#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:23 GMT TreeBASE (cc) 1994-2008 Study reference: Otero A., Valcarcel V., Jimenez-mejias P., & Vargas P. 2019. Being in the right place at the right moment? Parallel diversification bursts related to persistence of ancient epizoochorous traits and hidden factors in Cynoglossoideae. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S23831] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=226; TAXLABELS Actinocarya_tibetica Amblynotus_rupestris Amsinckia_calycina Amsinckia_menziesii Amsinckia_tessellata Amsinckia_vernicosa Anchusa_formosana Antiotrema_dunianum Antiphytum_floribundum Antiphytum_hintoniorum Arnebia_decumbens Arnebia_linearifolia Asperugo_procumbens Austrocynoglossum_latifolium Borago_officinalis Bothriospermum_kusnetzowii Bothriospermum_tenellum Brunnera_macrophylla Buglossoides_incrassata Caccinia_macranthera Cerinthe_majus Cordia_decandra Cordia_monoica Cryptantha_decipens Cryptantha_granulosa Cryptantha_johnstonii Cryptantha_paradoxa Cryptantha_peruviana Cryptantha_pterocarya Cynoglossum_amabile Cynoglossum_amplifolium Cynoglossum_australe Cynoglossum_clandestinum Cynoglossum_columnae Cynoglossum_creticum Cynoglossum_dioscoridis Cynoglossum_germanicum Cynoglossum_grande Cynoglossum_hispidum Cynoglossum_hungaricum Cynoglossum_montanum Cynoglossum_nebrodense Cynoglossum_occidentale Cynoglossum_officinale Cynoglossum_paniculatum Cynoglossum_spelaeum Cynoglossum_sphacioticum Cynoglossum_suaveolens Cynoglossum_troodi Cynoglossum_virginianum Dasynotus_daubenmirei Echiochilon_fruticosum Echium_acanthocarpum Echium_creticum Echium_vulgare Ehretia_anacua Ehretia_cortesia Embadium_stagnense Embadium_uncinatum Eremocarya_micrantha Eritrichium_aretioides Eritrichium_canum Eritrichium_nanum Eritrichium_pamiricum Eritrichium_pectinatociliatum Eritrichium_sericeum Eritrichium_thymifolium Glandora_nitida Gyrocaryum_oppositifolium Hackelia_andicola Hackelia_bella Hackelia_deflexa Hackelia_floribunda Hackelia_revoluta Hackelia_sharsmithii Hackelia_velutina Harpagonella_palmeri Heterocaryum_subsessile Huynhia_pulchra Johnstonella_angustifolia Lappula_alatavica Lappula_anocarpa Lappula_balchaschensis Lappula_brachycentra Lappula_cenchrusoides Lappula_consanguinea Lappula_duplicicarpa Lappula_intermedia Lappula_lasiocarpa Lappula_lipsky Lappula_marginata Lappula_microcarpa Lappula_myosotis Lappula_occidentalis Lappula_occultata Lappula_patula Lappula_semiglabra Lappula_sessiliflora Lappula_spinocarpa Lappula_squarrosa Lappula_stricta Lappula_tadshikorum Lappula_tenuis Lappula_texana Lasiocaryum_densiflorum Lasiocaryum_munroi Lepechiniella_microcarpa Lindelofia_anchusoides Lindelofia_longiflora Lindelofia_stylosa Lithospermum_macbridei Lithospermum_officinale Lithospermum_persicum Mairetis_microsperma Memoremea_scorpioides Mertensia_ciliata Mertensia_davurica Mertensia_lanceolata Mertensia_maritima Mertensia_sibirica Metaeritrichium_microuloides Microparacaryum_intermedium Microula_blepharolepis Microula_diffusa Microula_floribunda Microula_muliensis Microula_myosotidea Microula_oblongifolia Microula_ovalifolia Microula_pustulosa Microula_sikkimensis Microula_stenophylla Microula_tibetica Microula_trichocarpa Microula_turbinata Microula_younghusbandii Moltkia_petraea Moritzia_lindenii Myosotidium_hortensia Myosotis_alpestris Myosotis_caespitosa Myosotis_incrassata Myosotis_macrosperma Myosotis_sparsiflora Myosotis_stenophylla Myosotis_stolonifera Nihon_japonicum Nonea_caspica Omphalodes_akiensis Omphalodes_aliena Omphalodes_alienoides Omphalodes_brassicifolia Omphalodes_cappadocica Omphalodes_cardiophylla Omphalodes_caucasica Omphalodes_commutata Omphalodes_kuzinskyanae Omphalodes_linifolia Omphalodes_littoralis Omphalodes_nitida Omphalodes_verna Omphalolappula_concava Onosma_rhodopea Oreocarya_flavoculata Oreocarya_suffruticosa Paracaryum_ancyritanum Paracaryum_cappadocicum Paracaryum_laxiflorum Paracaryum_polycarpum Paracaryum_racemosum Paracaryum_rugulosum Pardoglossum_cheirifolium Pardoglossum_watieri Pectocarya_lateriflora Pectocarya_penicillata Pectocarya_setosa Pentaglottis_sempervirens Phacelia_campanularia Phacelia_sericea Plagiobothrys_congestus Plagiobothrys_fulvus Plagiobothrys_humilis Plagiobothrys_kunthii Plagiobothrys_linifolius Plagiobothrys_myosotoides Pseudomertensia_primuloides Pseudomertensia_trollii Pulmonaria_angustifolia Rindera_caespitosa Rindera_graeca Rindera_lanata Rindera_schlumbergeri Rindera_tetraspis Rochelia_cancellata Rochelia_cardiosepala Rochelia_persica Rochelia_retorta Sinojohnstonia_moupinensis Solenanthus_albiflorus Solenanthus_apenninus Solenanthus_atlanticus Solenanthus_circinatus Solenanthus_coronatus Solenanthus_hirsutus Solenanthus_karateginus Solenanthus_tubiflorus Solenanthus_turkestanicus Stephanocaryum_olgae Suchtelenia_calycina Thyrocarpus_glochidiatum Tournefortia_hirsutissima Tournefortia_ternifolia Trachelanthus_cerinthoides Trachelanthus_hissaricus Trachystemon_orientalis Trichodesma_africana Trichodesma_calcaratum Trichodesma_calycosum Trichodesma_physaloides Trichodesma_zeylanicum Trigonocaryum_involucratum Trigonotis_amblyosepala Trigonotis_formosana Trigonotis_guilielmi Trigonotis_jinfoshanica Trigonotis_peduncularis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M49078] TITLE Cynoglossoideae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2320; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Actinocarya_tibetica ----------------------------------------------------------------------------------------------------------------------------TAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAAAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAAAAAA---------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTAGAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAG----------TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTTAA-----------------TTATTTACTATGG--------------ATAGGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCGTAAATATATCATAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGATAA--------AAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTTAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGAAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAATC----AATAAATAAAGA--TTTTTCTTTGT----TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTT----TCTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Amblynotus_rupestris -------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATAT------TT----------GTATTGAA---TACTTTATAAAATC----------AAATAAAATGATTAATGACT-----AACATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAATTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTGCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATATTGA---TTGACATCCCAACAATTTCTCC{AT}ATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCACTTTTTAATTTG---------------------------------------------------------------ACTGAAACTTAC-{AT}AAGTTGTCTTAT-------------T----------------------------------------------------------------------TCTTATTG-----------------------------------------------------------------------A-------AG-----------ATGAA-GGTGCTC-TTCGCTCGACATCATTATTTGTTCTGTT-----CCACAGGAAACTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCCTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATGGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACA-----T-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATAAAGGATAAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------TAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAGGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT--------------------------------------TCATT-------------------------------------TATTAGA---------ATTCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Amsinckia_calycina ?GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATCCAAG-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAAT---------GATATAGTT----------------------TTTATGAAAAAAA---------------AGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCACAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATACCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TT---AAAGTC----TTGTGAGATA--CACATGATATACATACAAATAAG-------------GGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTAACAGTACC-TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGAACATTTTGG---------AATTAATCAAACTTTCTTTTTCGA--------AAAGTGTAT----CACTCGGAATCAGTCGTCCACAG----CTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACAGAAT---TAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAG-----TTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAAAA-----GG---------GTGAATGGAATT-------CAATAAGAGTCTA----------------------------------ATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Amsinckia_menziesii -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC--------------------AAATGATTAATGA-------------TAT------------------AGTTTTTATGAAAAAAAA---------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCACAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATACCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTA---AAGTC----TTGTGAGATA--CACATGATATACATACAAAT-------------AAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACAGTAACA--GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGAACATTTT---------GGAATTAATCAAACTTTCTTTTTCGA--------AAAGTGTAT----CACTCGGAATCAGTCGTCCACAG----CTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACAGAAT---TAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAG-----TTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGA-----AAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTA----------------------------------ATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Amsinckia_tessellata AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGA-------------TAT------------------AGTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAAAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAA----TTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTATATGCC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATACCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCCAAAATCCCTCA---TCTTTATCATTCGTTT--------------GTTTT-----ACAAACA-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATGATATACATACAAAT----AAGGGAAT----CCCCTTTTGAA-----------------TTATTTAC----------------------GGATATCATTTC----TGAGACTGAAACTTAC-AAAGTCGTCTTAT-------------T---GATACAA--GAAATTACAGTAACA--GTACC-------TGGATAAAA---------GTTGGTAATCTTCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATAC---ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGAACATTTT---------GGAATTAATCAAA----CTTTTTCGA--------AAAGTGTAT----CACTCGGAATCAGTCGTCCACAG----CTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAG-----TTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAA----AAAGGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATAATATTATATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGG---- Amsinckia_vernicosa -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGA-------------TAT------------------AGTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAA----TTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATACCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCGTTT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATT--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATGATATACATACAAAT----AAGGGAAT----CCCCTTTTGAA-----------------TTATTTAC----------------------GGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCCTCTTAT-------------T---GATACAA--GAAATTACAGTAACA--GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATATATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGAACATTTT---------GGAATTAATCAAA----CTTTTTCGA--------AAAGTGTAT----CACTCGGAATCAGTCGTCCACAG----CTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAG-----TTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATAAGAAGGA-----AAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Anchusa_formosana ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAATAAAA-------GTGGAAAAATAAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTATC---------------AAATTAAATGATTAATGACTACCAAAATTGATTC------------------TTTTTTTATGAAACAAATTTATGAACAAAAGAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTTGAATATTCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTCCATACCAATGATTTCTCCTCTCT---CTATTT---------TCGTTAGTGGTTCA-AAATTCCTCA---TCTTTCTCGTTCACTCTATT----------CTTTT-----ACAAATGGAT--------GATCTGGCCGGAAATGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATTCAAATGGACATCTTTGAACAAGGAAT----TTCCTTGTGAATCATTC-----------AAATTCACAAAGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATCATAAAATA-------AGAATGATACAGTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGGAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTCAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATACAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC----CAAAGTGTAT----CACTCGGAATCAGCCGTCCACAGGATTCTTTGCT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAATACCGAAGTAATGTCTAAACCT---------AATGATTGAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TTTAATGGTCTCAATAACGGAAT---CTTATT---------AAACAATCT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAATTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTTTTT----------------------------------------AGAAGGAAGAATCAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATCCCA--------------TCCACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Antiotrema_dunianum ------------------------------------------TAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTAATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGACAAATACTTTTTA---------------AAATGAAATGATTAATGACT-----AATATA-------------------TTATTTTTTATGAAAAAA--------------GAAGAGTTGGTGTTAATT-AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTT--------GAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGTT--TCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CA----AT----CCCCTTTTTAA-----------------TTATTTACTATGG--TATTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATA------------------------------CTTTTAATTGACATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antiphytum_floribundum -GT-GATAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTGCTCTGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTAATC--------------AAATGAAATGATTAATGAATACCACAATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GA-----------------AATCGATTCCACAT----------AGAAGAAAAAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TCGACATCCCAACGATTTCTCCTATAT---TTCTTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TT-AACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CTCCTTTGGAGTTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGAGAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCGGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCCCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAACAAGTTTC-------CAATTCAAAAGAACATTTTGT-------GGAATTGATCAA---------TTCGATCC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAA--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC-AAAATAAGGGGT----AAAGACTACTCAATAAATAAAAAAG-----AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CTAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAGAAAAAGAAAAGGGTGAATGGAATGAAATATTAAATAATAGTCTAATTCATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTCGAATTCCA--------------TACACAGAAAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Antiphytum_hintoniorum -GT-GATAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTACGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTGCTCTGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTAATC--------------AAATGAAATGATTAATGAATACCACAATATATTC-----------TGTTTTTATGTTTTATGAAAACAAAAAAA---------------------------AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATGA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TCGACATCCCAATGGTTTCTCCTCTAT---TTCTTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TT-AACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CTCCTTTGGAGTTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGATAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCGGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCCCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAACAAGTTTC-------CAATTC{AG}AAAGAACATTTTGT-------GGAATTGATCAA---------TTCGATTC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAA--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC-AAAATAAGGGGT----AAAGACTACTCAATAAATAAAAAAT-----AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CTAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAGAAAAAGAAAAGGGTGAATGGAATGAAATATTAAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTCGAATTCCA--------------TACACAGAAAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Arnebia_decumbens ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAAAAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTT-----------------------TTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCACAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTCAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-ACAAATAAATG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------TTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAAACCCCAGTCATCTAATAAAATA-------AGGATGATACATTAAAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTA-----------GATATCAAAATAG-AAAGAATCCGCTTCGGGCAAGTTCC-------CAATTTTAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAA--AAATCAC--AAAAA-GGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CGGATTAAAG-----AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAT---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGGATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Arnebia_linearifolia -GT-GACAACTTTC-AATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAAAAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------AAAG-TGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATAATTTT------------------------TATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCACAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTCAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-ACAAATAAATG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------TTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAAACCCCAGTCATCTAATAAAATA-------AGGATGATACATTAAAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTA-----------GATATCAAAATAG-AAAGAATCCGCTTCGGGCAAGTTCC-------CAATTTTAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAA--AAATCAC--AAAAA-GGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CGGATTAAAG-----AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAT---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGGATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Asperugo_procumbens AGT-GAAAACTTTCAAATTCAGAGAAACCCGGGAA-TTAATAAAAA-CGGGCAATCCTGAGCCAAATCC-GGTTC------AACAAAA-------GTTGAAAAATAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGCGAAA-------GTATATACA--TTT----------TTATAGAA---TACTTTATC---------------AAATGAAACGATT------------AATATAATC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTATT-----AATCGATTCCACAT----------AGAA--------CGAATATTCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTACTCTATT-----GTTTTACAAAACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TGATTCACTATGG-------------------ATATCATTTC----TCAGGCTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTATC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAAGAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGCT------GGAATTGATCGAA----CTTTTTCAATAC-----AAAGTGTAT----CA--------CAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCG-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAGGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTTTGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACGGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Austrocynoglossum_latifolium -----------------------------------------------TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAGA-----TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGAACAA--------------------------GGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATA-------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT----------------AGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Borago_officinalis ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTGCAAAAACCAA-AAAA---GTGGAAAAAGCAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGTTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGGGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACTACC--AATCGATTC------------------TGTTTTCATGAAAAAA----------------AGAGTTGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGACTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAGCATAGTCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTACATCCCAATTATTTCTCCTCTAT---TTATTT---------TCATTAGTGGTTAA-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------CTTTT-----ACAAATG-----------GA-------------------CATC--------TTGAACAAG-------------------------------------------------------GAAT----TTTCTTGTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTCC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CTGCAGGAACCTCCC--TTTTATTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATTCATCCATTTCTAGGGGCAAAGATCTAGGGTTAAT---GCCAATTAATAAATTGAACAACTTCG-----------TCAATA{AT}ATCTTC-----------GATATAGAAATCGGAAAGAATCTACTTCGAGCAAGTTTA-------CAATCCAAAAGGACATTTTG--------------GATCAAA----CTGTTTCGATAC----CAAAGTGTAT----CACTCGGAATCAGTCGTCCGCAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAATCCCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCT-----------------TTTAATTGTCTCAATAACGGAAT---CTGATTAAATT----AAAGAATCT-------------AAATAGATTTGAAACAAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAGATTCAATAAAT---CAAGA--TTTTTCTT-------GGAACTATTTC-----AAAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCTTTTTTTTTTA------------------------------------------------GAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTGTGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGATAAAACTTTTAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Bothriospermum_kusnetzowii AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGACAAATACTTTTTA---------------AAATGAAATGATTAATGACT-----AATATATTC-------------------TTTTTTATGAAAAAA--------------GAAAAGTTGGTGTT-AATTAATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGTT--TCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAATTTACTGTGGTA--------TTTACTATGG--------------ATAGGATCTCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------CTTGGTAA---TCTTCTTTAATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC-----------TGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAAGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCAC---ATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAG------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTTATTTTAG-------------TATTTTATGGATTCATCATTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Bothriospermum_tenellum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTAATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGACAAATACTTTTTA---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TT-TTTTATGAAAAAAGAA-----------GAAGAGTTGGTGTT-AATTAATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGTT--TCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTTAATTA-----------------TTTACTATGG--TATTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC-----------TGTT-----CCACAGGAACCTCTCTTTTTGTTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATATA----------------AGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTAACTGAACGGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTTATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-----------------------------------TATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTGAAGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Brunnera_macrophylla -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GT-GAAAAATAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGGC-----TGCTTTGGTCGAAGAATCTTTCTCA----------GAAAGTGTGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTATC---------------AAATGAACTGATTAATGACTACCAAAATTTATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTCTT-----AATCGATTCCACAT----------AAAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTACATCCCAACGATTTCTCCTCTAT---CTATTT---------TCGTTAGTGGTTCA-AAATTCCTCA---TTTTTCTCATTCACTCTATT----------CTTTT-----ACAAATGGAT--------GATCTGGCCGGAAACACCTTTTATC--------TT-AACAAGTC----TTGTAAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAATAAAT----TTCCTTGTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGGAACTTCCC--TTTTGTTGGGTTATAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAGTTGAACAACTTCG-----------TAAATATATCTTCGATATAGAAA-GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGATATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC----AAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAATACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TT-AATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTATGAATTAAT---------GGTTTCCTTTTTTTTTA----------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATT-------------------------------------TGTCATT------------------------------------------GATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Buglossoides_incrassata -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------AAAG-TGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATAATTAATGACTACCAAAATATATTC-----------------TTTTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCAATTCCACAT----------AGAAGAAAGAGTCAAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCGCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTAGTTCC-AAATTCCTCA---CCTTTCTCATTCACCCTATT----------CTTTT-----ACAAAAA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATTACCATCTTTGAACAAGGAATGAATCCCCCTTTTAATTTGAA-----------TAATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATATA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAACCCCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------AATATCAAAATCA-AAAGAATCCACTTCGAGCAAATTCC-------CAATTTAAAAGGAAATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAA--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTACAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATTAAAT-----AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGGT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGCAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTATGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Caccinia_macranthera ???-??????????????????????????????????????TAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTTCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATCTATTC------------------TTTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTAAAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCTTC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAG??