#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:50 GMT TreeBASE (cc) 1994-2008 Study reference: Sotome K., Hattori T., Maekawa N., & Matozaki T. 2019. Melanoderma boninense, a new species of Melanoderma (Polyporales, Agaricomycota) from Bonin Islands in Japan. Mycoscience, 60(3): 177-183. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22987] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=27; TAXLABELS Amauroderma_rugosum Antrodia_gossypium Antrodia_heteromorpha Boletopsis_leucomelaena Datronia_mollis Datroniella_scutellata Echinochaete_russiceps Favolus_brasiliensis Favolus_emerici Hydnellum_geogenium Lentinus_tigtinus Lenzites_betulina Melanoderma_bonnisens_28826 Melanoderma_bonnisens_TUFC101522 Melanoderma_bonnisens_TUFC101524 Melanoderma_disciforme_Yuan1643 Melanoderma_disciforme_Yuan1675 Melanoderma_microcarpum Perenniporia_tephropora Picipes_badius Picipes_tubaeformis Polyporus_brumalis Polyporus_squamosus Polyporus_tuberaster Pseudofavolus_cucullatus Pycnoporus_cinnabarinus Trametes_suaveolens ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=25; TAXLABELS Amauroderma_rugosum Antrodia_gossypium Antrodia_heteromorpha Boletopsis_leucomelaena Datronia_mollis Datroniella_scutellata Echinochaete_russiceps Favolus_brasiliensis Favolus_emerici Hydnellum_geogenium Lentinus_tigtinus Lenzites_betulina Melanoderma_bonnisens_28826 Melanoderma_bonnisens_TUFC101522 Melanoderma_bonnisens_TUFC101524 Melanoderma_microcarpum Perenniporia_tephropora Picipes_badius Picipes_tubaeformis Polyporus_brumalis Polyporus_squamosus Polyporus_tuberaster Pseudofavolus_cucullatus Pycnoporus_cinnabarinus Trametes_suaveolens ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53304] TITLE Melanoderma_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=629; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amauroderma_rugosum GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGAACTTACTGTGGGTTT-CATATCGT-----GAAGCGTGTCGTTTA------------ACGGCTCGTGAAGCGGTCTGTGCCT------GCGTTT--ATTACAAACCCTTGT-AAAGTAAT-AGAACGTGTATTG----CGATGT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTAAAAGCCTTT-GC-----GGGTTTGTTAGGCTTGGA-CTTGGAGG-----CTTGTCGGCT---------------------CATTAGTCGGCTCCTCTTAAATGCATTAG--CTTGGTTCCT----TGCGGAT-CGGC---------TGTCGGTGTGATAA-TTGTCAACGCCGCGA-CCG-TGAAGCGTT--------TGG---CGAGCTTCTAA Antrodia_gossypium GCTGGCTCTCTC-------TGGGGGCA-TGTGCACAC--TCTATTCA-------TCTATT-T-CTAT-ATACACCTGTGCACCTTTTGTGGGTTG-GTCATATG-----AGGGAAAGTTGAAAG----------------GCTTTTGTTCTAGACCTTCCT------ACGTTTTTATTATAAACCCTAGC--ATGTCTT-TGAATGTCTTTGC----ATTAAT-----GATGCATTTTA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAATCCTGTTTTACTTTATT------GTGAAATGGGTTTGGA-TTTGGAGGC--TTTTTGCTGGCTGCATTT----------ATATTTGCTGGTCGGCTCCTCTTGAATATATTAG--CTTGAGTCTTTTAATGAGATT-GGCT---------TATCGGTGTGATAA---ATTTGCGCCGTGG-TTGGTTTCATGTAAAT-----------TAAGCTTCTAA Antrodia_heteromorpha GCTGGCCTTTC--------AAAGGGCA-TGTGCACGC--CTCGCTTC----------AAT---CCAC-TTACCCCTGTGAACACTTTGTAGGTCG-GCTCAAGG-------GACAAATTCTTAA--------------CGGGGTTTGTTTCGGGTCTTCCT------ATGTTT-TATTACAAACGTTT----AAAGTCT-AAAGAATGTACTC----GCGTCT-----AACGCAT-TAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTT-GTA--------TGAACGCAGTTGGA-TTTGGAGGC---CATTGCCGGATTGT------------------AATGACTCGGCTCCTCTTGAATGCATTAG--CTCGAACCTT----TGCGGAC-CAGC---------TTTTGGTGTGATAA-TTGTCTACGCCGCTAACTG-AGACGCATGAACG----GGA---TCGGCTTACAG Boletopsis_leucomelaena GCTGGCCTCTCTT-----CTGGAGGCA-TGTGCACAC--CTGGATCA--------TTCATCCCCTTC-ACACACCTGTGCACAACCTGTAGCTTG-GGATGATCA---CGGAGACCGTCTTTCT---------------GGCGGTGCCGAATGCCCTCGCT------ATGATCTTTTGATACACACCTTC--ATATAACGTTCATGTTGATGA----GATTAT-----TTTGAATGGAA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTGCCTTGGCTTT-TTTTT-TGCCAAAAGTGAAGTTGGATTTTGGAGGTT-TTGTTGCTGGCATTGGAGCGTCTGATTGATGCTTGCTTGTTGGCTCCTCCTAAAAGCAT------GCAGAGCTT----GGCAAAG-CGAT----------GTCGATGTGATAA-TTATCTACGTTGTCG-TC{AG}---AAGTGTGA-------AGA---TCTGCTGTTGG Datronia_mollis GCTGGCCTT-----------AAAGGCA-TGTGCTCGC--CCTGTTCA----------AAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-TGGTTAGA-----AAGCCAGGTTTATAA----------------CCTGACCTTTGAGCCGGGCTC------ATGTTTACTTTACAAACAACT----TAGTATC-AGAATGTGTATTG----CAATTT-----AATGCAT-TTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTACAAAGCTTT-GT------GTTTTGTTAGGCTTGGA-?TTGGAGG-----CTTGCTGGCTCTT-----------------------GTCAGCTTCTCTTAAATTCATTAG--CTTGATTCCT----TGTGGAT-CGGC----------CTCGGTGTGATAA-TTGTCTACGCTGTGA-CCG-TGAAACATA--------TGG---TGAGCTTCTAA Datroniella_scutellata GCTGGTCTC----------ACCAGGCA-TGTGCTCGC--CCTGCTCA----------AAT-C-CACT-CTACACCTGTGCACCTACTGTGGGCTT-GGTATATG-----GGGGTCTGGTTTTAC----------------CTGGCCCCTTGAGTCAAGCTC------ATGTTT-CATTACAAACACT-----TAGTATC-AGAATGTTTATCA----TGATGT-----AACACATATAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGTAATTCTCAACCTAACTGCCTTT-ATT----GGGCTTGTTAGGATTGGATATTGGAGG-----CTTGCCGGTT------------------------TAGTTGGCTCCTCTCAAATGCATTAG--CTTGGTTCTC----TGTGGAT-CAGC---------TCTCGGTGTGATAA-TTGTCTATGCCGTGA-CTG-TGAAATGCT--------TGA---CAAGCTTCTAA Echinochaete_russiceps GCTGGTTCTCTTTAACCAAGAGAACAA-TGTGCTCGC--TCTGTTC-----------AAT-C-CACT-CTACACCTGTGCACTTATTGTGGGTGT-TGATTGCG-----AGGAGGGGGGACTTG-------------TTTCCCTTCCTTCGAGTCAACCTC------ACGTTT-TACTACAAACT-------CAGTATT-AGAATGTGTATTG----CAATAT-----AATGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACTTACACATCCTT-GTAACAAAGGTTGTATAAGCTTGGACTTTGGAGGTC-TCATTGTCGGTTT--------------------TTAACTCCGGCTCCTCTTAAAAGCATTAG--CTTGGTTTATTT--TATGGAC-CAGC---------TTTCAGTGTGATAG-TTGTCTACACTGTGG-CTG-TGAAGTATGTTTG----TGA---CCAGCTTCTAA