#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:31 GMT TreeBASE (cc) 1994-2008 Study reference: Blanco M., Carnevali G., Endara L., Koehler S., Neubig K., Singer R., Whitten W., & Williams N. 2007. Molecular phylogenetics of Maxillaria and related genera (Orchidaceae: Cymbidieae) based upon combined molecular data sets. American Journal of Botany, 94(1): 1860-1889. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2377] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=574; TAXLABELS Brasiliorchis_rupestris_SK0013 Brasiliorchis_rupestris_SK0063 Brasiliorchis_schunkiana Brasiliorchis_ubatubana_SK0155 Brasiliorchis_ubatubana_SK0373 Chrysocycnis_schlimii_GG1992763 Chrysocycnis_schlimii_W2386 Cryptocentrum_calcaratum_W0179 Cryptocentrum_calcaratum_W2651 Cryptocentrum_inaequisepalum_W1567 Cryptocentrum_inaequisepalum_W2325 Cryptocentrum_inaequisepalum_W2535 Cryptocentrum_inaequisepalum_W2700 Cryptocentrum_latifolium_A5081 Cryptocentrum_latifolium_W2349 Cryptocentrum_latifolium_W2733 Cryptocentrum_lehmannii_W2408 Cryptocentrum_peruvianum_W1796 Cryptocentrum_peruvianum_W2322 Cryptocentrum_pseudobulbosum_W1999 Cryptocentrum_pseudobulbosum_W2411 Cryptocentrum_sp._W2324 Cryptocentrum_standleyi_H8764 Cryptocentrum_standleyi_W2323 Cryptocentrum_standleyi_W2407 Cyrtidiorchis_alata_GG944005 Cyrtidiorchis_alata_W2932 Cyrtidiorchis_frontinoensis Eriopsis_biloba_W2439 Eriopsis_biloba_W3153 Heterotaxis_brasiliensis Heterotaxis_discolor_A5063 Heterotaxis_discolor_B2098 Heterotaxis_discolor_SK0311 Heterotaxis_discolor_W2350 Heterotaxis_discolor_dupe_W0198 Heterotaxis_equitans_SK0141 Heterotaxis_equitans_W2483 Heterotaxis_fritzii Heterotaxis_maleolens_A5055 Heterotaxis_maleolens_W2764 Heterotaxis_santanae Heterotaxis_sessilis_A5065 Heterotaxis_sessilis_W2544 Heterotaxis_superflua_SK0153 Heterotaxis_superflua_SK0279 Heterotaxis_superflua_W3197 Heterotaxis_valenzuelana_SK0263 Heterotaxis_valenzuelana_SK0270 Heterotaxis_valenzuelana_W2620 Heterotaxis_valenzuelana_W3000 Heterotaxis_villosa_SK0367 Heterotaxis_villosa_W2481 Heterotaxis_violaceopunctata_SK0129 Heterotaxis_violaceopunctata_W2294 Hylaeorchis_petiolaris Maxillaria_acervata Maxillaria_aciantha_A5094 Maxillaria_aciantha_W1978 Maxillaria_acicularis_SK0115 Maxillaria_acicularis_SK0237 Maxillaria_acicularis_SK0345 Maxillaria_acicularis_SK0352 Maxillaria_acicularis_SK0371 Maxillaria_acicularis_W1994 Maxillaria_acostae_B0938 Maxillaria_acostae_B2826 Maxillaria_acostae_W2644 Maxillaria_acostae_W2786 Maxillaria_acuminata_W2536 Maxillaria_acuminata_W2597 Maxillaria_acuminata_W2698 Maxillaria_acutifolia Maxillaria_adendrobium_D4231 Maxillaria_adendrobium_W2621 Maxillaria_adolphii Maxillaria_aequiloba_W1668 Maxillaria_aequiloba_W2918 Maxillaria_aff._aggregata_W3180 Maxillaria_aff._aggregata_W3189 Maxillaria_aff._arbuscula_W2500 Maxillaria_aff._lepidota_W1665 Maxillaria_aff._lepidota_W2387 Maxillaria_aff._lepidota_W2406 Maxillaria_aff._mapiriensis Maxillaria_aff._nutans Maxillaria_aff._patens Maxillaria_aff._perryae Maxillaria_aff._ponerantha Maxillaria_aff._tubercularis Maxillaria_aff._vaginalis Maxillaria_alba_A5062 Maxillaria_alba_SK0266 Maxillaria_alba_W2306 Maxillaria_allenii Maxillaria_alpestris Maxillaria_alticola_W2498 Maxillaria_alticola_W2800 Maxillaria_amparoana Maxillaria_ampliflora_B2845 Maxillaria_ampliflora_W2608 Maxillaria_anceps Maxillaria_angustisegmenta_A5095 Maxillaria_angustissima_W2637 Maxillaria_angustissima_W2637 Maxillaria_angustissima_W2637 Maxillaria_carolii Maxillaria_cassapensis Maxillaria_cedralensis Maxillaria_cerifera_SK0058 Maxillaria_cerifera_W2292 Maxillaria_cf._acutifolia Maxillaria_cf._aggregata Maxillaria_cf._alba Maxillaria_cf._anatomorum Maxillaria_cf._bennettii Maxillaria_cf._breviscapa Maxillaria_cf._confusa Maxillaria_cf._dalessandroi Maxillaria_cf._disticha Maxillaria_cf._exaltata_W2332 Maxillaria_cf._exaltata_W2333 Maxillaria_cf._friedrichsthallii Maxillaria_cf._grandiflora Maxillaria_cf._hillsii Maxillaria_cf._horichii Maxillaria_cf._laevilabris Maxillaria_cf._longicaulis Maxillaria_cf._loretotensis Maxillaria_cf._luteoalba Maxillaria_cf._madida Maxillaria_cf._microphyton_D6238 Maxillaria_cf._microphyton_W2659 Maxillaria_cf._neglecta Maxillaria_cf._nubigena_W2718 Maxillaria_cf._nubigena_W3160 Maxillaria_cf._richii Maxillaria_cf._rufescens_SK0258 Maxillaria_cf._rufescens_W1669 Maxillaria_cf._scorpioidea Maxillaria_cf._splendens Maxillaria_cf._strumata Maxillaria_cf._triloris Maxillaria_cf._umbratilis Maxillaria_cf._uncata Maxillaria_cf._variabilis Maxillaria_cf._wercklei Maxillaria_chacoensis Maxillaria_chartacifolia_W1597 Maxillaria_chartacifolia_W2752 Maxillaria_chicana Maxillaria_chionantha_A5091 Maxillaria_chionantha_W1968 Maxillaria_chionantha_W2493 Maxillaria_chionantha_W2634 Maxillaria_chionantha_W2649 Maxillaria_coccinea Maxillaria_colemanii Maxillaria_concavilabia Maxillaria_ctenostachya_Morales1639 Maxillaria_ctenostachya_W2549 Maxillaria_ctenostachya_W2647 Maxillaria_cucullata_A5066 Maxillaria_cucullata_A5079 Maxillaria_cucullata_SK0298 Maxillaria_cucullata_W0075 Maxillaria_cucullata_W2546 Maxillaria_curvicolumna Maxillaria_cymbidioides Maxillaria_dendrobioides_D6243 Maxillaria_dendrobioides_W2599 Maxillaria_dendrobioides_W2627 Maxillaria_dendrobioides_W2655 Maxillaria_densa_A5072 Maxillaria_densa_Higgins1017 Maxillaria_densa_W1964 Maxillaria_densifolia Maxillaria_desvauxiana Maxillaria_dichotoma_W2584 Maxillaria_dichotoma_W2777 Maxillaria_dillonii_W2575 Maxillaria_dillonii_W2878 Maxillaria_diuturna_B0620 Maxillaria_diuturna_D6251 Maxillaria_diuturna_W2305 Maxillaria_diuturna_W2631 Maxillaria_diuturna_W2780 Maxillaria_divaricata Maxillaria_dressleriana Maxillaria_eburnea Maxillaria_echinophyta_SK0353 Maxillaria_echinophyta_W1056 Maxillaria_echinophyta_W2990 Maxillaria_ecuadorensis_W1572 Maxillaria_ecuadorensis_W2724 Maxillaria_elatior Maxillaria_elegantula_D6262 Maxillaria_elegantula_D6264 Maxillaria_elegantula_W2576 Maxillaria_elegantula_W2578 Maxillaria_elegantula_W2872 Maxillaria_encyclioides Maxillaria_endresii Maxillaria_exaltata_D6277 Maxillaria_exaltata_W1506 Maxillaria_exaltata_W2317 Maxillaria_exaltata_W2318 Maxillaria_falcata Maxillaria_ferdinandiana_SK0089 Maxillaria_ferdinandiana_SK0109 Maxillaria_ferdinandiana_W1872 Maxillaria_flava_D5441 Maxillaria_flava_W2579 Maxillaria_flava_W2611 Maxillaria_flava_W2624 Maxillaria_fletcheriana Maxillaria_fractiflexa Maxillaria_friedrichsthallii_SK0125 Maxillaria_friedrichsthallii_W0067 Maxillaria_fulgens_D5452 Maxillaria_fulgens_W2630 Maxillaria_galantha Maxillaria_gentryi_W2379 Maxillaria_gentryi_W2499 Maxillaria_gentryi_W2656 Maxillaria_gigantea_W1579 Maxillaria_gigantea_W2316 Maxillaria_gigantea_W2398 Maxillaria_gomeziana_Atwood_sn Maxillaria_gomeziana_W1985 Maxillaria_grayii_W2409 Maxillaria_grayii_W2486 Maxillaria_grayii_W2879 Maxillaria_grisebachiana Maxillaria_guadalupensis_W1593 Maxillaria_guadalupensis_W2704 Maxillaria_guadalupensis_W2714 Maxillaria_gualaquizensis Maxillaria_guareimensis Maxillaria_haberi Maxillaria_hedwigiae_A5074 Maxillaria_hedwigiae_SK0314 Maxillaria_hedwigiae_W1961 Maxillaria_hennisiana_A5096 Maxillaria_hennisiana_W2572 Maxillaria_hennisiana_W2779 Maxillaria_hennisiana_W2808 Maxillaria_hennisiana_W2809 Maxillaria_heterophylla_var._acicularifolia_SK0095 Maxillaria_heterophylla_var._acicularifolia_SK1706 Maxillaria_heterophylla_var._intermedia Maxillaria_heterophylla_var._magnifolia Maxillaria_heterophylla_var._pygmaea_SK0113 Maxillaria_heterophylla_var._pygmaea_SK0278 Maxillaria_heterophylla_var._pygmaea_SK0292 Maxillaria_heubschii Maxillaria_horichii_W0070 Maxillaria_horichii_W2602 Maxillaria_horichii_W2615 Maxillaria_houtteana Maxillaria_imbricata_SK0025 Maxillaria_imbricata_W2337 Maxillaria_inaudita_A5054 Maxillaria_inaudita_W2763 Maxillaria_irrorata Maxillaria_johannis Maxillaria_jostii Maxillaria_jucunda_W2581 Maxillaria_jucunda_W2605 Maxillaria_juergensii_SK0069 Maxillaria_juergensii_SK0079 Maxillaria_juergensii_SK0111 Maxillaria_klugii_W2390 Maxillaria_klugii_W2492 Maxillaria_klugii_W2787 Maxillaria_laevilabris Maxillaria_lankesteri_W2885 Maxillaria_lankesteri_W2901 Maxillaria_lawrenceana Maxillaria_lehmannii Maxillaria_lepidota Maxillaria_leucaimata Maxillaria_linearifolia Maxillaria_loefgrenii Maxillaria_longibracteata Maxillaria_longicaulis Maxillaria_longicolumna Maxillaria_longiloba Maxillaria_longipes_B2965 Maxillaria_longipes_W2550 Maxillaria_longipes_W2574 Maxillaria_longipes_W2751 Maxillaria_longipetiolata_A5075 Maxillaria_longipetiolata_W1974 Maxillaria_longissima_W1642 Maxillaria_longissima_W2399 Maxillaria_longissima_W2745 Maxillaria_lueri_A5085 Maxillaria_lueri_W2051 Maxillaria_lueri_W2629 Maxillaria_lutheri_W2563 Maxillaria_lutheri_W2567 Maxillaria_lutheri_W2569 Maxillaria_madida_SK0065 Maxillaria_madida_SK0081 Maxillaria_madida_SK0107 Maxillaria_madida_W1868 Maxillaria_mapiriensis Maxillaria_marmoliana Maxillaria_meleagris_B1604 Maxillaria_meleagris_W2816 Maxillaria_meridensis_B1562 Maxillaria_meridensis_W1568 Maxillaria_meridensis_W1647 Maxillaria_meridensis_W2451 Maxillaria_meridensis_W2568 Maxillaria_mexicana Maxillaria_microphyton_W2307 Maxillaria_microphyton_W2586 Maxillaria_miniata Maxillaria_minor_W2598 Maxillaria_minor_W2607 Maxillaria_minor_W2628 Maxillaria_minuta_SK0097 Maxillaria_minuta_SK0253 Maxillaria_modesta Maxillaria_molitor_W2424 Maxillaria_molitor_W2425 Maxillaria_moralesii_B2097 Maxillaria_moralesii_W1976 Maxillaria_mosenii_var._echinochila_SK0087 Maxillaria_mosenii_var._echinochila_SK0294 Maxillaria_mosenii_var._hatschbachii_SK0071 Maxillaria_mosenii_var._hatschbachii_SK0083 Maxillaria_multicaulis Maxillaria_multiflora Maxillaria_nardoides_W2359 Maxillaria_nardoides_W2502 Maxillaria_nasuta_SK0261 Maxillaria_nasuta_W1869 Maxillaria_neglecta Maxillaria_neisseniae Maxillaria_neophylla Maxillaria_neowiedii_SK0073 Maxillaria_neowiedii_SK0091 Maxillaria_neowiedii_SK0241 Maxillaria_nicaraguensis Maxillaria_notylioglossa_SK0033 Maxillaria_notylioglossa_SK0255 Maxillaria_obscura Maxillaria_ochroleuca_SK0011 Maxillaria_ochroleuca_W2378 Maxillaria_oreocharis_A5086 Maxillaria_oreocharis_W0193 Maxillaria_oreocharis_W2594 Maxillaria_oreocharis_W2619 Maxillaria_oreocharis_W2652 Maxillaria_pacholskii_W2393 Maxillaria_pacholskii_W2464 Maxillaria_pacholskii_W2501 Maxillaria_pachyachron_B2235 Maxillaria_pachyachron_W2653 Maxillaria_pachyacron_D6249 Maxillaria_pachyphylla_A5098 Maxillaria_pachyphylla_SK0105 Maxillaria_pachyphylla_SK0369 Maxillaria_paleata_W2561 Maxillaria_paleata_W2562 Maxillaria_paleata_W2565 Maxillaria_pardalina Maxillaria_parkerii Maxillaria_parviflora_A5070 Maxillaria_parviflora_SK0027 Maxillaria_parviflora_W2019 Maxillaria_parviflora_W2822 Maxillaria_patens_W1580 Maxillaria_patens_W2715 Maxillaria_patens_W2778 Maxillaria_pauciflora_LJ5002 Maxillaria_pauciflora_W2484 Maxillaria_pendens Maxillaria_pumila_SK0094 Maxillaria_pumila_SK0101 Maxillaria_pumila_SK0243 Maxillaria_pumila_SK0355 Maxillaria_punctostriata_B2107 Maxillaria_punctostriata_W2543 Maxillaria_ramonensis Maxillaria_reichenheimiana_B2102 Maxillaria_reichenheimiana_W2616 Maxillaria_reichenheimiana_W2713 Maxillaria_repens Maxillaria_richii_A5077 Maxillaria_richii_W2362 Maxillaria_rigida_SK0007 Maxillaria_rigida_SK0053 Maxillaria_ringens Maxillaria_robusta Maxillaria_rodrigueziana Maxillaria_rotundilabia_W2516 Maxillaria_rotundilabia_W3173 Maxillaria_rubioi Maxillaria_rufescens_A5073 Maxillaria_rufescens_SK0339 Maxillaria_rufescens_W2754 Maxillaria_sanantonioensis Maxillaria_sanderiana_W1652 Maxillaria_sanderiana_W2422 Maxillaria_sanderiana_W2603 Maxillaria_sanguinea Maxillaria_scalariformis_D6252 Maxillaria_scalariformis_W2559 Maxillaria_scalariformis_W2633 Maxillaria_schlechteriana_B1662 Maxillaria_schlecteriana_W2157 Maxillaria_scorpioidea Maxillaria_serrulata Maxillaria_setigera_Atwood_sn_W196 Maxillaria_setigera_SK0117 Maxillaria_sigmoidea_B2141 Maxillaria_sigmoidea_B2915 Maxillaria_sigmoidea_D6240 Maxillaria_silvana_W2485 Maxillaria_silvana_W2747 Maxillaria_sophronitis_W2296 Maxillaria_sophronitis_W2613 Maxillaria_sp._J7921 Maxillaria_sp._LJ6100 Maxillaria_sp._LJ6406 Maxillaria_sp._W2310 Maxillaria_sp._W2368 Maxillaria_sp._W2380 Maxillaria_sp._W2904 Maxillaria_sp._W3186 Maxillaria_speciosa Maxillaria_splendens_SK0144 Maxillaria_splendens_W1962 Maxillaria_squamata Maxillaria_striata Maxillaria_strumata_SK0302 Maxillaria_strumata_W3021 Maxillaria_suarezorum_W2758 Maxillaria_suarezorum_W2895 Maxillaria_synsepala Maxillaria_tenuibulba_W2894 Maxillaria_tenuifolia_W1843 Maxillaria_tigrina_GG20012204 Maxillaria_tigrina_W2991 Maxillaria_tonduzii Maxillaria_trilobata_D6278 Maxillaria_trilobata_P2000 Maxillaria_triloris_B1640 Maxillaria_triloris_B2967 Maxillaria_triloris_W1558 Maxillaria_triloris_W2917 Maxillaria_triloris_W2928 Maxillaria_tubercularis Maxillaria_turkeliae Maxillaria_tutae Maxillaria_umbratilis_B1642 Maxillaria_umbratilis_B1835 Maxillaria_umbratilis_W2600 Maxillaria_umbratilis_W2643 Maxillaria_uncata_A5076 Maxillaria_uncata_SK0075 Maxillaria_uncata_SK0359 Maxillaria_uncata_W2394 Maxillaria_uncata_W2609 Maxillaria_vaginalis Maxillaria_variabilis_A5080 Maxillaria_variabilis_B1076 Maxillaria_variabilis_SK0327 Maxillaria_vernicosa_SK0099 Maxillaria_vernicosa_SK0103 Maxillaria_vernicosa_W1871 Maxillaria_vittariifolia_P2193 Maxillaria_vittariifolia_W1861 Maxillaria_wercklei Maxillaria_whittenii Maxillaria_witsenioides Maxillaria_woytkowskyi Maxillaria_yanganensis Mormolyca_gracilipes Mormolyca_peruviana Mormolyca_polyphylla Mormolyca_ringens_SK0134 Mormolyca_ringens_W2871 Mormolyca_schweinfurthiana_W3109 Mormolyca_schweinfurthiana_W97085 Neomoorea_wallisii Pityphyllum_antioquiense_W2436 Pityphyllum_antioquiense_W2473 Pityphyllum_huancabambae Pityphyllum_pinoides_W1653 Pityphyllum_pinoides_W2401 Pityphyllum_pinoides_W2440 Pityphyllum_saragurense Rudolfiella_floribunda Scuticaria_salesiana Trigonidium_acuminatum_SK0021 Trigonidium_acuminatum_SK0145 Trigonidium_acuminatum_SK0363 Trigonidium_acuminatum_W2442 Trigonidium_egertonianum_SK0317 Trigonidium_egertonianum_SK0361 Trigonidium_egertonianum_W0068 Trigonidium_insigne_W1599 Trigonidium_insigne_W2564 Trigonidium_insigne_W2660 Trigonidium_insigne_W2926 Trigonidium_obtusum_SK0023 Trigonidium_obtusum_W2997 Trigonidium_riopalenquense_A5097 Trigonidium_riopalenquense_W1534 Trigonidium_sp._nov._SK0315 Trigonidium_sp._nov._SK0319 Xylobium_leontoglossum_W1557 Xylobium_leontoglossum_W2683 Xylobium_pallidiflorum Xylobium_sp._SK0166 Xylobium_subpulchrum Xylobium_zarumense taxon_523 taxon_524 taxon_525 taxon_526 taxon_527 taxon_528 taxon_529 taxon_530 taxon_531 taxon_532 taxon_533 taxon_534 taxon_535 taxon_536 taxon_537 taxon_538 taxon_539 taxon_540 taxon_541 taxon_542 taxon_543 taxon_544 taxon_545 taxon_546 taxon_547 taxon_548 taxon_549 taxon_550 taxon_551 taxon_552 taxon_553 taxon_554 taxon_555 taxon_556 taxon_557 taxon_558 taxon_559 taxon_560 taxon_561 taxon_562 taxon_563 taxon_564 taxon_565 taxon_566 taxon_567 taxon_568 taxon_569 taxon_570 taxon_571 taxon_572 taxon_573 taxon_574 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=88; TAXLABELS Anthosiphon_roseans Bifrenaria_tetragona Chrysocycnis_schlimmii Cryptocentrum_peruvianum Cyrtidiorchis_alata_GG944005 Cyrtidiorchis_alata_W2932 Eriopsis_biloba Heterotaxis_crassifolia Heterotaxis_equitans Heterotaxis_santanae Heterotaxis_violaceopunctata Maxillaria_acostae Maxillaria_acuminata Maxillaria_aff_aggregata Maxillaria_alticola Maxillaria_angustissima Maxillaria_arbuscula Maxillaria_augustae_victoriae Maxillaria_aurea Maxillaria_auyantepuiensis Maxillaria_bicallosa Maxillaria_brachybulbon Maxillaria_bradeorum Maxillaria_buchtienii Maxillaria_calantha_W2550 Maxillaria_calantha_W2751 Maxillaria_camaridii Maxillaria_canarensis Maxillaria_cf_variabilis Maxillaria_chartacifolia Maxillaria_chicana Maxillaria_chionantha Maxillaria_confusa Maxillaria_ctenostachya Maxillaria_cucullata Maxillaria_dendrobioides Maxillaria_dillonii Maxillaria_elatior Maxillaria_elegantula Maxillaria_exaltata Maxillaria_ferdinandiana Maxillaria_fulgens Maxillaria_gentryi Maxillaria_gracilis Maxillaria_grayii Maxillaria_guadalupensis Maxillaria_hennisiana Maxillaria_horichii Maxillaria_imbricata Maxillaria_laevilabris Maxillaria_lepidota Maxillaria_longipetiolata Maxillaria_longissima Maxillaria_lueri Maxillaria_meridensis Maxillaria_multicaulis Maxillaria_nardoides Maxillaria_nasuta Maxillaria_notylioglossa Maxillaria_ochroleuca Maxillaria_oreocharis Maxillaria_pacholskii Maxillaria_pachyachron Maxillaria_paleata Maxillaria_parviflora Maxillaria_ponerantha Maxillaria_porrecta Maxillaria_proboscidea Maxillaria_procurrens Maxillaria_pulla Maxillaria_richii Maxillaria_scalariformis Maxillaria_schunkiana Maxillaria_silvana Maxillaria_sophronitis Maxillaria_suarezorum Maxillaria_triloris Mormolyca_peruviana Mormolyca_ringens Pityphyllum_laricinum Pityphyllum_saragurense Trigonidium_acuminatum Trigonidium_egertonianum_SK0317 Trigonidium_egertonianum_SK0361 Trigonidium_insigne Trigonidium_obtusum Trigonidium_sp._nov._SK0315 Xylobium_leontoglossum ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3437] TITLE Maxillaria_rpoC1_ITS_matK_atpB; LINK TAXA = Taxa2; DIMENSIONS NCHAR=7214; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 6060 6070 6080 6090 6100 6110 6120 6130 6140 6150 6160 6170 6180 6190 6200 6210 6220 6230 6240 6250 6260 6270 6280 6290 6300 6310 6320 6330 6340 6350 6360 6370 6380 6390 6400 6410 6420 6430 6440 6450 6460 6470 6480 6490 6500 6510 6520 6530 6540 6550 6560 6570 6580 6590 6600 6610 6620 6630 6640 6650 6660 6670 6680 6690 6700 6710 6720 6730 6740 6750 6760 6770 6780 6790 6800 6810 6820 6830 6840 6850 6860 6870 6880 6890 6900 6910 6920 6930 6940 6950 6960 6970 6980 6990 7000 7010 7020 7030 7040 7050 7060 7070 7080 7090 7100 7110 7120 7130 7140 7150 7160 7170 7180 7190 7200 7210 7220 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anthosiphon_roseans TGTCGAAATTCTTTTTTGA-----------AAA-GTCCT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGATTAATTCCATAAGA---CCCTAATAACTAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCACTCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTAT---------------------------------------------TGTATTTTTTTTTT-------ATTGGGG-------------------TGGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTAC-----------------------------------------GATTT-CTATTCAATTT----------------------------CAA----TTTCCTATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTCTT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTCTTTGATTTTTTTTT-------------------------CTCTTTATTTTGATATTTT------------------------------------------------------------------TATTCATTA-----------------------------------TAAAAATGAGTAT-AAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATGAAAGATTATAAAATAATG--------------------AGGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCACT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTCA-TGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCTATAGTTTTCTTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTGTTCTCAAATGGTATCAGAAGGTTTTGGAGCCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCATGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTAGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGAAATAAAAGATTCTTTTGGTTCCTACATAATTCTCATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTCTATTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTCTAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGATATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCA------------------------TGAAAAAAAAAAAAAAAAAAAAGATTTATTAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGATGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----CTTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCAAAA----TA-TA--GACCGAGCGATTCGGAGAACCCGTGAAT--TGATCCAA--CGGCCGTCCT-GGCTGTCG----TCCTCATCTC-CTCATC--GCGGGAAGGAGGG----CGCGGTGGAGGATGGATGAAAA-------CACAAA--CTGGCGCAGCATCGCGCCAAGGGAAA----GACCG-AAAGGCACGAGCCCCGCGTTGGG--CTCGGTGGTG--TGGGGTGCAGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCATCGGGCGTGTC-GGTCG--AGGCCCGGATGCGTAGAGTGGCTCGTCGTGCCA--GTCGGCGCGGCGGGCTGAAGAGCACGTTG-CGTC-TC--GCTGGCCGCGAACA-ACACGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGACGGCCCGAGAGACGGTTCGTGTC----TTTGAAGTG--ATCCCGAC-CCATGCGC--CCATGGAGCATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGACCACCCGCCGAGTTTAAGCATATCAATAAGCGAAGGAAAAG--------------------------------------------------------GGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAAATTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCCTTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGAGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCGCATTTCCTTTTTTTTTTT-CGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAA--TAAAAAGAAAATA-GA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATTCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGAGAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAATAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCAGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGAAAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAAT?????????????????????????????????????? Bifrenaria_tetragona TGTCGAAATTATTTTTTTA-----------AAA-GTACT-GAATCGAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAG-----------AAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCAAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTT---ATTGTA-TAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTTTTCTATTT-ACTA-----------------------TATAGACTA---TATAGACTAT--ATAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC--------------------------------------------------------TTTATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTT------------------------------------------------------------------------------------------------------------------------------------------TTTCATTTTATT-----------------------------------------------------------------------------------------------------------------------------------------TGATGTTTTTTTTT-----------------------TTCTTTATTTTGATATTTTTATTTCTTTTTCTTTTTTT----------------------------------------------ATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TCAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATTAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTATAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGAATGAAAA-------------AAGATAGACATTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAACTTCAATAGTTTGATTTTTTATGAACCTATAGAAATTTTCGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATTTTTGATTTCTTCGGTGAATGATTCCAACCAAAATGGATTTTGGGGTCAC---------AATAATTCTTTTTCTTCTCATTTTTCTTCTCAAATGGTATCAGAAGGTTTTGCAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAGATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTTGAATATCTATTCCTGTTTCTTCGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCTTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAATAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATAATCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATCGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAATTGATCTGGACCAATTTATCGGATTCTGATATTCTTGATCAATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAGATTACATTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTCTTTTTGGAAGAAGAACAATATCTTTCTTTAATCTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAAAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCCTTCATGATTGTTCATGATACATTTT-----CATTTTCATGAAAAAAAAAAA---------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTATTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA-ATACCGAGCGATTCGGAGAACCCGTGAAA--TGACCGAA--CGGCCGTCCT-GGTCGTCG----CCCCCATCCC-CTCTCC--GCGGGGAAGGGGG----CATGGCGGGGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGACACGAGCCCTGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCAGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAG--CTCCATCCC--GAAAATGGGCATGTC-GGCCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCA--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCTTGCCGCGAACA-ACAAGGGGTGGG-TG-AAATCTATGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGAATTGTGCC----TTCGATATG--ATCCCGGC-CCATGCGC--CGATCGA--------CGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGGAACATGAAGCTCAGAATTATGGGTGCATTCAATACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCCGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCCTATTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTACTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAAGAAGAACCCTTTTATTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCATGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATATCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGACGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGAAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATCGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGGCGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGGGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Chrysocycnis_schlimmii TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATC-AAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---ACTTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAA-------TTTTTTCTATTGTA-TAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTAGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCTTCTATTCTTTTTTTTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--A-AATTT-ACTATAATATA-----TAATA--TAACTATAATATATATA-TATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA---------------------------------------------------------------------------------TTTTTTTATATA---------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTAGATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATTGGAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCCTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTTTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACTTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGCTTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTAAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAACGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCCGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTATTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGTGGGTGGGTG-CGTGGCTGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCC-CGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTTGTGCTGGCCCGAGAGACGTTTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCA{CG}GGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTCAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTACTTTATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACAGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAACTGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGAACCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCGGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Cryptocentrum_peruvianum