---------????????---????????????------------------------------??????????????????????????????????????-------?????????????ATGAA-GGTGCTC-CTCGTTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCCCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCACTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATTGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTATTA-G------------------------------------------AATTTGAATTCCA--------------TACACAGACAAAACTTCAAACAAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cerinthe_majus ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTGCTCTGCTTTGGTCGACGAATCTTTCTAA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATCAAAT-----------GATGAAAATGATTACTGACTACCAAAATATATTC-----------------TTTTTTTTATGAAAAAAAG------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCATTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTATTA-----------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGTCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATAAGTCGCCTTTTGATTTTGA---------------TTCACAACGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTTTAAAGATTTCTTATTAAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCAATA-----------------------------CTTTTAATTGACATAGACCCCAGCCATCTAATAAAATA-------ACGATGATACATTATAAA-GGTGCTC-TTC-CTCGACATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGT-----TTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCA-AAAGAATCCACTTCGAGCAGGTTCC-------CAATTTAAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGGCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAGAAAGGGTATGTTGCTGCCATTTTGAAAAGATTAAGAAACACCGAAGTAATGTCTAAACCT--------AAATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAATGGAAT---CA{AG}ATT---------AAAGAATAT-------------AAATCGATTTGAAACGAGACAAACAAAAAAAAGGGGC----AAAGACTACTCAACAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGAAAGA-----------------GTGAATGGAATT-------AAATAAGAATCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Cordia_decandra AGT-GATAACTTCCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---GTTCAGAAAGCGAAAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCGTTGGTCGAGGAATCTTTCCATCAAAACTTCAGAAAGGATGAAGGATAAACGTATATACA--TAT----------GTATTCAA---TACTCTATC---------------AAATGAAATGATTAATGACGACCCTAATCTGCTT--------------------TTTTTATGAAAAAAAAAAG---------GAAAAGTTGGTGTG-----AATCGATTCCACAT----------TGAAGAAAGAATCGAAGATTCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAACTAATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TTGATTCCCCAACCGTTTATCCTATCC---CTCTTT---------TCGTTAGCGCTTCC-CAATTCCTTA---GCTTTCTCATTCACTCT-------------------------GAACG-----------GATCTGAGCGGAAATGCCTTCTTTATCT-----TATCACAAGTC----TTGTGAGATA--CGTATGATACACATAAAAATGAACATCTTTGAACAAGGAAT----CCCCATTTGAA-----------------TGATTCACAATGG-------------------ATATCATTTA----TCATACTGAAATTTAC-AAAATCGTCTTAG-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------TGGATAAAA---------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATG-------AGGATGATACATTATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAACT-CCCCTTTTTGTTGGGTTGTAATGT-----AAATAGTCCATGATGGAGCTCGAGTAGAA------AAGAAAGTCTGAATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAATTCGAGCAAGTTTT-------CAATTCAAAAGGAAATTTTGTT------TGAATTGATCAAA----CTTTTTCGATCC-----AAAGTGTATGTATCACGCGGAATCAACCGTCCGTAGAATTCTTTGAT----------AGAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCC---------AATGATTTAAAAC-----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTGAATTGTCTCAATAACTGAAT---CAGATT---------GAAGAATCG-------------AAATCGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACCACTCAATAAATGCAAAATTACCTAAAGA--TTTTTCTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGGATG-------------GTTTATTTTTCA--------------------------------------------GGAAGGAAGAAGAAAAAAGA-------CTTAATTAACT------------AATAGTCTAATTGATTTGAT---------GATTTTATTTATGGATTCC---TTTGTCATT------------------------------------------TATTCGAATTCCA--------------TACATAGACAAAACTTCAAATTAA------ATCATTTTTTCTCG-AGCCGTACGAGGAGAAAAACTTCCTATACGTTTCTA---GGGGGGGGTAT Cordia_monoica ------GAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---GTTCAGAAAGCG-AAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCCTTGGTCGAGGAATCTTTCCATCGAAATTTCAGAAAGGATGAAGGAGAAACGTATATACA--TAT----------GTATTCAA---TACTCTATC---------------AAATGAAATGATTAATGACGACCCGAATCCGCTT----------------------TTTATCAAAAAAAG------------GAAAAGTTGGTGTG-----AATCGATTTCACAT----------TGAAGAAAGAATCGAAGATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAACTGATTA--------------------ATCAGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTA-AGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TTGATTCCCCAACCGTATATCCTATCC---CTCTTT---------TCGTTAGCGCTTCC-CAATT-CTTA---GCTTTCTCATTCACTCT-------------------------AAACG-----------GATCTGAGCGGAAATGCCTTCTTTATCT-----TATCACAAGTCTTGTTTGTGAGATA--CGTATGATACACATAAAAATGAACACTTTTGAACAAGGAAT---CCCCTTGTTGAA-----------------TGATTCACAATGG-------------------ATATCATTTC----TCATACTGAAACTTACAAAAATCGTCTTAG-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------CGGATAAAA---------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAA------------------------ATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGTTCTGTT-----CCACAAAAACT-CCCCTTTTTGTTGGGTTGTAATGT-----AAATAGTCCATGATGGAGCTCGAGTAGAA------AAGAAAGTATTAATTCATTTCTTGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAGTCCAATTCGAGCAAGTTTT-------CAATTCAAAAGGAAATTCTGTT------GGAATTGATCAAA----CTTTTTCGATTC-----AAAGTGTATGTATCACGCGGAATCAACCGTCCGTAGAATTCTTTGAT----------AGAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCATCGAAGTAATGTCTAAACCC---------AATGATTTAAAAC-----AAAGATA------AAGGATCTCAG-AACAAGGAAACGCCAT----------------TTTAATTGTCTCAATAGCTGAAT---CAGATT---------GAAGAATCG-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACCACTCAATAAATGAAAAATTGCCTAAAGA--TTTTCCTT-------TGAGTTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATG-------------TTTTCTTTTTCA--------------------------------------------AGAAGGAAGAAGAAAAAAGA-------CTTAATTAACTAA------TA--AATAGTCTACTTGATTTGAT---------GATTTTATTTATGGATTCC---TTTGGTATT------------------------------------------TATTCGAATTCCA--------------TACATAGACAAAACTTCAAATTTA------ATCATTTTTTCTCG-AGCCGTACGAGGAG-AAAACTTCCTATACGTTTCTA----GGGGGG---- Cryptantha_decipens -----????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????????????-------------------------------------------------------------------??----------------------??????????????------???????----??---?????????--------------------------------????AAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAAAATTGATTT--------------------CTCAGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGCGGTTCC-AAATCCCTCA---TCTTTATCATTTACTCTATTATT-------GTTTT-----ACAAACG-----------TATCTGACTGGAAATTTCGCCTATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CGGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG----TTTACTATGGATAGGATATCATT-------TAGACTGAAACTTAC-AAAGTCGTC-----------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------TTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATT--GAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCA-GAGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATTAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCTACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------TGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGA---TTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACGCCAT----------------TTAAATTGTCTCAATAACGGGAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAATTATTTG-----ACAGCTAT-----ACAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATATCCA-------------TACACAGAAAAAACTGCAAACCAA---ATCATTTTATCTTGAGG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT-------------- Cryptantha_granulosa ???-?????????????????????????????AA-AGAGTTAGTG----TTAATCGATTCC------------------------ACA------TAGAAGAAAGAA----------------------------------------TCGAATA------------------------TTCATTGATCAAAGA-------TCA----------AA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAAAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA----------------------------------TCCTATGT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATATACGTATGATACACATAGAAATGCA-----------CAGGGAA----TCCCCTTT-------------------TGAATTATTTACTG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTGGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAACCTC------TTTTTGGGTTGTAATG---------TAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCTACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGAAGGAAGAAGAAAAGG------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCCT----GGGGGGGTAT Cryptantha_johnstonii -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAAAA-------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGAA-------ATATA----------------------GTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGCTTT--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGA-------AGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAAAAAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cryptantha_paradoxa -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAAAA-------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGAA-------ATATA----------------------GTTTTTATGAAAAAA-----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATACACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGA-------AGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATTTCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cryptantha_peruviana ------GAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTGGAAAAAGAAGAAAAAA-------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATAGT----------------------TTTTATGAAAAAAGA-----------------GTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTT----------------------------------------------------------------CCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAAGCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATATAAATGCA----------CGGGGAAT----CCCCTTTTGAA-----------------TTATTTACTACGG----TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-CAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAA------------------------ATGAA-GGTGCTC-TTCGCTCGACATT---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAGTAAAA---AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACGACAAACAAAAAGGGGT----AAAGACTACTCAATAAAT------------AACGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGAA-------------------------------------TCAGAAGGAAG---AAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACTAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGG---- Cryptantha_pterocarya -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCAT-GATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGAATTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TTTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------TATCTGACTGGAAA----TTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CGGGGAAT----CCCCCTTTGAA-----------------TTATTTACTATGG----TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGGCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGAAGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACAGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTTCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_amabile -------------------------??TCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCAGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTAGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCC--TCATT--ATA?????-------????????????-ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAGAAAAAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------ATTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------AGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTGC Cynoglossum_amplifolium -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAACAAAAGTTGAAAAAGAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATTCA------TAAAGTGTGAAAGAAA---GTATATACA--TTT----------GTATTGA----TACTTTACTTTATCTTACTTTATCAAATGAAATGATTAATGACT---------AATAT------------------AGTTTTTATGAAAAAAAAAAA------------GAGTTGGTGTTAAT--AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATGGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCA----GC----TTG--TTGTTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TGGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAGGAATCCCCTTTTGAA-----------------TTA--------------TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GT-----------GGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------ATAA-GA-AGGATATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGTTGT--AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTTGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTC{AG}AAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAT-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAT--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGG-------AGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT----TTGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG---------TATTTATTTTATGGATTCA---TTTTTTTTT---------TAATTTTTTAATTTATTAATATTATATTAGATATATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_australe ????????????????????????????????????????????????????????????????????????????????????????????--???????????????????????????????????????????????????????????????????---?????TAAA----------------------------------TCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGA?GAATTGATTT--------------------CTCAGAC----?AGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTAGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCC--TCAT???????????-------????????????-ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAGAAAAAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------ATTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------AGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTATGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCATACCATACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_clandestinum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAGAAA----GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTCAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCCATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACATACA----GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTACATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTGGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_columnae -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATATTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_creticum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTT-----ATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGTTTTGTTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTGTTTTAT---GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATA------CATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCTGGAACCTGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_dioscoridis -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTT-----ATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGTTTTGTTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTGTTTTAT---GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATA------CATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGAACCTGGATAAAA--GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAA-----TGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_germanicum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTCCA--------------AATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAA---------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_grande -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGAT------------TAATATA----------------------GTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGA----TCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGAAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--C-----ATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTAATAAAAT----------GATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTCC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT-------TTGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTTTAG------------------------------------ATATTAGATTAGAATTCCATCCA----------TACACAGAAAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_hispidum -----------------------------------------------------------------------------------------GAA-----------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAAGAAA---GTATATACA--TTT----------GTATTGA----TACTTTACTTTATCTTACTTTATCAAATGAAATGATTAATGACT-----AATATAGTT----------------------TTTATGAAAAAAG-----------------AGTTGGTGTT-----AATCGATTCTACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCA----GCCTATTTGTTG--TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TGGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAGGAATCCCCTTTTGAA-----------------TTATTTACTATGG----TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-A----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGTTGT--AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC--AACAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGG-------AGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTTTGT----TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG---------TATTTATTTTATGGATTCA---TTTTTTTTT---------------------------AATTTATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_hungaricum -GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTT-CA--------------AATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AAGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTACATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG--AA--GGAATTGAG---A----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAAATCATTATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_montanum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCACTAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGTAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAATTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT---------------------TATTAATATTAATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_nebrodense -GT-GACAACTTTC-AATTCAGAGAA-CCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AA{AT}ATATT{CT}------------------TGTTTTTATGAAAAAAAAAAAA--------GAAGAGTTGGGTTGGTGTTAATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCAAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAATTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_occidentale ----------------------------------------------------------------------GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAA-GAAA---GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATA---------------------------TAGTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAA----TTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCACA----------GGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTATTGA----------AGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATAATGAG-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG------GAATTGTTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCATTTAAAT----------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAATA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------TTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_officinale ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG----------------GACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTT------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAG---GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_paniculatum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC---------------------------GAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG--------------ATA-----TAATTTC----TCAGACTTAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cynoglossum_spelaeum -GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAACAAAAGTTGAAAAAGAAAAAGAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAAGAAA---GTATATACA--TTT----------GTATTGA----TACTTTACTTTATCTTACTTTATCAAATGAAATGATTAATTAATGACT-AATATA----------------------GTTTTTATGAAAAAAAAAAAA-----------GAGTTGGTGTT-----AATCGATTCTACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCA----GCCTATTTG--TTGTTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TGGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTGTT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAGGAATCCCCTTTTGAATTATTGAA---------TTATTTACTATGG----TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GT-----------GGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------ATAATAA-GA-AGATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGTTGT--AAATAGTGCATGATGAAACTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGG-------AGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT----TTGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAGTATTTATTTTATTTATTTTATGGATTCA---TTTTTTTTA----------------------------ATTTATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Cynoglossum_sphacioticum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAAAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCTCATCATCTTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAATTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT---------------------TATTAATATTAATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_suaveolens -GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAG-----ATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACA-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTA----------------GAA----------CAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTTTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGATTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Cynoglossum_troodi -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTT-----ATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGTTTTGTTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACG-TTGTC----GGGGGGGTAT Cynoglossum_virginianum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-------------TG---GAATCTTTCTCA----------TAAAGTGTGAAGAAA----GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGAC-----TAATATA----------------------GTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTATTGA----------AGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAG-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT------GGAATTGTTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCATTTAAAT----------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------TTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Dasynotus_daubenmirei -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAAAA-------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATT------------AATATAGTT----------------------TTTTTGAAAAAAA---------------AGAGTTGGTGTT-----AATCGATTCCACAT----------AAAAGAAAGAATCGAATATTCATTGATCAAA--------------GATCAATTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTAACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGACAGTTAG-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACTCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTAGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTA-------CAATTCAAAAGGACATT---------------TTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAA----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAGTA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCA----CGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATG-----AGC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTTATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Echiochilon_fruticosum -GA-TGAAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAATAATGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAG----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGGGTTGACT----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAGA-------GTATATACA--TTT----------GGATTGAA---TACTTTAATC--------------AAATGAAATGATTAATGACTACCATAATCTATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGAGAGAGTCCCGTTCTACATGCC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TCGACATCCCAACGATTTCTCCTATAT---TTCTTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CTCCTTTGGAGTTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--TAAATTAAA--------GTACC-------TGGATAAAA---------GTTGGTAA---TTT-----CATA------------------------------CTTTTAATTGACATAAACCCCGGTCATCTTATAAAATA-------AGGATGATACACTATGAA-GGTGCTC-TTCGCTCGACATC---ATT------------------AGGAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAATGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATCCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GTCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACACTTTGT-------GGAATTGATCAA---------TTTGATCC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAGGGGGGT----AAAGACTACTCAATAAAT------------AAATA--TTTTTCTT-------TGAACTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAAAAAAAAGAAAGG------GTAAATGGAATGAAATATTAAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGATA- Echium_acanthocarpum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTATCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACA------------------------TATGATAGACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCC-----------GAAA---------GTTGGGAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTTGCTCGACATC---ATTTGTGCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCAAGCAAGT------AAAAAAGAAAGTATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAACTTTAAAGGACATTTTGT------CGGAATTAATCAAA----CCTTTTCAATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCTACAGGGTTCTTTGAT----------AAAAAGAAATCAC--AAAAAGGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGGAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------GAAGAATAT-------------AAATAGATTTCAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAA-AAAT-------------AAGA--TTTTTCTT-------TGAAGTATTTG-----ACAGTTAT-----CCA-CTTGAGTTATGAGTACGAATGGAT---------GGTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Echium_creticum ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTCCCAAAATATATTT-------------------TTTTTTTTCAAAAAAAAAAAA--------GAAGAGTTGGTGTT-----AATCAATTCCACAT-----AGAAGAAAGAAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAATAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-----------CGAAA---------GTTGGGAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGA-ACATTATAAG-GGTGCTC-TTTGCTCGACATC---ATTTGTGCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGA{GT}GAAGCTCAAGCAAGT------AAAAAAGAAAGT{AT}TTCATTTTTCGGGGCA{AG}GGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAACTTTAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCAATAC-----AAAGTGTAT----CATT{CT}GGAATCAGTCGTCTACAGGGTTCTTTGATTTGAT-----AAAAAGAAATCAC--AAAAAGGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAA-AAAT------------AAAGA--TTTTTCTT-------TGAAATATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTTATTTTTTTA------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGTAACCT---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCTTATACGTTTCTC---GGAGGGGGTAT