Favolus_brasiliensis GCTGGCCTTTA--------CGAAGGCA-TGTGCACGC--CCTGCTC-----------AAT-C-CACT-CTACACCTGTGAACTTACTGTGGGTTT-CGAGAAGG----------GGGCCGTAAA----------------AAAGCCTTCAGATTGAAGCCC------ACGTTT-AACCACAAACACTGTC-ATTGTATT-TGAATG--TATCG----CGATGTTAATAAACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGCGTCGTGTAACTCTCAACCTACAAGTCCTTTGTT----GACTTTGTTAGGCTTGGATATTGGAGGT---CTTTGCTGGCTGTT------------------TATTAGCCAGCTCCTCTTAAATGCATTAG--CTTGGTTCCTC---TGCGAAT-CGGC---------TCTCGGTGTGATAA-ATGTCTACGCCGTGA-CCG-TGAAGCGTTTAT-----GGG---CGAGCTTCTAA Favolus_emerici GCTGGCCTT----------ACGAGGCATTGTGCACAC--CCTGCTC-----------AAT-C-CACT-CTACACCTGTGAACTAACTGTGGGTCT-TTTGGGGG-------TTTGCATCTTTTG--------------------TAAGCCTTTGGGGGCTC------ATGTTTACTTTACAAACACTCAT-AAAGTAAT-GGAATGTGTATTG----CGATGT-----AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCGTGTAATTCTCAACCTACAAGGTCTTTGTG----GGCCTTGTTAGGCTTGGATATTGGAGGATATAATTGTCGG-----------------------CATGAGTCGGCTCCTCTTAAATGCATTAG--CTTGGTCCTT----TGTGGAT-CGGC---------TCTCGGTGTGATAAGTTGTTTATGCCGTGA-CCG-TGAAGCATTTTCTA---TGGGAAGGAGCTTATAA Hydnellum_geogenium GCTGGTCCTT---------AAGGGGCA-TGTGCACACACCTCGACCGGATGTGTTCCAATCCTTTCT-TTACACCTGTGCACGATCTGTAGCTGG-AGGGGATGA----TCACAGAGTTGTTCA----------------GACTTTGAATGCCCCTTCGCTATGAACGCCTTTTTATTATACCCCTTGTAAAAGTCCTTTTGAATGTTTTGATCT--GCGTGTAAC--AGCGCAAATGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTATCAACTGCTTTGGTTTT-GTT------CCAAAGTGAAGTTGGACTTTGGAGGTC-TTATTGTCGGCTTGT------------------------TCGGCTCCTCCCAAAAGCATTAT--AATAAAGCCC----TTTTTCT-TGGCAAAAAGTATCTTTGACGTGATAA-TTGTCTACGTCGCAG-AGA---AAGCCTTA-------TAGG-AGGGGCTTATAT Lentinus_tigtinus GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGCACTTACTGTGGGTTT-CAGGAGCTT---CAAGGGCGTTTCTTAC----------------GCCGGAGTTGTGACTGGGCCT------ACGTTT--ACTACAAACTCTTAC--AAGTATC-AGAATGTGTATTG----CGATGT-----AACGCATCTCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGGTTCTTAACG--GGACTTGCTTAGGCTTGGA-CTTGGAGGC---TCTTGTCGGCTTGCTTT--------------CGTCAAGTCGGCTCCTCTCAAATGCATTAG--CTTGGTTCTT----TGCGGATCCGGC---------TCACGGTGTGATAA-TTGTCTACGCCGCGA-CCGTTGAAGCGTTTTAA----TGGG-ACTAGCTTCTAA Lenzites_betulina GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------ATCC-CACT-CTACACCTGTGCACTTACTGTAGGTC---------------GGCGTGGGTTTCTAGC--------CTCCGGGTTTGAAGCATTCTGCTGGCCT------ATGTAC-ATTTATAAACACTTTA--AAGTAAC-AGAATGTAAAC------GCGTCT-----AACGCATTTTA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCCATAAATCCTT-GTG----A---TGTATGGGCTTGGA-TTTGGAGG-----CTTGCTGGTCCCTC-----------------TCGGGATCGGCTCCTCTTGAATATATTAG--CTTGATTCCG----TGCGGAT-CGGC---------TCTCAGTGTGATAA-TTATCTACGCTGTGA-CCG-TGAAGCGTT--------TGG---CGAGCTTCTAA Melanoderma_bonnisens_28826 GCTGGCCTG----------TATTGGCA-TGTGCTCGC--CCTGCTCA---------AAAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-CTGGTCTT------GTTCCGGTCAGTGAT---------------GACCTTTCAATATTGGAGCCC------ACGTTT-TACTACAAACGTCC----AGTCAAT-AGAATGTGTATCAT---TGATGTCA---AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------CTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATTGGCTCCTCTCAAATGCATTAG--CCTGGTTCCT----TACGGAT-CGGTG-----TACCCTCGGTGTGATAG-TTGTTTATGCCGTGG-CCG-TGAAGTGTTT-------TGG---CCAGCTTCTAG Melanoderma_bonnisens_TUFC101522 GCTGGCCTG----------TATTGGCA-TGTGCTCGC--CCTGCTCA---------AAAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-CTGGTCTT------GTTCCGGTCAGTGAT---------------GACCTTTCAATATTGGAGCCC------ACGTTT-TACTACAAACGTCC----AGTCAAT-AGAATGTGTATCAT---TGATGTCA---AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------TTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATCGGCTCCTCTCAAATGCATTAG--CCTGGTTCCT----TACGGAT-CGGTG-----TACCCTCGGTGTGATAG-TTGTTTATGCCGTGG-CCG-TGAAGTGTTT-------TGG---CCAGCTTCTAG Melanoderma_bonnisens_TUFC101524 GCTGGCCTG----------TATTGGCA-TGTGCTCGC--CCTGCTCA---------AAAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-CTGGTCTT------GTTCCGGTCAGTGAT---------------GACCTTTCAATATTGGAGCCC------ACGTTT-TACTACAAACGTCC----AGTCAAT-AGAATGTGTATCAT---TGATGTCA---AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------TTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATCGGCTCCTCTCAAATGCATTAG--CCTGGTTCCT----TACGGAT-CGGTG-----TACCCTCGGTGTGATAG-TTGTTTATGCCGTGG-CCG-TGAAGTGTTT-------TGG---CCAGCTTCTAG Melanoderma_disciforme_Yuan1643 GCT--------------------CTTG-TGTGCTCGC--CCTGCTCA---------AAAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-TTGCGGGG---------------------------------TTTGTTGACCCTTGTTGAAAGCCT------ACGTTT-CATTACAAACGACCA---AGTCATT-AGAATGTGTATCATCGATGTTAT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TTAACGGAGGAGCACGCCTGTTTGAGTGTCGTGAATATCTCAACCTTGACAACTTT-GTT--------GTTAGAGGCTTGGA-CTTGGAGGAC-TCATTGTCGGTGCTT-------------------TGTTACCGGCTCCTCTCAAATGCATTAGCCCCTGGTTCATTT-GTGTGAAA-CGGT------TAATCTCGGTGTGATAG-TTGTCTACGCCGTGGGCCGTGTAAGCATATGTTGTATTGA--CCGGGCTTCTAA Melanoderma_disciforme_Yuan1675 GCT--------------------CTTG-TGTGCTCGC--CCTGCTCA---------AAAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-TTGCGGGG---------------------------------TTTGTTGACCCTTGTTGAAAGCCT------ACGTTT-CATTACAAACGACCA---AGTCATT-AGAATGTGTATCATCGATGTTAT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TTAACGGAGGAGCACGCCTGTTTGAGTGTCGTGAATATCTCAACCTTGACAACTTT-GTT--------GTTAGAGGCTTGGA-CTTGGAGGAC-TCATTGTCGGTGCTT-------------------TGTTACCGGCTCCTCTCAAATGCATTAGCCCCTGGTTCATTT-GTGTGAAA-CGGT------TAATCTCGGTGTGATAG-TTGTCTACGCCGTGGGCCGTGTAAGCATATGTTGTATTGA--CCGGGCTTCTAA