAGCATTTCGACCTGGCCCTGGGTATCCGCCACTCTACCCTGACGAACGGCCTCAAGTACTCCCTTGCGACGGGAAACTGGGGCGAGCAGAAAAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACGCTTTCTCATTTGCGTCGTACCAACACTCCCATTGGACGTGATGGCAAACTGGCCAAGCCCCGCCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCCGAAACGCCCGAGGGTCAAGCTTGTGGCCTCGTCAAGAATCTGTCACTTATGTGTTACGTCAGTGTGGGTTCGCCTGCAGAGCCCATCAAGGAGTTCATGGTGCAGCGGAACATGGAGTTGCTTGAAGAGTACGAGCCTGGCTCCAGTCCCGA Ditopellopsis_sp_CBS121471 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATTCAAAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTCGTCCCCATTTCTGGCTTCAACGGCGACAACATGATCGAGGGCGAGTCTCTCGATCCCCGAGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTT--GGGGGGTGTTATAGCCTACTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTATATGAAGCGGTGCGTCAGCGAGGGCAAGCATTTTGACCTCGCCTTAGGCATTCGTCACTCTACACTCACGAACGGTCTTAAGTATTCGCTCGCAACAGGAAACTGGGGCGAACAGAAGAAGGCGAGCAGCTCCACGGCTGGTGTCTCTCAGGTGCTCAACCGATACACGTTCTCGTCCACGCTTTCTCACTTGCGGCGTACCAATACTCCGATAGGCCGTGATGGCAAACTGGCCAAGCCTCGCCAACTGCACAACACTCACTGGGGTCTCGTCTGCCCTGCAGAAACCCCCGAGGGCCAAGCTTGTGGCCTCGTAAAGAACCTGTCGCTCATGTGTTATGTCAGCGTGGGATCCCCTGCCGAACCTATCAAGGAATTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTATGAGCCCGGTTCCAGTCCTGA 'Gnomonia gnomon CBS199_53' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGTCCGACACCCTCGACCCCCGTGGCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAACGTAGCTCTCTTC--GGAGAGTGTTATAGCCTATTGTACGATACCCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATATATGAAGCGTTGTGTCAGCGAGGGCAAGCACTTCGACCTCGCGTTGGGCATTCGCCACTCTACCCTGACAAACGGTCTCAAGTACTCTCTTGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACCGCTGGTGTCTCCCAGGTGCTCAACCGATACACTTTCTCGTCGACACTTTCTCACTTGCGGCGAACTAACACTCCAATCGGACGTGATGGCAAACTGGCCAAGCCTCGTCAGCTGCACAACACTCACTGGGGTCTCGTCTGTCCCGCAGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTGTCTCTCATGTGTTACGTCAGTGTGGGTTCCCCTGCCGAGCCTATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAATACGAGCCTGGCTCGAGTCCCGA Gnomonia_pseudoamoena_CBS121261 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCTTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTTGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGTCCGACACCCTCGACCCCCGCGGCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCAACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCTGTGTGGCTCATCCGAGGTTCTCCTCGGTGCACTCCATGCAGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCTATTATACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTTAGCGAGGGGAAGCACTTTGACCTTGCGCTGGGTATCCGCCACTCAACCCTGACCAACGGTCTCAAGTACTCTCTTGCAACAGGAAATTGGGGTGAGCAGAAGAAGGCCAGCAGCTCCACCGCGGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCGTCAACGCTTTCTCACTTGCGGCGAACCAACACTCCAATCGGACGCGATGGAAAATTGGCCAAGCCTCGTCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGCGGTCTCGTCAAGAACCTGTCTCTCATGTGTTATGTTAGCGTAGGTTCGCCTGCCGAGCCTATCAAGGAATTCATGGTACAGCGGAACATGGAGTTGCTCGAAGAATATGAGCCCGGCTCGAGTCCCGA 'Gnomoniopsis comari CBS806_79' ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCGGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTTTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGTTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGTATCCGTCACTCTACACTTACGAATGGTCTCAAGTACTCGCTTGCAACAGGAAACTGGGGCGAGCAAAAGAAGGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACCGATACACGTTCTCGTCCACACTTTCTCACTTGCGGCGCACCAACACGCCAATAGGCCGTGATGGCAAACTCGCGAAGCCCCGTCAATTGCACAACACGCACTGGGGTCTTGTCTGCCCTGCAGAAACCCCCGAGGGCCAAGCTTGTGGCCTCGTCAAAAACCTGTCCCTCATGTGTTACGTCAGTGTGGGTTCCCCTGCCGAGCCTATCAAGGAGTTCATGGTGCAACGCAACATGGAGTTGCTCGAAGAGTATGAACCCGGCTCTAGTCCCGA 