#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:49 GMT TreeBASE (cc) 1994-2008 Study reference: Xu L. 2018. Myxotrichum albicans, a new slowly-growing species associated with forest litters in China. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S23427] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=34; TAXLABELS Myxotrichum_arcticum_AF062810 Myxotrichum_cancellatum_AF062811 Myxotrichum_carminoparum_AF06 Myxotrichum_chartarum_AF062 Myxotrichum_deflexum_KF986799 Myxotrichum_deflexum_KX901287 Myxotrichum_setosum_AF062815 Myxotrichum_stipitatum_AF062816 Myxotrichum_stipitatum_KF313096 Myxotrichum_stipitatum_KF850380 Oidiodendron_albicans_MH378419 Oidiodendron_cerealis_AF062788 Oidiodendron_cerealis_KX901288 Oidiodendron_chlamydosporicum_AF062789 Oidiodendron_chlamydosporicum_AF062804 Oidiodendron_citrinum_AF062790 Oidiodendron_echinulatum_AF062791 Oidiodendron_echinulatum_DQ069040 Oidiodendron_flavum_KF850372 Oidiodendron_flavum_KJ921607 Oidiodendron_fuscum_AF062807 Oidiodendron_griseum_KM232506 Oidiodendron_maius_AF307772 Oidiodendron_maius_HQ608115 Oidiodendron_myxotrichoides_AJ635314 Oidiodendron_periconioides_AF062802 Oidiodendron_pilicola_AF062787 Oidiodendron_rhodogenum_AF062803 Oidiodendron_setiferum_AF062805 Oidiodendron_setiferum_LN833544 Oidiodendron_tenuissimum_AF307774 Oidiodendron_truncatum_AY624313 Oidiodendron_truncatum_HM565134 Pseudogymnoascus_roseus_AY608924 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M47641] TITLE Oidiodendron_41_closest_hy2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=485; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Myxotrichum_arcticum_AF062810 CCCTC-GCGGGTAGATCTCCCACCCACTGTGATTGCTACCGT-GTTGCTTTGGCGGGCCGCAGGGCCCAGCCCCGCCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAAGCCCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGCTGCGGCCGGCCCCAAAGACAGTGGCGGTGCCGCCTGGCCCTGAGCGTAGTACATCTCTCGCTCCAGTG-TCCGGCGGTGACCTGCCAGAA--CCCAAACTCTCGTGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_cancellatum_AF062811 CCCTA-CCGGGTAGATCTCCCACCCACTGTTATTGCTACTGTCGTTGCTTTGGCGGGCCGCCGGGCCCTGCCCGGCCGCCGGCCCCGGCTGGCGCGCGCCCGCCAAAGGCCCG-CAAACTCTGAATGTCAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCACGCCCTC-GCGGCCGGCCCCAAAGCCAGTGGCGGCGCCGCCCGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCGGCGGCTGCCTGCCAGAA-CCCCAAACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_carminoparum_AF06 CC-TCTACGGGTAGATCTCCCACCCTGTGTTATCGCTAC-CGCGTTGCTTTGGCGGGCCGCTAGGCTCCGGCCAGCCACCGGCTCCGGCCGGTGCGCGCCCGCCAGAGACCCCTA--ATCCTGACTGTACGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGTTGGGCCCTGCCCGTTGCGGCCGGCCCCAAAGACAGTGGCGGCACCGTCTGGTCCTAAGCGTAGTAATGCTCTCGCTCTAGGG-TCCGGCGGGCGCACGCCAGCAACCCC-AACTCCTCTGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_chartarum_AF062 