Echium_vulgare ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-AGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTCCCAAAATATATAT-------------------TTTTTTTTCAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCAATTCCACAT-----AGAAGAAAGAAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAATAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--AAAATTACA--------GTACC-----------CGAAA---------GTTGGGAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAG-GGTGCTC-TTTGCTCGACATC---ATTTGCGCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCAAGCAAGT------AAAAAAGAAAGTATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAACTTTAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCAATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCTACAGGGTTCTTTGATTTGAT-----AAAAAGAAATCAC--AAAAAGGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAA-AAAT------------AAAGA--TTTTTCTT-------TGAAGTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTTCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGTAACCT---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCTTATACGTTTCTC---GGAGGGGGTAT Ehretia_anacua ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-----AATCCG-------------------------------------------TCGACTTTCCAACCATTTATCCTATCC---CTCTTT---------TCGTTAGCGCTTCC-AAATTCCTTA---GCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGAGCGGAAATGCCTTTATCT--------TATCACAAGTC----TTGTGAGATA--CGTATGATACACATAAAAATGAACATCTTTGAACAAGGACT----CCCCATTTGAATGA-----------------TTCACAATGG-------------------ATATCATTTC----TCATACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTCCA--------GAACC-------TGGATAAAA-------------GGAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATG-------AGT----------ATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAACTCCCCC-TTTTGTTGGGTTGTGATGT-----AAATAGTCCATGATGGAGCTCGAGTAGAA------AAGAAAGTATTAATTCATTTCTCGGGGCGAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAATTCGAGCAAGTTTC-------CAATTCAAAAGGAAATTATGTT------GGAATTGATCAAA----CTTTTTCGATCC-----AAAGTGCATGTATCACGCGGAATCAACCGTCCGTAGGATTCTTTGAT----------AGAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCC---------AATGATTTAAAAC-----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTTAATTGTCTCAATAACTGAAT---CAGATT---------GAAGAATCA-------------AAATAGATTTGAAAGGAGACAAAT---AAAAAGGGGT----AAAGACCACTCAATAAATG--AAATTGCCTAAAGA--TTTTCCTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATG-------------CTTTCTTTTTCA--------------------------------------------GGAAGGAAGAAGAAAAAAGA-------CTTAATTAAAT------------AATAGTCTAATTGATTTGAT-------------GATTTTATGGATTCC---TTTGTCATT------------------------------------------TATTCGAATTCCA--------------TACATAGACAAAACTGCAAATCAA------ATCATTTTTTCTCG-AGCCGTACGAGGAG-AAAACTTCCTATACGTTTCTA----GGGGGG---- Ehretia_cortesia -------AACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGCCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAACAAAG---GTTCAGAAAGAAAAAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCCTTGGTCGAGGAATCTTTCGATCGAAACTTCATAAAGGATGAAGGATAAACGTGTATACA--AAG----------GAATCGAA---TATTC---------------------ATTG--------------------ATC-----AAAT------------------------------------------------------------------------------------------------------------------------------------CATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAACTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCTTTCTACATGTC--------AATACTGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TTGATTCCCCAACCATTTACCCTATCC---TTCTTT---------TCGTTAGCGCTTAC-AAATTCCTTA---GCTTTCTCATTCACTCTATT----------TTTTT-----ACAAACG-----------GATCTGAGCGGAAATGCCCTTATCT--------TATCACAAGTC----TTATGAGATA--CGTATGATACACATAAAAATAAACATCTTTGAACAAGGACT----CCCCATTTGAATGA-----------------TTCACAATTG-------------------ATATTATTTC----TCATACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------TGGATAAAA-------------GGAA---TCTTCTTTTATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAA-----------------------ATGAA-GGTGCTC-TTAGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAACTCCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTTCATGATGGAGCTCGAGTAGAA------AAGAAAGTATTAATTCATTTCTCGAGGCGAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAATTCGAGCAAGTTTC-------CAATTCAAAAGGAAATTCTGTT------GGAATTGATCAAA----CTTTTTCGATCC-----AAAGTGCATGTATCATGCGGAATCAACCGTCCGTAGGATTCTTTGAT----------AGAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCACTGAAGTAATGTCTAAACCC---------AATGATTTAAAAC---AAATAAATAAATATAAAGGATCCCAG-AACAAGGAAACGCCAT----------------TTTAATTGTCTCAATAACTGAAT---CAGATT---------GGAGAATCG-------------AAATAGATTTGAAAGGAGACAAAC---AAAAAGGGGT----AAAGACCACTCAATAAATG--AAATTGCCTAAAGA--TTTTCCTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATG-------------TTTTCTTTTTCA--------------------------------------------GGAAGAAAGAAGAAAAAAGA-------CTTAATTAAAA------------AATAGTTTAATTGATTTGAT-------GATTTTCTGTTTATGGATTCC---TTTGTCATT--------------------------------------TATTCGAATTCCATACTTTATTCGAATTCCATACATAGACAAAACTGCAAATCAA------ATCATTTTTTCTCG-AGCCGTACGAGGAG-AAAACCTCCTATACGTTTCTA----GGGGGG---- Embadium_stagnense ?????????????????????????????????????????????????????????????????????-?????????????????CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT-------------AG-AAGA-TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTTGTGGTTCC-AAATTCCTCG---TCTTTCTCATCTT???????---???????????????????????????-------??????????????????????????????----???????????----????????????????????????????????????????????????????????????????????-----------------?????-----------??????????????????????????--------????????????-????????????????--------?????????????-??????????--------????????-?--????????????------????????---?????????????????????-????-??????????????-??????????????????????????????????????-------?????????????-------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----------A------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAAGAATAAAC--------------CCTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Embadium_uncinatum AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT-------------AG-AAGA-TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATCTTTCTCATTCACTCTATT-GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTA--------------------------GAACAAAGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTAC---------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----------A------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAACG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAAC--------------------------------------------------------------------------------- Eremocarya_micrantha ---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????????????-----------------------------------------------------------???-----???????????-----?????----?????????????----?????----????????------???-------------------------------???-----??AGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCC-----ACCTA-------------CATCCCAACGATTTCTCCTATAT---CTATCT----------ATTTTAGGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAATTATTT--ACTATGGATAGGTTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACGTTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTCTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAGAAGG---------GTGAATGGAATT-------CAATAAGAGTTTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT------------------------------TATTAATATTATTAGATATTAGATTAGAATTCCA-----TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Eritrichium_aretioides -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATAAAATA----------TAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATA-------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCACTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTATTTCTTAT------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGAAAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCTCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATCATTATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATC-----------------ATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATAAAGGATAAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACAGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGTAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATT----------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATTATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Eritrichium_canum ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGACA---AAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTTC-AAATTCCTCT---TCCTCCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTT------------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAA-----------------TTTG----------------------------------------------ACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTT----------------GAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACA-----T-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAAT-------------GGTTTCCTTTTTTA-------------------------------------------------AGGAAGAAAGGG---------GTGAATGGAATT-------CAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Eritrichium_nanum ???????CACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATAAAATA----------TAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATA-------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCACTTTTTAA-----------------TTTG----------------------------------------------ACTGAAACTTAC-AAAGTCGTCTTATTTCTTAT------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGAAAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCTCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATCATTATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATC-----------------ATAAAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACA-----T-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATAAAGGATAAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACAGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACGGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGTAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTT----------------------------TCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATTATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Eritrichium_pamiricum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAATAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----CAAC--AA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAA---------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGAC----CAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCT---TCCTCCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTT------------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTT----------------GAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCACAAAAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------------AGGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAATCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Eritrichium_pectinatociliatum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-ATAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTTCGA-------CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCAATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGACGAGAGAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCACT---TCCTCCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATGACA--------GTATC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGCA-GGTGCTC-TTCGCTCGACATC---ATTC------C------CCTTAAAAGCTC----------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAA-----TCTTT-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGGCAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTACACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AATAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------------AGGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCAGT------------------------------------------TATTAGAATTCCA--------------TACACGGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTCGGGGGGGGGGGTAT Eritrichium_sericeum -GT-GACAACTTTCAAATTCAGAGAAATCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAG-AAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------T----TGTGAAA-------GTAT----A--TTT----------GTATTGAA---TACTTTATAAAATC----------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTGCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATATTGA---TTGACATCCCAACAATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCACTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTTGTCTTATTTCTTAT------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATTATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATCATTATTTGTTCTGTT-----CCACAGGAAACTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCCTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATAAAGGATAAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATATAAAT{AT}--------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAGTCAAT-------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAGGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATT----------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Eritrichium_thymifolium AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA-------CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAAAA-------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCT---TCCTCCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTC-------------------------------------------------ACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTT----------------GAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------------AGGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Glandora_nitida AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGA{CG}CCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTC------AAAATAGATTCTTTTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATTTTTGAATAAGGAATGAATCGCCTTTTGAATTTTAA-----------TAATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATTCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCGGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACGGCAACCCCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Gyrocaryum_oppositifolium -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-AGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----CGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTATGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TTTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTTCACAT----------AAAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTTACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GTCTAT--------TTGACATCCCAACGATTTCTCCACTAT---CCATTT---------TAGTTAGTGGTTTC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC-----TTTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCAT--TTGAA-----------------TGATTCACTATAG-------------------ATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTCTTCGCTTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTTGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTTAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAT-----AAAGTGTAT----CATTCGGAATCAGTCGTCCA---------TTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAAGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAAAACATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAAAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hackelia_andicola -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GAAGTTAAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAG-----ATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTA--------------------------GAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTT-GATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Hackelia_bella -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAG-----ATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATA-------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTA--------------------------GAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTC{AG}AAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACGGT------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Hackelia_deflexa ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTAAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAGA-----TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGAACAA--------------------------GGAAT----CCCCTTTTTAATTT---------------------------------------------------------------GACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT----------------AGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTT-GATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Hackelia_floribunda -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAGA-----TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATTCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGAACAA--------------------------GGAAT----CCCCTTTTTAATTT---------------------------------------------------------------GACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTATTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT----------------AGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Hackelia_revoluta -????????????????????????????????????????????--???????TCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAGA-----TCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGAACAA------------A-------------GGAAT----CCCCTTTTTAATTT---------------------------------------------------------------GACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGAAAA---TCTTCTTTCATA------------------------------CATTTAATTG????????????????????????????-------?????????----ATGAA-GGTGCTCTTTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCTTTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGACAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCTACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hackelia_sharsmithii -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAG-----ATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAA----------TGAGATA--CGTA--------------------------GAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--AAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAGAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------AGCAGCAGAAGGAATAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Hackelia_velutina -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT----------ATTCCACAT----------AGAAG-----ATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTA--------------------------GAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAGAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTT----------------TAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAA-------TTGT--------------GGAATTGATCAAA----CTTTTTCGATAT-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----A------------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAAATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAATACTACTCAATAAAT------------AAAGA--TTTTTCTT----TGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAATAATAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC-GGGGGGGGGGTAT Harpagonella_palmeri -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGTGA---AA--GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGATT-----AATATA----------------------GTTTTTATGAAAAAAAA-----------------GTTGGTGTT-----AATCGATTTCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCATTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCCAACGATTTCTCCTAT-----TTAGTT---------TAGATAGTGGTTCC-AAATCCCTCATCTTCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TT-----------------------------------------------A------------------------------------------------------------------------------------------------------------------------------TTT---CATA------------------------------------------------------------------------------------------------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----AGAAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTC-A------------T-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGATAAAAT-----AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACAGAAT---CAGATT---------AAAGAAT----------------AATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-----------------------------------ACAGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA-TTTTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TAGACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Heterocaryum_subsessile -GT-GACAACTTTCAAATTCAGTAGAAACCCCGAA-TAAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---ATTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACACATTT----------GTATTGAA---TACTTT-TC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCGAACAATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGAA-----------TGATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAA--------------------TACC-------TGGATAAAA---------GTTAGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGACCATTGATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCGTTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAGTCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATACAGAAATCA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAAGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------CAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CA---T---------AAAGAATAT-------------AAATAGATTTGAAATGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTCT-T-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGGATGGAATT-------AAATAGGTGTCTAA------TTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------------TATTAGA---------ATTCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-ATACGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGCTAT Huynhia_pulchra -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCTAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGATGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTC----------------TTTTTTTTTTTGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGT-----------ATGATACACATACAAATAACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTT-------------------------------------------------------ATAAA-GGTGCTC-TTCGCTCGATATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTC----ATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTTAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTTGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACCCCTTTTAAA-----------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAGTGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Johnstonella_angustifolia ------??????????????????????????????????????????????????????????????????????????????????????--?????????????????????????????????????????????????????????????????????---????????????????????????????????????-------------------------------------------------------------------???????---------------?????????---?????--????????????----------------------???