'Gnomoniopsis fructicola CBS208_34' ATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGGGTGAGTCCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGCAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGAATCCGCCACTCCACACTCACCAATGGTCTCAAGTACTCGCTTGCAACAGGAAACTGGGGCGAGCAAAAGAAAGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACAGATACACATTCTCGTCCACGCTTTCTCACTTGCGGCGCACCAACACGCCAATAGGTCGTGATGGCAAATTGGCGAAGCCTCGTCAGTTGCACAACACCCACTGGGGTCTTGTCTGCCCTGCGGAAACCCCCGAAGGCCAAGCTTGTGGCCTTGTGAAAAACCTTTCTCTCATGTGTTATGTCAGTGTGGGATCCCCTGCGGAACCTATCAAGGAGTTCATGGTTCAGCGCAACATGGAGTTGCTCGAAGAGTACGAACCAGGGTCTAGTCCCGA Gnomoniopsis_macounii_CBS121468 ATCAAGAACATGATCACTGGTACCTCTCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGTGACAACATGATCGAGGGCGAGTCTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTAAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTGCTGTACGATACCCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGTGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGTATCCGCCACTCTACACTCACGAACGGTCTCAAGTACTCGCTTGCCACAGGAAATTGGGGCGAGCAAAAGAAGGCGAGCAGCTCTACGGCTGGTGTCTCTCAGGTGCTCAACCGATACACATTCTCGTCCACGCTTTCTCACTTGCGGCGCACCAACACTCCAATAGGCCGTGATGGCAAATTGGCGAAGCCTCGTCAATTGCACAACACGCACTGGGGTCTTGTCTGCCCTGCAGAAACCCCCGAGGGCCAAGCTTGTGGTCTCGTCAAGAACCTATCGCTCATGTGTTACGTCAGTGTGGGATCCCCTGCCGAACCTATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTATGAACCCGGTTCCAGTCCCGA Melanconis_marginalis_CBS109744 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAAATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGGCAAGGCCTGGCAGAGGATGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTATGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCATACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGCGTCAGCGAGGGCAAACATTTCGATCTAGCCTTGGGTATTCGCCACTCTACCCTCACGAACGGTCTGAAGTACTCTCTTGCAACCGGGAACTGGGGCGAGCAGAAGAAAGCTAGTAGCTCTACGGCTGGTGTGTCTCAGGTGCTCAACCGATACACATTCTCGTCCACGCTCTCTCATTTGCGGCGCACCAACACTCCAATTGGACGTGATGGCAAATTGGCCAAGCCTCGCCAGCTGCACAACACGCATTGGGGACTCGTCTGCCCTGCAGAAACACCCGAAGGTCAAGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGTTATGTCAGTGTCGGCTCCCCTGCCGAACCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAATACGAGCCTGGCACCAGCCCCGA Melanconis_stilbostoma_CBS109778 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTTGCAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGGCAAGGCCTGGCAGAGGAAGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTGTGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGATGTGTCAGCGAGGGCAAGCACTTCGATCTCGCCTTGGGTATTCGCCACTCTACCCTCACAAACGGTCTCAAGTACTCCCTTGCAACTGGAAACTGGGGCGAGCAAAAGAAGGCTAGCAGCTCTACGGCAGGTGTGTCTCAGGTGCTCAACCGATACACATTCTCGTCCACTCTTTCTCATTTGCGCCGCACCAACACTCCGATTGGACGTGATGGCAAATTGGCCAAGCCTCGCCAGCTGCACAACACGCATTGGGGTCTCGTCTGCCCCGCAGAAACCCCCGAAGGTCAAGCTTGTGGTCTCGTCAAGAACCTGTCGCTCATGTGTTATGTCAGTGTCGGTTCCCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTCGAGGAATACGAGCCTGGCACCAGCCCCGA Occultocarponailaoshanense_CBS129146 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATGAACAAGATGGACATCGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCTAAGACCGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGGTCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGACTCAGGCCAACATCGGTTTTCGTCGGAGGAGAAGAATGCCAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTAGTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTCGACCTCGCCTTGGGCATTCGCCACTCTACCCTGACGAACGGTCTGAAGTATTCTCTTGCGACAGGAAACTGGGGCGAGCAGAAAAAAGCCAGTAGTTCCACTGCCGGTGTCTCCCAGGTGCTCAATCGATACACCTTCTCGTCAACTCTGTCTCATTTGCGTCGCACCAACACTCCCATCGGACGCGATGGCAAGTTGGCCAAGCCTCGTCAGCTGCACAACACCCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCTTGCGGTCTCGTCAAGAACCTATCGCTCATGTGCTATGTCAGTGTGGGGTCGCCTGCCGAACCCATCAAGGAATTCATGGTGCAGCGCAACATGGAGCTGCTCGAAGAGTACGAGCCTGGCTCCAGTCCTGA 