CCCTTTACGGGTAGATCTCCCACCCTGTGTTATCGCTAC-CGCGTTGCTTTGGCGGGCCGCTAGGCTCCAGCCTGCCACCGGCTCCGGCCGGTGCGTGCCCGCCAGAGACCCCCCT-ATCCTGACTATAAGTGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTAGCTTGGTGTTGGGCCCTGCCCGTTGCGGCCGGCCCCAAAGACAGTGGCGGCACCGTCTGGTCCTAAGCGTAGTAATGCTCTCGCTCTAGGG-TCCGGCGGGCGCATGCCAGCAACCCC-AACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_deflexum_KF986799 CCC-TTATGGGTAGATCTCCCACCCTGTGCTATCGTCCC-TGTGTTGCTTTGGCGGGCCGCTGGGCTCGACCCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCTCTACA-ACTCTTGATGTTTGTGACGTCCGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGCATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCTGGCCCGTTGCGGCCGGTCCTAAAATCAGTGGCGGTGCCGCCTGGCTCTAAGCGTAGTAATGCTCTCGCTCTAGGG-TCCGGTGGTCGCTGGCCAG-AACCCC-AACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_deflexum_KX901287 CCC-TTATGGGTAGATCTCCCACCCTGTGCTATCGTCCC-TGTGTTGCTTTGGCGGGCCGCTGGGCTCGACCCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCTCTACA-ACTCTTGATGTTTGTGATGTCCGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGCATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCTGGCCCGTTGCGGCCGGTCCTAAAATCAGTGGCGGTGCCGCCTGGCTCTAAGCGTAGTAATGCTCTCGCTCTAGGG-TCCGGTGGTCGCTGGCCAG-AACCCC-AACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_setosum_AF062815 CCCTT-ACGGGTAGAC-TCCCACCCACTGTGATTGTTACCGTCGTTGCTTTGGCGGGCCGCTGGGCTTCGCCCGGCCACCGGCCCCGGCTGGTGCGCGCCCGCCAGAGGCTCCGCAAACTCTGGATGTCAACGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGC-GCGGCCGGCCCCAAAGACAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACAACTCTCGCTCT-GGAGCCTGGCGGTGCCCTGCCAGAA-CCCCTAACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_stipitatum_AF062816 CCC-TCGCGGGTAGATCTCCCACCCTGTGTTATCGCTAC-CGCGTTGCTTTGGCGGGCCGTCGGGCTCGACCCCGCCGCTGGCTCCGGCCGGCGCGCGCCCGCCAGAGACCCCC---ATCCTGAATATACGTATCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTTGCTTGGTGTTGGGCCCCGCCCGCTGCGGCCGGCCCCAAAGTCAGTGGCGGCACCGTACGGTCCTAAGCGTAGTAATACTCTCGCTCCAGGG-CCCTACGGCCGCGCGCCAG-AACCCC-AACTCCTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_stipitatum_KF313096 CCCCTTGCGGGTAGATCTCCCACCCTTTGAAATCGCTAC-CGCGTTGCTTTGGCGGGCCGTCGGGCTCTTCCCCGCCGCTGGCTCCGGCCGGCGCGCGCCCGCCAGAGACCCCCC--ATCCTGAATATACGTATCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTTGCTTGGTGTTGGGCCCCGCCCGCTGCGGCCGGCCCTAAAGTCAGTGGCGGCACCGTACGGTCCTAAGCGTAGTAATACTCTCGCTCCAGGG-CCCTGCGGCCGCGCGCCAG-AACCCC-AACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Myxotrichum_stipitatum_KF850380 CCCCTCGCGGGTAGATCTCCCACCCTGTGTTATCGCTAC-CGCGTTGCTTTGGCGGGCCGTCGGGCTCGACCCCGCCGCTGGCTCCGGTCGGCGCGCGCCCGCCAGAGACCCCCC--ATCCTGAATATACGTATCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTTGCTTGGTGTTGGGCCCCGCCCGCTGCGGCCGGCCCTAATGTCAGTGGCGGCACCGTACGGTCCTAAGCGTAGTAATACTCTCGCTCCAGGG-CCCTGCGGCCGCGCGCCAG-AACCCC-AACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_albicans_MH378419 CCCCTCGCGGGTAGATCTCCCACCCTGTGTTATTGCTAC-CGCGTTGCTTTGGCGGGCCGTTGGGCTCGACCCCGCCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAGACCCCCCG-ATCCTGAATATACGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGCTTGGTGTTGGGCCCTGCCCGTCGCGGCCGGCCCTAAAATCAGTGGCGGTACCGTGCGGTCCTAAGCGTAGTAACACTCTCGCTCTAGGG-CCCTGCGGTCGCGCGCCAG-AACCCC-AACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_cerealis_AF062788 