------??????????????????????AGAGTTAGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAAAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA----------------------------------TCCTATGT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATAGAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATAG------------------GATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTGGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CGCCCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCGC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTTAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTTTTCAGA----------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT-----GGGGGGTAT Lappula_alatavica AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACATAGAAGAAAGAAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_anocarpa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA--------------------------------------------------AGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_balchaschensis AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAA-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCTT----------------T---AGTTAT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTT-------------G-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAGAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGTAAAGAAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_brachycentra AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACATAGAAGAAAGAAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_cenchrusoides AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTGATAAAAGTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_consanguinea AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA--------------------------------------------------AGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_duplicicarpa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAGAAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT--------------------ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_intermedia AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTGATAAAAGTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATTAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_lasiocarpa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAGAAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT--------------------ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_lipsky AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Lappula_marginata -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA-------CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAAAA-------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCT---TCCTCCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTC-------------------------------------------------ACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTT----------------GAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACAT------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------------AGGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_microcarpa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACATAGAAGAAAGAAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_myosotis AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTGATAAAAGTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_occidentalis -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTTCCACTCCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---TAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_occultata AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACATAGAAGAAAGAAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_patula AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTGATAAAAGTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_semiglabra AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAGAAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT--------------------ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_sessiliflora ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAG-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA------------AAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCGTTTTAGTTAT--TAGTTAGTGGTTCC-AAATTCCTCG---T-----CCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAT-------------TTTTAATTTG---------------------------------------------------------------ACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCCTT-------------------------------------TTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTTT----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAATAATGCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAGAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGTAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAA----------------AAATA--TTTTTCTT-------TGAACTATTTGATTTGACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTTTTTTA--------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_spinocarpa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAATAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTT---------------------TAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAA-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GT-------------TG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAGAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGTAAAGAAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_squarrosa ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTT-ATC---------------AAATAAAATGATT------------AATATATTC----------TGTTTTTCTGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTT--------------------------------------------------AAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_stricta AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTGATAAAAGTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_tadshikorum AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACATAGAAGAAAGAAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCTTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAAT-------------------------------------------------AATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTTCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_tenuis AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTGA---------------------------------------------------------------CTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAACA-----------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA--------------------------------------------------AGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lappula_texana AGT-GACAACTTTCAA?TTCAGAGAAACCCCGGAA-CTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCAAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAATGATT------------AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTCCATGTC--------ATTACCGGCAACAATGAAATTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTTCCACTCCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----TAAATGTAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAA----ACA-------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---TAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lasiocaryum_densiflorum ----------------------------------------------------------------------GGTTTTCCGAAAACAAACACAAAA-GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATATA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATCTATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCAATTTCACAT----------AAAAGAAAGAGTCGAGTATTCATCGATCAAA-------------TCGATCACTCCATAG-----TCTGATAGATTTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TGGACATCCCAACGATTTCTCCTATAT---CTATTT-------------------------------------------TCAGTT-------------------------------AACG-----------GATCTGACTAAAAACACCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATCCAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TGATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTTTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA-------------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGGATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCA-AAAGAATCCACTTTGAGCAAGTTTC-------CAATTTTAAAGGACATTTTGT-------GGGATTGATCAAA----CTTTTTCGATCC-----AAAGTGTAT----CACTCGGAATCCGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAGGGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGAGA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCAAAAGA--------AAATCGATTTGAAACGAGGCAAAC--AAAAGAGGGGT----AAAGACTACTCAATAAAA------------ACAGA--TTTTTCTT-------TGAACTATTCT-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAC---------GGTTTCTTTTTTAAGAAGGAAGAA-----------------------G------AAAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT--------------------------------TATTGAGATTGATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ACCATTTTATCTTG-AGTCGTACGAAGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lasiocaryum_munroi -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAATGA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACACAAAA-GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATATA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATCTATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCAATTTCACAT----------AAAAGAAAGAGTCGAGTATTCATCGATCAAA-------------TCGATCACTCCATAG-----TCTGATAGATTTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TGGACATCCCAACGATTTCTCCTATAT---CTATTT-------------------------------------TCAGTT-------------------------------------AACG-----------GATCTGACTAAAAACACCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATCCAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TGATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTTTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGCCATCTCATAAAATA-------AAGATGATAGATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGGATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCA-AAAGAATCCACTTTGAGCAAGTTTC-------CAATTTAAAAGGACATTTTGT-------GGGATTGATCAAA----CTTTTTCGATCC-----AAAGTGTAT----CACTCGGAATCCGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAGGGGGCATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGAGA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCAAAAGA--------AAATCGATTTGAAACGAGGCAAAC--AAAAGAGGGGT----AAAGACTACTCAATAAAA------------ACAGA--TTTTTCTT-------TGAACTATTCT-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAC---------GGTTTCTTTTTTAA-----------------------------GAAGGAAGAAGAAAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT--------------------------------TATTGAGATTGATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ACCATTTTATCTTG-AGTCGTACGAAGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lepechiniella_microcarpa -------------------------------------------------------------------------------------------------------------------------GGATAGGTGCTGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACTAA-----TATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATTGATTCCACAT----AGAAATAGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATTATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACA------------CTA-----TGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTT-------------------------------------------------------------------------------------------------------------------TTGCTC-TTTGTTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAAAAGTAGTA-TTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGTCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTCAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGA-------GATTAAAGTTAAAG---AATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lindelofia_anchusoides ???????????????????????????TCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAA----CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT------ATATATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAATTA-----------------TTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCC--TCATTAT????????-------?????????????ATGAA-GGTGCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAGAAAAAAGTAGTATTC----ATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAT---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCTAATGATTTAAATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAA---T----TAAAGTTAAAGAAGAATAT-------------AAATAGATGTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lindelofia_longiflora -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCAAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG-----ATAGGATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAGAAAAAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------AGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lindelofia_stylosa AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACACAAAA-----GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTT-CA--------------AATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAG---------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGG---TAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT--GAA-GGAATTGAGAAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Lithospermum_macbridei AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TTCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTC-----------------TTTTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTAAATTTTAA-----------TAATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGTA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTAATAAAGGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAATCCCC---TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGT------TGGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATATAAAT---------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTAATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Lithospermum_officinale ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATCACTACCAAAATATATTC------AAAATATATTCTTTTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTTAATTTTAA-----------TAATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGTA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAATCCCC---TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATATAAAT---------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Lithospermum_persicum TGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATA---------------AAATGAAATGATTAATGACTACCAAAATATATTC-----------------TTTTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACA-----------GATCTGACCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAACAAGGAATGAATCGCCTTTTTAATTTTAA-----------TAATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACCCGTA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAATCCCC---TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATATAAAT---------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTATT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTAATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC--GGGGGGGGGTAT Mairetis_microsperma AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---CTTGAGAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTGCTCTGCTTTGGTCGACGAATCTTTCTAA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTA----------------TTTTTTTTTATGAAAAAAAA------------GAGGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGGTTTCTCCTCCACTATCTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGGCCGGAAACGTCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATAACCATCTTTGAACAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAAAGA-------------------ATATCATTTC----TCAGACTGAAACTGAG-AAAGTCGTTTTATTGAA---------TGAAGATCCAA--GAAATTACA--------GTACCCGGA---TGGAAAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTTATCTCATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCACTCGACATC---ATTTGTTCTGTT-----CCACAACAACCCCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCCAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGAT-TTTGTGGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCTACAGGATTCTTTGAT----------AAAAAGAAATCAC---AAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTTTTTAATTGTCTCAATTTTTAATTGTCTCAATAACAGAAT---CAGATTATTATT---AAATAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACTAATGGAT---------GGTTTCATTTTTTA--------------------------------------------------AGAAGTAAAGG---------GTGTATGGAATA-------AAATAAGAATCTAATTCATTTTAG-------------GATTTTATGAAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Memoremea_scorpioides AGT-GA-AACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAATAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTA--------------CACAT----------AGAATAAAGAATCCAATATTCATTGATCAAA-------------TAATTCACTCCAGAG-----TCTGGTAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCATTCTACATGTC--------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAGTCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-CAATTCCTCA---TCTTTCTCATTCACTCCATT----------TTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--GGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TGATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAA---------CA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTT----------------------------------CTTTTAATTGACATAGACCCCAGTCATCTATTAAAATA-------AGGATGATACATTATGAA-GGTGCTC-CTCGTTCGACATC---ATTTGTTCTGTT-----CTATAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAATTATTCATTTATTTCTCGGGGAAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCCAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAACCAGTTGTCCACAGGATTCTTTGCT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACTAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAA---------GGTTTCTTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTTTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTACA--------------TACACAGACAAAACTTCAAACTAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Mertensia_ciliata -GT-GAC-ACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCAAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTGGGTATT-----AATCGATTCTACAT----------AGAAGAAAGCATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTAGTGAATTTGAA-----------TTATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTAGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTGGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------CGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----AGAAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATGGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCAATAC-----AAAGTGTAT----CACTCGGAACCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGGGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAA-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACGGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTCT Mertensia_davurica -??????CACTTTC--ATTCAGGGAAACCCCGGA--TTAATAAA----GGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAC---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAATAGTTGGTATT-----AATCAATTCTACAT----------AGAAGAAAGCATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TTATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTAGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTC???------------------------------?????????????????????????????????????---------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCAAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCAATAC-----AAAGTGTAT----CACTCGGAACCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CCGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGG--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAA-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTCT Mertensia_lanceolata -GT-GACAACTTTCAAATTCAGAGAAACCCCGAA---TAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCAAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTATT-----AATCGATTCTACAT----------AGAAGAAAGCATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTAGTGAATTTGAA-----------TTATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTAGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTGGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------CGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCAATAC-----AAAGTGTAT----CACTCGGAACCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATTAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGGGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAA-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCGTTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTCT Mertensia_maritima ?GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTGGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TGTTTTTATGAAAAAAAAAAAA--------GAAGAGTTGGTATT-----AATCGATTCTACAT----------AGAATAAAGCATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAATTCC-AAATTACTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------TATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TTATCCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTAGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTGGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------CGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTCTA-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCAATAC-----AAAGTGTAT----CACTCGGAACCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAA--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAA--ACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAATGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAA-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTCT Mertensia_sibirica -----AC-ACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAATATGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTAATATAATATATTC------------------TGTTTTTATGAAAAAAAAAAAA--------GAAGAGTTGGTATT-----AATCGATTCTACAT----------AGAAGAAAGCATCGAATATTCATTGATCAAA-------------ACATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTAGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAATTTGAA-----------TTATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTAGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------CGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACTTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATGGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCAATAC-----AAAGTGTAT----CACTCGGAACCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGGGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAA-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACGGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTCT Metaeritrichium_microuloides -----------------------------------------------------------------------------------------AAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTAACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTT--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGATCA--------AAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAAT-----AAAAAATAAAGA--TTTTGCTT----TGTTGAACTATTTT-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCTTTTTTTC-----------------------------------AGA--ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------TATTAATATTAGAATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTTCTATACGTTTCTT----GGGGGGGTAT Microparacaryum_intermedium -???????-?????????????????TTCCCGGAAATTTATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAAAAAA------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTTTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCA----GCCTATTTG-----TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----C---TTATGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGA???????????-?????????????-------------???????????--?????????--------?????-------?????????????--???????????---???????????????????-----------------------??????????????????????????????????????-------?????????????ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Microula_blepharolepis -GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGAT-------T-----AATATA----------------------GTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATTAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAAAGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCT-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGT---ATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG------ATAGG--------ATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATTA------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTG---GAATTGATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAATCAATAAAG----AAAGATTTTTTTCTT----TGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAG-----------AAAGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTTCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAAGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_diffusa ???????????????????????????????????-??TTATAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATAT----------------------AGTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTATCTATTT--TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA---------GTTGGTAA---GCAATCCATTTTCCCCC????-???????????????????-??????????????????????????????????????---?????????????????--------TGCTC-TTTGTTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAGGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGAAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT----CAATAAATAAAGA---TTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Microula_floribunda -??-????????????????????????????????????????????????????????????????--????????????????????AA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATATTCATTGATAATA----------AAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGCC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGTATATACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG---------------TAGGATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGAT????--?????????--------?????-------?????????----------------------------?------------------------------------???????????????????????????????????-------?????????????------------------------ATC---ATTTGTTCTGTT-----CCACAGGAACCTCTT-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACACTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTATAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAAT----CAATAAATAAAGA---TTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Microula_muliensis AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAAAAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTCAAG------------AAATGAAATGATTAATGACT-----AATAT----------------------AGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACT------------------ATAGGATATCATTTA----TAAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATT-----------------GCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGG{CT}TG{CT}AATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAA{GT}TGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT--G{CG}AATTGAT??ATCAAA----CT{GT}{AT}?TCGATAC-----AAAG{CT}GTAT----CACTCGGAATCAG{AT}CG-----AGGATTCTTTGAT--------AA{AC}AGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCA{GT}TTTGAAAGGATTA{AC}GAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----CAAAATA------AAGGATTCTAG-AACAAGGAAACACCGT----------------TTAAATTGTCTCAA{GT}AACGGA{AC}T---CAGATT---------{AG}AAGAATAT-------------{AC}AATAGATTTGAAACGAGACAAAT--AAAAACGGGGT----AAAGACTACTCAATAAAT------------AAAGA-TTTTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTATGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_myosotidea AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAATAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAACTCA--TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATAT-----------AGTTTTTATATAGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------ATAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG-------------------ATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTTTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGG?ACCTCTC-TTTTTGTTGGGTTGTAATGTAAAGTAAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT--GGAATTGATTGATAAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGTTTGAT----AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGAGT----AAAGACTACTCAATAAAT----CAATAAATAAAGA-TTTTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC-------GGGGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCT-----------------------------------TATTAATATTTTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_oblongifolia AGT-GAAA-CTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT--GTATTGAATTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATCT-----------------AATATAGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACTGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTAGAAATGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATACA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTATTTATCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACAAAATTATAGTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-?GTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTTTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------CAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTA?-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAACAGATTTAAAACGAGACAAAC--AAAAACGGGGT----AAAGACGACTCAATAAAT----CAATAAATAAAGATTTTTTTTCTTTGT---TGAACTATTTT-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTT-ATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGA-ATTCATCCA----------TACACAGACAAA-CTTC-AACCAA------ATCATTT-ATCTTG-AGCCGTACGAGGAA--AAACTTCCTATACG-------------------- Microula_ovalifolia AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAATAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAACTCA--TAAAGTGTGAAA-------GTATATAAA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATAT-----------AGTTTTTATATAGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGGGTT-----AATCGATTCCACAT----------ATAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG-------------------ATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTTTTATTTAT---------TGAAGATCC-A--GAAATTA-A--------GTACC-------TGGATAAAG-----------TGGGAA---TCTCCTT-CATA------------------------------CTTT-AATTGAC-TAGACCC-AGTCATCTAT--AAATA-------AGGA-GATACATT------------------------------------------------------------TC-TTTTTGTTGGGTTGTAATGTAAAGTAAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT--GGAATTGATTGA{CT}AAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGTTTGAT----AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGA{CT}TAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGA{CT}TCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------TAATAGATTTGAAACGAGACAAAC--AAAAACGGAGT----{AG}AAGACTACTC?AT{AC}?AT----CAATAAATAAAGA-TTTTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC-------GGGGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Microula_pustulosa -----------------------------------------------ATGGCAATCCTGAGCCAAATCC-GG-TTTCCGAAAACAAACAAAA---GTTGAAAAATAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAACTCA--TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AA{GT}ATA-----------GTTTTTATATAGTTTTTATGAAAAAAAAAA----------GAAGAGTTGG{GT}GTT-----AATC{AG}ATTCCACAT----------ATAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCAC{CT}CCAT{AG}G-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGT---ATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG-------------------ATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTTTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTCGGAAA---TCTTCTTTCGTA------------------------------CTT-TAAT---------G----------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAATCTATC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTG---GAATTGATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----CAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATTT--------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAATAAA---------GAAGATTTTTTTCTT----TGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAG-----------AAAAG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT-GGGGGGGGGGTAT Microula_sikkimensis AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATAT----------------------AGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACTGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAAAGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAATGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATACA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATT?ACTTACT------ATGGATGGATAGGATATCATTTATTTATCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACAAAATTACAGTACC-------TGGATAAAA---------GTTGG?AA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATT------------C-TTCGCTCGACATC---ATT{CT}G?TCTGTT-----CCGCAGGAACCTCTC-TTTTTGTTGGGTTGTAA{GT}G?-----AA{AC}T{AC}GTGCATGATGA{AG}GCTCGAGTAA{AG}A------AAGAAAG{CT}ATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAA{AT}AAATTGAACAACTTCG-----------{CT}AAATATATCTTC-----------GATATAGAAATCG-A{AG}AGAA{GT}C{CG}CCTTCGAGC{AG}AGTTTC-------CAATTCAAAAGGATATTTTTTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAACAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACGACTCAATAAAT----CAATAAATA-----TTTTTTTCTTTG----TGAACTATTTT-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCC-TTTTTCAGA-------------------------------------ATCAGAA-----------A-G---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTT-ATGGATTCA----TTTTCATT--------------------------------TATTATATTAGATTCGAATTCCA--------------TACACAGACAAA-CTTCAAACCAA-------TCATTT-ATTTTG-AGCCG-ACGAGGAA--AAACTTCCTATACGTTCTT--------------- Microula_stenophylla -??-????????????????????????????????????????????????????????????????--????????????????????????-??????????GAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGCCCCGTTCTACATGCC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTAGTATATACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAG??????--?????????--------?????-------?????????????--???????????---?????????---------------------------------??????????????????????????????????????-------?????????????-------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATT----CATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCCTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGGAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAGC--AAAAACGGGGT----AAAGACTACTCAATAAAT----CAATAAATAAAGA-TTTTTCTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Microula_tibetica ???-????????????????????????????????????????????????????????????????????????????????????????--?????????????????????????????????????????????????????GTGTGA?AGT{AT}TAT---ACATTTGTA-----TT----------GAATACTTTCTC-----------------------------------------------------------------------------------------AAATGAAATGATTAATGACT--------ATA----------------------GTTTTTATGAAAAAAAAA-----------GAAGAGTTGG?GTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTTTCAATATTCATTGATAAAATCATTCACTCCATAG-----TCTGATAGATCCTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCA-AAATCCCTCA---TCTTTCTCATTCACTCT????????????????????????????????????????????????-?--??????????????--------??????????--?????????????????????????????????????----??????????-????----??????????---------------------????????????????????????----????????????????-????????????????????????????-??--------??????????-------????--------------????-????????????------------------------?-???????-----------------------???-??-???????????----------------------------------?????????????ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCGAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGA---TTTGATAA--------AAGGGGAAATCAC--AAAAAAAGGTATGTTGCTACCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAATAAATCAATAAATAAAGA--TTTTTCTTTGT----TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCC-TTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATCGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAGACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_trichocarpa -GT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATTATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGT---ATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAA-----AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTG---GAATTGATTGATCAAACTTTCTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTACTCAATAAAT------------AAAGATTTTTTTCTT----TGTTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAG-----------AAAGG---------GTTAATGGAATTCAA----CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_turbinata AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------ATATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATAT----------------------AGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAATTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAATTAGTGGTTCC-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CG---TATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATT-------------------------TC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT--GGAATTGATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGAT--------AAAAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----CAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGGGT----AAAGACTAC--------T----CAATAAATAAAGA-TTTTTTTCTTTGT---TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT---CAATAAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTAATT------------------------TATTATTTATTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Microula_younghusbandii ---??-?????????????????????????????????????????????????????????????????-????????????????????--??-????????????????????????GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTCTC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATAAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATTAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCT-AAATCCCTCA---TCTTTCTCATTCACTCTATTATT-------GTT---------AAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGT---ATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTTAA-----------------TTATTTACTATGG--------------ATAGGATATAATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTATTTAT---------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTT----------------------------------------------------------CGTATAATCCTCCGTCCC???????????-------?????????????ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGTAAAGTAAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATTGATAAAACTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCG-----AGGATTCTTTGTTTGATAA----AAGGGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAAATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAACGGAGT----AAAGACTACTCAATAAATC----AATAAATAAAGATTTTTTTCTTTGT----TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC-------GGGGTTTCCTTTTTTCAGA-------------------------------------ATCAGAA-----------AGG---------GTTAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTC----TTATTAATA-------------------------------TTTTAATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Moltkia_petraea AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTTAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACGAATCTTTTTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTC-----------------TTTTTTTTCATAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATAGATCTTTTGAAGAATTGATTAATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCA-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAACG-----------GATCTGG-----------TT-------------TT---GAAT------TTGAATGA--------------------------------------------------------------------------------TTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--AAAATTACA--------GTACC-----------CGAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTGATTTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTAAAAGGACATTTTGT-------GGAATTAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCGCAAGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGGTA------AAGGATCCTAGAAACAAGGAAACACCTT----------------TTAAATTGTCTCAAAAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTCATTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Moritzia_lindenii -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTGGAAAAATAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATAGATTC------------------TTTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTCTT-----AATCGATTCCACAT----------AGAAGGAAGAGTCGAATATTCATTGATCAAA-------------TTATTAACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGGC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GTCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATATT--------TCGTTCGTGGTTCA-AAATTCCTCA---TCTTGCTCATTCACTCTGTT----------CTTTT-----ACAAATG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCCTTGAAAAAGGAAT----TTCCTTTTAAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------CGAAGATCCAA--GAAATTACA--------GTACC-------------------------CGTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTTATAAAATATAGGATAAGGATGATACTTTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGAAACCTCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATTCATTAATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTAAACAACTTCG-----------TAAATATATCTTCGATATAGAAA----ATAGAAATCG-AAAGAATCCATTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAAGATTTTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATTT-------------AAATAGATTTGAAACGGGACAAAC---AAAAAGGGGT----AAAGACTACTCAATAAAT------------AACGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTTTA-----------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTCTGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAATCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotidium_hortensia -??-TGACACTTTTCAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCTATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAATGA-----------------TTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAATATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTTT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAATACCAT----------------TTTAATTGTCTCAATAACGGAAT---AAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----TCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTGA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATAGATTCA---TTTGTCATT------------------------------------------TATTAAAATTCCA--------------TACACAGACAAAACTTCAAACCAAATCCAAATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----AGGGGGGTAT Myosotis_alpestris AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAGTAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAAGGAAGGA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAC---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTAAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC-----------------AAAATCAAATTAATGACA-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATTAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAAC----TCTCCTATTT---ATTAGT-----------GTTAGTGGTTCC-AAATTCCTCA---TATTTATCATTCACTCTATTTATATTTTTTGTTTT-----ACAAACG-----------GATCTGGCTGGAAACGCCTTTCATC--------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCTAA--GAAATTACA--------GTAAA-------------------------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACGTTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------TAATTCAA----ACATT-----------GGAT----TGGAA----TTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGATAAAAGATAAAAGGAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AACGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAAT------AT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAATA--TTTTTCTT-------TGAACTATTTGACAGTTAAGTTAT-----CCAACTTGAGTTATGAGTACGAA-----TGAAT----GGTTTCCTTTTTTA-------------------------------------AGAATTATTAAGAATAAGA------AGAAAAGGGTGAATGGAATTCAATAA-GAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT---------------------------------------TATTATTAGAATT------------------------------CTATAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotis_caespitosa -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAAGGAA------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGCAGAATCTTTCTCA----------TAAAGTGTAAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AA--------ATTAATGACT-----AATATATTC------------------TGTTTTTATGACAAAAAAAAAGAA-----GAAAGAGTTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-TCTGATTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT--------------AGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAA----------------------------------------------------------------------------------------------------------------------CATCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTAAA-------------------------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCACTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGAAAGTATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTTGAGCAAGTTTC-------CACTTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAATCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAA-TGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AACGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAATGGGGT----ACAGACTACTCAATAAATG----AATAAAAAAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAAGTTATCCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTAAGAATTATTA-----------------------ATTAAGAATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCAT------------------------------AAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotis_incrassata -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAAGGAAGGATAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATT-----------------------AAATTAATGACT-----AATATATTCTATATATATATTCTATTCTATTTTTATGAAAAAAAAAAA---------GAAGAGTTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGGCATCCCAACGATTTCTCTTATAT---ATAT--------ATCTATTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTT------------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTATA--------GTAAA-------------------------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATAAATA---AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTG-------------------CTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCAGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATTTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAATGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAA----------------TTTAATTGTCTCAATAAGGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT-------TGAACTATTTGACAGTTAAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTT------------------------TTATGAATTAATTAAGAATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATTCAAATT-CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------------TATTAGAATT-----------------------------------CCATAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotis_macrosperma -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-{AT}TAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAATAAACAAAA---GTTGAAAAAGAAAAAA----GGATAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATTAA--------TGACT-----AATATATTC---------TATATATTCTATTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGGCATCCCAACGATTTCTCTTATAT---CTATTTATATATC--TATTTAGTGGTTCC-AAATTTCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------TATCTGACTGGAAACGCCTTT------------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAA----------------------------------------------------------------------------------------------------------------------CATCTTTT-------------TGAAAATCCAA--GAAATTACA--------GTAAA-------------------------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTG-------------------CTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCAGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAATGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAA----------------TTTAATTGTCTCAATAAGGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT-------TCAACTATTTG-----ACAGTTAAGTTATCCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTT-ATGAA---TTA-----------------------ATTAAGAATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATTCAAATT-CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAAAATTCCAT------------------------------AAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotis_sparsiflora -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GATTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------ATATATACA--TTT----------GTATTGA-------TTTATC-----------------------AAATTAATAACT-----AATATAT----------------------TTTTTATGAAAAAAAAAAA---------GAAGAGTTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTCAATATGTCAATACCGGCAACAATTAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTAT--------------TTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATTTTATT-GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTT----TTGTGAGATA--TGTATGATACCCATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTAAA-------------------------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAACTA-------AGGATGATACATTATGAA-GGTGCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTGGAGCAAGTTTC-------CAATTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CGCTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT-------TGAACTATTTGACAGTTAAGTTAT-----CCTACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTAAGAAT-----TTAAGAATAAGAATT----ATTAATTAAGAATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAA----------------------------------TTCA---TTTGTTATT-------------------------------------TATTAGAATT-----------------------------------CTATAAACCAAATCATTATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Myosotis_stenophylla -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GG-TTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAAGGAA------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------AAAAGTGTGAAA-------GTATATATA--TTT----------GTATTGAA---TACTTAATG--------------------AAA---TTAATGACT-----AATATTTTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATTGA-TCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATTGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTATTTGACA--TTGACATCCCAACGATTTCTCCTATAT---CTAT--------------TTAGTAGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TGACACAAGTT----TTGTGAGATA--CGTATGATACACATATAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAATATTCAA--GAAATTACA--------GT----------------AAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATATCATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAATAAAA------ATGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCCGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCGTTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----A------------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC-AAAAAAAAGGAT----AAAGACTACTCAATAAAA------------AAATA--TTTTTCTT-------TGAACTATTTGACAGTTAAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAGT---------GGTTTCCTTTTTTAAGAA----------------TTATTAATTAAGATTAAGAATTAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------------TATTAGAATT-----------------------------------CCATAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCGG----GGGGGGGTTG Myosotis_stolonifera -GT-GGCAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAAGGAA------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGCAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC-----------------------AAATTAATGACT-----AATATATTC------------------TGTTTTTATGACAAAAAAAAAAA-------GAAGAATTGGTGTT-----AATTGATTCCGCAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCAAAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTAT--------------TTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTT----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTAAA-------------------------GTTGGTAA---TCT-------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGGTTC-------CACTTCAAAAGGACATTGGAT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAATGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AACGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----ACAGACTACTCAATAAATGAATAAAA----AAAGA--TTTTTATT-------TGAACTATTTGACAGTTAAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTAAGAATTATTATTAATTATATTAATTATTAATTAATTAAGAATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------------TATTAGAATT-----------------------------------CCATAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC---GGGGGGGGTAT Nihon_japonicum AGT-GACAACTTTC-AATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACACAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGACAAATACTTTTTA---------------AAATGAAATGATTAATGACT-----AATATATTC-------------------TTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-AATTAATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCA----GCCTAT--------TTTAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATG----------GTATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------TACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAAGA------------------------------CTTTTAATTGACATAGACCCCAGTTATCTAATAAAATA-------AGGATGATACATTAAGGA-GGTGCTC-TTTG{CT}TCGA{AC}A-----------TCTGTT-----CCACAGGAACCTCTC-TTTTTGTGGGGTTG----GT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAA{AC}GTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TCAATATATCTTC-----------GATATAGAAATCG-AAATAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CATATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGA--------AAGACTAC--------T----CAATAAATAAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Nonea_caspica AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GCGGAAAAATAAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACAAAT---GGAGTTAAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTTTGAAA-------GTATATACA--TTT----------TTATCGAA---TACTTTATC---------------AAATGAAATGATTAATGACT---ACAA---ATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCGAT--------TTTACATCCCAACGATTTATCCTCTAT---CTATTT---------TTGTTAGTTGTTCA-AAATTCTTAA---TCTTTCTCATTCACTCTATT----------CTTTT-----AGAAATGTAGAAATGGATGATCTGGCCGGAAACGCCTTTCATC--------TTACATAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGGACATTTTTTAACAAGGAAT----TTCATTTTGAACTTGAA-----------TGATTCACAATGG-------------------ATATTATTTA----TCAGACTGAAACTTTC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTAAC-------CGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATATACCCCGGCCATCTAATATAAT-----------AAAATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGGAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATCCATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATCAAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC----CAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAT--AAAAAAAGGTATGTTGCTACCATTTTGAAAGGATTCATAAATACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TTGAATTGTCTAAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC-AAAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTATGAATGAGT---------GGTTTCCCTTTTTTTTA----------------------------------------AGAAGTAAGAAGAAGGGG---------GTGAATGGAATT-------AAATAAGAATCTAATTTATTTTAG-------------GAGTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCAA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_akiensis -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-------------TGGAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGACAAATACTTTTT-AA--------------AATGAAATGATTAATGACT-----AATATATTC------------------T-TTTTTATGAAAAAA--------------GAAGAGTTGGTGTTAATT-AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATGGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCC---A-GCCTAT--------TTTAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTA-------------------------------------------------------------------------------------------------------------------------------------------------------TGG---------------------------TA-------TTTACTATGGATAGGATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC-----------TGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGGT---------AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACCACTTCG-----------TCAATATATCTTC-----------GATATAGAAATCG-AAATAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CATATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAGGG---------GTGAATGGAATTCAATATTCAATAAGAGTCTAATTTATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------TATTAATATTAGATATTAGATTGGAATTCCAT-----CCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGCA-AAAACTTCCTATACGTTCTC-----GGGGGGGTAT Omphalodes_aliena ---------------------------------------ATAAA---TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTAATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAATGA-----------------TTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA-----------------------------------------------------------------------------------------------------------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---ACCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATAA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAA---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT--------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAACT-------AAATAAGAGTATAATTCATTTTAG-------------TATTTTATAGATTCA---TTTGTTATT------------------------------------------TATTAAAATTCCA--------------TACACAGACAAAACTTCAAACTAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_alienoides ?-???????????????????????????????????????AAAA--TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------GAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-ACAAACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCTCTTTGAATGA-----------------TTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGGTA---ATCTTCATTCAGA-----------------------------CTTTT-ATTG???????????????????