TGTCGAAATTCTTTTTTGA-----------AAA-GTCCT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAAGAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTATTCTAT-----TTCTAT---------------------TGTATTTTTTT------------------------------------TTGTT-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCGAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-CTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTCC-----------------------------------------GATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTCTG---------------------------------------------------------AATAATTCTTATTCTTTTTT------------------------------------TT-------TTTTTT--TTTTATT--ATTTTTTTTT-------------------------CTCTTTCTTTTGATATTTT------------------------------------------------------------------TATTCATTA-----------------------------------TAAAAAGGAGTAT-GAAGAATAATAAATATGATATAGAATAG---------GAATATAAAAAATA---------------------TTCATAA------ATTCCTAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTTAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGATTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AACTATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTT-AATGGCAGAATTACAAGGATATTTAGATCTTCAA-----------AAAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAAGAGTTTT---------GAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCGTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AATAATTCTTTTTCTTCTCATTTTTCTTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCTCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATACGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTTTTTTTTCACGAATCTCATAATTTGAAGAATCTCATTACTTCAAAGAAATTTATTTACCTCTTTTCAAAAATAAATAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTCTAGTCATG---------TGTTGTAATTCTTTTCATAGGATCCTATGGTTTCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCTTCTTGTGAATTTTTGGCAATCTTATTTTCATTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTTTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTGATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCATTATCATAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGCTTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATAAATGATCTAGTGGATCATTCATGATTTTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TCTTTATGAATTTGTATTCTGAAATGCTCATATATCATCCTATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--AATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-AA----CCGAGCGATTCGGAGAACCTGTGAAT--TGAGCCAA--CAACCGTCCT-TGCCGTCG----TCCTCGTCTC-CCCCTC--GCGGGGAGTCGGTG---CGCGGCAGAGAACGGATGAAAA-------CACAAA--CCGGCGCAGTATCGCGCCAAGTGAAA----CATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCA--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATATGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCAT--GCCAGTGTGCGTGCC-GTATT--TGGTTCGGATGTGTAGAGTGGCTCCCCGTGCCCT-GTCGGCGCGGCGGGCTGAAGAACACGTTT-TGTC-TC--GCTGGCCGCGAACA-ACACGGGGTGGG-TG-AAAGCTATGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGAGTCGTATC----CCTGAAGTG--ATCCCGTC-CCATGCGT--CGATTGA-CATGCGGCAGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAATTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGACGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGTATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAACAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTT-----AATTATACATTCTATTTCTTTTAAAAA-GAAATTCTGTTCAGGC--AAGCACAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGTACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCGCATTTCCTTTTTTTT----CTTAAACATAAAAGAAAGTAAAAAAGGTTATAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATTAATAAAAGGCTGGGCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATATCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGAGAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTGCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGAGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGACATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCGGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAGGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Cyrtidiorchis_alata_GG944005 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAACCCAATTCAATCCTTTACTCAGTGAATGAGTAAATTTTCCATTTTTTCTATTGTACTAT--------------------TTTATATTGTTGTATATTGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCCTATTTGTTCCCCTTTTATAGA-----------TGAATTATAGATGAATTATGACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-AGTATAATATATATATATCTTTATATATTTTATTTAATA---------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ACTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAATTTGATTT-ATATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTT------------------CA------------------------------------------TTGAA-TTATATTTATT---------------------------------------------------------AATAATTCTCATTCTTTTTA-------------------------TTATTTTTGAATT-GAAAAATTTTTTCATTTTATTTGATGCTTTTTTTT-----------------------ATCTTTATTTCGATATTTTTCTTTCTTT--------------------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGACAAAATA---------------------TTC--------------AGAAGGTCA--TGAATTCCATTATAAAT----ATAAA----------------TTTTCAAAACGAAGACT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTCTCGAA---------TCATTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATCG------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGAAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTCTTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCTCTTGAAGAAAAA---ATAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTAGCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATTTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAATAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGATTATCTTAGAATCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCTTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAATGTACTAAAA---AATTCCTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTATGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCCGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGAATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----CTTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAAT---TA-TA--CACCGAGCGATTCGGAGAACACGTGAAA--TGAGCCAA--CGGCCGTCCA-CGACGTCG-----CCTCGTCTC-CTCCTC--ACGGGGTGTGTGGGGG-CGCGGCGGAGGACGGATGGAAAA------CACAAA--CCGGCGCAGCATCGCGCCAAGGGATA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGG-TGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCCCCTACAGTGGGCG--TT-GGTTG--AGGAC-GGATGTGCAGAGTGGCTCGTCGTGCCA--GTTGGTGCGGCGGGCTGAAGAGTGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGTTGTGAGCGCAGCCTGCGTTGTCTTGTGCCGGCCCGAGAGACGGGCTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAG?------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cyrtidiorchis_alata_W2932 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAACCCAATTCAATCCTTTACTCAGTGAATGAGTAAATTTTCCATTTTTTCTATTGTACTAT--------------------TTTATATTGTTGTATATTGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTATAGATGAATTATGACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTATATTTACTATAG-----------------------AATTTAGTAA-TAGAATTT-AGTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTATTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGAATTTATATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTT------------------CA------------------------------------------TTGAA-TTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTGAATT-GAAAAATTTTTTCATTTTATTTGATGCTTTTTTTT-----------------------ATCTTTATTTTGATATTTTTATTTATTTTTCTTTTTT-----------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTATAAAT----ATAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGTACCGAA-CCCTTTTCGTA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGT-GTTTAGG-GAATCTTTTTTT-CATTGT--------------?AATAT------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGAAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTCTTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGGGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCTCTTGAAGAAAAA---ATAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTAGCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATTTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAATAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACGCATTTCTATGGAAAAATAGATTATCTTAGAATCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCTTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAATGTACTAAAA---AATTCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTATGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCCGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGAATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----CTTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAAGAAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAAT---TA-TA--CACCGAGCGATTCGGAGAACACGTGAAA--TGAGCCAA--CGGCCGTCCA-CGACGTCG-----CCTCGTCTC-CTCCTC--ACGGGGTGTGTGGGGG-CGCGGCGGAGGACGGATGGAAAA------CACAAA--CCGGCGCAGCATCGCGCCAAGGGATA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGTG--TGGG-TGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCCCCTACATTGGGCG--TT-GGTTG--AGG-ACGGATGTGCAGAGTGGCTCGTCGTGCCA--GTTGGTGCGGCGGGCTGAAGAGTGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGTTGTGAGCGCAGCCTGCGTTGTCTTGTGCCGGCCCGAGAGACGGGCTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAG?------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Eriopsis_biloba TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA-----------AATAAAT-------------------GGGAGTTAGCATTTGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCCATTTTTTCTATTGTACTAT-------------------------------------TGTATATTGTATTTTTTTTTTATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTTACTAT--AAGATAT-ATATAT---------------------------------CTTTATATCTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATATCTTTACTTTAGAA-------------------------------------------------------------------TTT--------TTTAATTCT----------------------------AAT----TTATAATTTTATTTCTATT-----------CAATTGAAATTGAATATTT---------------------ATCTATTTTAATTGAAATTATATTTATT---------------------------------------------------------AATAATTATTATTCTAATTATTCATTCTTTTTATTATTTTTCAAATTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------GAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAAGA---------------------TTC--------------AGAAGGTGA--TCAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCA---------------------------------------TTAGTTTAGTAGTTTAGGTGAATCTTTTTTT-AATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAGTTACAAGGATATTTAGATTGAAAA-------------AAGATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTATTTTTCTTCTCATTTTTCTTTTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAAATATCACATTTAAATTATGTTTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTCCACGAATATCATAATTTGAATAATATCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTTGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTCGTAAACAGTCTTATTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCGATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATACTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCATTTATTTATCTTATAGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTAGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTGTTGGAAGAAGAACAATCTCTTTCTTTAATCTTCCTACAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTCTT-----CATTTTCATGACAAAAAAA-----------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTATTATC--AATATGTAATTATTTTTT-----ATTTTTTATTGATA-------TATACATAGGGAAAGCCGTGTGCAATAAAA-CTC-AAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCGAA--CGGCCGTCCC-GGTCGTCG----CCCCCATCTC-CTCTTC--GGGGGGGAGGGGG----CGCGGCGGCGGAAGGATGAGAA-------CACAAAA-CCGGCGCAGCATCGCGCCAAGGGAA-----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAG--CTCCGTCCC--GCCAATGGGCGTGTC-GGCCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGCTGAAGAGCGGGCTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGTGACGGACCGTGCC----CTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAGATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTGAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGGAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCCGTAAAAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATCGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCAAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAATAAAGTAAAAAAGGTTAGAGCGAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCCGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAAGAAGAACCCCTTTATTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTCTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGACGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCCGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGAAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGGCGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATAGGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Heterotaxis_crassifolia TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------AGATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AACTATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGGAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTAGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTGACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAACAATTACCTAACTATTCCTTCTATTTTTTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTCGCGATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCGGAGAACCTGTGAAAA-GGAGCCGA--CGACCGTCCT-GGCTGTTG----CCCCCGTCTC-CTCCTC--GTGTGGAGGGGGG----CGCGGCAGAGGACGGATGAAAAA------CACAAA--TCGGCGCAGCATCGCGCCAAGGGAA-----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGTG--TGGGGTGCTATTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCACTCCGTGCCGC--CTTCGTCCC--GCCAGTGGGCGCATC-GGTCG--AGGCTTGGATGTGTATAGTGGCTCGTCGTGCTC--GTCGGTGCGGCGGGCTGAAGATCGGGTTT-TGTC-CC--GTCGGCCGCGAACA-ACAAGGGATGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGTCAGCCAGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGGAC--CGATCGG-CATGCCGTGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGAGAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAAACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGGGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Heterotaxis_equitans TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACTTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCAGGGTCCTCTATTCTTTCTTCTTTTTTTTT---C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------TTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AACTATTT------GAAAGGTTTCCCTTTTTTT--------G?TTACTGTTTAC?TGTATTTA?ATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAAGAGATTTAGGCT?CAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCAATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAACAATTACCTAACTATTCCTTCTCTTTTTTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAGTTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCAAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTCGCGATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTTGGAGAACCCGTGAAAA-TGAGCTGA--CGATCGTCCT-GGCTGTTG----CCCCCGTCTC-CTCCTC--GCGTGGAGGGGGG----CGCGGTGAAGGACGGATGAAA--------AACAAA--TCGGTGCAGCATCGCGCCAAGGGAA-----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCTGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCTAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTCGTCTACCCTTAGTGGGCTTGTC-GGTCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGTGGGTTT-CGTC-CC--GTTGGCCGCGAACA-ACAAGGGATGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCTGGCCTGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGTGT--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCAAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATATTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAATAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAAAGAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTTTATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAACAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTGCTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGGGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGCGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTATAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Heterotaxis_santanae -----------------GA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCAAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGCCCTCTATTCTTTCTTCTTTTTTTTTTC-CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTG-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTCTTTAAAA---------------------ACCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTATA-------------------TTGAAAT-----ATTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTATT--------------------------------TTTTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------CTAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGCTTC?ATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGCCAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTGTCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAAGTTTTTTTGGAAGAAGAACAATCCCTTTCTTTAATGTTCCTCCAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCGGAGAACCAGTGAAAA-TGAGCTGA--CGACCGTCCT-GGCTGTTG----CCCCCGTCTC-CTCCTC--GCGTGGAGGGGGG-----GCGGCGGAGGATGGATGAAA--------CACAAAA-TCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGTTGTCGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTCGTCCC--GTCAGTGGGTGCGTC-GGTCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGTCTGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGTGCC----TTCAATGTG--ATCCCGGC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGAACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCACAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATTTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCCTTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Heterotaxis_violaceopunctata ?GTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAA-GAAATAT-CCGATAGCAAGCTGATCGGTTAATCCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGCTAGCATCCGATTGAGCAATCGAATCCAATACAATCCTTTACTCAGTGAATGAGTCAATATTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTATAG--------------------------------AATTTACTAT--AATATT--ACTATAATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATT-----------------------------GAAA---TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTT----------------------------------------------ATATTCATATTCTATTTTATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTT-TTATAAT--------------------------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGG-GAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAACAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCAGAGAACCCGTGAAAA-TGAGCCGA--CGACCGTCCT-GGCTGTTG----CCCCCGTCTC-CTCCTC--GCGTGGAGGGGGG----CGCGGCAGAGGAAGGATGAAAAA------CA-AA---TCGGCGCAGCATCGCGCCAAGGGAA-----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTTTGGCACACCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCTAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCACTCCGTGCCGC--CTTCGTCCC--GCCAGTGGGCTCGTC-GGTCG--AGGCTTGGATGTGCAGAGTGGCTCGTCGTGCCT--GTTGGTGCGGCGGGTTGAAGAGCGGGTT---GTC-CC--GTCGGCCGCGAACA-ACAAGGGATGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGAGCC----TTCGATGTG--ATCCCGGC-CCATGGGC--CGAACGG-CATGCCGCGGCTTGGAATGTGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTATTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAATAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCACAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAAGGATATCATGTACATAACCATCAAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTGGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGGGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCTGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_acostae TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGGG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------TCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TA-----------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------CATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTCTTTCTTTTTATTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AGATATT-------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTGAAATGGCAGAATTACAAGAATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAATTTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAAGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTCTGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGCCGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCCACCTTCTAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATTAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATG-------------------AATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCACAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCAAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAAAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_acuminata TGTCGAAATTTTTTTTTGAT----------AAA-GTACT-GAATCGAAAATAAATATTCCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTT-------------TTT-TG-------------------TTGTG-CACCTATTC-TTCTT-------------------------ATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTCTTTTTTTT--------CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTT------CTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTTA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTTATTCTGGAAATTCCATTCTCATCGCGATTAGGATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTT------ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACAGAGCGATTCGGAGAACCCGTGAAA--TGATACAA--CGGCCGTCCT-GGCCGTCG----CCCCCGTTTC-CTCCTA--GCGGGGTGGGTGAGGG-CGCGGCAGAGGAAGGATGAAAAAAAAA--CCCAAA--CCGGCGCAGCATTGCGCCAAGGGAAA----GAATG-AAAGACACGAGCCCCGCGTCGGG--CTCGGTGGCGT--GGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTTCGTCCC--GCCAGTGGGCGTGTC-GGTTG--AGGCC-GGATGCGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGCAT-CGTC-TC--GCCGGCCGCGAACA-ATAAGGGGTGGG-TG-AAAGCTATGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTCTACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGCGCAAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGGAAGGAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTTGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_aff_aggregata -----------------GA-----------AAA-GTACT-GAATCAAAAATAAATATTCCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------AGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTG-ACTATA-TATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TATTTAC---------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTTC----------ATATTATAATTGAATTATA--------------------------------TTGAAATTCTATTTAAT---------------------------------------------------------AAGAATTATTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTGATTTGATTTTTTTTTT------------------------TTCTTTATTT--------------------------------------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------TAGAAA-TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CAGGTG--------------TAA---------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTATCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCCATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTCTAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TC-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCC-GGCTGTTG----CCCCCGTCTC-CTCCTC--GCGTGGTGGGGGG----CGCGGCGGAGGATGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCACGTCGGG--CTCGGTGGCA--TGGGGTGTTGTCGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTTGTCAT--GCCAGTGGGCGTGTT-GGCTG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-TGTC-TC--GCCGGACGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGA--CGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_alticola TGTCGAAATTCTTTTTTGAATTCTTTTTTGAAAAGTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTGGG--------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-AGTATAATATATATATATATA-TA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTTCATATTAT----------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTCTTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGAGATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTAAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCGTTAATGTTCCTCAAAAAAATCCCTTTTCTTTTACACGGATTACATAGAGAACGTATTTGGTATTTAGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------TATTCATGAATTGATATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGGAA----TA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCC-GGCTGTTG----CCCCCTCTCC-TCC-TC--GCGTGGTGGGGGG----CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCACGTCGGG--CTCGGTGGCA--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC-CTTCGTTCCC--GCCAGCGGGCGCGTT-GGCTG--AGGCACGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-TGTC-TC--GCCGGACGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTTAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGTTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCACCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGATATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_angustissima TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGG---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTATAGA----------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTACTATTTATCTATTTG------------------AATTGAATTCTA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTCTATTTTTCTTTCTTTTTATTTTTTTT---------------------------------------------TTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATACCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCACTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCATTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTATATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCAAAA----TA-TA--CACCGAGCGATTCAGAGAACCCGTGAAA--TGAGCAAA--CCGCCGT{CT}CT-GGCCGTCG----CCCCGGCCTC-CTACTT--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATTAAA--------CACAAA--C{CT}GGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCTGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--GCCAGCGGGCG--CC-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCAGGTTT-CGTC-TC--GCCGGTCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACTA-GTG--ATCCCGAC-CCAAGCGC--CGATCAG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGAGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCTTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_arbuscula TGTCGAAAATCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-TCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCCTTTTTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAG-GGTT-------------CCGGGGTCTTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA-----------------------------------TTTA-------------------------------------TTATA--------------------------------------------------TATTTATTATTTATATA--------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------------------------------------------------------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAATTTCCTATATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTTGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTTATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGAGATTGTTTTTTCACGAATCTCCTAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCCTACATTATGTTCGATATCAAGGAAAAGCAATTTTAGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGGAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTGGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCATTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CTGCCGTCCT-GGCCGTCG----CCCCCGTCTC-CTCCTC--GTGGGGTGGGTGGGGG-CGCGGCGGAGGACGAATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAA-----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCAAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCG--TC-GGGCG--AGGCCCGGATGCG{CT}AGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AATGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATAGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAAACCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCTATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCGTCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTTATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATTCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGCATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGATTTTAAGTATACAAAAGAGCCATATTTTTCTAGTTC Maxillaria_augustae_victoriae TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATAATATAATTTACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATACTTTATAGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCATTT------------------TATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTT------------------------------------------------------------------------CTTCATACTCATTTTTATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------GTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATTTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATCCTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--?ATACGTAATTCTTTTTT-----ATTTTTGATTGATA-------CATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATAAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--CCAAGCGGGCG--CC-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGAC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-CTTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_aurea -----------------GA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGCTCAATCGAATCCAATTCAATCCTTTACTCAATGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTTT------ATTTGGG-------------------TGGGG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------AGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTGCTGTCAAGAGAA-GGGG-------------CCGGGGCCCCCTATTCTTTCTTATTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTTAC---------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTTC----------ATATTATAATTGAATTATA----------TTGAAAT--------------ATTGAAATTCTATTGATT---------------------------------------------------------AAGAATTATTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTGATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----ATAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAATTTAGTAGTTTAGGTGAATCTTTTTTT-CAGTGT--------------AAA---------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTATCAAATGGCATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATATTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTAATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCAGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCC-GGCTGTTG----CCCCCATCTC-CTCCTC--GCGTGGTGGGGGCGGGGCACGGTGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAACCCCACGTCGGG--CTCGGTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGGCTGCC---TTCATCCC--GCCAGTGGGCGCGTT-GGCTG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGACGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTTAGCGCAGCCTTCGTTGTCTCATGCCGGCCTGAGAGACGAGTTGTGCC----TTCAATGTG--ATCCCGAC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCAAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCAAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAAGGATTGCTAAAAGCAAAATTCGGAAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACGGGCGTTCCAACCCATTTTAGTGGGGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_auyantepuiensis TGTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTAGTGTACTTA-------TTGTACTAT---------------------TGTATATTTTTTTTTTTTT--ATTGGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGGA-GGGGC------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-ATATTCAATTT----------------------------CCA----TTGAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTATTATTTTA-----------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------CTATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTTGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAAAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGACTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTCTGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TG--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGGCCGCCCC-GGCCGTCG----CCCCCGTCGC-CCCCCC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGATGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAA-----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGG-CGTGCC-GGCCG--GGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GCCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCCGCGTTGTCTCGCGCCGGCCCGAGAGACGGGCAGTGCC----TTCGACGTG--ATCCCGAC-CCACGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGGATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGT-AAAAAATACTTTTTGCGAAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCTTT----------CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGAAAAATAAGATAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCAAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TATAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_bicallosa TGTCGAAATTATTTTTTGA-----------AAA-GTCCT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCTAATTCAATCCTTTACTCATTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTAACATATTCGTTCCCCTTTTATA--CTT-TTATAGATGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-AGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATA------------TAACTAGAATATATA----GAAATTTACTATATTTACTATAATTATATTTACTATAATAT-TATAATATATA-------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTT-------AATATCTTTACTTT-------------------------------AGAATTTGATTT-TTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATG-----------------------------------------------TTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAAT---------------------------GAATATAAAAAATA---------------------TTA--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGATTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCATTAGTTTA------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGCAGAGATATATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTTTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAAATATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAAGAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATATTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTTTGACTAATAAATTAGATACCATAGTTCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTCTTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAGATTCTTAGACTTTCTTCTC--GAGATGTAA----------------TTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CACCGAGCGATTGGGAGAACCTGTGAAA--TGAGCCAA--CGGCCGTCC?-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGAGGGGGG----CGCGGTGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAAA--GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCGGTTGGCGTGTC-GGCGG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGCGCGACGGGCTGAAGAGCGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGTTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGAGTTGTGCC----TCCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATC-TGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGTCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAAAGAAATTCTGTTCAGGC--AAGCACAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGAGAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACATCCATTAGTTTGTAAGGGCTTCAACGCAGATTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_brachybulbon TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAAGAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTT---------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATTTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTATTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTCTCTATTTT------------------AATAGAATTCTA---------------------------------------------------------------------------------------------------------------TTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTTATATTTTT-----TTTTTATTTTTTT----------------------------TTATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAATTTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGTTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTTATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CGGCCGTCCT-GGCCGTCG----CCCACGCCCC-CTCCTC--GCGGAGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTG-CG--TGGGGTGCTGTTGCACGCCATTCGGATGTACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--TCCTGCGGGCG--GC-GGCCG--AGGCACGGATGTGAAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGTGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTCTGAGCGCAGCCTGCGTTGTCTCGCGCCTGCCCGAGAGACGGGCGGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGACACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAAAAACTGTCATCCCATTGAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAATAAAAAGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACAGAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-CTTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGCCAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_bradeorum TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTATTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------TTTTA-------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTTAGAACTTT-----------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTATTTGATGTTTTTTTTTTTT--------------------CTATTTATTTTGAGATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAATAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TTAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCAAA----------TTTTCA-------------------------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTTATTTCTTCGGTGAATGATTCTAACCAAAATGAATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGATAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTGGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATAATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------AATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTATC--GATATGTAATTATTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCCG--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCG--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--ACCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGCGCC----TTCGATGTG--ATCCCGGC-CCACGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATCCTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---TGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGCTAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_buchtienii TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTT-----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATATTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGGTTTTTTTTT----------------------CTCTTTCTTTTTATATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAG---------GAATATAAAAAATA---------------------TTCAGAAAAAAATATTCAGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAT------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTCTTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATTAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTTTTTTTCATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCC-GGCCGTCG----CCCCCGCCCC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGAAGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCTCGTCGCTCCGTGCCAC--CGGCGTCCC--GCCAGCGGGCG--TC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAG----------------------------------------------------------------------------------------------------------------------------------------CCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTG---------TTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_calantha_W2550 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATT---------------------------------------------------------------------------------------TATATA---------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTATTATTT-------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTGATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTT----------ATTTTTTT-----------------------------------------------------------------------------------------------------TAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCTTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGTAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGAATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAAAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGCGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTTGGAGAACCCGTGAAA--TGAGCAAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTG-CTCCTC--GCGGAGCGGGCGGGGG-CGTGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--TC-GGCCG--AGGCCCGGATGTGCAGAGTGGCCCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATTCGC--CGATCGG-CGTGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAG?------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Maxillaria_calantha_W2751 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-TATATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATTTATAATATTTATAATTTATATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTATTATTT-------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTT----------ATTTTTTTT-----------------------------------------------------------------------------------------------------AT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTT--CTTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGTAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGAATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCTCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAAAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTAGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGA??????????TTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTG-CTCCTC--GCGGAGCGGGCGGGGG-CGTGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--TC-GGCAG--AGGCCCGGATGTGCAGAGTGGCCCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CGTGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATATTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCGCAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACATCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_camaridii TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCAGATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTATTATTTT------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTATTTATTTTGAGATTTTTCTTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACGAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAAAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTATATAATTTTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTTATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAACAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATATTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG-----CCCCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCATGAGCCCTGCGTCGGG--CTCGGTGGCG--TGGGCTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATATGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--GTTGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTCGTT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCAGAGAGACGGGTTGCGCC----TTCGATTTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGAGCCCAGGACGGGCGAGGACACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAA-TACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGAAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTT--CGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCAATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTTGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_canarensis ---------------TTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGATGATCGGTTAAATCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------AGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTTAC---------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTTC----------ATATTAGAATTGAATTCTA----------TTGAAATA-TTGAATTGAAATATTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTA-----------------------------------TAAAAAGGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCCAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CAGTGT--------------AAATAGTT------GAAAGGTTTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTATCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCCATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CTACCGTCCC-GGCTGTTT----CCCCCGTCTC-CTC-----GCGTGGTGGGGGG----CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCACGTCGGG--CTCGGTGGCA--TGGGGTGTTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTCGTCCC--GCCAGTGGGCGCGCT-GGCTG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-TGTC-TC--GCCGGACGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTTAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGG-TTGTGCC----TTCAATGTG--ATCCCGGC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCAAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTCATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_cf_variabilis TGTTGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-----------------TTGTATATTTTGTATAT---TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCTTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTTTT--------------------TTCTTTATTTTTAGATTTTT----------CTTTTTTT----------------------------------------------ATATTCATTA-------------------------------------------------------------------------------------------TAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTTGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAATAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTTAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGAATCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGAT----------ACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACACGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGTCCC-CTCCTC--GTGGGGTGGATGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTCGGGG-CTCGGTGGCATATGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCGC--GCCAGTGG-CG--TC-GGCCG--AGGCCCGGATGCGCAGAGTGGCCCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGTGGTGCC----TTTGACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCAGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAATATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGCATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_chartacifolia TGTCGAAATTATTTTTTGA-----------AAA-GTCCT-GAATCTAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCTAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TTTTTACTAT--TCTATTT-ACTAT----------------TTTTACTATA-------------------------------------------------------------TTTCTTTTTTTTTTCTATTTACTATATTTACTATA------TTTACTATATTTACTATAATATATTTATAATATATTATAATA-TATATATA--------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AATAATTCTTATTGTTTTTA-------------------------TTCTTTTTCA------------------TTTTATTTGATGTTTTTTT-------------------------CTCTTTATTTTTATATTTTTATTTATTTTTCTTTTTTT-ATATTTTTT------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGATTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTCTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTCTAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAAAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTCTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATTCCTTTTCTTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGG?TTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-CA--CACCGAGCGATTGGGAGAACTTGTGAAA--TGAGACAA--CGGCTGTCCT-GGCCGTCG----CCCTCGGCTC-CTCCTC--GCGGGGAGGGGGGG---CACGGTGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAAA--GATCG-AAAAGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGTAGATTGGCTCGTCGTGCCT--GTCGGTGCGACGGGTTGAAGAGCGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACATGGGGTGGG-TGAAAAGTTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGAGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCAAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATAGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATCGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTGAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_chicana TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAACCCAATTCAATCCTTTACTCAGTGAATGAGTAAATTTTCCATTTTTTATATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTAACATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTATTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-AGTATAATATATATATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTATATATTTTCTTTAATATCTTTACTTTATCTTTACTTTAGAA-------------------------------------------------------------------TTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTT------------------CATTGAATTATA----------------------------------------------------------------------------------------------------TTTATTAAGAATTCTTATTCTTTTTA-------------------------TTATTTTTGAATT-GAAAAATTTTTTCATTTTATTTGATGCTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTTTTT--------------------------------------------------------CTATTCATTA-----------------------------------TAAAAAGGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTAGAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTCTTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGGGAAACGTTTAATTACTCGAATGTATCAACAAAAATCTTTGATCTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTATTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCAATTAGTATCTTCTCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCCCATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTATTGCGATTGTTTTTTCACGAATCTCATAATTTTAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTGTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTAGAATCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAAGATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGGACTTTGGCCCGTAAACATAAAAGTACAGTACGGACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGT?CCTCCAAAAAATCCCTTTTATTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TTATA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGTCGTCCA-CGACGTCG-----CCTCGTCTC-CTCCTC--GCGGGGTGGGTGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGATA----GATTG-GAAGGCATGAGCCCCGCGTCGGG--CTCGGTGGCA--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGTCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTTGCTCCGTGCCAC--CTGCATCCC--CCTACAGTGGGTGTT-GGTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCACGGTGGGCTGAAGAGTGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGTGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGTTGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCTGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAG?------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Maxillaria_chionantha TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATATATA----------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------ATAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTATTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTTCTATTTTTCTTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTATTTTTTT--------TGTTACAGTATAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTATCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAA?TTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAAATTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTAAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCTTCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTGATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCCTGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CCGCGTCCC--GCCAGCGGGCG--CC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTCCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCTAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTACCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGGGTGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAGTCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTTATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGATTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_confusa TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATAATATAATTTACTATAATATATATAATATAATTTACTATAATATATATAATATAATTTACTATAATATATATAATATAATTTACTATAATATATATAATATAATTTACTATAATATATATAATATAATTTACTATAATATATATA--------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTT--ATTATTATTTTA--------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATACCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTGTTATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACAATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGAGCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACAGAAA----TA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TCAGCCAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCCC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGGGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--TTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGAAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAA--ACGCGTCCC--GCCAGTGGGCG--CC-GGCCG--TGGCTCGGATGTGCAGAGTGGCTCGTCGTGCTC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAGGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTATGTTCAGGC--AAGTGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTTTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAACAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGCGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_ctenostachya TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTTGATTT-----------------CTATT------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTATTTGATGTTTTTTTTTTT---------------------CTATTTATTTTGAGATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATAAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTTCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTTTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTAATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGACCGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGGTGGCG--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCGGAGAGACGGGTTGCGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATGGCGATGGGTGATTTGATCGAAATTTTCTTTTGACGAATTTGGACTGAAAAACTGTCTTCCCATTTAATCTGATGGGAATGCCCCTGGTTCTAACATGTATCTGGGGAGGAGTAACATGAAGCTCAAAATTATGGGTGCATTCAAAACTTCAAAAGGGAAAAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAATAATTTCACATTTCCTTTTTTTTT---CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTGAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_cucullata TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAAT-------------ATTTACTATAATATATATA-TA-----------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATATCTTTACTTTTTTTCTTTAATATCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA-------------------TTGAAT----ATATTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTATTTATTTTGATATTTTTATTTCTTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----ATAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAATTTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAAAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTAATTTTCAAGTGTACTAAAA---AATCCCTTGGTAGTAAGAAATCAAATGCTAGAGAAT?CATTTCTA?TAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGAACGAAA----TA-TA--AACCGAGCGATTCGGAGAACCCGTGAAA--TGAGTCGA--CGGCCGTCCC-GATCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGATGTTGCACGCCATGCGGATTGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATATGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGCCGAGGGCACGTTCGCCTGGGCGTCAAGCATCGCGTCGCTCCGTGCCAC--CTCCGTCCC--AAAAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CATC-TC--GCCGGCTGCGAACA-ACAAGGGATGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGCGCC----TTCTATGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAATCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTTT----CAACATAAA-GAAAGTAAAAAAGGTTAGAGCAAAA-TCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTGAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_dendrobioides TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT--CAT------ATTTTTCTATT------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTT-------------------------TTCT----------------ATTTATTTTTCTTTTTTTT---------------------------CTATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT----------------------------------------------------AGAAT-----------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAGGGTGTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTTTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAG?TCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCAGCGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG----CCCTCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CCACGTCCC--GACAGCGGGCGTGCC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCAT--GTCGGCGCGACGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCTGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CCACGCTC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAAAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTGGGGAGGAGTAACATGAAGCTCAAAATTATGGGTGCATTCAAAACTTCAAAATGGAAAAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---TGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAAA---------TAAAAATGAATCAGGGAAAGGCTGGTCCTTACTGTAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_dillonii TGTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AAAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATAAAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAAAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTTTTTT---------------------------------------------------------------------------------------------------------------AT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTTA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTATTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAAAAAAA---AGAATACCCAAATATCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAAAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAAGAAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGGAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--CGAGCAAA--CGGCCGTCCC-GGCCGTCG----CCCCCGCGTG-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACACCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--TC-GGTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTCTAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAATAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_elatior TGTTGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-----------------TTGTATATTTTGTATAT---TGTATTTTTTTTTTTT-----ATTTGGG-------------------TTGGG-CCCCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGGT------------CCGGGGTCTTCTAATCCTTCTTCTTTTTTTT----CTATTT-AC{AC}A-----------------------------------TATTTAC{AC}AT--AGAATTT-ACTATAAAATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA---------------------------------------------------------------------------------------------------------TTTTTATA-------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTTAATTT----------------------------CAA----TTTAATATTTATCGATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAA{AT}T-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------TTCTTTATTTTGATATTTTT----------CTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTG---------------AAATATTT------AAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTTGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCATTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAACTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGGTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCTTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----CTTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACACGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGTCCC-CTCCTC--GTGGGGTGGGTGGGGG-CGCGGCGGAGGACGGATGAAAAA------CACAAA--TCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGCGGCATATGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCTGTCCC--GCCAGCGGGCG--TC-GGCCG--AGGCCCGGATGCGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGTTGTGCC----TTTGACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTCTACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAATATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGTGTTTTCTCGAACAAAGTTTTAA---------------------------------------CTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGCATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_elegantula TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAGATAAATAT-CCGATAGCAAGTTGATCGGA?AATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------CTTTTTG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATCCAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATGGACTAT--ATAATTT-ACTATAATATATA-------------------------------------------------TAATATAATTTACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------TCTTT-ATACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAGA----------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTT------------------------------------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATCCTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTACTC-GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATAAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--CCCAGCGAACG--CC-GGCCA--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGTCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGAC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCCTTTCTTTATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATTTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_exaltata TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATCAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-----------------------TAATATAATCGACTATAATATATATATATATA--------------------------------------------------------------------------------------------------------------------------------TCTTTAATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTCTATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------ATTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAATTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCATTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTCGATACCATAGTCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCTGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCC-GGCCGTCG----CCCCCGCCTC-TTCCTC--GCGGAGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCTTCGCTCCGTGCTAC--CTGCGTCCC--GCCAGCGGGCGT--C-GGTCT--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCTGCGTTGTCCCGTGCCGGCCCGAGAGACGGGCGGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CGTGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGATCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_ferdinandiana TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTTGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTTTT------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------C--CTA-GGATTTACATATACAA-CAT------------------------------------------------------AGATTACTGTCAAGAGAA-GGG--------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT------------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTTACTT---AATATCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTT-----------------------------------------------CTCTTTATTTTGATATTTTT----------CTTTTTTT----------------------------------------------ATATTCATTATTCTTCATACTCATTTTT------------------------------------CTAAT---------------------------GAATATAAAAAATA---------------------TTCAGAAG-----ATTCAGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATAGTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAATATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTGATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACAAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATTTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCCTAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGGAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTGAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGGTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGGGTACTAAAA---AATACTTTGGTAGTAAGAAATCAAATGCTAGTGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATAATCATATTTGTGGTGAGATTGTCAAAATTATTAGACTTTCTTCTC--AATATGTAATTCTTTTTTT----ATTTTTAATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CAGCCGTCCT-GGGCGTCG----CTCCCGTCG--CCACTT--ACGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAATAAA-----CACAAA--CCGGCGCAGCATCGCGTCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTAGGG--CTCGGTTGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--TTCCGTCGC--GCCAGAGGGCG--TC-GGTCG--GGGCGCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TC-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGACAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CCATGCGT--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGAACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGAAATAGTTAGTTATACCTCGTGAAAAGATACTTTTTGCGGAATTATACAGTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGTATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAAAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTTTTCGTAAACAGAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAC--------GAGTAGC-TTTTGTAGGGTTTTATCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTATTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGAGGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTATTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCAGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAACAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAACCGTATTTTTCTAGTTC Maxillaria_fulgens -----------------GA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGCGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTTT?-----ATTTGGG-------------------TGGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATCCAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCAGGGTCCTCTATTCTTTCTTCTTTTTTTT----CC--------------------------------------------TATTACCTAT--AGAATTT-ACTATAA-ATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCCTT-AAAA----------------------CCTTTACTTT-------------------------------AGAATTTGATTT-CTATCCAATTT----------------------------CCA----TTGAATATTTATCTATTTTCC---------ATATTATAATTGAATTATA-------------------TTGAAA-----TATTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTATTCTTTTTATTATTAAGAATTATTATTCTTTTTATTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATATTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTAACACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAACGATTCGGAGAACCCGTGAAA--TGACCCGA--CGACCGTCCT-GGATGTTG----CCCCCGTCTC-CTCCTC--GCGTGGAGGGGGG----CGCGGCGGAGGATGAATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACCAGCCCCGCGTGGGG--CTCGGTGGCG--TGGGGTGTTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTCGTCCC--GCCAGTGGGCGCGTT-GGCTG--AGGCTCGGATGTGTAGAGTGGCTCGTCGTGCCT--GTCAGTGCGGCGTGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCTGAGAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CCATGGGC--CGATCGG-TATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAGATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGACTTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GGAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAACCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATGAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_gentryi TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTCTTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTATCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATTAGAATATATATATATA----------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTCATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----CTCTTTCTTTTTCTATTTCTCTTTCTTTTTCTATTTTTATTTCTTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTT-TCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAAAACCGGCGCAGCATCGCGCCAAGCGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CCGCGTCCC--GTCAGCGGGCG--CC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGACCGAGAGACGTGCCGTGCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGACACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGGATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCGTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTTTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_gracilis -GTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTTGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTT---------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CATCTTTTATAGATGAATTATGACTCTTTTCACATCTAGGATTTACATATACAACATATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------TATTTACTA---TATTTACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA---------TTTT------ATATA-----------------------------------------------------------TTTTTA-------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTACTATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTT----------ATTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------CGAAAGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAATGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT------------GTAAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTATAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATAAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAAAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTACCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTTTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATTGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTTGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTTTTAGAAGAATTTTTTTTGGAAGAAGAACAATTTCTTTTTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATTTGGTGGATCATTCATGATTGTTCATGAGACTTTTT-----CATTTTCATGAAAAAAAAAA----------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTTAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATTGAGCGATTTGGAGAACCAGTGAAA--TGATCCAA--CGGCCGTCCT-AGCCGTCA----CCCCTGTCTC-TTCCTT--GCGGGGAGGGGGG----AGCGGCGGAGGAAGGATGAAA--------CACAAA--CTGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGATTGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCT--GCAAGTGGGCGTGTC-GGCCT--AGGCCCGGATGTGTAGAGTGGCTCGTCGTGCCT--GTCGGCGTGGCGAGCTGAAGTGCGGGTTT-CGTC-TC--GCTGGCCACGAATT-ACGAGGGGTGGG-TG-AAAGATGTGAGCGCAGCCTGCGTTGTCCCGTGCCGGCACGAGAGACGGGATGGGCC----TTTGATGTG--ATCTCGAC-CCATGCGC--CGATCGG-CATGCGACGGCTTGGAATGTGGCCCCAGGACGGGCGAG??CACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTTTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACAAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGTCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAAAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCAAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTATCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCT{ACG}TACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGTGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATACTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTGAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_grayii TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATAATATAATTTACTATAATATAGATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATACTTTATAGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AATAATTCTTCTTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTT------------------------------------------------------------------------CTTCATACTCATTTTTATAATGAATA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATCCTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAAGAAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATAAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--CCCAGCGGGCG--CC-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGAC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_guadalupensis TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAAGAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTT---------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATAGAATTTACTATAATATATATA----------------TATATATA--------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTAGA----------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTTCTATTTTTATTT------------------------------------------------------------------------CTTCATACTCATTTTTATAATGAATA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----ATAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCATAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATCCTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CTGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGATGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCA-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--GCCAGCGGGCG--CG-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGGC-CCACGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGAGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_hennisiana TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGTAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTT---------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------TCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTCTTTTTATTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAATTTTCAGAAATAGAAATTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTAGAATATGAGTTTATTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATAATT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGAATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATATAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTCTGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TC-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCGAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAGA--CCGGCGCAGCATCGCGCCAAGGGAGA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCACGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCCC--CCGCGTCCC--GCCAGCGGGCG--CC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAAAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_horichii TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTCATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTATTTATTTTGAGATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATAAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTTTCTTTTTTT--------?GTT?CAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAATCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTAATCCTGTTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTATTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTACCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCTGA--TGGCCGTCCC-AGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGCGAGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--ACGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--TCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--TTCGGCGCGGCGGGTTGAAGTGTGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGCGCC----TTCGATGTG--ATCCCGGC-CCACGCGT--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAACCAAAAATAAAATAACA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTATCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCATT-ATCTGG-TGTAACTACTTGGGCCGGATGAAAGGAAACTTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_imbricata TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------TTTTA-------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTATTTGATGTTTTTTTTTT----------------------CT------------------ATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCTTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTAAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTTTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTATC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGGCGA--TGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGACGTGCCC--GTCGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCTGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCTCGAGAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CAACGCGC--CGATCGT-CATGCGGCTGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCAAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAATAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---TTGAAACATAAAAGAAGGTAAAAA-GGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACT{GT}GAGTAAA-------GAGTAGCTTTT{GT}GTAGGGTTTTCTCGAACAAAGTTTTAAAAATAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACATGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTTGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTCATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTAGAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGTATTGCTAAAAGCAAAATTCGGGAAAAAGAACC---------GGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTTTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTAAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_laevilabris TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAACCCAATTCAATCCTTTACTCAGTGAATGAGTAAATTTTCCATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTTTTTT----TTT----------------------TTGGG-CACACTATTCTTCTTTAGGTACCAAATTCGTTCCCCTTTTAAAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GAATTTACATATACCA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CGGGGGTCCTCTATTCTTTCTTATTTTTTTTTTT-CTATTT-ACTA-----------------------------------TATTTACTAT--TCTATTT-ACTATA----------------TTTACTATATAATTTAGTATAATATATATATA------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTATCTATTTT------------------CATTGAATTATA-------------------------------------------TTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTGAATT-GAAAAATTTTTTCATTTTATTTGATGCTTTTTTTT-----------------------CTCTTTATTTGGATATTTTT----------ATTTTTTT----------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTATAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGG--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTATTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCTCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCCCATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTAGAATCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTG--TAAGAAATTCGATACCATAGTACCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----AATTTTCATGAAAAAAAAAAAAAAAAAAA-GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAAT---TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGTCATCCA-CGGCGTCG-----CCTCATCTC-CTCCTC--GCGGGGTGGGTGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGATA----GATTC-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTTTTGCACGCCATGTGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTTGCTCTGTGCCAC--CTGCATCCCCCTACAGTGGGTG--CT-GCTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCACGGCGGGCTGAAGAGTGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGTGGTGGG-TG-AAAGTTGTGAGCGCAGCCTATGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCATTGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCTGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTCGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACTAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAATAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTT----------ATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATACGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAATAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAACAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAATAACCCCTTTTTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCGCAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGATCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATTCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGAAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_lepidota TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTAA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTACTATTTCTCTATTTT------------------CATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTTCTTTTTATTTTTTT----------------------------------------------ATATTCA-TATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTTAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTATAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTTGGAGAACCCGTGAAA--TGAGCCAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGTGGGCGGT--------GGGGGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCATGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCAGCCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--G{CT}CAGCGGGTG--TC-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGATGGGCCGTGCC----TACCACGTG--ATCCCGAC-CCATGCAC--CGATCGG-CATGCGGCAGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTTAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGAAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA--------------ATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCTGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_longipetiolata TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAAGAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTAGTGTACTTA-------TTGTACTAT---------------------TGTATATTTTTTTT-------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CGATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAAT{AC}TATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------ATAATTTGATTT-ATATTAAATTG----------------------------AAA----TTGAATATTTATCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTATTATTTTA-----------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACAAAAATGGATTTTGGGGTCAC---------AAAAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCTATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----?A-TG--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCGGA--CGGCCGTCCC-GGCCGTCG----CCGCCGTCTC-CCCCCC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACGAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGACCC--GTCAGTGG-CGTGTC-GGCCG--GGGCCCGGATGTGCAGAGTGGCT?GTCGTGCCC--GCCGGCGCGGCGTGCTGAAGAGCGGGTTT-?GT?-TC--GCCGGCCGCGAACA-ACGAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGCAGTGCC----CTCGACGTG--ATCCCGAC-CCACGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGGATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTAAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGT-AAAAAATACTTTTTGCGAAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCTTT----------CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGAAAAATAAGATAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TATAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGAGAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATCTAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_longissima TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATCCCATAAGA---CCCTAATAAATAAAT-------------------AGGAGCTAGCATTCGATTGAGCAATCGAATCCAATAGAATCCTTTACTCAGTGAATGAGTCAATCTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTCTTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTT------------------------------------------------------------------------CTTCATACTCATTTTTATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGGA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTT--TCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----AATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGG{CT}GG{AG}CGGGGG-CGCGGCGGAGGACGGATAAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--CCCAGCGGGCG--CC-GGCCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCTTGAGAGACGGGCCGCGCC----TACCACGTG--ATCCCGAC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_lueri TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCGTAAGA---ACCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTT---------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATAGATA-TATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------ATTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAATTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAACAATTACCTAAATATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTCTTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATATGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTATTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-TTGATATATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCGCGCCCC-CTCCTC--GCGGAGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAGAA------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGTACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--TCCAGGGGGCG--TC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGGGACGGGCCGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAAAATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGAGAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTATTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_meridensis TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA---------TAATATAATTTATATAATATAATTGACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------------------------------TCTTTAATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTG----------------------------AAA----TTGAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTCTATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------ATTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAATTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCATTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTCGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCTGAGAACCCGTGAAA--TGAGCCAA--CGGCCATCCC-GGCCGTCG----CCCCCGCCTC-TTCCTC--GCGGAGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCTTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--TC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCTGCGTTGTCCCGTGCCGGCCCGAGAGACGGGCGGTGCC----TACCATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CGTGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGATCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_multicaulis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA-------------AAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTAAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGAATTTTGGGGTCACAGGGGTCACAAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATCGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACTGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGTTTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTTTTTTACCCGGATTACATAGAGAACG?ATTTGGGATTTGGACCTTATCCGGATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CCTTTTCCTGAAAAAAAAAA----------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGATCGTCCT-GGCTGTTG----CCCCTGTCTC-CTCCTC--GCGTAGAGGGGGG----CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCTACGTCGGG--CTCAGTGGCA--TGTGGTGTTGTTGCACGCCATGCAGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC-------CTTC--GCCAGTGGGCGCGTT-GGCTG--AGGCTCGGATGTGCAGAGTGGGTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-TGTC-TC--GCCGGCTGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGTGCC-----TTGATGTG--ATCCCGGC-CCATGGGC--CGATTGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTAACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTATCAAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGACCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATTTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGC---------GAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_nardoides TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAAGAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATAAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTCTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCC---------A-----------TGAATTAT-----------GACTCTTTTCA--------TATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGG--------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--C---------------------------------------------TATTTACTAT--ATAATTT-ACTATAATATATATATAT---ATTTAATATATTTTAAATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTTACTT---AATATCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTGATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATT-------------------TTTTATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAA-TA---------------------TTCAGAAG-----ATTCAGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTTGAATTTGAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGCTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGAAAGAAAAGATTTTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATACTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTTACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCGAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATAAATTTGTATTTTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----CTTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCTAA--CGGCCGTCCT-GGCCGTCG----CTCCCGTCG--CCTCTT--GTGGGGCGGGTGGGGG-CGCGGCGGAGGACGGATGAAAAAC-----CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-GAAGGCACGAGCCCCGCGTAATGGGCTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCTAAGGGCACGTCCGCCTGGGCGTCAAGCGCCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCTGTTGGCG--TC-GGTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCG--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCTGGCCGCGAACA-ACAAGGGGTGGG-TC-AAAGCTGTGAGCGCAGCCTGCGTTGTCCGGTGCTGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CCATCGG--------CGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACAGTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAAAAATCCTTTATGAGTCCCAAAATCTTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TATAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTTTAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATTCAATCCTGGAAATACAGCATCCCACTATTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTACGAATTATTAAAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGCGGTCTAATCAGACAAAACGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTATATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGATTTTCAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_nasuta -----------------GA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAAATTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTATA--------------------------------TTGAAATTCTATTTATTAAGAATTATTAT---------------------------------------------AAGAATTATTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------ATATTCATATTCTATATAATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTATAAAT----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTT---------GT--------------AAA---------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTAAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCATTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTATTAGACTTTCTTCTC--GATATGTCATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCT-GGCTGTTG----CCCCCGTCTC-CTCCTC--GCGTGGAGGGGGG----CGCGGCGGAGGACGGATGAAA--------CCCAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAAGCACGAGCCCCACGTCGGG--CTCTGTGGCG--TGGGGTGCTATTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGCGCCGC--CTTCGTCCC--GCCAGTGGGCGCGTC-GGCCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGCTGAAGAGTGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACAAGGGATGGG-TG-AAAGCTGTGAGCGTAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGGGC--CGATCGG-CATGCCGCGGCTTGGAATGTGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTGTTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAAAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_notylioglossa TGTCGAAATTCTTTTTTGAT----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTT-------------------------ATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGTGTCCTCTATTCTTCTTTTTTTT--------CTATTT-ACTA-----------------------TATTTACTA---TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA-------------------------TTTTATTTAATTTAA-----------------------------TAT----TTATA------------------------------ATTTATATA------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTTATATTTTTATTT------ATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTTA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGGGTCTTT-------------------------------------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCAAAATGGGTTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGCTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGGATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCTTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTAATAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGACAA--CGGCCGTCCT-GGCCGTCG----CCCCCGTCTC-CCCCTCTGGCGGGGTGGGTGGGGG-CGCGGCGGAGGAAGGATGAAAAAAAAA--CCCAAA--CCGGCGCAGCATTGCGCCAAGGGAAA----GAATG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTTCGTCCC--GCCAGTGGGCGTGTC-GGTCG--AGGCC-GGATGCGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGCAT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AA-GCTATGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGCGCAAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATACACAAAGAAATCCTTTATGACTCCCAAAATATTCCTTTCTTGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGT-GACATAAAAGGAAGGAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAATA---------TAAGAATGAATCACGGAAAGGCTGGTCCTTACTGGAAACTTGATTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTTGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_ochroleuca TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTAGATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTCATATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTGAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTCTTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGGGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----CA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCCC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CCGCGTCCC--GCCAGCGGGCG--TC-GGACG--AGGCCCGGATGTGCAGAGTGGCTCGTCGCGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGCCGTGCC----CACCACGTG--ATCCCGGC-CCATGCGC--CCATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAAAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_oreocharis TGTTGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT--------------------------TTGTATAT---TGTATTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCTTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------TATTGACTA---TATTGACTAT--AGAATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------TTCTTTATTTTGATATTTTT----------CTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTTGGTTCAC---------AAGAATTATTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTCTTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTAGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTCTTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTCTTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTAATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCAGAGAACACGTGAAA--TGAGCCAA--CGGCCGTCCT-GGGCGTCG----CCCCCGTCCC-CTCCTC--GTGGGGTGGGTGGGGG-CGCGGCGGAGGACGGATGAAAAAA-----CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCAGCATCGGG--CTCGGTGGCATATGGGGTGCTGTTGCACGCCATGCGGATTGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTTCGTCCC--GCCAGTGGGCG--TC-GGCCG--AGGCCCGGATGCGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGGTCGCAAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGTGCAACCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGTTGTGCC----TTTGACGTG--ATCCCAGC-CCATGCGC--CGATTGG-CATGCGGCGGCTTGGAATGCGACCCCAGGAGGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTATCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTT--CGAAAATATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATACAAAATAAAATAAGA---------TAAGAATGAATCAGGGAAAGGCTGGTCCTTACTTAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGCATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGACTTTAAGTATAAAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_pacholskii TGTCGAAATTCTTTTTTGA-----------AAA-GTACTTGAATCGAAAATAAATAT-TCGATAGCAAATTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCCATTTTTTATATTGTACTAT-------ATGTATATT-----------TGTATAT---TGTATTTTTTTGTTTTT----ATTTGTG-------------------TTGTG-CACCTATTC-TTATTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTTTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGG--------------CCGGGATCCTCTATTCTTTCTTCTTTTTTTTT---C---------------------------------------------TATTTACTAT--AGAATTT-ACTAGAATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT-----------------------------------------------------T------------------AATTGAATTATA--------------------------------TTGAAATTTTATTTATT---------------------------------------------------------AAGAATTATTATTCTTTTTC-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTGATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTCAGAAG-----ATTCAGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTT-CCTTTTTTT--------GGTTACAGCATAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTCAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTATTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACAAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCC---------AAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATATCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAATATCCTATGGTTCCTCAAATATACTTTCATGCATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATACTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTAATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGATATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------GATTTATGAATTTGTATTCTGAAATGCTCAAATATCATCATATTTGTGATGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TTTGACAA--CGGCCGTCCT-GGCCGTCGCCG-CTCCCGCCG--CCTCTT--GCGGTGCGGGCGGGGG-CGCGGCCGAGGACGGATGAAAAAA-----CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCA-AAAGGCACGAGCCCCGCGTAGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCTTCCC--GCCAGTGGGCG--TC-GGTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-GC--GCCGGTCGCGAACA-ACAAAGGGTGGG-TC-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGCGACGGCTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGAGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACAGTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-TTTTATCGCATATATGCTTCAAGGGATATCATGCGCATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTT--CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATTAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTATTTTTTACTACTAAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAGCCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGGGGTATTTGTGCAAATAGGTATAATCAATATCATTCTAATTGCATAAAAAAGGAAACAGTTTATAAGAATGATTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_pachyachron TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATA-ATATAATTTACTATAATATATATA-TATATA-------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAGA----------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTTATATTTTTCTTT------------------------------------------------------------------------CTTCATACTCATTTTTATAATGAATA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----ATAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCCTT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATCCTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CCGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAA--CCGCGTCCC--GCCAGCGGGCG--CC-GGCCA--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGTGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCAGTGCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTATCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_paleata TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATATTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCATCTTTTCACATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTC-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------TTTTA-------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTATTTGATGGTTTTTTTTT----------------------CTATTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------CTATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT----------------------------------------------------AGAAT-----------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCCAATTTTCATTAATTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATATAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGATCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATATCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATTCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTATC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG----CCCCGGTCTC-CTCCTC--GTGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTTCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCTGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CCACGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTTACAAAACCCTATACTTTTCATTATAAAACGAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATCCTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCAAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----TGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATAGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_parviflora TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------ATTTGGG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTCATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTCATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGGTTTTTTTTT----------------------CTATTTATTTTGAGATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA-CCGTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATAAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTCTTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTAATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCTGA--TGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGCGGGCGGGGC-CGCGGCGGAGGACGGATGAAA--------CA-AAA--ACGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCGTGTC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCCC--TTCGGCGCGGCGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGCGCC----TTCGATGTG--ATCCCGGC-CCACGCGT--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGACAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCTACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCCCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_ponerantha TGTCGAAAATCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-TCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCTT---------GAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTCTTTTTTTTT--------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGTT-------------CCGGGGTCTTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-CTATA----------TTTA------TA-------------TTTAA---------------------------------------------------------------------------------------------TTTATTATTTATATA--------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------ATAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------CATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------GTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTT--------------------------TTCTTTATTTTGATATTTTT----------ATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTATATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTGTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTTGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGAGATTGTTTTTTCACGAATCTCATAATCTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATTTTATTTTCACTTTTGGTTTCAACCTTCTAGGATCCATATAAAGGAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAATAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTGGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCAAA--CGGCAGTCCT-GGCCGTCG----CCCCCGTCTC-CTCGTC--GTGGGGTGGGTGGGGG-CGCGGCGGAGGATGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCTTGCGTTGGG--CTCGATGGCG--TGGTGTGCTGTTGCACGCCATGCGGATGGATACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGTGTCGCGTCGCTCCGTGCCAC--CTCTGTCCC--GCCAGTAGGCG--TC-GGGTG--AGGCCCGGATGCGCAGAATGGCTCGTCGTGCCC--GGCGGTGCGGCGGGTTGAAGAGCGGGTTT-CGTC-TC--GCCGGTCGCGAACA-ACAAGGGGTGGG-TG-AATGCTGTGAGCGCAGCCTGTGTTGTCTCGTGCCGGCTCGAGAGACGGGTTGTGCC----TTCGACGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCAAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTTATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTGAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATAGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAAGAAACCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCGTCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGAGAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAAAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTTATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTAAACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGATTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_porrecta TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTT---------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------TCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATA-------------------------TAATAGAATTTACTATAATATATATA-TA-----------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CCA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTTATTTCTTTTTATTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTAGAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGAATATTTAGATTTAAAA------------AAAGATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTCTGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGAATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCTC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CCGCGTCCC--GCCAGCGGGCG--AC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAATCTGTGAGCGCAGCCTGCGTTGTCCCGCGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTT{AC}AAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_proboscidea -----------------GA-----------AAA-GTACT-GAATCAAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAAATTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTG-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTC--C---------------------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTACTA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTTC----------ATATTTGAATTGAATTCTA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTATTA----------------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTAT-AAAAATGTTCATTA-------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAG----AGAAA-----------------TTTCAAAACGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTTCAATAGTTTGATTTTTTATGAACCTGTGGGAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCTTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCCAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCT-GGCTGTTG----CCCCCATCTC-TTCCTC--GCGTGGAGGGGGG----CGCGGCGGAGGACGGATGAAA--------CCCAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCTGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGCGCCGC--CTTCGTCCC--GCCAGTGGGCGCGTT-GGCCG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGTTGAAGAGCGGGTTT-CGTC-TC--GCCGGTCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTTGTGCCGGCCTGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGAC-CCATGGGC--CGATCGG-CATGCCTCGGCTTGGAATGCCACCCCAGGATGGGCGAAGCCCCCCCCCA?GTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCC-GGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAATCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_procurrens TGTCGAAAATCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-TCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGTT-------------CCGGGGTCTTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------TATTTACTA---TATTGACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA-------------------------------------------------------------------------------------------------------TTTATTATATATTTCTTATTTATATA---------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTCTT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTCTTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTT------------------------TTCTTTATTTTGATATTTTT----------ATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTTT--------------AAATATT-------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTATATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGTATTTTTGGTTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGAGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTAATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGGTTCAACCTTATAGGATCCATATAAAGGAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCTTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTGGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTGGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT----ATTATTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCAGAGAACCCGTGAAA--TGAGCAAA--CGGCTGTCCT-GGCCGTCG----CCCCCGTCTC-CTCCTC--GTGGGGTGGGTGGGGG-CGCAGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTATTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCG--TC-GGGCG--AGGCCCGGATGCGTAGAGTGGCTCGTCGTGCCC--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AATGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCAAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATAGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTTCTGAAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAAACCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCGTCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTGATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTTATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGCATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAATTTCTAAGAATGATTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_pulla TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTAAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTTATAGA--------------------------------CTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTATTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTTTATTT---------------------------------------------------------------------------------------------------------------------------------------------GATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTT----------ATTTTTTT-----------------------------------------------------------------------------------------------------TAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGACT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTGGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAACTATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTATTATACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCCGCCCC-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCTGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CCGCGTCCC--GCCAGCGGGCG--TC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-TGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTTAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAAT-------AAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCGCAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_richii TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATC-AAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---ACTTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTAAA-------TTTTTTCTATTGTA-TAT-------------------------------------TGTATTTTTTTTTTT------ATTTGTG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTAGTTCCCCTTTTATAGA-----------GGAAATAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGGCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTTTTTTTTTTT------C---------------------------------------------TATTTACTAT--A-AATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA----------------------------------------------------------------------------------TTTTTTATATATTTTTTTATATA---------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-TTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTTTTATTTTTTTTA-------------------------TTATTTTTCAATTGGAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAAT---------------------------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTT---------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTTTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACTTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGCTTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTAAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTATTAGACTTTCTTCTC--GATATGTAATTATTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGTCG----CCCCTGTCTC-CTCCTC--GCGGGGTGGGTGGGTG-CGTGGCTGAGGACGGATGAAAAA------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCC-CGTCGGG--CTCGGTGGTG--TGGGGTGCTATTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGCAGAATGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TGAAAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGT--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAG---------------------GGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGA---------CCCATAAAAAGTGGAATTTGTT-----------------------------------------------------------------------------GATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTAGATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATGAGAGGGCCTAGTATATTTCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTCATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTATATTGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAAGAAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAATAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAA{AC}TGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGAACCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATCCTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_scalariformis TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATTAGTCAATTTTCAATTTTTTCTATTGTACTAT-----CGTTGTACTAT---------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTCGATTT-CTATTCAATTT--------------------------------------CATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CT------------------ATTTATTTTTCTTTTTTT----------------------------CTATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT----------------------------------------------------AGAAT-----------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCAAA----------------CA----TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTATATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGCAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATTCATATAACGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCGTTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAAA-----------TATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTGGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCAGAGAACCCGTGAAA--TGAGCCGA--TGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCTCGC-GGGGGCGGGCGGGG--CGCGGCGGAGGACGGATGAAA--------CA-AAA--CCGGCGCAGCACCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCTGCGTCGGG--CTCGTTGGCA--TGGGGTGATGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCAACCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CCACGTCCC--GCCAGCGGGCGTGCC-GGCAA--AGGCC-GGATGTGCAGAGTGGCTCGTCGTGCAT--GTCGGCGCGACGGGTTGAAGTGCGGGTTT-CGTC-TT--GCCTGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTTGATGTG--ATCCCGGC-CCACGCTC--CGATCGT-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTT---TGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAAA---------TAAAAATGAATCAGGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAACAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATACAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATTTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_schunkiana TGTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTATATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTTTTTTTTTTT---TCATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA------TCTTTACT--------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTC-------------------------TTATTTTTCAATT-GAAAAATTTTTTCGTTTTATTTGATGTTTTTTTTT-----------------------CTCTTTATTTTGATATTTTT----------ATTTTTT-----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAATGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAATGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT------------GTAAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTTAATGATTCTAACCAAAATGGATTTTGGGGTTAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTAATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATAAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAAAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTGTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCACAGTCCCAGTTATTTACCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCGGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATTGAGCGATTCGGAGAACCAGTGAAA--TGATCCAA--CGACCGTCCT-AGCCGTCA-----CCCCGTCTC-TTCCTC--GCGGGGAGGGGGG----CGCGGCGGAGGATGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCACGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTTCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCGC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCT--AGGCCCGGATGTGTAGAGTGGCTCATCGTGCCC--GTCGGTGCGGCGAGCTGAAGAGCGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACGAGGGGTGGG-TG-AAAGATGTGAGCGCAGCCTGCGTTGTCCCGTGCCGGCACGAGAGACGAGATGGGCC----TTTGATGTG--ATCCCGGC-CCATGCGT--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTTTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGTCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCAAAAATCTTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTACTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTATCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATACTTCAAGAAGTGATGCAGGGGCATCCTATATTGTTGAATAGAGCGCCCACCCTGCATAAATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_silvana TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTGAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TTTATTTTTTTT---------ATTTTTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTAGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTAT--ATAATTT-ACTATAATATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTCTA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AATAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTT-------------------------CTCTTTATTTTTATATTTTT----------CTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAG---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTCGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACAAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTATTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTTTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTAATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCACAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATTACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGTGCCAA--CTGTCGTCCT-GGCCGTTG----CCCTCGCCTC-CTCCTC--GCAGGGCGGGCGGGGG-CGCGACGGAGGACTGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGAAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTTGGTGGCG--TGGGGTGCTGTTGCACGCCATGTGGAGGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCAGCCGGTCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCATCTCTTCGTGCCAA--TCGCGTCCC--GCCAGGGAGCG--CC-GGTCG--TGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--ATCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGTCGCAAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAACCTGCGTTGTCTTGCGCTGGCTCGAGAGACGGGCTGTGCC----TACCATGAG--ATCCCAGC-CCATGCGC--CGATCGG-CATGAGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAATAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTTGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTTCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_sophronitis -----------------GA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGTAAGTTGATCGGTTAATTCCATAAGA---CTCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTTT------ATTGGGG-------------------TTGGG-CACCTATTC-TTCTTTATGT?CCATATTCATTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATCCAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-AAGG-------------CCGGGGCCCTCTATTCTTTCTTCTTTTTTTTTT--TTAATT-ACCAT----------------------------------TTTTACCTAT--AGAATTT-CCTATAAAATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAAAA----------------------ACTTTACCTTA------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAAAATTTATCTATTTTC----------ATATTATAATTGAATTATA----------TTGAAATAATTGAATT---ATATTGAAATTCTATTTATT---------------------------------------------------------AAGAAATATTATTCCTTTTA-------------------------TTCTTTTTCCATT-GAAAAATTTTTTCCTTTTATTTGAGGGTTTTTTTTT----------------------TTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------CAATATAAAAAATA---------------------TTCAGAAG-------TCAGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA-----------------TTTCAAAATGAAGATT--GGGTTGCGCCATATATATATAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCATTAGTTTATAATATGAGTT-----CATTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAA---------------------CCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATTTTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTGATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATAAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTCTTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATTCATATAAGGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTCTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCGTCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CATCGAGCGATTCAGAGAACCCGTGAAA--TGAGCCGA--CGACCGTCCT-GGCCGCCC----CCCCCGTCTC-CTCCAC--GCGTGGAGTGCGG----CGCGGCGGAGGACGGATTAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCACGTCGGG--CTCGGTGGCA--TGGGGTGTAGTTGCACGCCATGCAGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCATCGCTCCGTGCCGC--CTTCGTCCC--GCCAGTGGGCACGTT-GGCTG--AGGCTCGGATGCGCAGAGTGGCTCGTCGTGCCT--GTCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTAGTGCC----TTCGATGTG--ATCCCGGC-CCATGTGC--CGATCGG-CATGCCGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGC?ACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACT{AT}CAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAAGACTTTTTGCCGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCAAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATAACCCTTTCAGGGGATTCATCTTTTGAGAGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAAAGATTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGTTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCGATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGACGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTAGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATACTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATTCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_suarezorum TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATC-AAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---ACTTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAA-------TTTTTTCTATTGTA-TAT-------------------------------------TGTATTTTTTTTTTT------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTATTTCCCCTTTTATAGA-----------TGA---------------------TTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCCCTATTCTTTTTTTTTTTTTTT----CTATTT-ACTA-----------------------------------TATTTACTAT---AAATTT-ACTATAATAGATAATATAACTATAATATATATATATTTTCTTTAATA-------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT---ACTTTAGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTTTTATTCTTTTTA-------------------------TTATTTTTCAATTGGAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTTATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAAT---------------------------GAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCCTTTTTT--------GGTTACAGTAGAAATGTATTGAAATGGCAGAATTACAAGGATATTTAGA?TTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTTTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACTTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGCTTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCACGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTGAAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTATTTTTTCACGAATATCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATTCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAATAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTATTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGACCCAA--CGGCCGTCCT-GGCCGTCG----CCCC-GTCTC-CTCCTC--GCGGGGTGGGTGGGTG-CGTGGCTGAGGACGGATGAAAAA------CACAAA--CCGGCGCAGCATCGCGCCAAGGCAAA----GATTG-AAAGGCACGAGCCCC-CGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCGGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GTCGGTCGCGAACA-ACAAGGGGTGGG-TGAAAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTTCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGGCCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGA---------CCCATAAAAAGTGGAATTTGT-----------------------------------------------------------------------------TGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTAGATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTTCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTCATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTATTTTGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTT-------------ACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAAGAAAAAAGAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTCAAAAGAATAATAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGC---------AAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGAACCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTCATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Maxillaria_triloris TGTCGAAATTCTTTTTTGA-----------AAA-ATACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAAGAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTT----CTATTT-ACTA-----------------------------------TATTGACTATTACTATATTGACTAT-------------ATAATTTACTATAATATATATAATAAAATTTACTATAATATATATA-TATA---------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AAAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTTTTT----------------------CTCTTTATTTTGATATTTTTATTTCTTTTTATTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTTT--------------AAATATTT------GAAAGGTTTCTCTTTTTTT--------TGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAT---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAAAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATTGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTCTCACATTTAAATTATGTGTCAGAGCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTACAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTCTTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATACCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGGAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGCCCT-GGCCGTCG----CCCCCGCCCG-CTCCTC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--CC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGCCGTGCC----TACCACGTG--ATCCCGGC-CCATGCGC--CGATCGG--------CGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTATGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCTGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGC---------TTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTTAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTATTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATTAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCTTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCATATTTTTCTAGTTC Mormolyca_peruviana TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATC-AAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCTTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTAT---------------------------------------------TGTATTTTTTTT---------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTAGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTTATCTTTTCACATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--A-AATTT-ACTATAATATATA------------TAATATATATATA----------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA---------------------------------------------------------------------------------TTTTTTTATATA---------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTG------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATTGGAAAAATTTTTTCATTTTCTTTGATGTTTTTTTTTTT---------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------CTATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATAGAAAAAATA---------------------TTA--------------ATAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCTCCTTTTTT--------GGTTACAGTAGAAATGTATTTCA?TGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATA{AT}TTACTCACTTGCTCATTATAATAGCTTCGATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGCTTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATTTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTTTTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAA?????????????????-----------------------------------------------------------------------GGGTCATCCTATTAGTAAACC?ATCTGGACCGAGTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCGAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTAGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACAT?GAGAACGTATTTGGTATTTGGACATTATCCGTATGAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATA?ATCATCATATTTGTG?TGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATAT?TAATTCTTTTTT-----AT?TTTGA?TGATA-------TATACATAGGGAAAGCCGTG?GCAATGAAAACTGCAAGCACGGTTTGGGGCAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TG--CATCGAGCGATTCGGAGAACCCGTGAAG--TGAGCTAG--CGGCCGTCCT-GGCCGTCG----CCCTTGTCTC-CTCCTG--GCGGGGTGGGCGGGTG-CGTGGCTGTGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATTG-AAAGGCACGAGCCCC-CGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGTGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAATCGGCGTGTC-GGCCG--AGGGCCGGATGTGCAGAGTGGCCCGTCGTGCCC--GTCGGCGCGACGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGTCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGATGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCAG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGAATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATTTTGGGAGGAGTAACATGAAACTCATAATTATGGGTGCATTCAAGACTTCAAAATGGAAAAAAGGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTAAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGTATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTT-AAAAAGAATAAGTACCCCTTTCTTT-ATTTGG-TGTAACTACT-GAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAGTCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAACTGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGAACCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCTGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACATTTTATAAGAATGACTTTAAGTATATAAAAGAGCCGTATTTTTCTAGTTC Mormolyca_ringens TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATC-AAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCTTAATAAAGAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCCATTTTTTCTATTGTA-TAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCTTTTTTT-----CTATTC-ATTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAAATGAGTAT-GAAGAAGAAT---------------------------TAATAGAAAAAATA---------------------TTC--------------AGAAGGTGA--TGA---------GAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATAGAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCTTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTTCAATAGTTTTATTTTTTATGAACTTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGCTTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTTTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATATCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGAATTCTATGGTTCCTCAAATATACTTCCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----AA-TA--CACCGAGCGATTTGGAGAACCCGTGAAA--TGAACCAA--CGGCCGTCCT-GGCCGTCGC---GCCCTGTCTC-CTCCTC--GCGGGGTGGGTGGGTG-CGTGGCTGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATTG-GAAGGCACGAGCCCC--GTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACTGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCTG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTTCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTGAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAATAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTCAAAAAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTACTTTATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAACTGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGAACCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTTATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Pityphyllum_laricinum -----AAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAAT--------TTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTTGTTCCCCTTTGATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATCTT----------------------------------------------------------------------------------------------------------------------------TACTATATTT-ATATA----------------------------------------------------------------------------------------------TTTTCTTTAGAA-------------------------------------------------------------------TTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCA------------------TTTTATTTGATGTTTTTTTT------------------------CTCTTTATTTTGATATTTTT----------CTTTTTTT----------------------------------------------AGATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATAT----------------GAATCTAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTTGAA----------TTTTCA-------------------------------------------TTAGTTTATAATATGAGTTGAGTAGTTTAGGTGAATCTTTTTTT-CATTAT--------------AAATATTT------GAAAGGTTTC------------------------------------------------------------------------------------------------------------------------------------------TATTTACTCACTTGCTCATTCTAATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTCTTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTTTTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCCTACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCTTCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTACTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCAATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAGTTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCAGAGAACCCGTGAAA--TGAGCCAA--CAGCCGTCCC-GGTCGTCG----TCCCCTTTTC-CTCCTC--GCGGGGAGGGGGG----CGTGGCGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGCC-GGTCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCTGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGGATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATAAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATGAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCAAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGCTGCATTCAAAACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCT{AC}GTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-TAAATTCTGTTCACGC--AAGCGCAAGCGAATATAGCATGGTTAAAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCAT{CT}TTTTGAGGGGAAGTAGACTACTCAATAATTTCACATTTCCTTTTTTTTT---CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTATTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTATAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTTCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTTTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTACCCAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGATACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Pityphyllum_saragurense TGTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCGAAAAGAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTAT-------------------------------------TGTATTTTTTTTT--------CTTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATATA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGTTCCTCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTTACTAT--AGAATTT-ACTATAATATATATATAT---------------------CTTTCTCTATTT---------------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTACTTTATTA-------------------------------------------------------------------TTTGATTT-CTATTCAATTT----------------------------CAA----TTGAATATTTATCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTAGATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCATTT-----------------------------------------------------------------TCTTTGATGTTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTC-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTC----------------------CAGTAGAAATGAATTTAAATGGCAGAATTACAAGGATATTTTGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAATAAATCCAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGAATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAATCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATTTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAAGAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTTCTGTTTCTTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCATAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTTATGAAGAAATGGAAATTTCTTCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACAATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTATTCATGATACTTTTT-----CATTTTCATGAAAAAAAA------------GATTCATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAAGAAAA-CTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA----CCGAGCGATTCAGAGAACCCGTGAAA--TGAGCCGA--CGGCCGCCCT-CGTCGTCG----TCCCCTTTTC-CTCCTT--CGCGGGGAGGGGTGG--CGCGGCGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGACACGAGCCCCGCGTCGGG--CTCGGTGGCT--TGGCGTGCTGTTGCACGCCATGCGGATGGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCTTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGTGGGCGTGTC-GGCCG--AGGCCCGGATGTGCAGAGTGGCTCGTCGTGCCC--ATCGGTGCGGCGGGCTGAAGAGCGGGTTT-CGTC-TC--GCTGGCCGCGAACA-ACAAGGG-TGG--TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCAGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAATTTAAGCATATCAATAGGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAAATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGGATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTTAATACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTATAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAATAATTTCACATTTCCTTTTTTTTTTTT----AACAAAAAAGAAAGGAAAAAAGGTTAGATCAAAAATAAAA------TTAAGA---------TAAGAATGAATCAATGAAAGGCTGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-CTTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACAGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAAAATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Trigonidium_acuminatum TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGTAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCCATTTTTTCTATTTTCCTTT---------------------------TGTATAT---TGTATTTTTTTTTTT-------TTT----------------------TGGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTCTAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTTT-CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTC-ACTATAATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-CTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAAATTGATTT-CTATTCAATTT----------------------------CCA----TTTCATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATGTTTTTTT-------------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTATTCTTCATACTCATTTTT------------------------------------CTAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCCTATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTTGGTTTTTTGGTTATAGTAGAAATGTATTTAAATGGAAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATATAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTCTTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACAAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTG??TAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAATAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCTTTCTCTTTTCTGGGG?ATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAATAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATGTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATCTCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TG--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCC-GGCCGTCG----CCCCCGTCTC-CTCCTC--GCGGGGTGGCCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATCGCGTCGCTCCGTGCCAC--CTGCGTCCC--GCCAGCGGGCG--TC-GGTCG--AGGCCCGGACGTGCAGAGTGGCTCGTCGTGCCCC-GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCGGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCCATGTG--ATCCCGGC-CCACGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAGATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTTAAAAA-GAAATTCTGTTCAGGC--AAGCG------AATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATTCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGAGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTTTTT----CCATAAAAGAAAGTAAAAA-GGTTAGAGCAAAAATAAAATATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCTCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATACAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATTCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAAGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGTAACAAGTCGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCTGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAACAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCATATTTTTCTAGTTC Trigonidium_egertonianum_SK0317 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTTT---------------------------TGTATAT---TGTATTT--------------ATTTG-A-TTGT----ATGTGT-GTATTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGGTTT-CTATTCAATTATTCAATTG--------------------AAA----TTGAATATTTCTCTATTTT------------------AATTGAATTA----------------------------------------TTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATT-----------------------------------------------TTTTTATTTATTTTTCTTTTTTT--------------------------------------------------------------------------ATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATTGTGGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTTATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGG?ATTTTTCAGGG?TACTAAAA---A?TCCTTTGGTAGTAAGAAATCAAATGCTAGAGA??TCATT?CTA?TAAAGACTC?GACTAAGAA??TAGATACCATAGTCCCAGTTATTTATCTTAT?GGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCTCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-CA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCAA--CGGCCGTCCT-GGCCGGCG----CCCCCGTCTCCTCCCC---GCGGGGTGGGCGGGGG-CGCGGCCGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAA--GAGATAG-AAAGGCACGAGCCCCGCGTGGGG--CTCGGTGGCG--CGGGGTGCTGTCGCACGCCGCGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCGC--CTCCGTCCC--GCCAGCGGGCG--TC-GGTCT--AGGCCCGGACGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AGAGCTGCGAGCGCAGCCCGCGTTGTCTCGTGCCGGCCCGAGAGACGGGCCGTGCC----TTCCATGTG--ATCCCGGCCCCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATATTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAAGGATATCATGCACATAACCATCGAGGTTAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGGAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTT--CGTAAACATAAAAAAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAAGAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATTTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATGTAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Trigonidium_egertonianum_SK0361 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTTT---------------------------TGTATAT---TGTATTTTTTTT---------ATTTGTA-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTT---CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGGTTT-CTATTCAATTATTCAATTT--------------------CAA----TTGAATATTTCTCTATTTT------------------AATTGAATTA----------------------------------------TTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATT-----------------------------------------------TTTTTATTTATTTTTCTTTTTTT----------------------------ATATTCATATTCTATATCATATTCATTATTCTTCATACTCATTTTT------------------------------------ATAAT---------------------------GAATATAAAAAATA---------------------TTC--------------AGAAGGTGA--TGAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTCTTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTTATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTT?CA?GGGTACTAAAA---A?TCCCTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAAGACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTT?TCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCTCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGGCCGTCCT-GGCCGGCG----CCCCCGTCTC-CTCCTC--GCGGGGTGGGTGGGGG-CGCGGCGGAGGACGGATGAAAA-------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAAA--GATAGG-AAGGCACGAGCCCCGCGTCGGG--CTCGGCGGCG--TGGGGTGCTGTCGCACGCCACGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAACGTCGCGTCGCTCCGTGCCAC--CTCCGCCCC--GCCAGCGGGCG--TC-GGTCG--AGGCCCGGACGTGCAGAGTGGCTCGTCGTGCCC--GCCGGCACGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCTGCGTTGTCTCGTGCCGGCCCGAGAGACGGGTTGTGCC----TTCCATGTG--ATCCCGGC-CCATGAGC--CGACCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAA--TCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATATTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCATATAACCATCGAGGTTAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGGAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTTTTTT---CA-CATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATCAAAGAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATTTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTACTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATGTAATTCTAATTGCAGAAAAAAGGAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Trigonidium_insigne TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTTT---------------------------TGTATAT---TGTATTTTTTTTTTTTT------------------------------TTGGG-CACCTATTTTTTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCCCTATTCTTTTTTCTTTTTTTTTTTTCTATTT-ACAA-----------------------TATTTACTA---TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTATTCAATTT--------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATTTGTATTTTTTTTT-------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTTATTTTTT---------------------------------------ATATTCCT--------------ATTTT-ATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATA---------------------TTC--------------ATAAGGTGA--TGAATTCCATTAGAAAT----AGAAA--------------AATTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTCTAATATGAGTTTAGTAGTTTAGG-GAATCTTTTTTT-CATTGT--------------AAATATT-------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATGATTCTAACCAAAATGTATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTATTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAACAATCTCTTTCTTTAATGTTCCTCCAAAAAATCTCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGGCCGTCCC-GGCCGTCG----CCCCCGTCTCCCCCCCC--GCGGGGCGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAGA----GATAG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCG--TC-GGTCG--GGGCCCGGACGTGCAGAGTGGCCCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-CC--GCCGGCCGCGAACG-ACAAGGGGTGGG-TG-AGAGCTGTGAGCGCAGCCTGCGTCGTCTCGTGCCGGCCCGAGGGACGGGCTGTGCC----TTCCACGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCTTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTAACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGTAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAAAGGATTCATCTTTTAAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATACCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAATAGTTTCTAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Trigonidium_obtusum TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTTT----------------TGTATATT---TGTATAT---TGTATTTTTTTTTTT------ATTTGGG-------------------TTGGG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCCCTATTCTTTCTTCTTTTTTTTTT--CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTCTATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATTTGTATTTTTTTTT-------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCCT--------------ATTTT-ATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATTAGAATATGAATATAAAAAATATTC--------------ATAAGGTGA--TGAATTCCATTAGAAAT----AGAAA--------------AATTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGAAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGGAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCACCCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATATCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCC-------------------GTCG----CCCCCGTCTTCCTCCCC--GCGGGGCGGGCGGGGG-CGCGGCGGACGACGGATGAAA--------CACGAA--CCGGCGCAGCATCGCGCCAAGGGAAAG---GTACG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTCGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCG{AT}ATTGCAGAATCCCGCG{AT}ACCATC{AG}AGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCG--CC-GGTCG--AGGCCCGGACGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGA{AG}CGGGTTC-CGTC-TC--GCCGGCCGCGAACG-ACAAGGGGTGGGTTG-AAAGCTGTGAGCGCAGCCCGCGTTGTCTCGTGCCGGCCCGAGGGACGGGCCGTGCA----TTCCGTGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATG----------GAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTAACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGTAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATACCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTTTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAATAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Trigonidium_sp._nov._SK0315 TGTCGAAATTCTTTTTTGA-----------AAA-GTACT-GAATCGAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAGA---CCCTAATAAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAATCCAATTCAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTCTATTGTACTTT---------------------------TGTATAT---TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGT-------------CCGGGGTCCTCTATTCTTTCTTCTTTTTTTTTTT-CTATTT-ACTA-----------------------------------TATTGACTAT--AGAATTT-ACTATAATATATATA--------------TAATATATATA-TATA---------------------------------------------------------------------------------------------------------------------------------------------------------TCTTT-ATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTT-------------------------------AGAATTTGATTT-CTATTCAATTT----------------------------CAA----TTTAATATTTCTCTATTTT------------------AATTGAATTATA--------------------------------TTGAAATTATATTTATT---------------------------------------------------------AAGAATTCTTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAAATTTTTTCATTTTATTTGATTTGTATTTTTTTTT-------------------CTCTTTATTTTGATATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCCT--------------ATTTT-ATATTCATTA-------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAATTAGAATATGAATATAAAAAATATTC--------------ATAAGGTGA--TGAATTCCATTAGAAAT----AGAAA--------------AATTTTCAAAACGAAGATT--GGGTTGCGCCATATATATAAAAGAATATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCGAA----------TTTTCATTT---------ATTCA--------------------------TTAGTTTATAATATGAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTCCCTTTTTTT--------GGTTACAGTAGAAATGTATTTAAATGGCAGAATTACAAGGATATTTAGATTTAAAA------------AAAAATAGATTTTGGAAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTATTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATGATTCTAACCAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAAGAAATTTATTTACGTCTTTTCAAAAATAAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATATATTCCTGTTTATTTGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTCCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTGAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTCTTAGAAGAATTTTTTTTGGAAGAAGAAAAATCTCTTTCTTTAATGTTCCTCCAAAAAATATCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAATGATCTGGTGGATCATTCATGATTGTTCATGATACTTTTT-----CATTTTCATGAAAAAAA-------------GATTTATGAATTTGTATTCTGAAATGCTCATATATCATCATATTTGTGGTGAGATTGTCAAAATTCTTAGACTTTCTTCTC--GATATGTAATTCTTTTTT-----ATTTTTGATTGATA-------TATACATAGGGAAAGCCGTGTGCAATGAAAACTGCAAGCACGGTTTGGGGAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAA----TA-TA--CACCGAGCGATTCGGAGAACCCGTGAAA--TGAGCCGA--CGGCCAT---------TCG----CCCCCGTCTTCCTCCCC--GCGGG-CGGGCGGGGG-CGCGGCGGAGGACGGATGAAA--------CACGAA--CCGGCGCAGCATCGCGCCAAGGGAAA----GGTACGAAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCATGCGGATGGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAGGCGTCGCGTCGCTCCGTGCCAC--CTCCGTCCC--GCCAGCGGGCG--CC-GGTCG--AGGCCCGGACGTGCAGAGTGGCTCGTCGTGCCC--GTCGGCGCGGCGGGCTGAAGAGCGGGTTC-CGTC-TC--GCCGGCCGCGAACG-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCCGCGTTGTCTCGTGCCGGCCCGAGGGACGGGCCGTGCC----TTCCGTGTG--ATCCCGGC-CCATGCGC--CGATCGG-CATGCGGCGGCTTGGAATGCGACCCCAGGACGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGTAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGGATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAATTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTAACAGATTTGGACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGTAACATGAAGCTCAGAATTATGGGTGCATTCAAGACTTCAAAATGTAAGAAAAGGGGAATTGATCCATGGTCGATTCTGTAACAGATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATTCTGTTCAGGC--AAGCGCAAGCGAATATAGCATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTTT----CGTAAACATAAAAGAAAGTAAAAAAGGTTAGAGCAAAAATCAAAAATAAAATAAGA---------TAAGAATGAATCAAGGAAAGGCTGGTCCTTACTGGAAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAATAAGAACCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATACCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCTATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTTTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTTTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTCATATGAATCTCCTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGGAAATAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC Xylobium_leontoglossum TGTCGAAATTATTTTTTGA-----------AAA-GTACT-GAATCAAAAATAAATAT-CCGATAGCAAGTTGATCGGTTAATTCCATAAG-----------AAATAAAT-------------------GGGAGTTAGCATTCGATTGAGCAATCGAGTCCAATTAAATCCTTTACTCAGTGAATGAGTCAATTTTCAATTTTTTATATTGTACTAT---------------------------TGTATAT---TGTATTTTTTTTTT-------ATTTGTG-------------------TTGTG-CACCTATTC-TTCTTTATGTACCATATTCGTTCCCCTTTTATAGA-----------TGAATTAT-----------GACTCTTTTCA--------CATCTA-GGATTTACATATACAA-CAT------------------------------------------------------ATATTACTGTCAAGAGAA-GGGG-------------CCGGGGTCCTCTATTCTTTCTTATTTTTTTTT---CTATTT-ACTA-----------------------------------TATAATTTAC--TATATTT-ACTATAAAATATATATATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTTAATATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCTTTAATA----------------------TCTTTACTTTAGAATT-------------------------AGAATTTTTT---CATTCTAATTT-----------------------------------AGAATTTTATTTCTATTC-------------------AATTGA-TTCAA----------TTGAAAT---TGAATAT--TTAT-------CTATTTGAA----------TTTCAATTTGAATTGAATTATATTGAAATTATAAAATTATATTTATTAAGAATTATTATTCTTTTTA-------------------------TTATTTTTCAATT-GAAAATTTTTTTCATTTTATTTGATGTTTTTTTTT-----------------------CTCTTT--------ATTTTTATTTATTTTTCTTTTTTT----------------------------------------------ATATTCATTA-----------------------------------TAAAAATGAGTAT-GAAGAATAATGAATATGATATAGAATAT---------GAATATAAAAAAGA---------------------TTC--------------AGAAGGTGA--TCAATTCCATTAGAAAT----AGAAA----------------TTTTCAAAACGAAGATT--GGGTTGCGCCATATATATATATAAGTATAAAATAATG--------------------ATGTATTTGGTGAATCAAATATATGGTCCAATAACGAACCGAA-CCCTTTTCAAA----------TTTTCATT----------ATTCA--------------------------TTAGTTTATAATATTAGTTTAGTAGTTTAGGTGAATCTTTTTTT-CATTGT--------------AAATATTT------GAAAGGTTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTTCAATAGTTTTATTTTTTATGAACCTGTGGAAATTGTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATATTTGATTTCTTCGGTGAATGATTCTAACAAAAATGGATTTTGGGGTCAC---------AAGAATTCTTTTTCTTCTCATTTTTATTATCAAATGGTATCAGAAGGTTTTGGAGTCATTCTTGAAATTCCATTCTCATCGCGAGTAGTATCTTCCCTTGAAGAAAAA---AGAATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTGCATTTCTTGCGATTGTTTTTTCACGAATCTCATAATTTGAATAATCTCATTACTTCAAATAAAATTATTTACGTCTCTTCAAAAATCAAGAAAAGATTCTTTTGGTTCCTACATAATTCTTATGTATATGAATTCGAATATCTATTCCTGTTTATTCGTAAACAGTCTTCTTATTTACGATCAATATCTTCTGGAGTATTTCTTGAGCGAACACATTTCTATGGAAAAATAGAATATCTTATAGTCATG---------TGTTGTAATTCTTTTCAGAGGATCCTATGGTTTCTCAAATATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTTTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTCATCTTGTTAATTTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAGCAATTACCTAACTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTGTACTAAAA---AATCCTTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGTCCCAGTTATTTATCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTGTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCATTATCACAGGGGATCCTCAAAGAAGCAGGTTTTGTATCGTATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGAACTTTTATGCGAAGATTAGGTTCGGGATTTTTAGAAGAATTTTTTTTGGAAGAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGGAATC--GA-TA--TACCGAGCGATTCGGAGAACCCGTGAAA--AGAGCGAA--CGGCCGTCCT-GGCCTTCG-----CCCCGTCTC-CCCTTC--GCGGGGATCGGGG----CACTGCGGAGGACGGATGAAA--------CACAAA--CCGGCGCAGCATCGCGCCAAGGGAAAA---GATCG-AAAGGCACGAGCCCCGCGTCGGG--CTCGGTGGCG--TGGGGTGCTGTTGCACGCCGCGCGGATGGAAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCGTTGCGTCGCTCCGTGCCAG--CTCCGTCCAC-GCCAGCGGGCGTGTC-GGACG--AGGCTCGGATGTGCAGAGTGGCTCGTCGTGCTC--GTCGGCGCGGCGGGCTGAAGAGCGGGTAT-CGTC-TC--GCCGGCCGCGAACA-ACAAGGGGTGGG-TG-AAAGCTGTGAGCGCAGCCTGCGTTGTCTCGCGCCGGCCCGAGAGACGGGTTGTGCC----TTCGATGTG--ATCCCGGC-CCAAGCGC--CGATCGG-CACGCGGCGGCTTGGAATGCGACCCCAGGATGGGCGAGGCCACCCGCCGAGTTTAAGCATATCAATAAGCGGAGGAGAAGCCCCTCAACAAATCATGGTTTGGGCAAAAAAAATTCTACCGAATGGAGAGATAGTTGGAGAGGTGACAAAACCCTATACTTTTCATTATAAAACTAATAAACCGGAGAAAGATGGATTGTTTTGTGAAAGAATTTCCGGACCCATAAAAAGTGGGATTTGTGCTTGTGGAAATTACCGAGGAATTGGGACTGAAAAAGAAGACCCGAAATTTTGTGAAGAATGCGGGGTGGAATTTGTTGATTCTCGTATACGAAGGTACCAAATGGGATACATCAAACTAACATGTCCAGTGACTCATGTGTGGTATTTGAAACGTCTTCCTAGTTATATTGCGAATCTTTTAGATAAGTCCCTTAGAGAATTAGAGGGCCTAGTATATTGCGATGTGTGATTTGATCGAAATTTTCATTTGACAGATTTGTACTGAGAAACTGTCATCCCATTTAATCTGATTGGGATGCCCCCGGCTCTGACATGTATCTTGGGAGGAGGAACATGAAGCTCAGAATTATGGATGCATTCAAGACTTCAAAATGGAAGAAAAGGGGAATTGATCCATGGTCGATTCCGTAACAAATAATATAGGAATAGTTAGTTATACCTCGTGAAAAAATACTTTTTGCGGAATTATACATTCTATTTCTTTGAAAAA-GAAATGCTGTTCAGGC--AAGCGCAAGCAAATATAACATGGTTACAGGAGCTT-ATTTATCGCATATATGCTTCAAGGGATATCATGCACATAACCATCGAGGTGAGTAGAGACCTAAAAAAGATCGAATGGAACAATACAATATATAGACAAAGAAATCCTTTATGAGTCCCAAAATATTCCTTTCAGGGGATTCATCTTTTGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCCTTTTTTT-----CGTAAACATAAAAGAAAGTAAAAGAGGTTAGAGCAAAAATAAAAAATAAAATAAGA---------TAAGAATGAATCAATGAAAGTATGGTCCTTACTGGGAACTTGAGTAAA-------GAGTAGCTTTTTGTAGGGTTTTCTCGAACAAAGTTTTAAAAAGAAGAA---CCCCTTTCTTT-ATTTGG-TGTAACTACTTGAGCCGGATGAAAGGAAACCTTCACGTCCGATTGTGAGGGGGGGAATCCAATACTATAGGAACCTATCTCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTCATTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTCTTTTTTACTACTCAAGGTTTCGAGACATTTCGAAACCGAGAAATCTCTACGGGGGCAGGTGCTATCAGAGAACAATTAGCCGATTCGGATTTGCGAATTATTACAGATAATTCTTTGGTAGAATGGAAGGAATTAGGAGATGAAGAGTCCACAGGAAATGAATGGGAAGATAAAAAAATTAGAAGAAGAAAGGATTTTTTGGTTAGGCGCATAGAATTAGCTAAACATTTTCTTCGAACAAATGTAGACCCAGAATGGATGGTTTTGTGCCTATTACCAGTTCTTCCTCCTGAGTTGAGACCAATCATTCAGATAGACGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATAGAAGAGTCATCTATCGGAACAATACTCTTACCGATCTATTAGCAACAAGTAGATCTACACCAGGGGAATTAATAATGTGTCAAGAGAAATTGGTACAAGAGGCCGTGGATACACTTTTTGATAATGGGATCCGCGGACAACCCATGAGAGATGGTCATAATAAAGTTTATAAGTCATTTTCCGATGTAATTGAAGGCAAAGAAGGAAGATTTCGTGAGACTCTGCTTGGTAAACGGGTCGATTATTCGGGACGTTCCGTCATTGTCGTGGGTCCTTTGCTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTCTTCCAAACATTTGTAATTCGTGGTCTAATCAGACAAGATGTTGCTTCTAACACAGGGATTGCTAAAAGCAAAATTCGGGAAAAAGAACCCATTGTATGGGAAATCCTTCAAGAAGTGATGCAGGGGCATCCTGTATTGTTGAATAGAGCGCCCACCCTGCATAGATTAGGTATACAGGCGTTCCAACCCATTTTAGTGGAGGGGCGTGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCACATACCTTTATCTTTGGAAGCTCAAGCAGAAGCTCGTTTACTTATGTTTTCTAATATGAATCTCTTGTCTCCAGCTATTGGAGATCCCGTTTCCGTACCAACTCAAGATATGCTTATTGGACTCTATGTATTAACGATCGGGAATCCCCGAGGTATTTGTGCAAATAGGTATAATCAATATAATTCTAATTGCAGAAAAAAGAAAACAGTTTATAAGAATGACTTTAAGTATACAAAAGAGCCGTATTTTTCTAGTTC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Maxillaria_rpoC1_ITS_matK_atpB) = N: 1-7214; CODONPOSSET CodonPositions (CHARACTERS = Maxillaria_rpoC1_ITS_matK_atpB) = N: 1-7214; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2985] TITLE Maxillaria_ITS_matK_atpB; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4716; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX Brasiliorchis_rupestris_SK0013 Brasiliorchis_rupestris_SK0063 Brasiliorchis_schunkiana Brasiliorchis_ubatubana_SK0155 Brasiliorchis_ubatubana_SK0373 Chrysocycnis_schlimii_GG1992763 Chrysocycnis_schlimii_W2386 Cryptocentrum_calcaratum_W0179 Cryptocentrum_calcaratum_W2651 Cryptocentrum_inaequisepalum_W1567 Cryptocentrum_inaequisepalum_W2325 Cryptocentrum_inaequisepalum_W2535 Cryptocentrum_inaequisepalum_W2700 Cryptocentrum_latifolium_A5081 Cryptocentrum_latifolium_W2349 Cryptocentrum_latifolium_W2733 Cryptocentrum_lehmannii_W2408 Cryptocentrum_peruvianum_W1796 Cryptocentrum_peruvianum_W2322 Cryptocentrum_pseudobulbosum_W1999 Cryptocentrum_pseudobulbosum_W2411 Cryptocentrum_sp._W2324 Cryptocentrum_standleyi_H8764 Cryptocentrum_standleyi_W2323 Cryptocentrum_standleyi_W2407 Cyrtidiorchis_alata_GG944005 Cyrtidiorchis_alata_W2932 Cyrtidiorchis_frontinoensis Eriopsis_biloba_W2439 Eriopsis_biloba_W3153 Heterotaxis_brasiliensis Heterotaxis_discolor_A5063 Heterotaxis_discolor_B2098 Heterotaxis_discolor_SK0311 Heterotaxis_discolor_W2350 Heterotaxis_discolor_dupe_W0198 Heterotaxis_equitans_SK0141 Heterotaxis_equitans_W2483 Heterotaxis_fritzii Heterotaxis_maleolens_A5055 Heterotaxis_maleolens_W2764 Heterotaxis_santanae Heterotaxis_sessilis_A5065 Heterotaxis_sessilis_W2544 Heterotaxis_superflua_SK0153 Heterotaxis_superflua_SK0279 Heterotaxis_superflua_W3197 Heterotaxis_valenzuelana_SK0263 Heterotaxis_valenzuelana_SK0270 Heterotaxis_valenzuelana_W2620 Heterotaxis_valenzuelana_W3000 Heterotaxis_villosa_SK0367 Heterotaxis_villosa_W2481 Heterotaxis_violaceopunctata_SK0129 Heterotaxis_violaceopunctata_W2294 Hylaeorchis_petiolaris Maxillaria_acervata Maxillaria_aciantha_A5094 Maxillaria_aciantha_W1978 Maxillaria_acicularis_SK0115 Maxillaria_acicularis_SK0237 Maxillaria_acicularis_SK0345 Maxillaria_acicularis_SK0352 Maxillaria_acicularis_SK0371 Maxillaria_acicularis_W1994 Maxillaria_acostae_B0938 Maxillaria_acostae_B2826 Maxillaria_acostae_W2644 Maxillaria_acostae_W2786 Maxillaria_acuminata_W2536 Maxillaria_acuminata_W2597 Maxillaria_acuminata_W2698 Maxillaria_acutifolia Maxillaria_adendrobium_D4231 Maxillaria_adendrobium_W2621 Maxillaria_adolphii Maxillaria_aequiloba_W1668 Maxillaria_aequiloba_W2918 Maxillaria_aff._aggregata_W3180 Maxillaria_aff._aggregata_W3189 Maxillaria_aff._arbuscula_W2500 Maxillaria_aff._lepidota_W1665 Maxillaria_aff._lepidota_W2387 Maxillaria_aff._lepidota_W2406 Maxillaria_aff._mapiriensis Maxillaria_aff._nutans Maxillaria_aff._patens Maxillaria_aff._perryae Maxillaria_aff._ponerantha Maxillaria_aff._tubercularis Maxillaria_aff._vaginalis Maxillaria_alba_A5062 Maxillaria_alba_SK0266 Maxillaria_alba_W2306 Maxillaria_allenii Maxillaria_alpestris Maxillaria_alticola_W2498 Maxillaria_alticola_W2800 Maxillaria_amparoana Maxillaria_ampliflora_B2845 Maxillaria_ampliflora_W2608 Maxillaria_anceps Maxillaria_angustisegmenta_A5095 Maxillaria_angustissima_W2637 Maxillaria_angustissima_W2637 Maxillaria_angustissima_W2637 Maxillaria_carolii Maxillaria_cassapensis Maxillaria_cedralensis Maxillaria_cerifera_SK0058 Maxillaria_cerifera_W2292 Maxillaria_cf._acutifolia Maxillaria_cf._aggregata Maxillaria_cf._alba Maxillaria_cf._anatomorum Maxillaria_cf._bennettii Maxillaria_cf._breviscapa Maxillaria_cf._confusa Maxillaria_cf._dalessandroi Maxillaria_cf._disticha Maxillaria_cf._exaltata_W2332 Maxillaria_cf._exaltata_W2333 Maxillaria_cf._friedrichsthallii Maxillaria_cf._grandiflora Maxillaria_cf._hillsii Maxillaria_cf._horichii Maxillaria_cf._laevilabris Maxillaria_cf._longicaulis Maxillaria_cf._loretotensis Maxillaria_cf._luteoalba Maxillaria_cf._madida Maxillaria_cf._microphyton_D6238 Maxillaria_cf._microphyton_W2659 Maxillaria_cf._neglecta Maxillaria_cf._nubigena_W2718 Maxillaria_cf._nubigena_W3160 Maxillaria_cf._richii Maxillaria_cf._rufescens_SK0258 Maxillaria_cf._rufescens_W1669 Maxillaria_cf._scorpioidea Maxillaria_cf._splendens Maxillaria_cf._strumata Maxillaria_cf._triloris Maxillaria_cf._umbratilis Maxillaria_cf._uncata Maxillaria_cf._variabilis Maxillaria_cf._wercklei Maxillaria_chacoensis Maxillaria_chartacifolia_W1597 Maxillaria_chartacifolia_W2752 Maxillaria_chicana Maxillaria_chionantha_A5091 Maxillaria_chionantha_W1968 Maxillaria_chionantha_W2493 Maxillaria_chionantha_W2634 Maxillaria_chionantha_W2649 Maxillaria_coccinea Maxillaria_colemanii Maxillaria_concavilabia Maxillaria_ctenostachya_Morales1639 Maxillaria_ctenostachya_W2549 Maxillaria_ctenostachya_W2647 Maxillaria_cucullata_A5066 Maxillaria_cucullata_A5079 Maxillaria_cucullata_SK0298 Maxillaria_cucullata_W0075 Maxillaria_cucullata_W2546 Maxillaria_curvicolumna Maxillaria_cymbidioides Maxillaria_dendrobioides_D6243 Maxillaria_dendrobioides_W2599 Maxillaria_dendrobioides_W2627 Maxillaria_dendrobioides_W2655 Maxillaria_densa_A5072 Maxillaria_densa_Higgins1017 Maxillaria_densa_W1964 Maxillaria_densifolia Maxillaria_desvauxiana Maxillaria_dichotoma_W2584 Maxillaria_dichotoma_W2777 Maxillaria_dillonii_W2575 Maxillaria_dillonii_W2878 Maxillaria_diuturna_B0620 Maxillaria_diuturna_D6251 Maxillaria_diuturna_W2305 Maxillaria_diuturna_W2631 Maxillaria_diuturna_W2780 Maxillaria_divaricata Maxillaria_dressleriana Maxillaria_eburnea Maxillaria_echinophyta_SK0353 Maxillaria_echinophyta_W1056 Maxillaria_echinophyta_W2990 Maxillaria_ecuadorensis_W1572 Maxillaria_ecuadorensis_W2724 Maxillaria_elatior Maxillaria_elegantula_D6262 Maxillaria_elegantula_D6264 Maxillaria_elegantula_W2576 Maxillaria_elegantula_W2578 Maxillaria_elegantula_W2872 Maxillaria_encyclioides Maxillaria_endresii Maxillaria_exaltata_D6277 Maxillaria_exaltata_W1506 Maxillaria_exaltata_W2317 Maxillaria_exaltata_W2318 Maxillaria_falcata Maxillaria_ferdinandiana_SK0089 Maxillaria_ferdinandiana_SK0109 Maxillaria_ferdinandiana_W1872 Maxillaria_flava_D5441 Maxillaria_flava_W2579 Maxillaria_flava_W2611 Maxillaria_flava_W2624 Maxillaria_fletcheriana Maxillaria_fractiflexa Maxillaria_friedrichsthallii_SK0125 Maxillaria_friedrichsthallii_W0067 Maxillaria_fulgens_D5452 Maxillaria_fulgens_W2630 Maxillaria_galantha Maxillaria_gentryi_W2379 Maxillaria_gentryi_W2499 Maxillaria_gentryi_W2656 Maxillaria_gigantea_W1579 Maxillaria_gigantea_W2316 Maxillaria_gigantea_W2398 Maxillaria_gomeziana_Atwood_sn Maxillaria_gomeziana_W1985 Maxillaria_grayii_W2409 Maxillaria_grayii_W2486 Maxillaria_grayii_W2879 Maxillaria_grisebachiana Maxillaria_guadalupensis_W1593 Maxillaria_guadalupensis_W2704 Maxillaria_guadalupensis_W2714 Maxillaria_gualaquizensis Maxillaria_guareimensis Maxillaria_haberi Maxillaria_hedwigiae_A5074 Maxillaria_hedwigiae_SK0314 Maxillaria_hedwigiae_W1961 Maxillaria_hennisiana_A5096 Maxillaria_hennisiana_W2572 Maxillaria_hennisiana_W2779 Maxillaria_hennisiana_W2808 Maxillaria_hennisiana_W2809 Maxillaria_heterophylla_var._acicularifolia_SK0095 Maxillaria_heterophylla_var._acicularifolia_SK1706 Maxillaria_heterophylla_var._intermedia Maxillaria_heterophylla_var._magnifolia Maxillaria_heterophylla_var._pygmaea_SK0113 Maxillaria_heterophylla_var._pygmaea_SK0278 Maxillaria_heterophylla_var._pygmaea_SK0292 Maxillaria_heubschii Maxillaria_horichii_W0070 Maxillaria_horichii_W2602 Maxillaria_horichii_W2615 Maxillaria_houtteana Maxillaria_imbricata_SK0025 Maxillaria_imbricata_W2337 Maxillaria_inaudita_A5054 Maxillaria_inaudita_W2763 Maxillaria_irrorata Maxillaria_johannis Maxillaria_jostii Maxillaria_jucunda_W2581 Maxillaria_jucunda_W2605 Maxillaria_juergensii_SK0069 Maxillaria_juergensii_SK0079 Maxillaria_juergensii_SK0111 Maxillaria_klugii_W2390 Maxillaria_klugii_W2492 Maxillaria_klugii_W2787 Maxillaria_laevilabris Maxillaria_lankesteri_W2885 Maxillaria_lankesteri_W2901 Maxillaria_lawrenceana Maxillaria_lehmannii Maxillaria_lepidota Maxillaria_leucaimata Maxillaria_linearifolia Maxillaria_loefgrenii Maxillaria_longibracteata Maxillaria_longicaulis Maxillaria_longicolumna Maxillaria_longiloba Maxillaria_longipes_B2965 Maxillaria_longipes_W2550 Maxillaria_longipes_W2574 Maxillaria_longipes_W2751 Maxillaria_longipetiolata_A5075 Maxillaria_longipetiolata_W1974 Maxillaria_longissima_W1642 Maxillaria_longissima_W2399 Maxillaria_longissima_W2745 Maxillaria_lueri_A5085 Maxillaria_lueri_W2051 Maxillaria_lueri_W2629 Maxillaria_lutheri_W2563 Maxillaria_lutheri_W2567 Maxillaria_lutheri_W2569 Maxillaria_madida_SK0065 Maxillaria_madida_SK0081 Maxillaria_madida_SK0107 Maxillaria_madida_W1868 Maxillaria_mapiriensis Maxillaria_marmoliana Maxillaria_meleagris_B1604 Maxillaria_meleagris_W2816 Maxillaria_meridensis_B1562 Maxillaria_meridensis_W1568 Maxillaria_meridensis_W1647 Maxillaria_meridensis_W2451 Maxillaria_meridensis_W2568 Maxillaria_mexicana Maxillaria_microphyton_W2307 Maxillaria_microphyton_W2586 Maxillaria_miniata Maxillaria_minor_W2598 Maxillaria_minor_W2607 Maxillaria_minor_W2628 Maxillaria_minuta_SK0097 Maxillaria_minuta_SK0253 Maxillaria_modesta Maxillaria_molitor_W2424 Maxillaria_molitor_W2425 Maxillaria_moralesii_B2097 Maxillaria_moralesii_W1976 Maxillaria_mosenii_var._echinochila_SK0087 Maxillaria_mosenii_var._echinochila_SK0294 Maxillaria_mosenii_var._hatschbachii_SK0071 Maxillaria_mosenii_var._hatschbachii_SK0083 Maxillaria_multicaulis Maxillaria_multiflora Maxillaria_nardoides_W2359 Maxillaria_nardoides_W2502 Maxillaria_nasuta_SK0261 Maxillaria_nasuta_W1869 Maxillaria_neglecta Maxillaria_neisseniae Maxillaria_neophylla Maxillaria_neowiedii_SK0073 Maxillaria_neowiedii_SK0091 Maxillaria_neowiedii_SK0241 Maxillaria_nicaraguensis Maxillaria_notylioglossa_SK0033 Maxillaria_notylioglossa_SK0255 Maxillaria_obscura Maxillaria_ochroleuca_SK0011 Maxillaria_ochroleuca_W2378 Maxillaria_oreocharis_A5086 Maxillaria_oreocharis_W0193 Maxillaria_oreocharis_W2594 Maxillaria_oreocharis_W2619 Maxillaria_oreocharis_W2652 Maxillaria_pacholskii_W2393 Maxillaria_pacholskii_W2464 Maxillaria_pacholskii_W2501 Maxillaria_pachyachron_B2235 Maxillaria_pachyachron_W2653 Maxillaria_pachyacron_D6249 Maxillaria_pachyphylla_A5098 Maxillaria_pachyphylla_SK0105 Maxillaria_pachyphylla_SK0369 Maxillaria_paleata_W2561 Maxillaria_paleata_W2562 Maxillaria_paleata_W2565 Maxillaria_pardalina Maxillaria_parkerii Maxillaria_parviflora_A5070 Maxillaria_parviflora_SK0027 Maxillaria_parviflora_W2019 Maxillaria_parviflora_W2822 Maxillaria_patens_W1580 Maxillaria_patens_W2715 Maxillaria_patens_W2778 Maxillaria_pauciflora_LJ5002 Maxillaria_pauciflora_W2484 Maxillaria_pendens Maxillaria_pumila_SK0094 Maxillaria_pumila_SK0101 Maxillaria_pumila_SK0243 Maxillaria_pumila_SK0355 Maxillaria_punctostriata_B2107 Maxillaria_punctostriata_W2543 Maxillaria_ramonensis Maxillaria_reichenheimiana_B2102 Maxillaria_reichenheimiana_W2616 Maxillaria_reichenheimiana_W2713 Maxillaria_repens Maxillaria_richii_A5077 Maxillaria_richii_W2362 Maxillaria_rigida_SK0007 Maxillaria_rigida_SK0053 Maxillaria_ringens Maxillaria_robusta Maxillaria_rodrigueziana Maxillaria_rotundilabia_W2516 Maxillaria_rotundilabia_W3173 Maxillaria_rubioi Maxillaria_rufescens_A5073 Maxillaria_rufescens_SK0339 Maxillaria_rufescens_W2754 Maxillaria_sanantonioensis Maxillaria_sanderiana_W1652 Maxillaria_sanderiana_W2422 Maxillaria_sanderiana_W2603 Maxillaria_sanguinea Maxillaria_scalariformis_D6252 Maxillaria_scalariformis_W2559 Maxillaria_scalariformis_W2633 Maxillaria_schlechteriana_B1662 Maxillaria_schlecteriana_W2157 Maxillaria_scorpioidea Maxillaria_serrulata Maxillaria_setigera_Atwood_sn_W196 Maxillaria_setigera_SK0117 Maxillaria_sigmoidea_B2141 Maxillaria_sigmoidea_B2915 Maxillaria_sigmoidea_D6240 Maxillaria_silvana_W2485 Maxillaria_silvana_W2747 Maxillaria_sophronitis_W2296 Maxillaria_sophronitis_W2613 Maxillaria_sp._J7921 Maxillaria_sp._LJ6100 Maxillaria_sp._LJ6406 Maxillaria_sp._W2310 Maxillaria_sp._W2368 Maxillaria_sp._W2380 Maxillaria_sp._W2904 Maxillaria_sp._W3186 Maxillaria_speciosa Maxillaria_splendens_SK0144 Maxillaria_splendens_W1962 Maxillaria_squamata Maxillaria_striata Maxillaria_strumata_SK0302 Maxillaria_strumata_W3021 Maxillaria_suarezorum_W2758 Maxillaria_suarezorum_W2895 Maxillaria_synsepala Maxillaria_tenuibulba_W2894 Maxillaria_tenuifolia_W1843 Maxillaria_tigrina_GG20012204 Maxillaria_tigrina_W2991 Maxillaria_tonduzii Maxillaria_trilobata_D6278 Maxillaria_trilobata_P2000 Maxillaria_triloris_B1640 Maxillaria_triloris_B2967 Maxillaria_triloris_W1558 Maxillaria_triloris_W2917 Maxillaria_triloris_W2928 Maxillaria_tubercularis Maxillaria_turkeliae Maxillaria_tutae Maxillaria_umbratilis_B1642 Maxillaria_umbratilis_B1835 Maxillaria_umbratilis_W2600 Maxillaria_umbratilis_W2643 Maxillaria_uncata_A5076 Maxillaria_uncata_SK0075 Maxillaria_uncata_SK0359 Maxillaria_uncata_W2394 Maxillaria_uncata_W2609 Maxillaria_vaginalis Maxillaria_variabilis_A5080 