CCCTA-GCGGGTAGATCTCCCACCCACTGTTATTGTTACTGTCGTTGCTTTGGCGGGCCGCCGGGCCCAGCTCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCCTT-CAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCACGCCCCC-GCGGCCGGCCCCAAAGCTAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCGGCGGTTGCTTGCCAGAA-CCC-ACACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_cerealis_KX901288 CCCTA-GCGGGTAGATCTCCCACCCACTGTTATTGTTACTGTCGTTGCTTTGGCGGGCCGCCGGGCCCAGCTCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCCTT-CAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCACGCCCCCTGCGGCCGGCCCCAAAGCTAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCGGCGGTTGCTTGCCAGAA-CCC-ACACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_chlamydosporicum_AF062789 CCCTC-GCGGGTAGATCTCCCACCCACTGTTATTGCTACCGT-GTTGCTTTGGCGGGCTGCTGGGCCTAGCCCGGCCGCCGGCTCCGGCTGGCGCG--CCCGCCAGAGGCCCGACAAATTCTGATTGTCAGTGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCCGCCCGCTGCGGCCGGCCCTAAAGACAGTGGCGGCAGCGCCTGGCTCCAAGCGTAGTACAGCTCTCGCTCTGGGG-CTAGGCGGTAGCCTGCCAGAACCCCC----TTCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_chlamydosporicum_AF062804 CCCTC-GCGGG-AGATCTCCCACCCACTGTTATTGCTACCGT-GTTGCTTTGGCGGGCTGCTGGGCCTAGCCCGGCCGCCGGCTCCGGCCGGCGCGCGCCCGCCAGAGGCCCGACAAATTCTGATTGTCAGTGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCCGCCCGCTGCGGCCGGCCCTAAAGACAGTGGCGGCAGCGCCTGGCTCCAAGCGTAGTACAGCTCTCGCTCTGGGG-CTAGGCGGTAGCCTGCCA-AACCCCC---CTTCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_citrinum_AF062790 CCC--TCCGGGTAGATCTCCCACCCATTGCTATAACTACTCTCGTTGCTTTGGCGGGCCGCTGGGCCCTGCCCGGCCGCCGGCCCCGGCTGGCGCGTGCCCGCCAGAGACCTCACAGACTCTGAATGTTAGTGTCGTCCGAGTAACTATACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGCTTGGTGTTGGGCCCTGCCCGCCGCGGCCGGCCCTAAAGATAGTGGCGGCGCCGCCTGGCCCTCAGCGTAGTACAGCTCTCGCTCCAGGG-TCCGGCGGCAGCCTGCCAGAACCCCCCAACTCT-GTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_echinulatum_AF062791 CCCTA-CCGGGTAGATCTCCCACCCACTGTTATTGCTACTGTCGTTGCTTTGGCGGGCCGCCGGGCCCTGCCCGGCCGCCGGCCCCGGCTGGCGCGCGCCCGCCAAAGGCCCC-TAAACTCTGAATGTCAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCACGCCCTC-GCGGCCGGCCCCAAAGCCAGTGGCGGCGCCGTCCGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCGGCGGCTGCCTGCCAGAA-CCCCAAACTCTTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_echinulatum_DQ069040 CCCTT-CCGGGTAGATCTCCCACCCACTGTTATTGTTACCGTCGTTTCTTTGGCGGGCCGCCGGGCCCTGCTCGGCCGCCGGCCCCGGCTGGCGCGTGCCCGCCAGAGGCCCTTCAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGCCCTGCCCGTTGCGGCCGGCCCTAAAGTCAGTGGCGGCGCCGTCCGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCCGCGGTGGCTTGCCAGCA-ACCCCAACTCCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_flavum_KF850372 