-???????--------------???????-------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATCA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCA---AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAATGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Omphalodes_brassicifolia -----???????????????????????????????????????????????????????????????????????????????????????--???????????????????????????GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TACTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAATCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCCGACTGTAAACGCCTTTCATCTTTC----TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACG--------GTACC-------TGGATAAAA---------G???????---???????????????????????????????????-?????-????????-------?????????????---------------------------------------------TTTGTCGACATC---ATTTGTTCTGTT-----CCACAGGA?CCTCTC-TTT{GT}TGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTA-----------CAATAAATTGAAC??CTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AA{AT}GAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCA{AT}A----CTTTT{CT}CGATAC-----AAAGTGTAT----CACTTGGAATCAGTCGTCCACA{GT}GATTCTTTGAT----------AAAAGG{AC}A{AC}TCAC--AAAAAA-GGTATGTTGCTG{CT}CATTTTGAAAGGATTAAG{AC}AAC{AG}CCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGG{AC}TCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT----------CGAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Omphalodes_cappadocica AGT-GACATCTTTGCAATTCAGAGAAATCCCGGAA-TAAATAAGAA-TGGGCAATCCTGAGCCAGATCC-GGGTTTCCGACAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCCATGGAAGCTGTTCTAACAAAT---GGAGTAGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGATTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TTTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------TTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGGTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTAATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTT-----------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAAAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_cardiophylla ------------------------------------------AAAA-TGG-CAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTTCTATAT---CCATTT---------TAGTTAGTGGTTCA-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACATATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------G-----------------------------------------------------------------------------------------------------------------------GCTC-TTTGTTCGACATC---ATTTGTTCT-TT-----CCACAGGA-CCTCTC--TTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATCA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCGA---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTTATTGTCTCAATAACGGAAT---CAGATTCAAG---------AATAT-------------AAAT---------ACGAGACAAAC--AAAAAAAGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT--------GAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Omphalodes_caucasica AGTAGACAACTTTCAAATTCAGAGAAACCCCGGAA-TAAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTAGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TTTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTTC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTA----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------TTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGGTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTAATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTT-----------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAAAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_commutata ????????????????????????????????????????????????TGGCAATCCTGAGCCAAATCC-CGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TACTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAATCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCCGACTGTAAACGCCTTTCATCTTTC----TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAATGA-----------------TTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACG--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA-----------------------C?????-??????????????????????????????????????-------?????????????ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTA-----------CAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTTGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTTTT-------T-AACTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAAAAGAAAAGGGTGAA----GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_kuzinskyanae ?AT-GACACATTTCAAATTCATAGAAACCCCGAGAATTAATAACCC--CCTATTAGGGGAGCCAAATCTCCGTTTTCCGAAAACAAACAACC---CTTTTAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TACTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAATCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCCGACTGTAAACGCCTTTCATCTTTC----TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAATGA-----------------TTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACG--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAATCATCTAATAAAATA-------AGGATGATACATTATGAA-GATGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTCTTTTTGTTGGGTTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTA-----------CAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTTGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTTTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAAAAGAAAAGGGTGAA----GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_linifolia AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-CGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TACTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAATCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCCGACTGTAAACGCCTTTCATCTTTC----TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACG--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAATCATCTAATAAAATA-------AGGATGATACATTATGAA-GATGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTA-----------CAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTTGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTTTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAAAAGAAAAGGGTGAA----GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalodes_littoralis -?G?GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-CGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TACTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAATCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCCGACTGTAAACGCCTTTCATCTTTC----TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCCTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACG--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAATCATCTAATAAAATA-------AGGATGATACATT-----------------------------------------------------------------------------------------AATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTA-----------CAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------G{CG}A{AC}TTGATCAAA----CTTTTTC{AG}ATAC-----AAAGTGTAT----CACTTGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---A{AC}AAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTA{AC}AAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------C?AGA{AC}TAT-------------AAAT---------ACGAGACAAAC---AAAAAAGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTTTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTT{AC}TGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Omphalodes_nitida ???-?????????????????????????????????????????????GGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TTGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATAC?AATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTATA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTT??????????????????????????????????-------??????????????------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATACAAAGTAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAA-GGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAA------------TAAATAAAGA-TTTTTCTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Omphalodes_verna ?GT-G?CA--CTTCAAATTCAGAGAAACCCCGGAA-T?AATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCTGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTTTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATGGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACA----------TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAA-----------------TGATTCACTATGG-------------------ATATAATTTC----TCAGACTGAAATTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTATAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGG?CATTTTGT-------GGAATTGATCAAA----CTTTTTCGATACAAAGTAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------CAAGAATAT-------------AAAT---------ACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Omphalolappula_concava ---------------------------------------------------------TGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATAAAA-------TGATT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATTT-------------------AGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA-----TTTGAACAAGGAAT----CCCCTTTTTAATTTG---------------------------------------------------------------ACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Onosma_rhodopea AGT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTTTAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGACTAATCTTTCTCA----------TAAAGTGT----------------------------------------------------GTC---------------AAATGAAATGATTAATGACTACCAAAATATATTC-----------------TTTTTTTTCATAAAAAAAA------------GAGGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAGTATTCAGTGATCAAA-------------TTATTCACTCCATAG-----TCCGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TCGTTAGTGGTTCC-AAATTCCTCA---CCTTTCTCATTCACTCTATT----------CTTTT-----ACAAATG-----------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTATGATA-----------CACATACAAATGACCATCTTTGAAGAAGGAATGAATCGCCTTTTGAATTTGAA-----------TGATTCACAATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------CGAAGATCCAA--GAAATTACA--------GTACCCGAA---TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACTTTATAAA-GGTGCTC-TTCGCTCAACATC---ATTTGTTCTGTT-----CCACAGCAACCTCCC--CTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AA-AAAGTATTCA-----TTTTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATCAAAATCG-AAAGAATCCACTTCGAGCAAGTTCC-------CAATTTTAAAGGACATTTTGT-------GGAATAAATCAAA----CCTTTTCGATAC-----AAAGTGTAT----CATTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAGGGGTATGTTGCTGCCATTTTGAAAGGATTAAAAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC---AAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATGGAT---------GGTTTTATTTTTTT-------------------------------------------AGAAGGAAGAAGAAAAAG---------GTTAATGGAATT-------AAATAAGAGTCTAATTTCTTTTAG-------------GATTTTATGGAATCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----AGGGGGGTAT Oreocarya_flavoculata -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAA---------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATATTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGA-------AATATAGTT----------------------TTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTCCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGA-CCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAATTTC-------CAATTCAAAAGGACATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCA-------GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT---------------------TATTAATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTC-T----GGGGGGGTAT Oreocarya_suffruticosa ?????????????????????????????????????????????????????????????????????-??????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????A-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGAAA-------TATA----------------------GTTTTTATGAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTA-------------CATCCCAACGATTTCTCCTATAT---CTATTTTAT------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTGTCATA-------------------------------------------------------------------------------TGATG????-------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATT----CATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG---------GAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AATAAA----------------GAATATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Paracaryum_ancyritanum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAA---------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCC------TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTA----------------------ATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTA----------------------------------ATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Paracaryum_cappadocicum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAAAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCC------TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATACTTTTAATTGACATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Paracaryum_laxiflorum ?GT-GAC-ACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAA---------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAATG-------ACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCTTC------TTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA-----------CAGGAAT----CCCCTTTTGAATTA-----------------TTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATACTTTTAATTGACATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATT--------------------CGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTT{AT}TGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAGAAATGATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTTGAAGAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGT{AT}AT-----CCAACTTGAGTTATGAGTAAATGTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Paracaryum_polycarpum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCC---A-GCCTATTTG-----TTGACATCCCAAC----TCTCCACTAT---CTATTT---------TAGATAGTGGTTCC-AAATCCC------TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATACTTTTAATTGACATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTTTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG--AAGGGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Paracaryum_racemosum -------------------------------------------------------------------------TTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAA---------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTC------TTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAA-----TCCCCTTTTGAA----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATACTTTTAATTGACATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATAC---ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT-GAAGAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTA----------------------------------ATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Paracaryum_rugulosum -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAAA---------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATAA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGAGAGTGGTTCC-AAATCCC------TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATACTTTTAATTGACATATTTAATA-CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATATATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAAC----T----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGT---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Pardoglossum_cheirifolium ----?????????????????????????????????????????????????????????????????-??????????????????????---?????????????????????????????????????GAGACTCGATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGGGGGAAA-------GTATATACA--TTT--ATATATTGATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGAGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAAAATTCATTGATCAAA-------------TCATTCACTCCATAG-----CCTGAAAGATCTTTTGAAGAATTGATTT--------------------CGCGGAC----GAAAAAAAAGAAAGAGCCCCGTTCTACCTGCC--------AATACCGGCAACAATGAAATTTATAGTAGGAGGAAAATCCGGCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTAAAT---CTATTT---------TAGATAGTGGTTTC-AAATACCTCA---TCTTTATAATTCACACTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TGGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAC----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAAC?TAC-AAAGTCGTCG-----------------GAAGATCCAA--GAAATTACA--------GTACC-------TG?ATAAAA---------GTTGGTAA---TCTTCTT????????????-----------------------??????????????????????????????????????-------????????-----ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTTTGTTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAG---GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAATCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Pardoglossum_watieri -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTTATATATATTGATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAC----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCT-----------------GAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATAAAAGTTGGTAATCTTCTTTAATATTTAATACTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTTTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA-------AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTTTGTTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAG---GAAGAAAAGG---------GTAAATGGAATT-------CAATAAGAATCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Pectocarya_lateriflora -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCCTTTTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGAC-----TAATATA----------------------GTTTATATAAAAAAAA------------------GTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTTTCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATATAAATGCA----------CAGGGAAT----CCCCTTTTGAATTATTTAC---------TTATTTACTATAG------------------GATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAATAAAA----GTTAGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-AGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----AAGAAAGTATTCA----TTTCTTGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGGCATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---TAGATT---------AAAGAATCT-------------AAATAGATTTGAAATGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCTTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------TAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTATTT----------------------ATTAATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Pectocarya_penicillata ------------------------------------????????????????????????????????--???????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????????????-------------------------------------------------------------------------????-----????????-???????-?????????????------???????------????????????----------AAAAAA-------------------GTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCCGACTGGAAACGCCTTTCATC--------TTACATAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAATTATTTAC---------TTATTTACT------------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTAGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTTGGGGCAAGGATCTAGGGTTAAT---GCCAATTAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGGCATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---TAGATT---------AAAGAATCT-------------AAATAGATTTGAAATGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCTTTTTTTC-----------------------------------AGA--ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------TAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATTTATTAATATTATTAGATATTAGATTCATATTATTAGATATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Pectocarya_setosa -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACACAAAA-----GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATA----------------------GTTTTTATAAAAAAAAA-----------------GTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----AAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGTTTG-TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------TATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACT------------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCGA--GAAATTACA--------GTACC-------TGGATAAAATAAAA----GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATCCAAAAAGACATTTTGG---------AATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CAGTTGGAATCAGTCGTCCACAGGATTCTTTGATATT-TGATAAAAGGAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAAGAACGGAAT---TAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATAGATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCTA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Pentaglottis_sempervirens ?GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCAAAAAACAAACAAAA---GT-GAAAAATAAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTT--------AATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------TTATTTAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGGGTTGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTACATCCCAACGATTTCTCCTCTAT---CTATTT---------TCGTTAGTGGTTCA-AAATTCCCCA---TCTTTCTCATTCACTCTATT----------CTTTT-----ACAGATGGAT--------GATCTGGCCCGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGGACATCTTTTAACAAGGAAT----TCCCTTGTGAATTTGAA-----------TGATTCACAATGT-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTGCC-------CGAATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCGAATAAAATA-------AGGATGATACGTTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGGAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATATAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATCCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC----CAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATCCTTTGAT----------AAAAAGAAATCAC--AAAAAACGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAATACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAA--------------AGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAT---------GGTTTCTTTTTTTTTT-----------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGATTTA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGAAAAAACTCCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Phacelia_campanularia ----------------GTTCAGAGAAACCCTGGAT-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---GTTCAGAAAGCGAAAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCGTTGGTCGAGGAATCTTTCCCTCGAAACTTCAGAAAGGAGGAAGGAGAAACGTATATACA--TAT----------GTATTCAA---TACTCTATC---------------AAATGAAATGATTCATAATGATTACTTATGACCCTAATCTGTTCTGCTTTTTTTTTTTTCATAAAAAAAG------------GAAGAGTTGGTATG-----AATCGATTCCACCT----------TGCAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCACAG-----TCTGATAGATCTTTTGAAGAACTGATTA--------------------ATCGGAC----CAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTTT--------TTGATTCCCGAACCTTTTATCCTATAC---CTCTTT---------TCGTTAGCGCTTCC-AAATTCCTTA---GCTTTCTCATTCACTCTATT----------CTTTT-----AGAAACG-----------GATCTGAGCGGAA---------TCT--------TATCACAAGTC----TTGTGAGATA--CGTATCATACACATAAAAA----------TGAACAAGGACT----CCCCATTTGAA-----------------TGATTCACAATGG-------------------ATATCATTTC----TCATACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------TGAAAAAAAAA-------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGATCCCAGTCCTCTAATAA------------------------ATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGGTCTGTT-----CCACAAGAACTCCCCCTTTTTGTTGGGTTGTAATGT-----AAATAGTCCATGATGGAGCTCGAGTAGAA------AAGAAAGTATTCTTTCATTTCTCAGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAAGTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAATTCGAGCAAGTTTC-------CAATTCAAAAGGAAATTCTGTT------GGAATTGATCAAA----CTTTTTCGATCC-----AAAGTGTATGTATCACGCGGAATCAACCGTCCGTAGGATTCTTTGAT----------AGAAAGAAATCAT--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCC---------AATGATTTAAAAAC----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTAAATTGTCTCAATAACTAAAT---CAGATT---------GAAGAATCG-------------AAATAGATTTGAAACGAGACAAAC---AAAAGGGGGT----AAAGACCACTCACTAAAGG--AAATTGCCTAAAGA--TTTTCTTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACTAATG-------------GTTTCTTTTTCA--------------------------------------------GGAAGGAAGAAGAAAATAGA-------TTTCATTAAAT------------AAGAGTCTAATTGATTTGAT-------------GATTTTATGGATTCC---TTTGTCATT------------------------------------------GATTTGAAATCCA--------------TACATAGACAAAACTTCAAATCAA------ATCCTTTTTTCTCG-AGCCGTACGAGGAT-AAAACTTCCTATACGTTTCTA----GGGGGG---- Phacelia_sericea ------GAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---ATTCAGAAAGTGAAAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCGTTGGTCGAGGAATCTTTCCATCGAAACTTCAGAAAGGATGAAGGATAAACGCATATACA--AAT----------G---------------------------------------------------ACGACCCTAATCTGTTC---------------TGTTTTTTTTCATAAAAAAAG------------GAAGAGTTGGTATG-----AATCGATTCCACAT----------TGCAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCACAG-----TCTGATAGATCTTTTGAAGAACTGATTA--------------------ATCGGAC----CAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTCT--------TTGATTCCCGAACCATTTATCCTATAC---CTCTTT---------TCGTTAGCGCGTCC-AAATTCCTTA---GCTTTCTCATTCACTCTATT----------CTTTT-----AGAAACG-----------GATCTGAGCGGAA---------TCT--------TATCACAAGTC----TTGTGAGATA--CGTATTATACACATAAAAATGAACATCTTTGAACAAGGACT----CCCCATTTGAA-----------------TGATTCACAATGA-------------------ATATAATTTC----TCATACTGAAACTTAC-AAAGTTATCTATCTTA--------T-TGAAGATCCAA--GAAATTCCA--------GGACC-------TGGAAAAAA---------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGATCCCAGTCATCTAATAA------------------------ATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGGTCTATT-----CCACAAGAACTCCCCCTTTTTGTTGGGTTCTAATGT-----AAATAGTCCATGATGGAGCTCGAGTAGAA------AAGAAAGTATTAATTCATTTCTCAGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTT-----------GATATAGAAATCG-AAAGAATCCAATTCGAGCAAGTTTC-------CAATTCAAAAGGAAATTCTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTATGTATCACGCGGAATCAACCGTCCGCAGGATTCTTTGAT----------AGAAAGAAATCAT--AAAAAAGGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCC---------AATGATTTAAAAAC----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTAAATTGTCTCAATAACTGAAT---CAGATT---------GAAGAATCA-------------AAATAGATTTGAAACGAGACAAAC---AAAAGGGGGT----AAAGACCACTCACTAAATG--AAATTGCCTAAAGA--TTTTCTTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACTAATG-------------GTTTCTTTTTCA--------------------------------------------GGAAGGAAGAAGAAAAAAGA-------TTTAATTAAAT------------AATAGTCTAATTGATTTGAT-------------GATTTTATGGATTCC---TTTGTCATT------------------------------------------TATTAGAAATCCA--------------TACATAGACAAAACTGCAAATCAA------ATCATTTTTTCTCG-AGCCGTACGAGGAT-AAAACTTCCTATACGTTTCTA----GGGGGG---- Plagiobothrys_congestus ---?????????????????????????????????????????????????????????????????????????????????????????