'Ophiognomonia alniviridis CBS782_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCTTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGACATTGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCAAGAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCTCGTCCCCTTCGTCCCGATCTCCGGCTTCAACGGCGACAACATGATTGAGAGTGACAGTCTCGACCCCCGCGGCAAGGCCTGGTAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGTGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGCTGCGTTAGCGAGGGCAAGCATTTCGACCTTGCTTTGGGCATCCGTCACTCCACCCTGACGAATGGTCTCAAGTACTCCCTCGCCACTGGCAATTGGGGCGAACAGAAGAAAGCTAGTAGCTCGACCGCTGGTGTCTCCCAAGTGCTCAACCGATACACATTCTCGTCCACCCTCTCTCACTTGCGGCGCACCAACACGCCCATCGGGCGGGATGGCAAGTTGGCCAAGCCCCGCCAACTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAAACACCCGAGGGTCAAGCATGTGGTCTCGTCAAGAATCTGTCACTCATGTGCTACGTCAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGTTGCTTGAAGAGTATGAGCCTGGCTCCAGTCCAGA 'Ophiognomonia ischnostyla CBS837_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCATCGCTATGAACAAGATGGACATCGCCGAGTGGAAGCAGGCCCGTTACGAGGAGATCAAGAAGGAGACCTCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGGTCGTTCCCTTCGTTCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAATAGTAGGAACGTAGCTTTCTTC--GGAGAGTGTTATAGCCTATTATACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTACCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGACGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGCGTTAGCGAGGGCAAGCACTTCGACCTCGCCCTGGGCATCCGCCACTCTACCCTGACCAACGGTCTCAAGTACTCTCTTGCCACTGGCAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCTACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTCTCGTCCACCCTCTCTCATTTACGTCGCACCAACACGCCCATCGGACGTGATGGCAAATTGGCCAAGCCCCGTCAACTGCACAATACGCACTGGGGTCTCGTCTGTCCAGCAGAGACACCCGAGGGGCAAGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTTGAAGAGTACGAGCCCGGCTCTAGTCCGGA 'Ophiognomonia padicola CBS845_79' ATCAAGAACATGATCACTGGCACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCACTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGATATCGCGGAGTGGAAGGAGGAGCGCTACAAGGAGATCCAGAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGGTTGTTCCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGATCGAGAGCGAGTCTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGTCCAGGCCAGCATCGGTTTTCGCCGGGGGATAAGAACGGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTACCGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCATGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCCTACATGAAGCGGTGCGTTAGCGAGGGCAAGCACTTTGACCTGGCTTTGGGCATTCGTCACTCTACCCTGACCAACGGCCTCAAGTACTCTCTCGCCACTGGCAACTGGGGCGAGCAGAAGAAAGCCAGCAGCTCCACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTTTCGTCTACCCTGTCTCATTTGCGTCGCACCAACACGCCCATTGGACGTGATGGCAAACTGGCCAAGCCTCGTCAGCTGCACAACACTCATTGGGGTCTCGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGTGGTCTAGTCAAAAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCGCCTGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAACATGGAGCTGCTTGAAGAGTATGAACCCGGCTCTAGTCCGGA Ophiognomonia_rosae_CBS121267 