CCCTC-GCGGGTAGATCTCCCACCCACTGTAATTGCTACCGT-GTTGCTTTGGCGGGCCGCCGGGCCCAGCCCA-CCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAAGCCCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGCTGCGGCCGGCCCTAAAGACAGTGGCGGTGCCGCCTGGCCCTGAGCGTAGTACATCTCTCGCTCCAGTG-CCCGGTGGTAGCCTGCCAGAA--CCCCAACTCTCGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_flavum_KJ921607 CCCTC-GCGGGTAGATCTCCCACCCACTGTAATTGCTACCGT-GTTGCTTTGGCGGGCCGCCGGGCCCAGCCCG-CCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAAGCCCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGCTGCGGCCGGCCCTAAAGACAGTGGCGGTGCCGCCTGGCCCTGAGCGTAGTACATCTCTCGCTCCAGTG-CCCGGTGGTAGCCTGCCAGAA--CCCCAACTCTCGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_fuscum_AF062807 CCCTT-GCGGGTAGATCTCCCACCCACTGTTATTGATACTGT-GTTGCTTTGGCGGGCCGCCGGGCCCTGCTCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCTCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCCC-GCGGCCGGCCCTAAAGACAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGCG-CCCGGCGGTGGCCTGCCAGAACCCC--AACTC-TGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_griseum_KM232506 CCCTC-GCGGGTAGATCTCCCACCCACTGTGATTGCTACCGT-GTTGCTTTGGCGGGCCGCTGGGCCCCGCCCCGCCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAAGCCCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGCTGCGGCCGGCCCCAAAGACAGTGGCGGTGCCGCCTGGCCCTGAGCGTAGTACATCTCTCGCTCCAGTG-TCCGGCGGTGGCCTGCCAGAA--CCCAAACTCTCGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_maius_AF307772 CCC--TCCGGGTAGATCTCCCACCCATTGCTATCACTACTCTCGTTGCTTTGGCGGGCCGCTGGGCCCTGCCCGGCCGCCGGCCCCGGCTGGCGCGCGCCCGCCAGAGACCTCACAGACTCTGAATGTTAGTGTCGTCCGAGTAACTATATAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGCTTGGTGTTGGGCCCTGCCCGTCGCGGCCGGCCCTAAAGATAGTGGCGGCGCCGCCTGGCCCTCAGCGTAGTACAGCTCTCGCTCCAGGG-TCCGGCGGCAGCCTGCCAGAACCCCCCAACTCTTGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_maius_HQ608115 CCC--TCCGGGTAGATCTCCCACCCACTGTTATCACTACTCTCGTTGCTTTGGCGGGCCGCTGGGCCCTGCCCGGCCGCCGGCCCCGGCTGGCGCGTGCCCGCCAGAGACCTCACAGACTCTGAATGTTAGTGTCGTCCGAGTAACTATACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGCTTGGTGTTGGGCCCTGCCCGCCGCGGCCGGCCCTAAAGACAGTGGCGGCACCGCCTGGCCCTCAGCGTAGTACAGCTCTCGCTCCAGGG-TCCGGCGGCAGCCTGCCAGAACCCCC-AACTCT-GTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_myxotrichoides_AJ635314 CCCTAACCGGGTAGATCTCCCACCCACTGTTATCGTTACTGTCGTTGCTTTGGCGGGCCGCCGGGCCCTGCCCGGCCGCCGGCTCCGGCTGGCGCGTGCCCGCCAAAGGCCCG-CAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCCGCCCCC-GTGGCCGGCCCCAAAGTCAGTGGCGGTGCCGTCCGGCTCTAAGCGTAGTACATCTCTCGCTCCAGGG-CCCGGCGGTTGCCTGCCAGAA-CCC-AAACTCTTA-GGTTGACCTTGGATCAGGTTGGGAT Oidiodendron_periconioides_AF062802 CCCTC-GCGGGTAGATCTCCCACCCACTGTTATCGCTACCGTCGTTTCTTTGGCGGGCCGCTGGGCCCTGCCCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGACCCCCCAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCAGCCCGTCGCGGCCGGCCCCAAAGACAGTGGCGGCGCCGTCGGGCCCTAAGCGTAGTACATCTCTCGCTCTAGGG-CCCCGTGGTGGCTTGCCAGCA-ACCCCAACTCCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_pilicola_AF062787 