Melanoderma_microcarpum GCTGGCTTT----------TATTGGCA-TGTGCTCAC--TCTACTCA----------ATTCCACTCTAC-ACACCTGTGCACTTACTGTGGGCTTTTTGGT-AT-------TGTTGGTCAGTGAC---------------GACTTTTCAATCTGGAAGGCCTATGTTATGTTT-TACTACAAACGTCC----AGTCAAC-AGAATGTGTATCAT---TGATGTT----AATGCATCTAT-ATATAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTT--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAATCTAACACACTTG------------TTGTTAGAGTTGGA-TTTGGAGGC---CTTTGTTGGTACAT-------------------TGGTATCGGCTCCTCTCAAATGCATTAG--CTTGGTTCCT----TGCGGAT-CGGTA-----TA-CCTCGGTGTGATAG-CTGTTTACGCTGTGG-CCA-TGAAGTGTTT-------TGG---CCAGCTTCTAA Perenniporia_tephropora GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGCACTTACTGTGGGTTT-CAGATGGC-----GTAGTGAGCCTTTAC-------------GGGCTTGTGAAAGCATCTGTGCCT------GCGTTT--ATTATAAACTCTTAT--AAGTAAC-AGAATGTGTATTG----CGATGT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTATAAACCTTT-GT------GGGTTTGTAGGCTTGGA-TTTGGAGG-----CTTGTCGGCC---------------------TAACAGTCGGCTCCTCTTAAATGCATTAG--CTTGATTCCT----TGCGGAT-CGGC---------TCTCGGTGTGATAA-TTGTCTACGCCGCGA-CCG-TGAAGCGTT--------TGG---CGAGCTTCTAA Picipes_badius GCTGGCTTTTCC-----------AGCA-TGTGCTCGC--CCTGTTC-----------AAT-C-CACT-CTACACCTGTGCACCAACTGTAGGCTT-TTGGTGGGCTTGCTTTCCTTGTCCTTTACCG------GGCGTTGAGGGCTTGTTAACCTTGGCTT------GCGTTT-TCATACAAACCCTGTAAAAAGTAAAAAGAATGTGTATTG----CGATAT-----AACGCATTTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAGGCTTTTGT---------TTTGTAGGCTTGGA-CTTGGAGGC----GTTGCCGATGTTTTTA---------------TTTACGTTGGCTCCTCTCAAATGCATTAG--CTAGCGTCCTT---TGCGGAT-CAGC--------TTTTCGGTGTGATAA-TTGTCTACGCCGTAG-TTG-TGAAGCGTTTT------TGA---CCAGCTTCTAA Picipes_tubaeformis GCTGGCTTTCATTT---TTTGGAAGCA-TGTGCTCGC--CCTGCTC-----------AAT-C-CACT-CTACACCTGTGCACTAACTGTGGGTCT-TGTGTGTG-----GGCCTTCGTCCTTCG-----------CGGGGCGTCGGCTTTAACCCTGGCCT------ACGTTT-TCTTACAAACACTTTA-AAAGTATCGAGAATGTGTATTG----CGACAT-----AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAACTTT-------------TTGTAGGCTTGGA-CTTGGAGGT----ATTGCCGACGTTTTC----------------ATAATGCCGGCTCCTCTCAAATGCATTAG--CTCGCGTCCT----TGCGGAT-CGGC--------TCTTCGGTGTGATAA-TTGTCTACGCCGTGG-TCG-TGAAGCGTTTT------TGA---CCGGCTTCTAA Polyporus_brumalis GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGCACTTACTGTGGGTTT-CAGGAGCTT---CGAAGCGGGGGCTTAA---------TCGCCTTCGCCGAGTTGTTACTGGGCCT------ACGTTT--ACCACAAACACTTTA--AAGTAAC-AGAATG--TAATC----GCGTCT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAGTTCTTAACC--GGACTTGCTTAGGCTTGGA-CTTGGAGG-----CTTGTCGGCTCTT-------------------AGCAGTCGGCTCCTCTCAAATGCATTAG--CTTGGTTCCT----TGCGGAT-CGGC---------TCACGGTGTGATAA-TTGTCTACGCCGCGA-CCGTTGAAGCGTTTTAA----TGG---CCAGCTTCTAA Polyporus_squamosus GCTGGTCTT----------TTCAGGCA-AGTGCTCGC--CTCGTTCA----------AAT-C-CACT-CTACACCTGTGCACTTACTGTGGACTT-TGGTATTC-----TTGGAGGGTCCTTTG----------------GCCCTTTATAAATCCGGGTTC------ATGTTT-TATTATATATACGCTT--CAGTATTGAGAATGTGTATTG----TGATGT-----AACACATCGTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGAAATTCTCAACCTTACAAACTTTTGT------GTTTGATTTGGCTTGGA-GTTGGAGG-----CTTGCTAATGGGAA-----------------ATTCCTTTGGCTCCTCTCAAATGCATTAG--CTTGGTTCCT----TGCGGAT-TGGC---------TCCTGGTGTGATAA-ATGTTTACGCCGCAG-CTGTTGAAGC?TTTT------GGG---CAAGCTCCTAA Polyporus_tuberaster GCTGGCCTTTCTT----GCGAGAGGCA-TGTGCTCGC--CTTTGCTC----------AAT-C-CACT-CTACACCTGTGCACTTACTGTGGGTTT-TTGGTCGG-----AGGGGTTGCGCTCCG-----------GCGTGGCTCCTTTGAAACCTTGACCC------ACGTTT-CACTACAAACACG-----ATGTATC-AGAATGTCTATTG----CGATGTT----AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTGCGAGATCCTTGTG----GTCTTCGTAAGGCTTGGACTTTGGAGGC---TTTTGTCGG-----------------------CGATTGTCGACTCCTCTCAAATGCATTAG--CTTGGTTCCT----TGCGGAT-CGGC---------TTTCGGTGTGATAG-TTGTCTACGCCGTGA-CCG-TGAAGCGTTT-------TGG---CGAGCTTCTAA Pseudofavolus_cucullatus GCTGGCCTTCAC-------CCAAGGCA-TGTGCTCAC--CCTGTTCA----------AAT-C-CACT-CTACACCTGTGCACTTACTGTGGGCTT-TGGATCTG-----TTTTTCGGTTCTGAGGGGTCAAACCTTTGGAAGCGCAATTCGCTCCAGGCTC------ACGTTTTTACTACAAACACTTT---TGGTATT-AGAATGTGTATTG----CGATGTT----AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAGTTGTTGTTG--CAACTTTGTTTGGCTTGGA-TCTGGAGGC----TTTGCTGGCTTGCT-----------------CTGAGTTCAGCTCCTCTTAAATGCATTAG--CTTGGTTCCT----TGTGGAT-CAGC---------TCTCGGTGTGATAAATTGTCTATGCCGTGA-CTG-TGAAGCGTT--------TGG---CGAGCTTATAA Pycnoporus_cinnabarinus GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGCACTTACTGTAGGTTT-GGCGTGGG-----CTTCGGGGGCCTCCGG------------GCTTTCGAGGCATTCTGCCGGCCT------ATGTAA-CACTACAAACACATA---AAGTAAC-AGAATGTCATC------GCGTCT-----AACGCACATAA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCCACACGTCCTT-GT------GATGATGTGGGCTTGGA-TTTGGAGG-----CTTGCTGGCCCTT-------------------GTGGGTCAGCTCCTCTTGAATGCATTAG--CTTGATTCCG----TGCGGAT-CGGC---------TCTCAGTGTGATAA-TTGTCTACGCTGTGA-CCG-TGAAGCGTTT-------TGG---CGAGCTTCTAA Trametes_suaveolens GCTGGCCTT----------CCGAGGCA-TGTGCACGC--CCTGCTC------------AT-C-CACT-CTACACCTGTGCACCTACTGTAGGTT---------------GGCGTGGGCTCCTTC----------------GCGGGAGCGTTCTGCCGGCCT------ATGTAT--ATTACAAACCCCTTA--AAGAAAC-AGAATGTAAAC------GCGTCT-----AACGCATCTTA-ATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCGTAAATCCTT-GTG----A---TCTACGGGCTTGGA-CTTGGAGG-----CTTGCTGGCCCTT--------------------GCGGTTGGCTCCTCTTGAATGCATTAG--CTTGATTCCG----TATGGAT-CGGC---------TCTCAGTGTGATAA-TTGTCTACGCTGTGA-CCG-TGAAGTGTTT-------TGG---CGAGCTTCTAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53305] TITLE