Maxillaria_variabilis_B1076 Maxillaria_variabilis_SK0327 Maxillaria_vernicosa_SK0099 Maxillaria_vernicosa_SK0103 Maxillaria_vernicosa_W1871 Maxillaria_vittariifolia_P2193 Maxillaria_vittariifolia_W1861 Maxillaria_wercklei Maxillaria_whittenii Maxillaria_witsenioides Maxillaria_woytkowskyi Maxillaria_yanganensis Mormolyca_gracilipes Mormolyca_peruviana Mormolyca_polyphylla Mormolyca_ringens_SK0134 Mormolyca_ringens_W2871 Mormolyca_schweinfurthiana_W3109 Mormolyca_schweinfurthiana_W97085 Neomoorea_wallisii Pityphyllum_antioquiense_W2436 Pityphyllum_antioquiense_W2473 Pityphyllum_huancabambae Pityphyllum_pinoides_W1653 Pityphyllum_pinoides_W2401 Pityphyllum_pinoides_W2440 Pityphyllum_saragurense Rudolfiella_floribunda Scuticaria_salesiana Trigonidium_acuminatum_SK0021 Trigonidium_acuminatum_SK0145 Trigonidium_acuminatum_SK0363 Trigonidium_acuminatum_W2442 Trigonidium_egertonianum_SK0317 Trigonidium_egertonianum_SK0361 Trigonidium_egertonianum_W0068 Trigonidium_insigne_W1599 Trigonidium_insigne_W2564 Trigonidium_insigne_W2660 Trigonidium_insigne_W2926 Trigonidium_obtusum_SK0023 Trigonidium_obtusum_W2997 Trigonidium_riopalenquense_A5097 Trigonidium_riopalenquense_W1534 Trigonidium_sp._nov._SK0315 Trigonidium_sp._nov._SK0319 Xylobium_leontoglossum_W1557 Xylobium_leontoglossum_W2683 Xylobium_pallidiflorum Xylobium_sp._SK0166 Xylobium_subpulchrum Xylobium_zarumense taxon_523 taxon_524 taxon_525 taxon_526 taxon_527 taxon_528 taxon_529 taxon_530 taxon_531 taxon_532 taxon_533 taxon_534 taxon_535 taxon_536 taxon_537 taxon_538 taxon_539 taxon_540 taxon_541 taxon_542 taxon_543 taxon_544 taxon_545 taxon_546 taxon_547 taxon_548 taxon_549 taxon_550 taxon_551 taxon_552 taxon_553 taxon_554 taxon_555 taxon_556 taxon_557 taxon_558 taxon_559 taxon_560 taxon_561 taxon_562 taxon_563 taxon_564 taxon_565 taxon_566 taxon_567 taxon_568 taxon_569 taxon_570 taxon_571 taxon_572 taxon_573 taxon_574 ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Maxillaria_ITS_matK_atpB) = N: 1-4716; CODONPOSSET CodonPositions (CHARACTERS = Maxillaria_ITS_matK_atpB) = N: 1-4716; END; BEGIN TREES; TITLE Tb9613; LINK TAXA = Taxa1; TRANSLATE 1 Maxillaria_cucullata_A5079, 2 Maxillaria_cucullata_A5066, 3 Maxillaria_ctenostachya_W2647, 4 Maxillaria_ctenostachya_W2549, 5 Maxillaria_ctenostachya_Morales1639, 6 Maxillaria_pendens, 7 Maxillaria_pauciflora_W2484, 8 Maxillaria_pauciflora_LJ5002, 9 Maxillaria_patens_W2778, 10 Maxillaria_patens_W2715, 11 Maxillaria_patens_W1580, 12 Maxillaria_parviflora_W2822, 13 Maxillaria_parviflora_W2019, 14 Maxillaria_parviflora_SK0027, 15 Maxillaria_parviflora_A5070, 16 Maxillaria_parkerii, 17 Maxillaria_concavilabia, 18 Maxillaria_colemanii, 19 Maxillaria_coccinea, 20 Maxillaria_chionantha_W2649, 21 Maxillaria_chionantha_W2634, 22 Maxillaria_chionantha_W2493, 23 Maxillaria_chionantha_W1968, 24 Maxillaria_chionantha_A5091, 25 Maxillaria_chicana, 26 Maxillaria_chartacifolia_W2752, 27 Maxillaria_chartacifolia_W1597, 28 Maxillaria_chacoensis, 29 Maxillaria_cf._wercklei, 30 Maxillaria_cf._variabilis, 31 Maxillaria_cf._uncata, 32 Maxillaria_pardalina, 33 Maxillaria_paleata_W2565, 34 Maxillaria_paleata_W2562, 35 Maxillaria_paleata_W2561, 36 Maxillaria_pachyphylla_SK0369, 37 Maxillaria_pachyphylla_SK0105, 38 Maxillaria_pachyphylla_A5098, 39 Maxillaria_pachyacron_D6249, 40 Maxillaria_pachyachron_W2653, 41 Maxillaria_pachyachron_B2235, 42 Maxillaria_pacholskii_W2501, 43 Maxillaria_pacholskii_W2464, 44 Maxillaria_pacholskii_W2393, 45 Maxillaria_oreocharis_W2652, 46 Maxillaria_oreocharis_W2619, 47 Maxillaria_oreocharis_W2594, 48 Maxillaria_oreocharis_W0193, 49 Maxillaria_oreocharis_A5086, 50 Maxillaria_ochroleuca_W2378, 51 Maxillaria_ochroleuca_SK0011, 52 Maxillaria_obscura, 53 Maxillaria_notylioglossa_SK0255, 54 Maxillaria_notylioglossa_SK0033, 55 Maxillaria_nicaraguensis, 56 Maxillaria_neowiedii_SK0241, 57 Maxillaria_cf._umbratilis, 58 Maxillaria_cf._triloris, 59 Maxillaria_cf._strumata, 60 Maxillaria_cf._splendens, 61 Maxillaria_cf._scorpioidea, 62 Maxillaria_cf._rufescens_W1669, 63 Maxillaria_cf._rufescens_SK0258, 64 Maxillaria_cf._richii, 65 Maxillaria_cf._nubigena_W3160, 66 Maxillaria_cf._nubigena_W2718, 67 Maxillaria_cf._neglecta, 68 Maxillaria_cf._microphyton_W2659, 69 Maxillaria_cf._microphyton_D6238, 70 Maxillaria_cf._madida, 71 Maxillaria_cf._luteoalba, 72 Maxillaria_cf._loretotensis, 73 Maxillaria_cf._longicaulis, 74 Maxillaria_cf._laevilabris, 75 Maxillaria_cf._horichii, 76 Maxillaria_cf._hillsii, 77 Maxillaria_cf._grandiflora, 78 Maxillaria_cf._friedrichsthallii, 79 Maxillaria_cf._exaltata_W2333, 80 Mormolyca_ringens_SK0134, 81 Mormolyca_polyphylla, 82 Mormolyca_peruviana, 83 Mormolyca_gracilipes, 84 Maxillaria_yanganensis, 85 Maxillaria_woytkowskyi, 86 Maxillaria_witsenioides, 87 Maxillaria_whittenii, 88 Maxillaria_cf._exaltata_W2332, 89 Maxillaria_cf._disticha, 90 Maxillaria_cf._dalessandroi, 91 Maxillaria_wercklei, 92 Maxillaria_vittariifolia_W1861, 93 Maxillaria_neowiedii_SK0091, 94 Maxillaria_neowiedii_SK0073, 95 Maxillaria_neophylla, 96 Maxillaria_neisseniae, 97 Maxillaria_neglecta, 98 Maxillaria_nasuta_W1869, 99 Maxillaria_nasuta_SK0261, 100 Maxillaria_nardoides_W2502, 101 Maxillaria_nardoides_W2359, 102 Maxillaria_multiflora, 103 Maxillaria_multicaulis, 104 Maxillaria_mosenii_var._hatschbachii_SK0083, 105 Maxillaria_mosenii_var._hatschbachii_SK0071, 106 Maxillaria_vittariifolia_P2193, 107 Maxillaria_vernicosa_W1871, 108 Maxillaria_vernicosa_SK0103, 109 Maxillaria_vernicosa_SK0099, 110 Maxillaria_variabilis_SK0327, 111 Maxillaria_variabilis_B1076, 112 Maxillaria_variabilis_A5080, 113 Maxillaria_vaginalis, 114 Maxillaria_uncata_W2609, 115 Maxillaria_uncata_W2394, 116 Maxillaria_uncata_SK0359, 117 Maxillaria_uncata_SK0075, 118 Maxillaria_uncata_A5076, 119 Maxillaria_umbratilis_W2643, 120 Maxillaria_umbratilis_W2600, 121 Maxillaria_umbratilis_B1835, 122 Maxillaria_umbratilis_B1642, 123 Maxillaria_tutae, 124 Maxillaria_turkeliae, 125 Maxillaria_tubercularis, 126 Maxillaria_triloris_W2928, 127 Maxillaria_triloris_W2917, 128 Maxillaria_triloris_W1558, 129 Maxillaria_triloris_B2967, 130 Maxillaria_triloris_B1640, 131 Maxillaria_trilobata_P2000, 132 Maxillaria_trilobata_D6278, 133 Maxillaria_tonduzii, 134 Maxillaria_tigrina_W2991, 135 Maxillaria_tigrina_GG20012204, 136 Maxillaria_tenuifolia_W1843, 137 Maxillaria_tenuibulba_W2894, 138 Maxillaria_synsepala, 139 Maxillaria_suarezorum_W2895, 140 Maxillaria_suarezorum_W2758, 141 Maxillaria_strumata_W3021, 142 Maxillaria_strumata_SK0302, 143 Maxillaria_striata, 144 Maxillaria_squamata, 145 Maxillaria_splendens_W1962, 146 Maxillaria_splendens_SK0144, 147 Maxillaria_speciosa, 148 Maxillaria_sp._W3186, 149 Maxillaria_sp._W2904, 150 Maxillaria_sp._W2380, 151 Maxillaria_sp._W2368, 152 Maxillaria_sp._W2310, 153 Maxillaria_sp._LJ6406, 154 Maxillaria_sp._LJ6100, 155 Maxillaria_sp._J7921, 156 Maxillaria_sophronitis_W2613, 157 Maxillaria_sophronitis_W2296, 158 Maxillaria_silvana_W2747, 159 Maxillaria_silvana_W2485, 160 Maxillaria_sigmoidea_D6240, 161 Maxillaria_sigmoidea_B2915, 162 Maxillaria_sigmoidea_B2141, 163 Maxillaria_setigera_SK0117, 164 Maxillaria_setigera_Atwood_sn_W196, 165 Maxillaria_serrulata, 166 Maxillaria_scorpioidea, 167 Maxillaria_schlecteriana_W2157, 168 Maxillaria_schlechteriana_B1662, 169 Maxillaria_scalariformis_W2633, 170 Maxillaria_mosenii_var._echinochila_SK0294, 171 Maxillaria_mosenii_var._echinochila_SK0087, 172 Maxillaria_moralesii_W1976, 173 Maxillaria_moralesii_B2097, 174 Maxillaria_molitor_W2425, 175 Maxillaria_molitor_W2424, 176 Maxillaria_modesta, 177 Maxillaria_minuta_SK0253, 178 Maxillaria_minuta_SK0097, 179 Maxillaria_minor_W2628, 180 Maxillaria_minor_W2607, 181 Maxillaria_minor_W2598, 182 Maxillaria_miniata, 183 Maxillaria_microphyton_W2586, 184 Maxillaria_microphyton_W2307, 185 Maxillaria_mexicana, 186 Maxillaria_meridensis_W2568, 187 Maxillaria_meridensis_W2451, 188 Maxillaria_meridensis_W1647, 189 Maxillaria_meridensis_W1568, 190 Maxillaria_meridensis_B1562, 191 Maxillaria_meleagris_W2816, 192 Maxillaria_meleagris_B1604, 193 Maxillaria_marmoliana, 194 Maxillaria_mapiriensis, 195 Maxillaria_madida_W1868, 196 Maxillaria_madida_SK0107, 197 Maxillaria_madida_SK0081, 198 Maxillaria_madida_SK0065, 199 Maxillaria_lutheri_W2569, 200 Maxillaria_lutheri_W2567, 201 Maxillaria_lutheri_W2563, 202 Maxillaria_lueri_W2629, 203 Maxillaria_lueri_W2051, 204 Maxillaria_lueri_A5085, 205 Maxillaria_longissima_W2745, 206 Maxillaria_longissima_W2399, 207 Maxillaria_longissima_W1642, 208 Maxillaria_longipetiolata_W1974, 209 Maxillaria_longipetiolata_A5075, 210 Maxillaria_longipes_W2751, 211 Maxillaria_longipes_W2574, 212 Maxillaria_longipes_W2550, 213 Maxillaria_longipes_B2965, 214 Maxillaria_longiloba, 215 Maxillaria_longicolumna, 216 Maxillaria_longicaulis, 217 Maxillaria_longibracteata, 218 Maxillaria_loefgrenii, 219 Maxillaria_linearifolia, 220 Maxillaria_leucaimata, 221 Maxillaria_lepidota, 222 Maxillaria_lehmannii, 223 Maxillaria_lawrenceana, 224 Maxillaria_lankesteri_W2901, 225 Maxillaria_lankesteri_W2885, 226 Maxillaria_laevilabris, 227 Maxillaria_klugii_W2787, 228 Maxillaria_klugii_W2492, 229 Maxillaria_klugii_W2390, 230 Maxillaria_juergensii_SK0111, 231 Maxillaria_juergensii_SK0079, 232 Maxillaria_juergensii_SK0069, 233 Maxillaria_jucunda_W2605, 234 Maxillaria_jucunda_W2581, 235 Maxillaria_jostii, 236 Maxillaria_johannis, 237 Maxillaria_irrorata, 238 Maxillaria_inaudita_W2763, 239 Maxillaria_inaudita_A5054, 240 Maxillaria_imbricata_W2337, 241 Maxillaria_imbricata_SK0025, 242 Maxillaria_houtteana, 243 Maxillaria_horichii_W2615, 244 Maxillaria_horichii_W2602, 245 Maxillaria_horichii_W0070, 246 Maxillaria_heubschii, 247 Maxillaria_heterophylla_var._pygmaea_SK0292, 248 Maxillaria_heterophylla_var._pygmaea_SK0278, 249 Maxillaria_heterophylla_var._pygmaea_SK0113, 250 Maxillaria_heterophylla_var._magnifolia, 251 Maxillaria_heterophylla_var._intermedia, 252 Maxillaria_heterophylla_var._acicularifolia_SK1706, 253 Maxillaria_scalariformis_W2559, 254 Maxillaria_scalariformis_D6252, 255 Maxillaria_sanguinea, 256 Maxillaria_sanderiana_W2603, 257 Maxillaria_sanderiana_W2422, 258 Maxillaria_sanderiana_W1652, 259 Maxillaria_sanantonioensis, 260 Maxillaria_rufescens_W2754, 261 Maxillaria_rufescens_SK0339, 262 Maxillaria_rufescens_A5073, 263 Maxillaria_rubioi, 264 Maxillaria_rotundilabia_W3173, 265 Maxillaria_rotundilabia_W2516, 266 Maxillaria_rodrigueziana, 267 Maxillaria_robusta, 268 Maxillaria_ringens, 269 Maxillaria_rigida_SK0053, 270 Maxillaria_rigida_SK0007, 271 Maxillaria_richii_W2362, 272 Maxillaria_richii_A5077, 273 Maxillaria_repens, 274 Maxillaria_reichenheimiana_W2713, 275 Maxillaria_reichenheimiana_W2616, 276 Maxillaria_reichenheimiana_B2102, 277 Maxillaria_ramonensis, 278 Maxillaria_punctostriata_W2543, 279 Maxillaria_punctostriata_B2107, 280 Maxillaria_pumila_SK0355, 281 Maxillaria_pumila_SK0243, 282 Maxillaria_heterophylla_var._acicularifolia_SK0095, 283 Maxillaria_hennisiana_W2809, 284 Maxillaria_hennisiana_W2808, 285 Maxillaria_hennisiana_W2779, 286 Maxillaria_hennisiana_W2572, 287 Maxillaria_hennisiana_A5096, 288 Maxillaria_hedwigiae_W1961, 289 Maxillaria_hedwigiae_SK0314, 290 Maxillaria_hedwigiae_A5074, 291 Maxillaria_haberi, 292 Maxillaria_guareimensis, 293 Maxillaria_gualaquizensis, 294 Maxillaria_guadalupensis_W2714, 295 Maxillaria_guadalupensis_W2704, 296 Maxillaria_guadalupensis_W1593, 297 Maxillaria_grisebachiana, 298 Maxillaria_grayii_W2879, 299 Maxillaria_grayii_W2486, 300 Maxillaria_grayii_W2409, 301 Maxillaria_gomeziana_W1985, 302 Maxillaria_gomeziana_Atwood_sn, 303 Maxillaria_pumila_SK0101, 304 Maxillaria_pumila_SK0094, 305 Xylobium_zarumense, 306 Xylobium_subpulchrum, 307 Xylobium_sp._SK0166, 308 Xylobium_pallidiflorum, 309 Xylobium_leontoglossum_W2683, 310 Xylobium_leontoglossum_W1557, 311 Trigonidium_sp._nov._SK0319, 312 Trigonidium_sp._nov._SK0315, 313 Trigonidium_riopalenquense_W1534, 314 Trigonidium_riopalenquense_A5097, 315 Trigonidium_obtusum_W2997, 316 Trigonidium_obtusum_SK0023, 317 Trigonidium_insigne_W2926, 318 Trigonidium_insigne_W2660, 319 Trigonidium_insigne_W2564, 320 Trigonidium_insigne_W1599, 321 Trigonidium_egertonianum_W0068, 322 Trigonidium_egertonianum_SK0361, 323 Trigonidium_egertonianum_SK0317, 324 Trigonidium_acuminatum_W2442, 325 Trigonidium_acuminatum_SK0363, 326 Trigonidium_acuminatum_SK0145, 327 Trigonidium_acuminatum_SK0021, 328 Scuticaria_salesiana, 329 Rudolfiella_floribunda, 330 Pityphyllum_saragurense, 331 Pityphyllum_pinoides_W2440, 332 Pityphyllum_pinoides_W2401, 333 Pityphyllum_pinoides_W1653, 334 Pityphyllum_huancabambae, 335 Pityphyllum_antioquiense_W2473, 336 Pityphyllum_antioquiense_W2436, 337 Neomoorea_wallisii, 338 Mormolyca_schweinfurthiana_W97085, 339 Mormolyca_schweinfurthiana_W3109, 340 Mormolyca_ringens_W2871, 341 Maxillaria_gigantea_W2398, 342 Maxillaria_gigantea_W2316, 343 Maxillaria_gigantea_W1579, 344 Maxillaria_gentryi_W2656, 345 Maxillaria_gentryi_W2499, 346 Maxillaria_gentryi_W2379, 347 Maxillaria_galantha, 348 Maxillaria_fulgens_W2630, 349 Maxillaria_fulgens_D5452, 350 Maxillaria_friedrichsthallii_W0067, 351 Maxillaria_friedrichsthallii_SK0125, 352 Maxillaria_fractiflexa, 353 Maxillaria_fletcheriana, 354 Maxillaria_flava_W2624, 355 Maxillaria_flava_W2611, 356 Maxillaria_flava_W2579, 357 Maxillaria_flava_D5441, 358 Maxillaria_ferdinandiana_W1872, 359 Maxillaria_ferdinandiana_SK0109, 360 Maxillaria_ferdinandiana_SK0089, 361 Maxillaria_falcata, 362 Maxillaria_exaltata_W2318, 363 Maxillaria_exaltata_W2317, 364 Maxillaria_exaltata_W1506, 365 Maxillaria_exaltata_D6277, 366 Maxillaria_endresii, 367 Maxillaria_encyclioides, 368 Maxillaria_elegantula_W2872, 369 Maxillaria_elegantula_W2578, 370 Maxillaria_elegantula_W2576, 371 Maxillaria_elegantula_D6264, 372 Maxillaria_elegantula_D6262, 373 Maxillaria_elatior, 374 Maxillaria_ecuadorensis_W2724, 375 Maxillaria_ecuadorensis_W1572, 376 Maxillaria_echinophyta_W2990, 377 Maxillaria_echinophyta_W1056, 378 Maxillaria_echinophyta_SK0353, 379 Maxillaria_eburnea, 380 Maxillaria_dressleriana, 381 Maxillaria_divaricata, 382 Maxillaria_diuturna_W2780, 383 Maxillaria_diuturna_W2631, 384 Maxillaria_diuturna_W2305, 385 Maxillaria_diuturna_D6251, 386 Maxillaria_diuturna_B0620, 387 Maxillaria_dillonii_W2878, 388 Maxillaria_dillonii_W2575, 389 Maxillaria_dichotoma_W2777, 390 Maxillaria_dichotoma_W2584, 391 Maxillaria_desvauxiana, 392 Maxillaria_densifolia, 393 Maxillaria_densa_W1964, 394 Maxillaria_densa_Higgins1017, 395 Maxillaria_densa_A5072, 396 Maxillaria_dendrobioides_W2655, 397 Maxillaria_dendrobioides_W2627, 398 Maxillaria_cf._confusa, 399 Maxillaria_cf._breviscapa, 400 Maxillaria_cf._bennettii, 401 Maxillaria_cf._anatomorum, 402 Maxillaria_cf._alba, 403 Maxillaria_cf._aggregata, 404 Maxillaria_cf._acutifolia, 405 Maxillaria_cerifera_W2292, 406 Maxillaria_cerifera_SK0058, 407 Maxillaria_cedralensis, 408 Maxillaria_cassapensis, 409 Maxillaria_carolii, 410 Maxillaria_angustissima_W2637, 411 Maxillaria_angustissima_W2637, 412 Maxillaria_angustissima_W2637, 413 Maxillaria_angustisegmenta_A5095, 414 Maxillaria_anceps, 415 Maxillaria_ampliflora_W2608, 416 Maxillaria_ampliflora_B2845, 417 Maxillaria_amparoana, 418 Maxillaria_alticola_W2800, 419 Maxillaria_alticola_W2498, 420 Maxillaria_alpestris, 421 Maxillaria_allenii, 422 Maxillaria_alba_W2306, 423 Maxillaria_alba_SK0266, 424 Maxillaria_alba_A5062, 425 Maxillaria_aff._vaginalis, 426 Maxillaria_aff._tubercularis, 427 Maxillaria_aff._ponerantha, 428 Maxillaria_aff._perryae, 429 Maxillaria_aff._patens, 430 Maxillaria_aff._nutans, 431 Maxillaria_aff._mapiriensis, 432 Maxillaria_aff._lepidota_W2406, 433 Maxillaria_aff._lepidota_W2387, 434 Maxillaria_aff._lepidota_W1665, 435 Maxillaria_aff._arbuscula_W2500, 436 Maxillaria_aff._aggregata_W3189, 437 Maxillaria_aff._aggregata_W3180, 438 Maxillaria_aequiloba_W2918, 439 Maxillaria_aequiloba_W1668, 440 Maxillaria_adolphii, 441 Maxillaria_adendrobium_W2621, 442 Maxillaria_adendrobium_D4231, 443 Maxillaria_acutifolia, 444 Maxillaria_acuminata_W2698, 445 Maxillaria_acuminata_W2597, 446 Maxillaria_acuminata_W2536, 447 Maxillaria_acostae_W2786, 448 Maxillaria_acostae_W2644, 449 Maxillaria_acostae_B2826, 450 Maxillaria_acostae_B0938, 451 Maxillaria_acicularis_W1994, 452 Maxillaria_acicularis_SK0371, 453 Maxillaria_acicularis_SK0352, 454 Maxillaria_acicularis_SK0345, 455 Maxillaria_acicularis_SK0237, 456 Maxillaria_acicularis_SK0115, 457 Maxillaria_aciantha_W1978, 458 Maxillaria_aciantha_A5094, 459 Maxillaria_acervata, 460 Hylaeorchis_petiolaris, 461 Heterotaxis_violaceopunctata_W2294, 462 Heterotaxis_violaceopunctata_SK0129, 463 Heterotaxis_villosa_W2481, 464 Maxillaria_dendrobioides_W2599, 465 Maxillaria_dendrobioides_D6243, 466 Maxillaria_cymbidioides, 467 Maxillaria_curvicolumna, 468 Maxillaria_cucullata_W2546, 469 Maxillaria_cucullata_W0075, 470 Maxillaria_cucullata_SK0298, 471 Heterotaxis_villosa_SK0367, 472 Heterotaxis_valenzuelana_W3000, 473 Heterotaxis_valenzuelana_W2620, 474 Heterotaxis_valenzuelana_SK0270, 475 Heterotaxis_valenzuelana_SK0263, 476 Heterotaxis_superflua_W3197, 477 Heterotaxis_superflua_SK0279, 478 Heterotaxis_superflua_SK0153, 479 Heterotaxis_sessilis_W2544, 480 Heterotaxis_sessilis_A5065, 481 Heterotaxis_santanae, 482 Heterotaxis_maleolens_W2764, 483 Heterotaxis_maleolens_A5055, 484 Heterotaxis_fritzii, 485 Heterotaxis_equitans_W2483, 486 Heterotaxis_equitans_SK0141, 487 Heterotaxis_discolor_W2350, 488 Heterotaxis_discolor_SK0311, 489 Heterotaxis_discolor_dupe_W0198, 490 Heterotaxis_discolor_B2098, 491 Heterotaxis_discolor_A5063, 492 Heterotaxis_brasiliensis, 493 Eriopsis_biloba_W3153, 494 Eriopsis_biloba_W2439, 495 Cyrtidiorchis_frontinoensis, 496 Cyrtidiorchis_alata_W2932, 497 Cyrtidiorchis_alata_GG944005, 498 Cryptocentrum_standleyi_W2407, 499 Cryptocentrum_standleyi_W2323, 500 Cryptocentrum_standleyi_H8764, 501 Cryptocentrum_sp._W2324, 502 Cryptocentrum_pseudobulbosum_W2411, 503 Cryptocentrum_pseudobulbosum_W1999, 504 Cryptocentrum_peruvianum_W2322, 505 Cryptocentrum_peruvianum_W1796, 506 Cryptocentrum_lehmannii_W2408, 507 Cryptocentrum_latifolium_W2733, 508 Cryptocentrum_latifolium_W2349, 509 Cryptocentrum_latifolium_A5081, 510 Cryptocentrum_inaequisepalum_W2700, 511 Cryptocentrum_inaequisepalum_W2535, 512 Cryptocentrum_inaequisepalum_W2325, 513 Cryptocentrum_inaequisepalum_W1567, 514 Cryptocentrum_calcaratum_W2651, 515 Cryptocentrum_calcaratum_W0179, 516 Chrysocycnis_schlimii_W2386, 517 Chrysocycnis_schlimii_GG1992763, 518 Brasiliorchis_ubatubana_SK0373, 519 Brasiliorchis_ubatubana_SK0155, 520 Brasiliorchis_schunkiana, 521 Brasiliorchis_rupestris_SK0063, 522 Brasiliorchis_rupestris_SK0013, 523 taxon_523, 524 taxon_524, 525 taxon_525, 526 taxon_526, 527 taxon_527, 528 taxon_528, 529 taxon_529, 530 taxon_530, 531 taxon_531, 532 taxon_532, 533 taxon_533, 534 taxon_534, 535 taxon_535, 536 taxon_536, 537 taxon_537, 538 taxon_538, 539 taxon_539, 540 taxon_540, 541 taxon_541, 542 taxon_542, 543 taxon_543, 544 taxon_544, 545 taxon_545, 546 taxon_546, 547 taxon_547, 548 taxon_548, 549 taxon_549, 550 taxon_550, 551 taxon_551, 552 taxon_552, 553 taxon_553, 554 taxon_554, 555 taxon_555, 556 taxon_556, 557 taxon_557, 558 taxon_558, 559 taxon_559, 560 taxon_560, 561 taxon_561, 562 taxon_562, 563 taxon_563, 564 taxon_564, 565 taxon_565, 566 taxon_566, 567 taxon_567, 568 taxon_568, 569 taxon_569, 570 taxon_570, 571 taxon_571, 572 taxon_572, 573 taxon_573, 574 taxon_574; TREE 'Fig. 5-7' = [&R] (((((((((((((((((((207,206),205),(124,175,174),(76,246),(222,379),77,237),(((((371,368),372,370),369),85),(234,233)),((353,258,257,256),('Maxillaria_augustae-victoriae_D6266','Maxillaria_augustae-victoriae_W2893'),Maxillaria_platypetala),90,298,299,300,143),401),(((11,9),10),((296,294),295)),((39,40),41)),(((((((Maxillaria_confusa_A5083,398),Maxillaria_confusa_W2736,Maxillaria_atwoodiana),Maxillaria_confusa_W2367),((Maxillaria_crocea_SK0005,Maxillaria_crocea_W2299),274),(Maxillaria_pseudoreichenheimiana_A5078,Maxillaria_pseudoreichenheimiana_W2335),(276,275)),(Maxillaria_arachnitiflora_B2262,Maxillaria_arachnitiflora_Matthews_sn)),((159,158),399)),(((412,Maxillaria_angustissima_W2735),Maxillaria_angustissima_B2103),277)),(((((375,374),87),433),((434,221),432)),176),352),(400,429)),467),347),(((((((413,Maxillaria_angustisegmenta_W2570),(268,214)),(Maxillaria_cryptobulbon_A5060,Maxillaria_cryptobulbon_W2494)),((285,284),287,286,283),417),((((Maxillaria_porrecta_B0337,Maxillaria_porrecta_P0978),Maxillaria_porrecta_A5064,220,Maxillaria_porrecta_W1967,Maxillaria_porrecta_W2617,Maxillaria_porrecta_W2931),Maxillaria_porrecta_W1966),18)),(((449,448),447),450)),148)),(((((((((364,363,88,79,186),365),(((188,187),189),190)),(362,216)),(439,438)),((154,153),(265,264))),((150,84),235)),((((147,95),346),((263,345),344)),266)),(((163,267),409,58,164),366))),(((24,23),20,21),22)),((((229,228,227),((146,145),Maxillaria_buchtienii_W2940),60),((151,7),8),149),(((Maxillaria_perryae_J8101,428),Maxillaria_perryae_A5088),Maxillaria_perryae_W1672)),(51,50)),((((203,202),204),Maxillaria_brachybulbon),(((Maxillaria_attenuata_W0657,193),Maxillaria_bradei),Maxillaria_bolivarensis)),((((129,127,126),130),128),(16,102)),72),Maxillaria_pulla),((((212,96),210),213),211)),(388,387)),((((((((((((((((168,167),33,35),34,161),((180,179),181)),((113,425),(390,389))),((201,199),160,200),162),((((((465,464),(397,396)),421),133),(((254,169),253),123)),((((Maxillaria_biolleyi_B2092,138),Maxillaria_biolleyi_D6241),361,440),52))),((241,240,215),(302,301,Maxillaria_bracteata_W2198),(Maxillaria_bracteata_A5068,Maxillaria_bracteata_SK0305)),(395,394,393),(125,426),165),(135,134)),((((((69,356),183,357),184),(355,354)),68),(((225,224),(29,155)),91))),(192,191)),(((((121,120),(119,57),122),(Maxillaria_carinulata,Maxillaria_bradeorum_W2716),415,Maxillaria_bradeorum_W2590),((416,Maxillaria_bradeorum_W2639),Maxillaria_bradeorum_W2566),Maxillaria_campanulata),(132,131))),(106,92)),((((((13,12),15,14),297,17),(((75,243),244),(Maxillaria_pseudoneglecta_A5089,Maxillaria_pseudoneglecta_W2626)),(97,67)),((142,141),Maxillaria_brevilabia_B1717,Maxillaria_brevilabia_W2606)),((4,3),5))),((239,238),291),(Maxillaria_camaridii_GG20033648,Maxillaria_camaridii_SK0347)),((((2,278),468),(279,470)),1))); TREE 'Figs. 1-4' = [&R] ((493,494),((((((((((((((367,((((458,457),350),(351,61),78),166)),86),(54,406,53,405)),((446,444),445)),381),((((((((((424,423),422),(49,(47,46,45))),402),(255,136)),373),242),((((112,110),111),(Maxillaria_costaricensis_B1475,Maxillaria_costaricensis_W1910,30),185),414)),223),(((((32,(Maxillaria_procurrens_W2397,Maxillaria_procurrens_W2452)),((219,408),(392,Maxillaria_procurrens_W2438),((Maxillaria_arbuscula_W2395,Maxillaria_arbuscula_W2902),(435,(Maxillaria_arbuscula_W2508,Maxillaria_arbuscula_W2810))))),(((385,386,384,382),383),(Maxillaria_ponerantha_W2363,(Maxillaria_ponerantha_W2555,Maxillaria_ponerantha_W2654))),(236,(217,292))),459),Maxillaria_procurrens_W1657))),((((((314,313),(322,321)),323),(((316,315),(312,311)),(((320,319),317),318))),(327,326,325,324)),Maxillaria_clade_B)),((((((((38,37,36,195),(((((Maxillaria_pumila_FP,Maxillaria_plebeja_SK0085,280,Maxillaria_plebeja_SK1653),303),((304,178),(177,Maxillaria_plebeja_W1834))),107),(((((232,231),((360,358),359)),(((282,252,(249,251)),230),((250,248),247))),93),281))),56),(378,(376,377))),(109,108)),((((((((198,171),170,451),(453,452)),456),197,196),104,454),(455,70),105),(152,(101,100)))),(((((117,115),144),(116,114)),31),(44,(43,42)))),((391,(Maxillaria_auyantepuiensis_W2347,Maxillaria_auyantepuiensis_W2360)),(208,209)))),(((((((((380,((((((173,Maxillaria_candida),259),28),140),172),139)),((((262,(261,260)),62),63),((404,443),137,64))),(517,516)),((290,(289,288)),(272,271))),(80,340)),(83,(338,339))),82),81),(((497,496),495),(((226,420),74),25)))),(((((Maxillaria_bicallosa_A5059,26),27),((Maxillaria_bicallosa_A5058,Maxillaria_bicallosa_W2748),((Maxillaria_bicallosa_W1677,Maxillaria_bicallosa_W2480),Maxillaria_bicallosa_W2636))),(((((((509,507),508),514),(513,(512,(506,511,510)))),501),(((505,(504,(499,498))),500),(503,502))),Anthosiphon_roseans)),(((((((Brasiliorchis_aff._ubatubana,(Brasiliorchis_kautskyii,(Brasiliorchis_marginata,Brasiliorchis_murilliana))),((Brasiliorchis_picta_GG19843140,519),(522,Brasiliorchis_picta_SK0337))),(Brasiliorchis_gracilis_SK0017,Brasiliorchis_phoenicanthera_SK0274,Brasiliorchis_porphyrostele_W1972,Brasiliorchis_picta_W2755,(Brasiliorchis_gracilis_SK0147,Brasiliorchis_gracilis_W2303),(521,Brasiliorchis_porphyrostele_SK0159,518))),Brasiliorchis_chrysantha),(Brasiliorchis_consanguinea,Brasiliorchis_phoenicanthera_W2304)),Brasiliorchis_barbozae),520))),((((332,331),(336,335)),330),334)),(((((((483,((490,(492,482),(487,463),((488,471),491)),(462,461))),((480,479),((478,477),476))),(486,485)),(((475,474),(472,473)),484)),481),(((Maxillaria_conduplicata_A5071,Maxillaria_conduplicata_B1660),((Maxillaria_pittieri_B2237,Maxillaria_pittieri_W2580),(349,348))),(((19,103),(((((55,273,(442,441)),(((403,437),436),(194,431))),((Maxillaria_canarensis,65),(66,89))),(((270,269),293),(6,((343,341),342)))),(419,418))),(182,(157,156)),(218,Maxillaria_pendula)))),(Maxillaria_proboscidea_A5056,(466,(99,98))))),(((307,306,308),((310,309),305)),337)),((((Bifrenaria_inodora,Bifrenaria_tyrianthina),Bifrenaria_tetragona),(328,329)),460))); END; BEGIN TREES; TITLE Tb9612; LINK TAXA = Taxa2; TRANSLATE 1 Maxillaria_elatior, 2 Maxillaria_dillonii, 3 Maxillaria_dendrobioides, 4 Maxillaria_cucullata, 5 Maxillaria_ctenostachya, 6 Maxillaria_confusa, 7 Maxillaria_notylioglossa, 8 Maxillaria_nasuta, 9 Maxillaria_nardoides, 10 Maxillaria_multicaulis, 11 Maxillaria_meridensis, 12 Maxillaria_lueri, 13 Maxillaria_longissima, 14 Maxillaria_longipetiolata, 15 Maxillaria_lepidota, 16 Maxillaria_laevilabris, 17 Maxillaria_imbricata, 18 Maxillaria_horichii, 19 Maxillaria_hennisiana, 20 Maxillaria_guadalupensis, 21 Maxillaria_grayii, 22 Maxillaria_gracilis, 23 Maxillaria_gentryi, 24 Maxillaria_fulgens, 25 Maxillaria_ferdinandiana, 26 Maxillaria_exaltata, 27 Maxillaria_elegantula, 28 Maxillaria_chionantha, 29 Maxillaria_chicana, 30 Maxillaria_chartacifolia, 31 Maxillaria_cf_variabilis, 32 Maxillaria_canarensis, 33 Maxillaria_camaridii, 34 Maxillaria_calantha_W2751, 35 Maxillaria_calantha_W2550, 36 Maxillaria_buchtienii, 37 Maxillaria_bradeorum, 38 Maxillaria_brachybulbon, 39 Maxillaria_bicallosa, 40 Maxillaria_auyantepuiensis, 41 Maxillaria_aurea, 42 Maxillaria_augustae_victoriae, 43 Maxillaria_arbuscula, 44 Maxillaria_angustissima, 45 Maxillaria_alticola, 46 Maxillaria_aff_aggregata, 47 Maxillaria_acuminata, 48 Maxillaria_acostae, 49 Heterotaxis_violaceopunctata, 50 Heterotaxis_santanae, 51 Heterotaxis_equitans, 52 Heterotaxis_crassifolia, 53 Eriopsis_biloba, 54 Cyrtidiorchis_alata_W2932, 55 Cyrtidiorchis_alata_GG944005, 56 Cryptocentrum_peruvianum, 57 Chrysocycnis_schlimmii, 58 Bifrenaria_tetragona, 59 Anthosiphon_roseans, 60 Xylobium_leontoglossum, 61 Trigonidium_sp._nov._SK0315, 62 Trigonidium_obtusum, 63 Trigonidium_insigne, 64 Trigonidium_egertonianum_SK0361, 65 Trigonidium_egertonianum_SK0317, 66 Trigonidium_acuminatum, 67 Pityphyllum_saragurense, 68 Pityphyllum_laricinum, 69 Mormolyca_ringens, 70 Mormolyca_peruviana, 71 Maxillaria_triloris, 72 Maxillaria_suarezorum, 73 Maxillaria_sophronitis, 74 Maxillaria_silvana, 75 Maxillaria_schunkiana, 76 Maxillaria_scalariformis, 77 Maxillaria_richii, 78 Maxillaria_pulla, 79 Maxillaria_procurrens, 80 Maxillaria_proboscidea, 81 Maxillaria_porrecta, 82 Maxillaria_ponerantha, 83 Maxillaria_parviflora, 84 Maxillaria_paleata, 85 Maxillaria_pachyachron, 86 Maxillaria_pacholskii, 87 Maxillaria_oreocharis, 88 Maxillaria_ochroleuca; TREE Fig._8 = [&R] ((((((80,8),((((49,52),51),50),((73,24),((((41,32),46),45),10)))),((((((((((((83,18),5),((17,84,(3,76)),37)),33),4),(((((((((38,12),((((((20,85),27,21,42),13),(15,44)),74),6)),(((26,11),23),28)),(88,36)),71),((19,81),48)),78),(35,34)),2)),((((61,62),63),(65,64)),66)),((7,47),(((1,31),87),(79,(82,43))))),(((55,54),(16,29)),((69,((77,72),57)),70)),(((25,9),86),(14,40))),(75,22)),((56,59),(39,30))),(68,67))),60),58),53); END;