CCCTC-GCGGGTAGATCTCCCACCCACTGTTATCGTTACTATCGTTGCTTTGGCGGGCCGCCGGGTCCTGCCCGGCCCCCGGCCCCGGCTGGGGTGCGCCCGCCAGAGGCCCTACAAACTCTGAATGTCAGTGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGCCCTGCCCGCCGCGGCCGGCCCTAAAGACAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACAACTCTCGCTCTGGAG-TCCTGCGGTAGCTTGCCAGAA--CCCCTAATCTTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_rhodogenum_AF062803 CCCTT-ACGGGTAGATCTCCCACCCACTGTTATCGTTACTGTCGTTTCTTTGGCGGGCCGCCGGGTCC--CCCGGCCGCCGGCGTCAGGCGGCGCGCGCCCGCCAGAGGCCTT-CAAACTCTGAATGTTAGTGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCTCCGCCCCC-GTGGCCGGCCCCAAAGTCAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGGG-TCCTGCGGTGGCTTGCCAGAA-CCC-CAACTTCTATGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_setiferum_AF062805 CCCTC-ACGGGTAGATCTCCCACCCACTGTTATTGATACTGT-GTTGCTTTGGCGGGCCGCCGGGCCCCGCTCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCTCCGCAAACTCTGAATGTCAGCGTCGTCTGAGCA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGCCCTGCCCCC-GCGGCCGGCCCTAAAGACAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGCG-CCTGGCGGTGGCCTGCCAGAACCCCCCAACTC-TGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_setiferum_LN833544 CCCTC-GCGGGTAGATCTCCCACCCACTGTTATTGATACTGT-GTTGCTTTGGCGGGCCGCCGGGCCCCGCTCGGCCGCCGGCTCCGGCTGGCGCGCGCCCGCCAGAGGCTCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGCATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGCCCTGCCCCC-GCGGCCGGCCCTAAAGACAGTGGCGGCGCCGTCTGGCTCTAAGCGTAGTACATCTCTCGCTCTAGCG-CCTGGCGGTGGCCTGCCAGAACCCC--AACTC-TGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_tenuissimum_AF307774 CCCTC-GCGGGTAGATCTCCCACCCACTGTGATTGCTACCGT-GTTGCTTTGGCGGGCCGCCGGGCCCAGCCCAGCCGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAAGCCCCGCAAACTCTGAATGTCAGCGTCGTCTGAGTA-CTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGCTGCGGCCGGCCCTAAAGACAGTGGCGGTGCCGCCTGGCCCTGAGCGTAGTACATCTCTCGCTCCAGTG-CCTGGCGGTGGCCTGCCAGAA--CCCCAACTCTCGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_truncatum_AY624313 CCCTC-ACGGGTAGACCTCCCACCCACTGTGATTGTTACCGTCGTTGCTTTGGCGGGCCGCTGGGCCCAGCTCAGCCACCGGCCCCGGCTGGTGCGCGCCCGCCAGAGGCTCCGCAAACTCTTGATGTCAACGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAA-TGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGCCCTGCCCCC-GCGGCCGGCCCCAAAGACAGTGGCGGCGCCGCTTGGCCCTAAGCGTAGTACACCTCTCGCTCTAGGAACCCGGCGGTGGCCTGCCA-AAACCCCAAACTCATGTGGTTGACCTCGGATCAGGTAGGGAT Oidiodendron_truncatum_HM565134 CCCTC-ACGGGTAGACCTCCCACCCACTGTGATTGTTACCGTCGTTGCTTTGGCGGGCCGCTGGGCCCAGCTCAGCCACCGGCCCCGGCTGGTGCGCGCCCGCCAGAGGCTCCGCAAACTCTTGATGTCAACGTCGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGCCCTGCCCCC-GCGGCCGGCCCCAAAGACAGTGGCGGCGCCGCTTGGCCCTAAGCGTAGTACATCTCTCGCTCTAGGA-CCCGGCGGTGGCCTGCCAGAA-CCCCAAACTCATGTGGT-GACCTCGGATCAGTAGTCCGT Pseudogymnoascus_roseus_AY608924 CAGGTTGCCGCAAGGCCTCCTGGGTACTACCACCCTTTGTTTATTCACTTTGTTGCTTTGGCAAGCTGCCCTCGGCTGCTGGCTCCGGCCGGCGAGCGCTTGCCAGAGGACCT--AAACTCTGTTTGTCTATACTGTCTGAGTA-CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACAACCCTCAAGCTCAGCTTGGTATTGGGCCCCGCCGACC-CGGCGGGCCCTAAAGTCAGTGGCGGTGCCGTCCGGCTCCGAGCGTAGTAATCTTCTCGCTCTGGAGGTCCGGTCGTGGCTCGCCAGCAACCCCCAATTTTTTTGGTTGACCTCGGATCAGGTAGGGAT ; END; BEGIN TREES; TITLE Oidiodendron_41_closest_hy2; LINK TAXA = Taxa1; TRANSLATE 1 Myxotrichum_deflexum_KX901287, 2 Myxotrichum_deflexum_KF986799, 3 Oidiodendron_albicans_MH378419, 4 Myxotrichum_stipitatum_AF062816, 5 Myxotrichum_stipitatum_KF313096, 6 Myxotrichum_stipitatum_KF850380, 7 Myxotrichum_carminoparum_AF06, 8 Myxotrichum_chartarum_AF062, 9 Oidiodendron_chlamydosporicum_AF062804, 10 Oidiodendron_chlamydosporicum_AF062789, 11 Oidiodendron_fuscum_AF062807, 12 Oidiodendron_setiferum_LN833544, 13 Oidiodendron_setiferum_AF062805, 14 Myxotrichum_setosum_AF062815, 15 Oidiodendron_truncatum_AY624313, 16 Oidiodendron_truncatum_HM565134, 17 Oidiodendron_griseum_KM232506, 18 Myxotrichum_arcticum_AF062810, 19 Oidiodendron_tenuissimum_AF307774, 20 Oidiodendron_flavum_KF850372, 21 Oidiodendron_flavum_KJ921607, 22 Oidiodendron_cerealis_KX901288, 23 Oidiodendron_cerealis_AF062788, 24 Oidiodendron_myxotrichoides_AJ635314, 25 Myxotrichum_cancellatum_AF062811, 26 Oidiodendron_echinulatum_AF062791, 27 Oidiodendron_rhodogenum_AF062803, 28 Oidiodendron_echinulatum_DQ069040, 29 Oidiodendron_periconioides_AF062802, 30 Oidiodendron_pilicola_AF062787, 31 Oidiodendron_maius_HQ608115, 32 Oidiodendron_citrinum_AF062790, 33 Oidiodendron_maius_AF307772, 34 Pseudogymnoascus_roseus_AY608924; TREE Oidiodendron = [&R] (34:0.7075215961405947,(((1:0.00256629089584477,2:1.00000050002909E-6):0.10439928158381562,((7:0.03753930361431191,8:4.2979507622645913E-4):0.04610421342057423,(3:0.02689174671954472,(4:0.006316984664625369,(5:0.01728313986213362,6:0.005662387678588726):0.001584195388186424):0.028943942665774):0.04522262700798769):0.059325858063881305):0.03396500308944773,((31:1.00000050002909E-6,(32:0.0027391808560515486,33:0.007822463120944253):0.01071786930445241):0.07120835372924211,((9:0.0027191253988823306,10:1.00000050002909E-6):0.059276130291203856,(30:0.05466864073348473,(((27:0.05306932763165236,(28:0.016707687886816428,29:0.039860537944087136):0.019399766874419546):0.011147942953918204,((22:1.00000050002909E-6,23:1.00000050002909E-6):0.018050699274978446,(24:0.025960426023994766,(25:0.002972517850671469,26:0.005247295088423757):0.015960788516676497):0.015080896548742801):0.026338497257612187):0.007743454881979731,((11:1.00000050002909E-6,(12:0.00272472348987395,13:0.0054314680625103025):0.010796464302049606):0.011893478146668322,((14:0.029168642281410428,(15:0.004237647490273398,16:0.021821884384920748):0.037480512820836774):0.04029899427485028,((17:0.00330173487723181,18:0.005290175277554448):0.013764648818691456,(19:0.005388183072222553,(20:1.00000050002909E-6,21:0.002671615138201764):0.008290799762884292):1.00000050002909E-6):0.04520619472942503):0.01119681809328213):0.01569262812385054):0.009404617866250891):0.008966013768379587):0.008670118631911182):0.025629000829622557):0.7075215961405947); END;