Melanoderma_LSU_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1399; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amauroderma_rugosum GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCTGGGACTCAGCCTTGC--TTTTGCTTGGTGCACTTTCCGGA--TGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACC----TCC---GGGTGTGTTATAGACTTTAGTCGCATACGGCGGTCGGGATCGAGGAACGCAGCGCGCC--GTAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGAACTTACTGTGGGTTTCATATCGT--------------GAAGCGTGTC------GTTTAACGGCT----CGTGAAGCGGTCTGTGCCTGCG------TTT--ATTACAAACCCT-TGTAAAGTAAT-AGAACGTGT---ATTGCGATGT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTAAAAGCCTTT-GC-----GGGTTTGTTAGGCTTGGA-CTTGGAGG-----CTTGTCGGCTC---------------------ATTAGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCC-T----TGCGGAT-CGGC---------TGTCGGTGTGATAA-TTGTCAACGCCGCGACCG-TGAAGCGTT--------TGGCGAGCTTCTAA Antrodia_gossypium GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGTCTGGAAGTCAGCCTTGCAATTTTGTTTGGTGTATTTTTCAGAT-TGACGGGCCAGCATCGATTTTGACCGTTGGATAAAGATGAGGGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCCCTTGTCACATACAACGGTTGGGATCGAGGAACTCAGCACGCC--TTTATTGGTCGGGG-TTC----GCCCAC---GTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-TAAACCCGAGCGCGTAATTAAAGTAAAAGTTGAGATCCCCGTTACAAGGGAGCATCGACGCCCGGACTTGACCTTCTGTGATAGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCTCTCTC-------TGGGGGCA-TGTGCACACTC------------TATTCATCTATT-T-CTATATACACCTGTGCACCTTTTGTGGGTTGGTCATATG--------------AGGGAAAGTT----------GAAAGGC----TTTTGTTCTAGACCTTCCTACG------TTTTTATTATAAACCCT-AGC-ATGTCTT-TGAATGTCT---TTGCATTAAT-----GATGCATTTTA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAATCCTGTTTTACTTTATT------GTGAAATGGGTTTGGA-TTTGGAGGC--TTTTTGCTGGCTGCATTT----------ATATTTGCTGGTCGGCTCCTCTTGAATATATTAGCTTGAGTCT-TTTAATGAGATT-GGCT---------TATCGGTGTGATAA---ATTTGCGCCGTGGTTGGTTTCATGTA--------AATTAAGCTTCTAA Antrodia_heteromorpha GTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCCAGGACTCACCCTTGC--TTTAGCTTGGTGCATTTTCTGGT--TGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATC----TTC---GGATGTGTTATAGCCCTCAGTCACATACGACAGCTGGGATCGAGGACCGCAGCACGCC-TTTAT--GGCCGGGG-TTC----GCCCAC---GTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGC-GGGGAGCATCGACGCCCGGACCTGACCTTTTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTTTC--------AAAGGGCA-TGTGCACGCCT------------CGCTTC---AAT---CCACTTACCCCTGTGAACACTTTGTAGGTCGGCTCAAGG----------------GACAAATT--------CTTAACGGG----GTTTGTTTCGGGTCTTCCTATG------TTT-TATTACAAACGTT-T---AAAGTCT-AAAGAATGT---ACTCGCGTCT-----AACGCAT-TAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTT-GTA--------TGAACGCAGTTGGA-TTTGGAGGC---CATTGCCGGATTGT------------------AATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCT-T----TGCGGAC-CAGC---------TTTTGGTGTGATAA-TTGTCTACGCCGCTAACTGAGACGCATGAAC----GGGATCGGCTTACAG Boletopsis_leucomelaena GTTGTAGTCTGGAGAAGTGTTTTCTGTGCCGGACCGTGTACAAGTCCCTTGGAACAGGGCCTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTCTGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCATGTCTGCTAGGACTCAGCCTTGCATTTTTGCTTGGTGCACTTTCTGGT--TGACAGGCCAGCAT{CT}GATTTTGACCGTTGGAGAAAGGTGGAGGAAATGTGGCATC----TTT{CT}-GAGGTGTGTTATAGTCCTCTGCTGTATGCAATGGTTGGGATCGAGGACCGCAGCATGCC-TTTAT--GGCCGGGG-GTC----ACACCCACGTTACGTGCTTAGGATGCTGGCTTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACTTGCCTGCGAGTGTTTGGGTGG-AAAACCCAAGCGCGCAATGAAAGTGATAGTTGAGACCTCTGTCAT-GGAGGGCATCGACGCCCGGACCTGATCTACGGAGACGGTTCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTCTCTT-----CTGGAGGCA-TGTGCACACCT------------GGATCAT-TCATCCCCTTCACACACCTGTGCACAACCTGTAGCTTGGGATGATCAC------------GGAGACCGTC---------TTTCTGGC----GGTGCCGAATGCCCTCGCTATGAT---CTTT-TGATACACACCTT-C---ATATAACGTTCATGTTG---ATGAGATTAT-----TTTGAATGGAA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTGCCTTGGCTTTTTTTT--TGCCAAAAGTGAAGTTGGATTTTGGAGGT-TTTGTTGCTGGCATTGGAGCGTCTGATTGATGCTTGCTTGTTGGCTCCTCCTAAAAGCAT----GCAGAGCT-T----GGCAAAG-CGA----------TGTCGATGTGATAA-TTATCTACGTTGTCGTC{AG}---AAGTGTGA-------AGATCTGCTGTTGG Datronia_mollis GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGTTTGGAACTCAGCCTTGC--TTTTGCTTGGTGCACTTTCTGAA--TGACGGGCCAGCATCAATTTCAGCCGTTGGAAAAAGGCTGGGGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCTCTGGTCACATACAACGGTTGGGATTGAGGACCGCAGCGCGCC--GTAA--GGCAGGGG-GTT----TCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCAT-GGAGGGCATCGACGCCCGGACTTGAAGTTTTCTGATGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT-----------AAAGGCA-TGTGCTCGCCC------------TGTTCA---AAT-C-CACTCTACACCTGTGCACTTACTGTGGGCTTTGGTTAGA--------------AAGCCAGGTT----------TATAACC----TGACCTTTGAGCCGGGCTCATG------TTTACTTTACAAACAAC-T---TAGTATC-AGAATGTGT---ATTGCAATTT-----AATGCATTTT--ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTACAAAGCTTT-GT------GTTTTGTTAGGCTTGGA-?TTGGAGG-----CTTGCTGGC-----------------------TCTTGTCAGCTTCTCTTAAATTCATTAGCTTGATTCC-T----TGTGGAT-CGGC----------CTCGGTGTGATAA-TTGTCTACGCTGTGACCG-TGAAACATA--------TGGTGAGCTTCTAA Datroniella_scutellata GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTTGC--TTCCGCTTGGTGCACTTTCTGGA--TGACGGGCCAGCATCAATTTTGACCGTTGGAAAAGGGTTGGGGGAATGTGGCACC----TTT---GGGTGTGTTATAGCCTTCAGTCGCATACAACGGTTGGGATTGAGGACCGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGTCTC----------ACCAGGCA-TGTGCTCGCCC------------TGCTCA---AAT-C-CACTCTACACCTGTGCACCTACTGTGGGCTTGGTATATG--------------GGGGTCTGGT----------TTTACCT----GGCCCCTTGAGTCAAGCTCATG------TTT-CATTACAAACACT-----TAGTATC-AGAATGTTT---ATCATGATGT-----AACACATATAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGTAATTCTCAACCTAACTGCCTTT-ATT----GGGCTTGTTAGGATTGGATATTGGAGG-----CTTGCCGG------------------------TTTAGTTGGCTCCTCTCAAATGCATTAGCTTGGTTCT-C----TGTGGAT-CAGC---------TCTCGGTGTGATAA-TTGTCTATGCCGTGACTG-TGAAATGCT--------TGACAAGCTTCTAA Echinochaete_russiceps GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGTGTTATTTGGAACTCAGCCTTGC-TTTTTGCTTGGTGCACTTTCTGAA--TGACAGGCCAGCATCAATTTTGACTGTTGGAAAAGGGCTTGAGGAATGTGGCACCC--TTTT---GGGTGTGTTATAGCCTCTGGTCATATACAGCGGTTGGGATTGAGGAACGCAGCGCGCC--GTAA--GGCAGGGG-TTT----ACCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTTTCTGAAGGATCCGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGTTCTCTTTAACCAAGAGAACAA-TGTGCTCGCTC------------TGTTC----AAT-C-CACTCTACACCTGTGCACTTATTGTGGGTGTTGATTGCGA-------------GGAGGGGGGA--------CTTGTTTCC----CTTCCTTCGAGTCAACCTCACG------TTT-TACTACAAACT-------CAGTATT-AGAATGTGT---ATTGCAATAT-----AATGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACTTACACATCCTT-GTAACAAAGGTTGTATAAGCTTGGACTTTGGAGGT-CTCATTGTCGGTTT--------------------TTAACTCCGGCTCCTCTTAAAAGCATTAGCTTGGTTTATTT---TATGGAC-CAGC---------TTTCAGTGTGATAG-TTGTCTACACTGTGGCTG-TGAAGTATGTTT----GTGACCAGCTTCTAA Favolus_brasiliensis GTTGTAGTCTGGAGAAGTGCTTTCCGCGCCGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTGCAGAACTCAGCCTTGC--ATTCGCTTGGTGCACTTTCTGTA--CGACGGGCCAGCATCGATTTTAATCGTTGGATAAGGGCTCGAGGAATGTGGCACT----CTTTATGGGTGTGTTA-AGCCTCGGGTCGCATACAACGGTCGGGATCGAGGAACGCAGCAC--------------------------------------TTGTGCTTAGGATGCTGGCTTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-TAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTTTA--------CGAAGGCA-TGTGCACGCCC------------TGCTC----AAT-C-CACTCTACACCTGTGAACTTACTGTGGGTTTCGAGAAGG-------------------GGGCC----------GTAAAAA----AGCCTTCAGATTGAAGCCCACG------TTT-AACCACAAACACT-GTCATTGTATT-TGAATGT-----ATCGCGATGTTAATAAACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGCGTCGTGTAACTCTCAACCTACAAGTCCTTTGTT----GACTTTGTTAGGCTTGGATATTGGAGGT---CTTTGCTGGCTGTT------------------TATTAGCCAGCTCCTCTTAAATGCATTAGCTTGGTTCC-TC---TGCGAAT-CGGC---------TCTCGGTGTGATAA-ATGTCTACGCCGTGACCG-TGAAGCGTTTAT-----GGGCGAGCTTCTAA Favolus_emerici GTTGTAGTCTGGAGAAGTGCTTTCCGTGCCGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGG{GT}GGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTGCAGAACTCAACCTAGC--TTTTGCTTGGTGCACTTTCTGTA--TGACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGTTGAAGGAATGTGGCACC----TCC---GGGTGTGTTATAGCCTTTGGTCGCATACGGCAGTTGGGATCGAGGAACGCAGCGTGCC--GCAA--GGTGGGGC-TTC---GGCCTAC---ATTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------ACGAGGCATTGTGCACACCC------------TGCTC----AAT-C-CACTCTACACCTGTGAACTAACTGTGGGTCTTTTGGGGGTT----------------TGCATCTTT------------------TGTAAGCCTTTGGGGGCTCATG------TTTACTTTACAAACACT-CATAAAGTAAT-GGAATGTGT---ATTGCGATGT-----AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCGTGTAATTCTCAACCTACAAGGTCTTTGTG----GGCCTTGTTAGGCTTGGATATTGGAGGATATAATTGTCGGC-----------------------ATGAGTCGGCTCCTCTTAAATGCATTAGCTTGGTCCT-T----TGTGGAT-CGGC---------TCTCGGTGTGATAAGTTGTTTATGCCGTGACCG-TGAAGCATTTTCTATGGGAAGGAGCTTATAA Hydnellum_geogenium GTTGTAGTCTGGAGAAGCGTCTTCCGTGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGCGCTTTGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCAGGACTCAGCCTTGC--TTCTGCTCGGTGCACTTTTCTGGTTGGACGGGCCAGCATCGATTTTGATCGTCAGAAAAAGTAGGAGAGAATGTGGCACC----TTTC-GAGGTGTGTTATAGCTTTCTATCGCATATGACGGTCGGGATCGAGGACTGCAGCATGCCTTTTAT--GGCTGGGG-CTTTTTAGTCCAC--ACCATGTGCTTAGGATGCTGGCTTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAAACCCGAGCGCGTAATGAAAGTGATAGTTGAGACCTCTGTCGC-GGAGGGCATCGACGCCTGGACTTGATCTACGGAGACGGTTCCACGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGTCCTT---------AAGGGGCA-TGTGCACACACCTCGACCGGATGTGTTCC---AATCCTTTCTTTACACCTGTGCACGATCTGTAGCTGGAGGGGATGATCAC---------AGAGTTGTTCAGA------------------CTTTGAATGCCCCTTCGCTATGAACGCCTTTTTATTATACCCCTTGTAAAAGTCCTTTTGAATGTTT-TGATCTGCGTGTAAC--AGCGCAAATGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTATCAACTGCTTTGGTTTT-GTT------CCAAAGTGAAGTTGGACTTTGGAGGT-CTTATTGTCGGCTT------------------------GTTCGGCTCCTCCCAAAAGCATTATAATAAAGCC-C----TTTTTCT-TGGCAAAAAGTATCTTTGACGTGATAA-TTGTCTACGTCGCAGAGA---AAGCCTTATA-----GGAGGGGCTTATAT Lentinus_tigtinus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCC--TTTTGGTTGGTGCACTTTCCGGT--AGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACC----TTC---GGGTGTGTTATAGTCCTCAGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTC------------AAGGGCGTTT----------CTTACGC----CGGAGTTGTGACTGGGCCTACG------TTT--ACTACAAACTCT-TAC-AAGTATC-AGAATGTGT---ATTGCGATGT-----AACGCATCTCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGGTTCTTAACG--GGACTTGCTTAGGCTTGGA-CTTGGAGGC---TCTTGTCGGCTTGCTTT--------------CGTCAAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCT-T----TGCGGATCCGGC---------TCACGGTGTGATAA-TTGTCTACGCCGCGACCGTTGAAGCGTTTTA-AT-GGGACTAGCTTCTAA Lenzites_betulina GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGC--TTCGGCTTGGTGCATTTTCTGGG--CGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGTTGAAGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCTTCAGCCGCATACGACGGTTGGGATCGAGGAACGCAGCGCGCC--TTAT--GGCTGGGG-TTC----GCCCAC---ATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----ATCC-CACTCTACACCTGTGCACTTACTGTAGGTCGGCGTGGGTTT----------------CTAGCC---------TCCGGGTT----TGAAGCATTCTGCTGGCCTATG------TAC-ATTTATAAACACT-TTA-AAGTAAC-AGAATGT-----AAACGCGTCT-----AACGCATTTTA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCCATAAATCCTT-GT-------GATGTATGGGCTTGGA-TTTGGAGG-----CTTGCTGGTCCCTC-----------------TCGGGATCGGCTCCTCTTGAATATATTAGCTTGATTCC-G----TGCGGAT-CGGC---------TCTCAGTGTGATAA-TTATCTACGCTGTGACCG-TGAAGCGTT--------TGGCGAGCTTCTAA Melanoderma_bonnisens_28826 GTTGTAGTCTGGAGAAGTGCTTTCTGCGCTGGACCGTGTATAAGTACCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCATGTCACTCAGAACTCAGCCTGGC--TTTTGCTTGGTGCACTTTCTGAG--CGACGGGCCAGCATCAATTTTGACTGTTGGAAAAGGGCTTGAGGAATGTGGCATCA---TCT---CGATGTGTTATAGCCTCTGGTCGTATACAATGGTTGGAATTGAGGATCGCAGGGCGT----------------------------------TTACGCTCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCAACGCCCGGATCAGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTG----------TATTGGCA-TGTGCTCGCCC------------TGCTCA--AAAT-C-CACTCTACACCTGTGCACTTACTGTGGGCTTCTGGTCTTGT---------------TCCGGTCAGT---GATGACCTTTC----------AATATTGGAGCCCACG------TTT-TACTACAAACGTC-C---AGTCAAT-AGAATGTGTATCATTGATGTCA-----AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------CTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATTGGCTCCTCTCAAATGCATTAGCCTGGTTCC-T----TACGGAT-CGGTGTA-----CCCTCGGTGTGATAG-TTGTTTATGCCGTGGCCG-TGAAGTGTTT-------TGGCCAGCTTCTAG Melanoderma_bonnisens_TUFC101522 GTTGTAGTCTGGAGAAGTGCTTTCTGCGCTGGACCGTGTATAAGTACCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCATGTCACTCAGAACTCAGCCTGGC--TTTTGCTTGGTGCACTTTCTGAG--CGACGGGCCAGCATCAATTTTGACTGTTGGAAAAGGGCTTGAGGAATGTGGCATCA---TCT---CGATGTGTTATAGCCTCTGGTCGTATACAATGGTTGGAATTGAGGATCGCAGGGCGT----------------------------------TTACGCTCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCAACGCCCGGATCAGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTG----------TATTGGCA-TGTGCTCGCCC------------TGCTCA--AAAT-C-CACTCTACACCTGTGCACTTACTGTGGGCTTCTGGTCTTGT---------------TCCGGTCAGT---GATGACCTTTC----------AATATTGGAGCCCACG------TTT-TACTACAAACGTC-C---AGTCAAT-AGAATGTGTATCATTGATGTCA-----AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------TTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATCGGCTCCTCTCAAATGCATTAGCCTGGTTCC-T----TACGGAT-CGGTGTA-----CCCTCGGTGTGATAG-TTGTTTATGCCGTGGCCG-TGAAGTGTTT-------TGGCCAGCTTCTAG Melanoderma_bonnisens_TUFC101524 GTTGTAGTCTGGAGAAGTGCTTTCTGCGCTGGACCGTGTATAAGTACCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCATGTCACTCAGAACTCAGCCTGGC--TTTTGCTTGGTGCACTTTCTGAG--CGACGGGCCAGCATCAATTTTGACTGTTGGAAAAGGGCTTGAGGAATGTGGCATCA---TCT---CGATGTGTTATAGCCTCTGGTCGTATACAATGGTTGGAATTGAGGATCGCAGGGCGT----------------------------------TTACGCTCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCAACGCCCGGATCAGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTG----------TATTGGCA-TGTGCTCGCCC------------TGCTCA--AAAT-C-CACTCTACACCTGTGCACTTACTGTGGGCTTCTGGTCTTGT---------------TCCGGTCAGT---GATGACCTTTC----------AATATTGGAGCCCACG------TTT-TACTACAAACGTC-C---AGTCAAT-AGAATGTGTATCATTGATGTCA-----AATGCATCCAT-ATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTC--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAACCTAGCATGCTTG----------TTGTGTTAGAGTTGGA-CTTGGAGGC---CTTTGTCGGTATGA------------------TAAGTATCGGCTCCTCTCAAATGCATTAGCCTGGTTCC-T----TACGGAT-CGGTGTA-----CCCTCGGTGTGATAG-TTGTTTATGCCGTGGCCG-TGAAGTGTTT-------TGGCCAGCTTCTAG Melanoderma_microcarpum GTTGTAGTCTGGAGAAGTGCTTTCTGCGCTGGACCGTGTATAAGTACCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGCTCAGAACTCAGCCTTGC-ATTTAGCTTGGTGCACTTTCTGAG--CAACGGGCCAGCATCAATTTTGGCCGTTGGAAAAGGGCTTGGGGAATGTGGCACCAATTTAT---TGGTGTGTTATAGCCTCTTGTCACATACAATGGTCGGGATTGAGGATCGCAGGGCGT----------------------------------TTACGCTCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCAACGCCCGGACCAGACGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCTTT----------TATTGGCA-TGTGCTCACTC------------TACTCA---ATTCCACTCTACACACCTGTGCACTTACTGTGGGCTTTTTGGTATT----------------GTTGGTCAGT---GACGACTTTTC----AATCTGGAAGGCCTATGTTATG------TTT-TACTACAAACGTC-C---AGTCAAC-AGAATGTGTATCATTGATGTT------AATGCATCTAT-ATATAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTT--TCAACGGAGGAGCACGCCTGTTTGAGTGTCATGAATATCTCAATCTAACACACTTG------------TTGTTAGAGTTGGA-TTTGGAGGC---CTTTGTTGGTACA-------------------TTGGTATCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-T----TGCGGAT-CGGTATA------CCTCGGTGTGATAG-CTGTTTACGCTGTGGCCA-TGAAGTGTTT-------TGGCCAGCTTCTAA Perenniporia_tephropora GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGC--TTTTGCTTGGTGCACTTTCCGGA--TGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACC----TTC---GGGTGTGTTATAGACCTTAGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGCACTTACTGTGGGTTTCAGATGGC--------------GTAGTGAGCC-------TTTACGGGCT----TGTGAAAGCATCTGTGCCTGCG------TTT--ATTATAAACTCT-TAT-AAGTAAC-AGAATGTGT---ATTGCGATGT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTATAAACCTTT-GT------GGGTTTGTAGGCTTGGA-TTTGGAGG-----CTTGTCGGCCT---------------------AACAGTCGGCTCCTCTTAAATGCATTAGCTTGATTCC-T----TGCGGAT-CGGC---------TCTCGGTGTGATAA-TTGTCTACGCCGCGACCG-TGAAGCGTT--------TGGCGAGCTTCTAA Picipes_badius GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGC-TTTTTGCTTGGTGCACTTTCTGAA--CGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGATTGGAGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCTTCAGTCACATACGGCGGTTGGGATCGAGGAACGCAGCGCGCC--GTAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAGGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCTTTTCC-----------AGCA-TGTGCTCGCCC------------TGTTC----AAT-C-CACTCTACACCTGTGCACCAACTGTAGGCTTTTGGTGGGCTTGC---------TTTCCTTGTCCTTTACCGGGCGTTGAG----GGCTTGTTAACCTTGGCTTGCG------TTT-TCATACAAACCCTGTAAAAAGTAAAAAGAATGTGT---ATTGCGATAT-----AACGCATTTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAGGCTTTTGT---------TTTGTAGGCTTGGA-CTTGGAGGC----GTTGCCGATGTTTTTA---------------TTTACGTTGGCTCCTCTCAAATGCATTAGCTAGCGTCCTT----TGCGGAT-CAGCT--------TTTCGGTGTGATAA-TTGTCTACGCCGTAGTTG-TGAAGCGTTTT------TGACCAGCTTCTAA Picipes_tubaeformis GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGC-TTTTTGCATGGTGCACTTTCTGAA--CGACGGGCCAGCATCGATTTCGACCGTCGGAAAAGGGTTGGGGGAATGTGGCACC----TTA---GGGTGTGTTATAGCCTCCAGTCACATACGACGGTTGGGATCGAGGAACGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCTTTCATTT---TTTGGAAGCA-TGTGCTCGCCC------------TGCTC----AAT-C-CACTCTACACCTGTGCACTAACTGTGGGTCTTGTGTGTG--------------GGCCTTCGTCCTT-----CGCGGGGCG----TCGGCTTTAACCCTGGCCTACG------TTT-TCTTACAAACACT-TTAAAAGTATCGAGAATGTGT---ATTGCGACAT-----AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAACTTT-------------TTGTAGGCTTGGA-CTTGGAGGT----ATTGCCGACGTTTTC----------------ATAATGCCGGCTCCTCTCAAATGCATTAGCTCGCGTCC-T----TGCGGAT-CGGCT--------CTTCGGTGTGATAA-TTGTCTACGCCGTGGTCG-TGAAGCGTTTT------TGACCGGCTTCTAA Polyporus_brumalis GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCCGGAACTCAGCCTTCC--TTTTGGTTGGTGCACTTTCCGGT--AGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACC----TTTC-GGGGTGTGTTATAGTCCTCAGTCGCATACGTCGGTTGGGATCGAGGATCGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGAAGTTCTCTGACGGTTCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTC------------GAAGCGGGGG-------CTTAATCGCCTTCGCCGAGTTGTTACTGGGCCTACG------TTT--ACCACAAACACT-TTA-AAGTAAC-AGAATGT-----AATCGCGTCT-----AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAGTTCTTAACC--GGACTTGCTTAGGCTTGGA-CTTGGAGG-----CTTGTCGGCTCT-------------------TAGCAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-T----TGCGGAT-CGGC---------TCACGGTGTGATAA-TTGTCTACGCCGCGACCGTTGAAGCGTTTTA----ATGGCCAGCTTCTAA Polyporus_squamosus GTTGTAGTCTGGAGAAGTGCTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAACCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGTGTTGTTTGGAACTCAGCCTTGC--TTTTGCTTGGTGCACTTTCTGAA--TGACAGGCCAGCATCAATTTTGACCGTTGGAAAAAGGCAGGGGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCTCTTGTCACATACAACGGTTGGGATTGAGGACCGCAGCACGCC--GCAA--GGCAGGGG-GTT----TCCCAC---TTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGTCTT----------TTCAGGCA-AGTGCTCGCCT------------CGTTCA---AAT-C-CACTCTACACCTGTGCACTTACTGTGGACTTTGGTATTC--------------TTGGAGGGTC----------CTTTGGC----CCTTTATAAATCCGGGTTCATG------TTT-TATTATATATACG-CTT-CAGTATTGAGAATGTGT---ATTGTGATGT-----AACACATCGTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGAAATTCTCAACCTTACAAACTTTTGT------GTTTGATTTGGCTTGGA-GTTGGAGG-----CTTGCTAATGGGAA-----------------ATTCCTTTGGCTCCTCTCAAATGCATTAGCTTGGTTCC-T----TGCGGAT-TGGC---------TCCTGGTGTGATAA-ATGTTTACGCCGCAGCTGTTGAAGC?TTTT------GGGCAAGCTCCTAA Polyporus_tuberaster GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCGGAACTCAGCCTTGC--TTTCGCTTGGTGCACTTTCTGAA--CGACGGGCCAGCATCGATTTCGACCGTCGGAAAAGGGTTGGGGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCCCTGGTCGCATGCGGCGGTTGGGATCGAGGAACGCAGCGCGCC--GCAA--GGCAGGGACTTT----GTCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTTTCTT----GCGAGAGGCA-TGTGCTCGCCTT-----------TGCTC----AAT-C-CACTCTACACCTGTGCACTTACTGTGGGTTTTTGGTCGGA-------------GGGGTTGCGC------TCCGGCGTGGC----TCCTTTGAAACCTTGACCCACG------TTT-CACTACAAACACG-----ATGTATC-AGAATGTCT---ATTGCGATGTT----AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTGCGAGATCCTTGTG----GTCTTCGTAAGGCTTGGACTTTGGAGGC---TTTTGTCGGC-----------------------GATTGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC-T----TGCGGAT-CGGC---------TTTCGGTGTGATAG-TTGTCTACGCCGTGACCG-TGAAGCGTTT-------TGGCGAGCTTCTAA Pseudofavolus_cucullatus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTCGCTTGGAACTCATCCTGGC---TTTGCCTGGTGCACTTTCTGAG--TGACGGGCCAGCATCAATTTTGACCGTTGGAAAAAGGCTGGGGGAATGTGGCACC----TTC---GGGTGTGTTATAGACTCTGGTCACATACAACGGTTGGGATTGAGGACCGCAGCGCGCC--GCAA--GGCAGGGG-TTC----GCCCAC---TTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTTCAC-------CCAAGGCA-TGTGCTCACCC------------TGTTCA---AAT-C-CACTCTACACCTGTGCACTTACTGTGGGCTTTGGATCTGTTTTTCGGTTCTGAGGGGTCAAAC--------CTTTGGAAG----CGCAATTCGCTCCAGGCTCACG------TTTTTACTACAAACACT-TT--TGGTATT-AGAATGTGT---ATTGCGATGTT----AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAGTTGTTGTTG--CAACTTTGTTTGGCTTGGA-TCTGGAGGC----TTTGCTGGCTTGCT-----------------CTGAGTTCAGCTCCTCTTAAATGCATTAGCTTGGTTCC-T----TGTGGAT-CAGC---------TCTCGGTGTGATAAATTGTCTATGCCGTGACTG-TGAAGCGTT--------TGGCGAGCTTATAA