--??????????????????????????????????????????????????????????????????---????????????????????????????????????-???-----------???????????---???-?????????--?----------------------??????????---------------?????T----------------------------------------------------------------------------AAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATACTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAA---TTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCCGACTGGAAACGCCTTTCATT--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGTA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCGGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAT--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAATAATCAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAA----------GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTT---------GTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTATAATTCATTTTAG-------------TATTTTATGGATTCA--TTTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATAATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Plagiobothrys_fulvus -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAC----------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATCAAAATC---------AAATGAAATGATTAATGACT-----AATATA-----------------------GTTTTTATTAAAAAAAA--------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAATG-----------GATCTGGCTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAAT----------GTACAGGGAAT----CCTCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATGTCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCAGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCACTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCGCTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAA-GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-----------------------TATTTTATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Plagiobothrys_humilis -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAC----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATATTT---------------------------------TTATTATTAAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATACTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCA---ATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCCGACTGGAAACGCCTTTCATT--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAAT----------GTACAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCGGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAATAATCAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAA----------GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTT---------GTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTATAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATAATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Plagiobothrys_kunthii -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAC----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATATTT---------------------------------TTATTATTAAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATACTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCA---ATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCCGACTGGAAACGCCTTTCATT--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAAT----------GTACAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCGGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----AGAAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAT--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAATAATCAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAA----------GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTT---------GTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTATAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATAATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Plagiobothrys_linifolius -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATCAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAC----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATATTT---------------------------------TTATTATTAAAAAAAA----------------GAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATACTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCA---ATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCCGACTGGAAACGCCTTTCATT--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAAT----------GTACAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGACCCCGGTCATCTCATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAATAATCAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAA----------GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTT---------GTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTATAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT----------------------------TATTAATATTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATAATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Plagiobothrys_myosotoides ??----????????????????????????????????-?????????????????????????????????????????????????????--??????????????????????????????????????????????????????????????????????---????????????????????????????????????----------------------------------------------------------------------??-----------------?????????---????---????????--?----------------------???--------------------------AAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCAAATATTCATTGATCAAA------GATCAAATCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCT-------------ACATCCCAATGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATTATT-------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATCTTAC------ACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGTA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGA----ACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA----------------------------------TAATTGACATAGAGCCCAGTCATCTCATAAAATA-------AGGATGATACGTTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCAGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTT---------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTAAATTGTCTCAATAACGGAATAATCAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAA----------GGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTT---------GTTAT-----ACAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTATAATTCATTTTAG-------------TATTTTATGGATTCA---TTTTTCATT-------------------TATTAATATTATTAGATTTATTAGATTAGAATTCCATCCA----------TACACAGACAAAACTGCAAACCAA------ATAATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTT----GGGGGGGTAT Pseudomertensia_primuloides ---------------------------------------------------------TGAGCCAAATCC-GATTTTCCGAAAACAAAA-------GTTTAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTACTTTGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATTAA--------TGACT-----AATATATTC------------------TGT-TTTATGAAAAAAAAAAAA--------GAAGAGTTGGTGTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACTGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTTTATCTATTTTAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTATATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACA----------------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACA-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAA-----ATGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTG--GATTGGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTCAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT----TGATGAACTATTTG-----ACAGTTAAGTTATCCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAATTAAAAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTA----------------------------------ATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCTTATACGTTTCTC----GGGGGGGTAT Pseudomertensia_trollii --------------------------------------------------------------------------------------ACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGACTACTTTGCTTTGGTCGAAAAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC--------------------AAA---TTAATGACT-----AATATATTT---------------ATTCTGTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACTGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTTTATCTATTTTAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATTTATT------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACA----------------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACA-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTTATTGACATA?ACCCCAGTCATCTAATAAAATA-------GGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------ATGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTC{AG}AAAGGACATTTTGT--GGATTGGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAT-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACAAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTAAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT----TGATGAACTATTTGACAGTTAAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAATTAAAAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCTTATACGTTTCTC----GGGGGGGTAT Pulmonaria_angustifolia -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTGGAAAAAGAAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAG{CT}TGTTCTAACAAAT---GGAGTTAAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTTTGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACAAAAATTTATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTAGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCGAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAATAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTACATCCCAACGATTTATCCTCTAT---CTATTT---------TTATTAGTGGTTCC-AAATTACTCA---TCTTTCTCATTCACTCTATT----------CTTTT-----ACAAATG-----------------GCCGTAAACGCCTTTCATC--------TGACATAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGGA-----------------------CATCTTTGAACTTG-----------AATGATTCACAATGG-------------------ATATTATTTC----TCAGACTGAAACTTAT-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATAAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCGCAGGAACCTCCC--TTTTTTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATCCATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATCCACAAGGACATTTTGT-------GAAATTGATCAAA----CTTTTTCGATAC----AAAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAT--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTCATAAATACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TTGAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAGGGGGT----AAAGACTACTCAAAAAAG------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTATGAATGAAT---------GGTTTCTCTTTTTTTT-------------------------------------------AAGTAAGAAGAAGGGG---------GTGAATGGAATT-------AAAAAAGAATCTAATTTATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT----------------------------------TATTAGAATATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rindera_caespitosa ?????????????????????????????????????????????????????????????????????-??????????????????????---??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC-----GTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAAA-CC--TTTCA-CATCATC--TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAATTATT------------TACTATACTATGG--------------ATAGGATATCATTTC----TCAAACTGAAACT???-????????????????--------?????????????-??????????--------????????-?--????????????------????????---?????????????????????-????-?????????????????????????????????????????????????????-------?????????????ATGAA-GTTGCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Rindera_graeca ?????????????????????????????????????????????????????????????????????-??????????????????????---???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACATAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCAT?GATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------TTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC-----GTC?ATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACC----AAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACT--------------------GAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTGAC-AAAGTCGTCTTAT-------------TGAAGATCC?A-?GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTGATTG????????????---?????????????????----??-??????????-------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGTA-TTCATTTGTCGGGACAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT----TG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Rindera_lanata ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAAATTAATAAAAA-TGGGCTATCCTGAGCCAAATCC-GGTTTTCCGAAAA----CAAAA---GTTGAAAAATAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAAAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC-----GTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTT-ATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAC--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTATTTAATA--------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATT---------------TCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGAAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------AAATATAAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTG-------AACGGTTTCCTTTTTTCGGA----------------------------------ATCAGAA---GGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Rindera_schlumbergeri -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAATAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC-----GTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCACTAT---CTATTT---------TAGATAGTGGTTCC-A---CCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAG---GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCTATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rindera_tetraspis -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCAAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACTGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCACTAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAAGCCTTTCATCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCA-AAAGAATCCAC---------TTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTACTTTTTTCAGA-------------------------------------ATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT---------------------------TAATTATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rochelia_cancellata ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA-----------------ATTGAA---TACTTTATT---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCGACGATTTCTCCTATAT---CCGTTTTAGTTAT--TAGTTAGTGGTTCC-AAATTCCTCG---T-----CCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAA----------------------------------------------------------------------------TTA----TTTGACTGAAACTTAC-AGAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCCTT-------------------------------------TTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAAAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGTAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACATAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rochelia_cardiosepala ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA-----------------ATTGAA---TACTTTATT---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCGTTTTAGTTAT--TAGTTAGTGGTTCC-AAATTCCTCG---T-----CCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGT---------ATACAAATGAACATCTTTGAACAA----------------------------------------------------------------------------TTA----TTTGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCCTT-------------------------------------TTAATTGACATAGACCCCTGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAAAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGTAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACATAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rochelia_persica AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA-----------------ATTGAA---TACTTTATT---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCGTTTTAGTTAT--TAGTTAGTGGTTCC-AAATTCCTCG---T-----CCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAA----------------------------------------------------------------------------TTA----TTTGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCCTT-------------------------------------TTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAAAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGTAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCATTT-------------------------------------GTCATT------------------------------------------TATTAGAATTCCA--------------TACATAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Rochelia_retorta AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGT-------------GTATATACA-----------------ATTGAA---TACTTTATT---------------AAATAAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACAATTTCTCCTATAT---CCGTTTTAGTTAT--TAGTTAGTGGTTCC-AAATTCCTTG---T-----CCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAA-----------------TTATTTG---------------------------------------------------------------ACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTC-------------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGCGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-------TTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTCGATATAAAAA-GATATAGAAATTG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAC----CACTCGGAATCAGTCGTCCACACGATTCTTTGAT----------AAAAGTAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATA----TGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCT-------TTGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAGGAGTCTAATTCA-------------------------------------TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACATAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Sinojohnstonia_moupinensis -----------------------------------------------------ATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC--------------AAAATCAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATTGATTCCACAT------AGAAGGAAGAAAGAA-----TATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTATCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTATCATTCACTCTATT----GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solenanthus_albiflorus -GT-GACAAC-TTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TA--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG--TTGTTGACATCTCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGAAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAAAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAAATTCCATCCATACCA----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Solenanthus_apenninus -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCACTAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG----------------GACTGAAGCCTTTCATCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAAGTT------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGT----GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTCAGA-------------------------------------ATCAGAAG---GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Solenanthus_atlanticus ????????????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????ACA-------------------------------------------------------T------------------TTATATATA--TTG----------ATATTGAA---TACTTTTTC---------------AAA?GAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAA---------GAAGAGT?GGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAA?ATTCATTGATCAAA-------------TCAT?CACTCCA?AG-----TCTGATAGATCTTT?GAAGAAT?GATTT--------------------CTCGGAC----GAGAA?AAAGA?AGAG?CCCG?TCTACATGTC--------AATACCGGC?ACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAC----CCCCTTTTGAATTATTTACTATTTTGAATTATTTACTATGGATTATTTACTATGGATAGGATATCATT------TCAGACTGAAACTTAC-AAAGTCGTC-----------------TGAAGATCCAACGACAATTACA--------GTACC-------TGGA?????---------????????---???????????????????-----------------------??????????????????????????????????????-------?????????????---------GCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA----------AAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTTTGTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solenanthus_circinatus AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TA--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACA--ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-T?T??GTT---TTATGATGA-----AGCTCG?GTATGATGAA?CTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACTGAAT---CAGATTAAAGTTAAAGAAGAATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solenanthus_coronatus ???????????????????????????TCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAA----CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TA--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAA---------------------------------------------------------TTTA??????-------------------??????????????????????????????-????????????????--------?????????????-??????????--------????????-?--????????????------????????---?????????????????????-????-?????????????????????????????????????????????????????-------?????????????ATGAA-GGTGCTC-TTTGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAG---AAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Solenanthus_hirsutus -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TA--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------GAAAAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCTCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGAAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCT---TTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAAAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Solenanthus_karateginus ??-------------------------TCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAA----CAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------????????-?--????????????------????????---?????????????????????-????-?????????????????????????????????????????????????????-------?????????????ATGAA-G?TGCTC-TT???TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGTA-TTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCA-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGATTTATGAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solenanthus_tubiflorus -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT--ATATATTGATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATAT----------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAC----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCT-----------------GAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAA----------AAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG--AA--GGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTTTGTTGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAG---GAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAATCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Solenanthus_turkestanicus -??????????????????????????????????-????TATAAAATGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TA--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT------ATATTTATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTA---TT-----------TACTATGGATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCC--TCATTAT????????-------??????????---AAGAA-GTTGCTCTTTTGGTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAAAAGAAAAAAGTAGTATTCA----TTTGTCGGGGCAAGGATCTAGGGTTAAT---ACCAATCAATAAATTGAACAACTTCG-----TAAATATAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCTAC---------GTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAT--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Stephanocaryum_olgae ---------------------------------AA-TTAATAA-AAATGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAATAAAAAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA---------CTATATACATTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGA-------CT-----AATATATTC------------------TGTTTTTATGAAAAAAA-------------GAAGAGTTGGTGT--------------ACACAT----------AGAAGAAAGAATCTAATGATCATTGATCAAA-------------TAATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCATTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAGTCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCA-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------TTTTT-----ACAAATG-----------GATCCGACTGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGAA-----------------TGATTCACTATGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAG---------CA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTT----------------------------------CTTTTAATTGACATAGACCCCAGTCATCTATTAAAATA-------AGGATGATACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Suchtelenia_calycina ?GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACACATTT----------GTATTGAA---TACTTT-TC---------------AAATGAAATGATTAATGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------TAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA-----AATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTGA----TTGACATCCGAACAATTTCTCCTATAT---CCATTT---------TAGTTAGTGGTTCC-AAATTCCTCG---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAATG-----------GATCT-----AA-ACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTTAATTTGAA-----------TGATTCACTATGG--------------TATGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTTGTCTTAT-------------TGAAGATCCAA--------------------TACC-------TGGATAAAA---------GTTAGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATATAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCGTTTCTTGGGGCAAGGATCTAGGGTTAAT---GCCAGTCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATACAGAAATCA-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAAGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------CAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CA---T---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAGGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTCT-T-------TGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGGATGGAATT-------AAATAGGAGTCTAA------TTAG-------------TATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Thyrocarpus_glochidiatum -----------------------------------------------TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAAAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTAATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT--GTATTGATGTATTGACAAATACTTTTTA---------------AAATGAAATGATTAATGACT-----AATATATTC-------------------TTTTTTATGAAAAAAGAA-----------GAAGAGTTGGTGTT-----AATTAATCGATTCC------ACATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGAAATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACG--TTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTTAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATA------------------------------CTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Tournefortia_hirsutissima -GT-GATAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---GTTCAGAAAGCAAAAAAA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGGGTTGAC-----TGCATTGGTCGAGGAATCTTTCTATCGAGACTTCAGAAAGGATGAAGGATAAACGTATATACA--TAT----------GTATTCAA---TACTCTATC---------------AAATGAAATGATTAATGACGACCCTAATCTGTTC---------------TGTTTTTTTTATGAAAAAAAAAAAAG-------GAAGAATTGGTGTG-----AATCGATTCCACAT----------TGAAGAAAGAACCGAATATTCATTGATCAAA-------------TCACTCACTCCATAG-----TCTGATAGTTCTTTTGAAGAACTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAG---------------------------------------CAAGTCCCTCTATCCCCAAAAAGACTAT--------TTGATTTCCCAACCATTTATCTTATCC---CTCTTT---------TCGTTAGCGCTTCC-AAATTCCTTA---GCTTTCTTATCCACTCTATT----------CTTTT-----AGAAACG-----------GATCTGAGTGGAAATGCCTTTATCT--------TATCACAAGTC----TTGGGAGATA--CGTACAATACACATCAAAATGAACATCTTTGAACAAGGACT----CCCC--------------------------AGTCACAATTG-------------------ATATCATTTC----TCATACTGAAACTTAC-AAGGTCGTCTTAT-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------TGGATAAAA---------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GG?GCTC-TTGGCTCGACATC---ATTTG?TCTGTT-----CC?CAAGAACTCCCCTTTTTTGT?GGGTTGTAATG?