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCATCGCCATGAACAAGATGGACATCGCTGAGTGGAAGGAGGACCGTTACAAGGAGATCATGAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGGTTGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGCGAGACTCTCGACCCCCGTGCCAAGTCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGCTGGGGGATAAGAACAGTAGGAACGTAGCTCCCCTC--GGGGAGTGTTATAGCCTATTGTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTGGCCTTGGGCATCCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTTGCCACTGGCAACTGGGGCGAACAGAAGAAAGCCAGCAGCTCCACTGCTGGTGTCTCGCAGGTGCTGAACCGATACACCTTCTCGTCCACCCTGTCTCATTTGCGCCGCACCAATACGCCCATCGGACGTGATGGCAAATTGGCCAAGCCCCGTCAGCTGCACAACACTCATTGGGGTCTTGTCTGTCCTGCAGAAACGCCGGAAGGTCAAGCTTGTGGTCTGGTCAAAAACCTGTCGCTCATGTGTTACGTCAGTGTGGGATCCCCTGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAACATGGAGCTGCTTGAAGAGTATGAGCCCGGCTCTAGTCCGGA Plagiostoma_devexum_CBS123201 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATATCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTG-TTTGGGCATTCGCCATTCCACCTTGACGAACGGCCTCAAATATTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCTTCAACACTTTCTCATTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACTCATTGGGGTCTTGTCTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTGGTCAAGAACTTATCACTCATGTGCTACGTGAGTGTGGGGTCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAATATGGAGCTGCTTGAAGAGTATGAGCCTGGATCTAGCCCTGA Plagiostoma_fraxini_CBS109498 ATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGTAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATTGTACGATACTCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTTGCTTTGGGCATTCGCCATTCCACCCTGACGAATGGTCTCAAATACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCCCAGGTGCTCAACCGATACACATTCTCTTCAACACTCTCTCACTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACTCATTGGGGTCTTGTTTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTTGTCAAGAACTTATCGCTCATGTGCTACGTGAGTGTGGGATCGCCTGCCGAGCCCATCAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTATGAGCCTGGCTCTAGCCCCGA Plagiostoma_petiolophilum_AR3821 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTTGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTTTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGTTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TTGAGCATGGGGGCGAAAGACTAATCGAGGCTTACATGAAGCGGTGCGTCAGCGAGGGCAAGCACTTTGACCTCGCTTTGGGCATTCGCCATTCTACCCTGACGAACGGTCTCAAATATTCTCTTGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGCAGCTCCACTGCTGGTGTCTCTCAGGTGCTCAACCGATACACATTCTCTTCAACGCTTTCTCACTTGCGGCGCACCAACACACCCATTGGACGTGACGGCAAGTTGGCCAAGCCTCGCCAGCTCCACAACACGCACTGGGGTCTTGTCTGTCCTGCAGAGACACCAGAGGGTCAAGCTTGTGGTCTGGTCAAGAATCTATCGCTCATGTGCTACGTGAGTGTGGGATCGCCTGCCGAGCCCATTAAGGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTATGAGCCTGGCTCTAGCCCCGA Plagiostoma_robergeanum_CBS121472 ATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCGTTCTCATCATTGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGACGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTGCTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTATATGAAGCGATGCGTCAGCGAGGGCAAGCACTTCGATCTCGCCCTGGGTATTCGCCACTCTACCCTGACGAACGGTCTCAAGTACTCTCTCGCAACAGGAAACTGGGGCGAGCAGAAGAAAGCTAGTAGCTCCACCGCCGGTGTCTCTCAGGTGCTCAACCGGTACACATTTTCGTCGACTCTTTCTCATTTGCGGCGCACCAACACACCCATTGGACGTGATGGCAAGTTGGCCAAGCCTCGTCAGCTTCACAACACTCACTGGGGTCTTGTCTGTCCTGCAGAAACGCCCGAGGGTCAAGCTTGTGGCCTCGTCAAGAACCTATCTCTCATGTGCTATGTGAGTGTGGGATCGCCTGCCGAGCCCATCAAAGAGTTCATGGTGCAGCGCAACATGGAGCTGCTTGAAGAGTACGAGCCTGGCTCTAGCCCCGA Pleuroceras_oregonense_CBS121260 ATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCCGTCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACACGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACCTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGCTGTCCGGATTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTTGACCTCGCCTTAGGCATCCGCCACTCGACCCTAACGAATGGTCTGAAATACTCGCTGGCTACGGGAAACTGGGGCGAACAGAAGAAGGCGAGCAGCTCTACTGCAGGTGTCTCCCAGGTTCTGAATCGCTACACATTTTCATCGACACTTTCTCACTTGCGGCGTACAAACACGCCCATCGGACGAGATGGCAAGCTGGCCAAGCCACGTCAGCTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAGACACCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGCTATGTCAGCGTGGGCTCGCCTGCCGAGCCTATCAAAGAGTTCATGGTACAGCGCAACATGGAGTTGCTCGAGGAATACGAGCCTGGCTCTAGTCCCGA 'Pleuroceras pleurostylum CBS906_79' ATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCCGTCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACCTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGCTGTCTGGATTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTTCCCATCTCCGGTTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACCCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTTC--GGAGGGTGTTATAGCCTATTGTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTA-AAA-TAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCGTACATGAAGCGGTGCGTCAGCGAAGGCAAGCACTTTGACCTCGCCTTGGGCATCCGCCACTCGACCCTAACGAATGGTCTGAAATACTCGCTGGCTACGGGAAACTGGGGCGAACAGAAGAAGGCGAGCAGCTCTACTGCAGGTGTCTCCCAGGTTCTGAATCGCTACACATTTTCATCGACACTTTCTCACTTGCGGCGTACAAACACGCCTATCGGACGAGATGGCAAGCTGGCCAAGCCGCGTCAGCTGCACAACACGCACTGGGGTCTCGTCTGTCCTGCAGAGACACCCGAGGGTCAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTCATGTGCTATGTCAGCGTGGGCTCGCCTGCCGAGCCTATCAAAGAGTTCATGGTACAGCGCAATATGGAGTTGCTCGAGGAATACGAGCCTGGCTCTAGCCCCGA Pleurocerastenellum_CBS121082 ATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCCGTTCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTCGCCATGAACAAGATGGACTTGGTTGAGTGGAAGCAGTCCCGTTACGAGGAGATCCAGAAGGAGTTGTCCGGCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTGCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACCCTTGACGCCCGCGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGCGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGTTCAGGCCAACATCGGTTTTCGTCGGAGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGCTGTGTCAGCGAAGGCAAGCACTTTGATCTCGCACTGGGCATTCGCCACTCTACCCTGACGAATGGCCTCAAGTACTCTCTTGCTACAGGAAACTGGGGTGAGCAGAAGAAAGCCAGCAGCTCCACTGCCGGTGTCTCCCAGGTGCTGAACCGTTACACCTTTTCATCAACACTTTCTCACTTGCGGCGAACAAACACACCAATCGGGCGCGATGGCAAGCTGGCTAAACCTCGCCAGCTGCACAACACGCACTGGGGTCTCGTGTGCCCCGCAGAGACACCCGAAGGCCAAGCTTGTGGTCTTGTCAAAAATCTGTCGCTCATGTGCTACGTCAGTGTGGGCTCGCCTGCCGAGCCGATCAAGGAGTTCATGGTGCAGCGGAACATGGAGTTGCTCGAAGAGTACGAGCCAGGCTCCAGTCCTGA 'Tenuignomonia styracis DMW320_2' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCTCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis DMW329_2' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCGCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis DMW411_3' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGGTGAGACTCTCGACCCCCGTGCCAAGGCCTGGCAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAGGCATACATGAAGCGGTGTGTCAGCGAAGGCAAGCACTTCGACCTCGCCTTGGGCATCCGCCACTCTACTCTGACGAACGGCCTGAAGTACTCTCTTGCCACAGGAAATTGGGGCGAGCAGAAGAAAGCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCGCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA Tenuignomonia_styracis_HM16001C ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTC------------------------------------------------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA-------------------------------------------------------------------------------------------------------------------------------GCCAGTAGCTCCACAGCCGGTGTCTCGCAGGTGCTCAACCGATACACGTTCTCGTCCACACTGTCTCACTTGCGGCGTACCAATACTCCCATCGGACGTGATGGCAAGCTCGCCAAACCCCGTCAGCTTCACAACACGCATTGGGGTCTCGTCTGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA Tenuignomonia_styracis_HM16002C ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGAC---------------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC-GGGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCCTGCCGAAACACCCGAGGGCCAAGCTTGTGGTCTCGTCAAAAACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA 'Tenuignomonia styracis HM16003C_ef' ATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTGTTCTCATCATCGCCTCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGCGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTTGCCATGAACAAGATGGACACTGCCGAGTGGAAGCAGGCCCGTTTCGAGGAGATCCAGAAGGAGACCTCCGCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACA-----------------------------------------CAGAGGATGTTTATGGTGCAGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTA-CGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCCTCTC--GGGGGGTGTTATAGCCTATTGTACGATACTCTGACGGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTG-AAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTCTCGCTCATGTGTTACGTCAGTGTGGGATCTCCCGCCGAGCCTATCAAGGAGTTCATGGTACAGCGTAATATGGAGCTTCTCGAAGAGTATGAGCCCGGCTCGAGCCCCGA ; END; BEGIN TREES; TITLE Gnomoniaceae; LINK TAXA = Taxa1; TRANSLATE 1 Plagiostoma_petiolophilum_AR3821, 2 Cryphonectria_cubensis_CBS101281, 3 Plagiostoma_fraxini_CBS109498, 4 Melanconis_marginalis_CBS109744, 5 Ditopella_ditopa_CBS109748, 6 Cryphonectria_nitschkei_CBS109758, 7 Discula_destructiva_CBS109771, 8 Melanconis_stilbostoma_CBS109778, 9 Amphiporthe_hranicensis_CBS119289, 10 Cryptosporella_confusa_CBS121063, 11 Cryptosporella_suffusa_CBS121077, 12 Pleurocerastenellum_CBS121082, 13 Cryptosporella_wehmeyeriana_CBS121085, 14 Ambarignomonia_petiolorum_CBS121227, 15 Pleuroceras_oregonense_CBS121260, 16 Gnomonia_pseudoamoena_CBS121261, 17 Ophiognomonia_rosae_CBS121267, 18 Gnomoniopsis_macounii_CBS121468, 19 Ditopellopsis_sp_CBS121471, 20 Plagiostoma_robergeanum_CBS121472, 21 Plagiostoma_devexum_CBS123201, 22 Occultocarponailaoshanense_CBS129146, 23 Cryptosporella_hypodermia_CBS17169, 24 'Gnomonia gnomon CBS199_53', 25 'Gnomoniopsis fructicola CBS208_34', 26 'Ophiognomonia alniviridis CBS782_79', 27 'Apiognomonia borealis CBS799_79', 28 'Gnomoniopsis comari CBS806_79', 29 'Ophiognomonia ischnostyla CBS837_79', 30 'Ophiognomonia padicola CBS845_79', 31 'Apiognomonia veneta CBS897_79', 32 'Pleuroceras pleurostylum CBS906_79', 33 'Apiognomonia hystrix CBS911_79', 34 'Tenuignomonia styracis DMW320_2', 35 'Tenuignomonia styracis DMW329_2', 36 'Tenuignomonia styracis DMW411_3', 37 Tenuignomonia_styracis_HM16001C, 38 Tenuignomonia_styracis_HM16002C, 39 'Tenuignomonia styracis HM16003C_ef'; TREE PAUP_1 = [&R] ((2:0.018914,6:0.030529):0.065229,((4:0.012833,8:0.009965):0.010222,((19:0.026924,(18:0.006341,(25:0.02513,28:0.012607):0.004442):0.007299):0.015378,((34:0.0,37:0.0,(35:0.0,36:0.0,38:0.0,39:0.0):0.001277):0.044115,((14:0.030204,((7:0.059193,(12:0.037752,(15:0.001924,32:0.003444):0.03754):0.027342):0.00548,(26:0.037173,(29:0.028394,(17:0.007941,30:0.026502):0.017692):0.009325):0.020798):0.002081):0.004586,((22:0.037565,(9:0.011385,(11:0.002609,(23:0.012269,(10:0.007348,13:0.004351):3.38E-4):0.004317):0.017888):0.001699):0.002952,(5:0.038096,((16:0.039258,24:0.009312):0.02409,((27:0.015319,(31:0.025274,33:0.003859):0.007766):0.016929,(20:0.019142,(1:0.010904,(3:0.00491,21:0.008067):0.004906):0.010809):0.006127):0.006921):0.004743):5.24E-4):0.005931):0.001992):0.01881):0.019787):0.065229); END;