Pycnoporus_cinnabarinus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGACTCAGCCTTGC--TTCGGCTTGGTGCACTTCCCGGA--TGACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACC----TTC---GGGTGTGTTATAGCCTCCAGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCACGCC-TTTAC--GGCGGGGG-TTC----G?CCAC---CTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACTTGCATGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTCGAGACCTCTGTCGT-GGAGGGCACCGACGCCCGGACCAGACGTTTACTGACGGATCCGCGGTAGAGCATGTAGGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGCACTTACTGTAGGTTTGGCGTGGGCTTC-------------GGGGGCC---------TCCGGGCTTT--CGAGGCATTCTGCCGGCCTATG------TAA-CACTACAAACACA-TA--AAGTAAC-AGAATGT-----CATCGCGTCT-----AACGCACATAA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCCACACGTCCTT-GT------GATGATGTGGGCTTGGA-TTTGGAGG-----CTTGCTGGCCCT-------------------TGTGGGTCAGCTCCTCTTGAATGCATTAGCTTGATTCC-G----TGCGGAT-CGGC---------TCTCAGTGTGATAA-TTGTCTACGCTGTGACCG-TGAAGCGTTT-------TGGCGAGCTTCTAA Trametes_suaveolens GTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCATCGTCCGGAACTCAGCCTTGC--TTCGGCTTGGTGCATTTTCCGGT--TGATGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACC----CTC---GGGTGTGTTATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCC--TTAT--GGCTGGGG-TTC----GCCCAC---ATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG-AAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGT-GGAGGGCATCGACGCCCGGACCTGACGTTTTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG?????GCTGGCCTT----------CCGAGGCA-TGTGCACGCCC------------TGCTC-----AT-C-CACTCTACACCTGTGCACCTACTGTAGGTTGGCGTGGGCTC----------------CTTCGC---------------------GGGAGCGTTCTGCCGGCCTATG------TAT--ATTACAAACCCC-TTA-AAGAAAC-AGAATGT-----AAACGCGTCT-----AACGCATCTTA-ATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCGTAAATCCTT-GT-------GATCTACGGGCTTGGA-CTTGGAGG-----CTTGCTGGCCC--------------------TTGCGGTTGGCTCCTCTTGAATGCATTAGCTTGATTCC-G----TATGGAT-CGGC---------TCTCAGTGTGATAA-TTGTCTACGCTGTGACCG-TGAAGTGTTT-------TGGCGAGCTTCTAA ; END; BEGIN TREES; TITLE Melanoderma_LSU_ITS_MP; LINK TAXA = Taxa2; TRANSLATE 1 Amauroderma_rugosum, 2 Antrodia_gossypium, 3 Antrodia_heteromorpha, 4 Boletopsis_leucomelaena, 5 Datronia_mollis, 6 Datroniella_scutellata, 7 Echinochaete_russiceps, 8 Favolus_brasiliensis, 9 Favolus_emerici, 10 Hydnellum_geogenium, 11 Lentinus_tigtinus, 12 Lenzites_betulina, 13 Melanoderma_bonnisens_TUFC101522, 14 Melanoderma_bonnisens_TUFC101524, 15 Melanoderma_bonnisens_28826, 16 Melanoderma_microcarpum, 17 Perenniporia_tephropora, 18 Picipes_badius, 19 Picipes_tubaeformis, 20 Polyporus_brumalis, 21 Polyporus_squamosus, 22 Polyporus_tuberaster, 23 Pseudofavolus_cucullatus, 24 Pycnoporus_cinnabarinus, 25 Trametes_suaveolens; TREE MajRule = [&R] ((4:78.71428571428571,10:77.42857142857143):6.071428571428571,(2:109.85714285714286,(3:79.14285714285714,((24:26.0,(12:21.428571428571427,25:30.571428571428573):11.4):73.42857142857143,(((1:37.57142857142857,17:24.714285714285715):10.857142857142858,(11:12.714285714285714,20:14.285714285714286):41.0):10.285714285714286,((18:24.428571428571427,19:15.571428571428571):25.57142857142857,((22:26.571428571428573,(16:31.714285714285715,(13:0.0,14:0.0,15:1.0):16.642857142857142):58.142857142857146):4.6,((8:38.714285714285715,9:43.285714285714285):15.571428571428571,(7:51.57142857142857,(23:24.142857142857142,(5:26.142857142857142,(6:41.857142857142854,21:46.142857142857146):13.428571428571429):6.25):8.285714285714286):13.571428571428571):8.85):19.25):38.2):24.714285714285715):19.928571428571427):23.375):6.071428571428571):0.0; END; BEGIN TREES; TITLE Melanoderma_ITS_MP_ML; LINK TAXA = Taxa1; TRANSLATE 1 Amauroderma_rugosum, 2 Antrodia_gossypium, 3 Antrodia_heteromorpha, 4 Boletopsis_leucomelaena, 5 Datronia_mollis, 6 Datroniella_scutellata, 7 Echinochaete_russiceps, 8 Favolus_brasiliensis, 9 Favolus_emerici, 10 Hydnellum_geogenium, 11 Lentinus_tigtinus, 12 Lenzites_betulina, 13 Melanoderma_bonnisens_TUFC101522, 14 Melanoderma_bonnisens_TUFC101524, 15 Melanoderma_bonnisens_28826, 16 Melanoderma_disciforme_Yuan1643, 17 Melanoderma_disciforme_Yuan1675, 18 Melanoderma_microcarpum, 19 Perenniporia_tephropora, 20 Picipes_badius, 21 Picipes_tubaeformis, 22 Polyporus_brumalis, 23 Polyporus_squamosus, 24 Polyporus_tuberaster, 25 Pseudofavolus_cucullatus, 26 Pycnoporus_cinnabarinus, 27 Trametes_suaveolens; TREE ITSMPtree1 = [&R] (10,4,(3,(2,((((((22,11),(1,19)),(((18,(15,14,13)),(16,17)),(24,(21,20)))),(25,((23,6),(5,7)))),(8,9)),(12,(26,27)))))); TREE MLtreeITS = [&R] ((10,4),((2,(((((7,((18,(15,(14,13))),(16,17))),((23,6),((25,5),(8,9)))),(24,(21,20))),((22,11),(1,19))),(27,(12,26)))),3)); TREE ITSMPtree3 = [&R] (10,4,(3,(2,((((((22,11),(1,19)),(((18,(15,14,13)),(16,17)),(24,(21,20)))),(25,((23,6),(5,7)))),(8,9)),(27,(12,26)))))); TREE ITSMPtree2 = [&R] (10,4,(3,(2,((((((22,11),(1,19)),(((18,(15,14,13)),(16,17)),(24,(21,20)))),(25,((23,6),(5,7)))),(8,9)),(26,(12,27)))))); END; BEGIN TREES; TITLE Melanoderma_LSU_ITS_ML; LINK TAXA = Taxa2; TRANSLATE 1 Amauroderma_rugosum, 2 Antrodia_gossypium, 3 Antrodia_heteromorpha, 4 Boletopsis_leucomelaena, 5 Datronia_mollis, 6 Datroniella_scutellata, 7 Echinochaete_russiceps, 8 Favolus_brasiliensis, 9 Favolus_emerici, 10 Hydnellum_geogenium, 11 Lentinus_tigtinus, 12 Lenzites_betulina, 13 Melanoderma_bonnisens_TUFC101522, 14 Melanoderma_bonnisens_TUFC101524, 15 Melanoderma_bonnisens_28826, 16 Melanoderma_microcarpum, 17 Perenniporia_tephropora, 18 Picipes_badius, 19 Picipes_tubaeformis, 20 Polyporus_brumalis, 21 Polyporus_squamosus, 22 Polyporus_tuberaster, 23 Pseudofavolus_cucullatus, 24 Pycnoporus_cinnabarinus, 25 Trametes_suaveolens; TREE tree1 = [&R] ((4,10),(2,(3,(((25,12),24),(((11,20),(1,17)),(((18,19),22),((8,9),(((15,(13,14)),16),(7,(6,(21,(5,23)))))))))))); END;