-----AAATAGT?CATGATGGAGCTCGAGTAGAA------AGGAAAGGATTAATTC?TTTCTCGGGGCAAGGATCT?GGGTTAAT---GCTAATCAATAAATTGAACAACTTCG-----------?AAATTTATCTTC-----------GATAT?GAAATCATAAAGAATGAAATTCGAACAAGTTTC-------CAATTCAAAAGG?AATTCTGTT------GAAATTTATCAAA----CTTTTTCGATCC----TAAAGTGTATGTATCACGCGGAATCAATCGTCCGTAGGACTCTTTGAT----------?GAA?GAAATC?C--AAAAAAAGGTATGTTGCTGCC?TTTTGAAAGGATTA?GAAGTACCGAAGTAATGTCTAAACCC---------AATGATTTAAAAC-----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTTAATTGTCTTAATAACTGAAT---CAGATT---------GAAGAATTG-------------AAATAGATTTGAAACGAGACAATC---AAAAGGGGGT----AAAGACCACTCAATAAATG--AAATT--------A--TTTTCCTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATG-------------ATTTCTTTTTCA--------------------------------------------GGAAGGAAGAAGAAAAAAGA-------CTTAAACTTAATT------AAATAATAGTCTAATTGATTTGAT-------------GATTTTATGGATTTC---TTTGTCATT------------------------------------------TATTCGAATTCCA--------------TACATAGACAAAACTTCAAATCAA------ATCAATTTTTCTCG-AGCCGT?CG?GGAT-AAAACTTCC?A?AC?TTCTAT----GGGGG----- Tournefortia_ternifolia -GT-GATAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-TGTTTTCCGAAAACAAAGAAAG---GTTCAGAAAGCAAAAAAG--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGGGTTGAC-----TGCATTGGTCGAGGAATCTTTCTATCGAGACTTCAGAAAGGATGAAGGATAAACGTATATACA--TAT----------GTATTCAA---TACTCTATC---------------AAATGAAATGATTAATGACGACCCTAATCTGTTC---------------TTTTTTTTTTATGAAAAAAAAAG----------GAAGAATTGGTGTG-----AATCGATTCCACAT----------TGAAGAAAGAACCGAATATTCATTGATCAAA-------------TCACTCACTCCATAG-----TCTGATAGTTCTTTTGAAGAACTTATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTAT--------TTGATTTCCCAACCATTTATCTTATCC---CTCTTT---------TCGTTAGCGCTTCC-AAATTCCTTA---GCTTTCTTATCCACTCTATT----------CTTTT-----AGAAACG-----------GATCTGAGTGGAAATGCCTTTATCT--------TATCCCAAGTC----TTGGGAGATA--CGTATGATACACATCAAAATGAACATCTTTGAACAAGGACT----CCCC--------------------------AGTCACAATTG-------------------ATATCATTTC----TCATACTGAAACTTAC-AAGGTCGTCTTAT-------------TGAAGATCCAA--GAAATTCCA--------GGACC-------TGAATAAAA---------CTTTGTAA---TCTTCTTTCATC------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACATTATGAA-GGTGCTC-TTGGCTCGACATC---ATTTGTTCTGTT-----CCACAAGAATT-CCCCTTTTTGTTGGGTTGTAATGT-----AAATAGTACATGATGGAGCTCGAGTAGAA------AGGAAAGGATTAATTCATTTCTCGGGGCAAGGATCTAGGGTTAAT---GCTAATCAATAAATTGAACAACTTCG-----------TAAATTTATCTTC-----------GATATAGAAATCATAAAGAATGAAATTCGAACAAGTTTC-------CAATTCAAAAGGAAATTCTGTT------GGAATTTATCAAA----CTTTTTCGATCC----TAAAGTGTATGTATCACGCGGAATCAATCGTCCGTAGGACTCTTTGAT----------AGAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAGTACCGAAGTAATGTCTAA?CCC---------AATGATTTAAAAC-----AAAGATA------AAGGATCCCAG-AACAAGGAAACGCCAT----------------TTTAATTGTCTTAATAACTGAAT---CAGATT---------GAAGAATTG-------------AAATAGATTTGAAACGAGACAATC---AAAAGGGGGT----AAAGACCACTCAATAAATG--AAATTGCCTCAAGA--TTTTCCTT-------TGAGCTATTTG-----ATAGTTAT-----CCAACTTGAGTTATGAGTACGAATG-------------ATTTCTTTTTCA--------------------------------------------GGAAGGAAGAAGAAAAAAGA-------CTTAAACTTAATT------AAATAATAGTCTAATTGATTTGAT-------------GATTTTATGGATTTC---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACATAGACAAAACTTCAAATCAA------ATCAATTTTTCTCG-AGCCGTACGAGGAG-AAAACTTCCTATACGTTTCTA----GGGGGGGTA- Trachelanthus_cerinthoides ---------------------------------------------A-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGAAA-------GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TATATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTATTGT----------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTATTG-------------------------------------------------ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------GTTTC-------CAATTCAAAAGGACATTTTGTG----AAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAAGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATATAAATAGATTTGAAAAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT---TGAACGAACTATTTG-----ACAGTTAT-----CCAACTTGAGTTATGAGTACGAATGAACTGAAC----GGTTTCCTTTTTTC-------------------------------------AGAATCAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTGTCATT-------------------------------TATTAATATTAGATTAGAATTCCATCCATACCA-----TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trachelanthus_hissaricus ???????????????????????????TCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCAAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TG--------GAAGAATCTTTCTCATAAATCA---TAAAGTGTGGTG---AAA-GTATATACA--TTT----------ATATTGAA---TACTTTTTC---------------AAATGAAA-------TGACT-----AATATATTC------------------TGTTTTTATGAAAAAA--------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----AGAAATAGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTT--------------------CTCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTATTTG-----TTGACATCCCAAC----TCTCCTATAT---CTATTT---------TAGATAGTGGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----AGAAACG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCC--TCATTAT????????-------??????????----------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGG---GTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTAGT-ATTCATTTGTCGGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCAC---------TTTTC-------CAATTCAAAAGGACATTTTGTT---GAAGGAATTGAGCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC--AAAAAAGATA------AAGGATTTTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTAAAGTTAAAGAAGAATAT---------AAATAAATAGATTTGAAACGAGACAAAC--AAAAAAGGAGT----AAAGACTACTCAATAAAT------------AAAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trachystemon_orientalis -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAAAAAAA--TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAACAAAA---GTGGAAAAATAAAAAAGA--------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------TTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACTACCAAAATTTATTC------------------TGTTTTTGTGAAAAAAA-------------GAAGAGTTGGTCTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTTACATCCCAACGATTTCTCCTCTAT---CTATTT---------TCATTAGTGGTTCA-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------CTTTT-----ACAAATGGAT--------GATCTGGCCGGAAACGCCTTTCATC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----TTCCTTGTGAATTTGAA-----------TGATTCACAATGG-------------------ATATAATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------CGGATAAAA--------------------TATTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACACC---ATTTGTTCTGTT-----CCGCAGGAACCTCCC--TTTTGTTGGGTTGTAATGT-----AAATAGTGCATGGTGAAGCTCGAGTAAAA------AAGAAAGTATTCATTCATTTCTCGGGGCAAAGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTT-------CAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC----CAAAGTGTAT----CACTCGGAATCAGTCGTCCATAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAATATCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACGCCTT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATCT-------------AAATAGATTTGAAACGAGACAAAC---AAAAGGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTA-----ACAGTTAT-----CCAACTTGAGTTATGAGTACAAATGAAT---------GGTTTCCTTTTTTTTT--------------------------------------------AGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATTTTAG-------------GATTTTATGGATTCA---TTTGTCATT------------------------------------------TATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTA---GGGGGGGGTAT Trichodesma_africana -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCATAAAG-----TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTT-------------------TTTTTTATGAAAAAAAA------------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------ATAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTCTTCTTTTC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGATTGAATTTGAA-------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--TAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTTATAAAATA-------AGGATGA-ACATTATGAA-GGTGCTC-TTCGTTCGACATC---ATTTGTTCTGTT-----CCACAGGA-CCCCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTCCAATTCACAATTCAAAAGGA{AC}ATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACGATTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------A----GAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTATTA-G------------------------------------------AATTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trichodesma_calcaratum ??-????????TTC-AATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTT--------------------TTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCTTC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGATTGAATTTGAA-------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTTATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGTTCGACATC---ATTTGTTCTGTT-----CCACAGGGACTCCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GTCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTCCAATTCACAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAATGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACGATTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------A----GAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTATTA-G------------------------------------------ATTTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trichodesma_calycosum -??????????????????????????????????-?????????A-TGGGCAATCCTGGGCCAAATCT-GGTTTTCTGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCCATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTT------------------TT-TTTTATGAAAAAAAAAA----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCTTC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CACC?TTTGATTGAATTTGAA-------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TG???????????--???????????---????????????------------------------------?????????????????????????????????????----------------------------------------TCGACATC---ATTTGTTCTGTT-----CCACAGGGACCTCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTCCAATTCACAATTCAAAAGGACATTTTGTT------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGACCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATT---------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AA-G{AG}CTACTCA-TAAAT------------AAAGA---TTTTCTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichodesma_physaloides -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATATATTT------------------T-TTTTTATGAAAAAAAAA-----------GAAGAGTTGGTGTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCTTC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CCCCTTTTGATTGAATTTGAA-------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATACAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTTATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGTTCGACATC---ATTTGTTCTGTT-----CCACAGGGACCTCCCCTTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTCCAATTCACAATTCAAAAGGACATTTTGT-------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTA---------AAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACGATTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTATTAGA------------------------------------------T-TTAGAATTGCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trichodesma_zeylanicum -GT-GACAACTTTCAAATTCAGAGAAACCCTGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCT-GGTTTTCCGAAAACAAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAAT---GGAGTTGAC-----TGCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTATATACA--TTT----------GTATTGAA---TACTTTATC---------------AAATGAAATGATTAATGACT-----AATCTATTT------------------T-TTTTTAGGAAAAAAAAA-----------GAAGAGTTGGTTTT-----AATCGATTCCACAT----------AGAAGAAAGAGTCGAGTATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTGAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCA-AAATTCCTCA---TCTTTCTCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATCTGACTGGAAACGCCTTTCTTC--------TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAACATCTTTGAACAAGGAAT----CACCTTTTGATTGAATTTGAA-------TGATTCACTGTGG-------------------ATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA------------------------------CTTTTAATTGACATAGACCCCAGTCATCTTATAAAATA-------AGGATGATACATCATGAA-GGTGCTC-TTCGTTCGACATC---ATTTGTTCTGTT-----CCACAGGGACCTCCC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTAATTCATTTCTCGGGGCAAGGGTCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTCCAATTCACAATTCAAAAGCT---------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAAGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAATATA------AAGGATCCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAAT---CAGATTA---------AAGAATAT-------------AAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAT------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACGATTAT-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA-------------------------------------------AGAAGGAAGAAGAAAAGG---------TTGAATGGAATT-------CAATAAGAGTCTAATTCATTTTAG-------------TATTTTATGGATTCA---TTTA-------------------------------------------------TTAGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trigonocaryum_involucratum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAATT?--TT--------------------TCTCAGC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCAAGTCCCTCTATC?CCAAAA-GCCTATTTG-----TTGACAT?CCAACGATTTCTCCTATAT---CTATTT---------TAGATAGTAGTTCC-AAATCCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAA?CG-----------GATCTGACTGAA---GCCTTTCATCATC-----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGCA----------CAGGGAAT----CCCCTTTTGAA-----------------TTATTTACTATGG--------------ATAGGATATCATTTC----TCAGACTGAAACTTAC-AAAGTCGTCTTAT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTAATATTTAATA-----------------------CTTTTAATTGACATAGACCCCAGTCATCTAATAAAATT-------AGGATGATACA--ATGAA-GTTGCTC-TTTGGTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA----------AAGTATTCA----TTTCTCAGGGCAAGGATCTAGGGTTAAT---GCCAATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAAAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGAC--------------GGAATTGATCAAA----CTTTTTCGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTTTGAT----------AAAAGGAAATCAC---AAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAAC-----AAAGATA------AAGGATTCTAG-AACAAGGAAACACTAT----------------TTTAATTGTCTCAATAATGGAAT---CAGATT---------AAAGAATCT-------AAATCTAAATAGATTTGAAACGAGACAAAC--AAAAAAGGGGT----AAAGACTACTCAATAAAA------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAAGTTATCCAACTTGAGTTATGAGTAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trigonotis_amblyosepala AGT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTACA------TTT----------GTATTGAA---TACTTTATC---------------ATATCAAATGATTAATTACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAA----------GAAGAGTTGGTTTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCTCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATTTGACTGGAAACGCCTTTCATCCATC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATACTTT--------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----ACATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAA-------AATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG------------TTGATCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCT-------------------TGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAATAAAACAAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG------------------AAAAAAGAATAT-------------AAATAGATTTGAAACGAGACAAACAAAAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA----------------------------AGAATATAAGAA-TAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTTGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trigonotis_formosana -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTACA------TTT----------GTATTGAA---TACTTTATC---------------ATATCAAATGATTAATTACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTTTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATTTGACTGGAAACGCCTTTCATCCATC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATACTTT--------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAA-------AATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG-------------TGATCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCT-------------------TGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAATAAAACAAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------------------AAAAAGAATAT-------------AAATAGATTTGAAACGAGACAAACAAAAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA----------------------------AGAATATAAGAA-TAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTTGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trigonotis_guilielmi -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGAAAACAAAA-------GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTACA------TTT----------GTATTGAA---TACTTTAT--------------------CAAATGATTAATTACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAA-----------GAAGAGTTGGTTTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCGATT----------GTTTT-----ACAAACG-----------GATTTGACTGGAAACGCCTTTCATCCATC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATACTTT--------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAA-------AATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG-------------TGATCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCT-------------------TGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAATAAAACAAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------------------AAAAAGAATAT-------------AAATAGATTTGAAACGAGACAAACAAAAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA----------------------------AGAATATAAGAA-TAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTTGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trigonotis_jinfoshanica -GT-GACAACTTTCAAATTCAGAGAAACCCCGGAA-TTAATAAAAA-TGGGCAATCCTGAGCCAAATCC-GGTTTTCCGA----AAACAAAA---GTTGAAAAAGAAAAAA----------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTACA------TTT----------GTATTGAA---TACTTTATC---------------ATATCAAATGATTAATTACT-----AATATATTC------------------TGTTTTTATGAAAAAAAAAAA---------GAAGAGTTGGTTTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCTCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATTTGACTGGAAACGCCTTTCATCCATC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGAA----------CA------------------------------------------------------------------------------------------------------------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATACTTT--------------------------CTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACATTATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----ACATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAA-------AATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG-------------TGATCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCT-------------------TGAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAATAAAACAAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGG-------------------AAAAAGAATAT-------------AAATAGATTTGAAACGAGACAAACAAAAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTA----------------------------AGAATATAAGAA-TAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAA----------------------------------TTCA---TTTGTCATT------------------------------------------TATTTGAATTCCA--------------TACACAGACAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT Trigonotis_peduncularis ---------------------------------------------------------------------------------------------------------------------------------GCAGAGACTCAATGGAAGCTGTTCTAACATAT---GGAGTTGAC-----TCCTTTGGTCGAAGAATCTTTCTCA----------TAAAGTGTGAAA-------GTACAT------TT----------GTATTGAA---TACTTTATC---------------ATATCAAATGATTAATTACT-----AATATATTC------------------TGTTTTTATGAAAAAAAA------------GAAGAGTTGGTTTT-----AATTGATTCCACAT----------AGAAGAAAGAATCGAATATTCATTGATCAAA-------------TCATTCACTCCATAG-----TCTGATAGATCTTTTAAAGAATTGATTA--------------------ATCGGAC----GAGAATAAAGATAGAGTCCCGTTCTACATGTC--------AATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAA----AAATCGTGAGGGTTCGAGTCCCTCTATCCCCAAAA-GCCTAT--------TTGACATCCCAACGATTTCTCCTATAT---CTATTT---------TAGTTAGTGGTTCC-AAATTCCTCA---TCTTTATCATTCACTCTATT----------GTTTT-----ACAAACG-----------GATTTGACTGGAAACGCCTTTCATCCATC----TTACACAAGTC----TTGTGAGATA--CGTATGATACACATACAAATGA---------------------------------------------------------------------------------------------------------------AC-A------TCTTTT-------------TGAAGATCCAA--GAAATTACA--------GTACC-------TGGATAAAA---------GTTGGTAA---TCTTCTTTCATA--------------------------CTTTCTTTTTATTGACATAGACCCCAGTCATCTAATAAAATA-------AGGATGATACA--ATGAA-GGTGCTC-TTCGCTCGACATC---ATTTGTTCTGTT-----CCACAGGAACCTCTC-TTTTTGTTGGGTTGTAATGT-----AAATAGTGCATGATGAAGCTCGAGTAAAA------AAGAAAGTATTCA----TTTCTCGGGGCAAGGATCTAGGGTTAA-------AATCAATAAATTGAACAACTTCG-----------TAAATATATCTTC-----------GATATAGAAATCG-AAAGAATCCACTTCGAGCAAGTTTC-------CAATTCAAAAGGACATTTTG-------------TGATCAAA----CTTTTTTGATAC-----AAAGTGTAT----CACTCGGAATCAGTCGTCCACAGGATTCTT-------------------GAAATCAC--AAAAAAAGGTATGTTGCTGCCATTTTGAAAGGATTAAGAAACACCGAAGTAATGTCTAAACCT---------AATGATTTAAAATAAAACAAAGATA------AAGGATTCTAG-AACAAGGAAACACCAT----------------TTTAATTGTCTCAATAACGGAA-------------------AAAGAATAT-------------AAATAGATTTGAAACGAGACAAACAAAAAAAGGGGGT----AAAGACTACTCAAT----------------AAAGA--TTTTTCTT-------TGAACTATTTG-----ACAGTTAG-----CCAACTTGAGTTATGAGTACGAATGAAC---------GGTTTCCTTTTTTAAGAAT-----------------------------------ATAAGAAGGAAGAAGAAAAGG---------GTGAATGGAATT-------AAATAAGAGTCTAATTCATT-------------------------------------TGTCATT------------------------------------------TATTTGAATTCCA--------------TACACAGATAAAACTTCAAACCAA------ATCATTTTATCTTG-AGCCGTACGAGGAA-AAAACTTCCTATACGTTTCTC----GGGGGGGTAT ; END; BEGIN SETS; CHARSET LF (CHARACTERS = Cynoglossoideae) = 1-1208; CHARSET Rps16 (CHARACTERS = Cynoglossoideae) = 1209-2320; END; BEGIN TREES; TITLE Cynoglossoideae_RaxML; LINK TAXA = Taxa1; TRANSLATE 1 Actinocarya_tibetica, 2 Amblynotus_rupestris, 3 Amsinckia_calycina, 4 Amsinckia_menziesii, 5 Amsinckia_tessellata, 6 Amsinckia_vernicosa, 7 Anchusa_formosana, 8 Antiotrema_dunianum, 9 Antiphytum_floribundum, 10 Antiphytum_hintoniorum, 11 Arnebia_decumbens, 12 Arnebia_linearifolia, 13 Asperugo_procumbens, 14 Austrocynoglossum_latifolium, 15 Borago_officinalis, 16 Bothriospermum_kusnetzowii, 17 Bothriospermum_tenellum, 18 Brunnera_macrophylla, 19 Buglossoides_incrassata, 20 Caccinia_macranthera, 21 Cerinthe_majus, 22 Cordia_decandra, 23 Cordia_monoica, 24 Cryptantha_decipens, 25 Cryptantha_granulosa, 26 Cryptantha_johnstonii, 27 Cryptantha_paradoxa, 28 Cryptantha_peruviana, 29 Cryptantha_pterocarya, 30 Cynoglossum_amabile, 31 Cynoglossum_amplifolium, 32 Cynoglossum_australe, 33 Cynoglossum_clandestinum, 34 Cynoglossum_columnae, 35 Cynoglossum_creticum, 36 Cynoglossum_dioscoridis, 37 Cynoglossum_germanicum, 38 Cynoglossum_grande, 39 Cynoglossum_hispidum, 40 Cynoglossum_hungaricum, 41 Cynoglossum_montanum, 42 Cynoglossum_nebrodense, 43 Cynoglossum_occidentale, 44 Cynoglossum_officinale, 45 Cynoglossum_paniculatum, 46 Cynoglossum_spelaeum, 47 Cynoglossum_sphacioticum, 48 Cynoglossum_suaveolens, 49 Cynoglossum_troodi, 50 Cynoglossum_virginianum, 51 Dasynotus_daubenmirei, 52 Echiochilon_fruticosum, 53 Echium_acanthocarpum, 54 Echium_creticum, 55 Echium_vulgare, 56 Ehretia_anacua, 57 Ehretia_cortesia, 58 Embadium_stagnense, 59 Embadium_uncinatum, 60 Eremocarya_micrantha, 61 Eritrichium_aretioides, 62 Eritrichium_canum, 63 Eritrichium_nanum, 64 Eritrichium_pamiricum, 65 Eritrichium_pectinatociliatum, 66 Eritrichium_sericeum, 67 Eritrichium_thymifolium, 68 Glandora_nitida, 69 Gyrocaryum_oppositifolium, 70 Hackelia_andicola, 71 Hackelia_bella, 72 Hackelia_deflexa, 73 Hackelia_floribunda, 74 Hackelia_revoluta, 75 Hackelia_sharsmithii, 76 Hackelia_velutina, 77 Harpagonella_palmeri, 78 Heterocaryum_subsessile, 79 Huynhia_pulchra, 80 Johnstonella_angustifolia, 81 Lappula_alatavica, 82 Lappula_anocarpa, 83 Lappula_balchaschensis, 84 Lappula_brachycentra, 85 Lappula_cenchrusoides, 86 Lappula_consanguinea, 87 Lappula_duplicicarpa, 88 Lappula_intermedia, 89 Lappula_lasiocarpa, 90 Lappula_lipsky, 91 Lappula_marginata, 92 Lappula_microcarpa, 93 Lappula_myosotis, 94 Lappula_occidentalis, 95 Lappula_occultata, 96 Lappula_patula, 97 Lappula_semiglabra, 98 Lappula_sessiliflora, 99 Lappula_spinocarpa, 100 Lappula_squarrosa, 101 Lappula_stricta, 102 Lappula_tadshikorum, 103 Lappula_tenuis, 104 Lappula_texana, 105 Lasiocaryum_densiflorum, 106 Lasiocaryum_munroi, 107 Lepechiniella_microcarpa, 108 Lindelofia_anchusoides, 109 Lindelofia_longiflora, 110 Lindelofia_stylosa, 111 Lithospermum_macbridei, 112 Lithospermum_officinale, 113 Lithospermum_persicum, 114 Mairetis_microsperma, 115 Memoremea_scorpioides, 116 Mertensia_ciliata, 117 Mertensia_davurica, 118 Mertensia_lanceolata, 119 Mertensia_maritima, 120 Mertensia_sibirica, 121 Metaeritrichium_microuloides, 122 Microparacaryum_intermedium, 123 Microula_blepharolepis, 124 Microula_diffusa, 125 Microula_floribunda, 126 Microula_muliensis, 127 Microula_myosotidea, 128 Microula_oblongifolia, 129 Microula_ovalifolia, 130 Microula_pustulosa, 131 Microula_sikkimensis, 132 Microula_stenophylla, 133 Microula_tibetica, 134 Microula_trichocarpa, 135 Microula_turbinata, 136 Microula_younghusbandii, 137 Moltkia_petraea, 138 Moritzia_lindenii, 139 Myosotidium_hortensia, 140 Myosotis_alpestris, 141 Myosotis_caespitosa, 142 Myosotis_incrassata, 143 Myosotis_macrosperma, 144 Myosotis_sparsiflora, 145 Myosotis_stenophylla, 146 Myosotis_stolonifera, 147 Nihon_japonicum, 148 Nonea_caspica, 149 Omphalodes_akiensis, 150 Omphalodes_aliena, 151 Omphalodes_alienoides, 152 Omphalodes_brassicifolia, 153 Omphalodes_cappadocica, 154 Omphalodes_cardiophylla, 155 Omphalodes_caucasica, 156 Omphalodes_commutata, 157 Omphalodes_kuzinskyanae, 158 Omphalodes_linifolia, 159 Omphalodes_littoralis, 160 Omphalodes_nitida, 161 Omphalodes_verna, 162 Omphalolappula_concava, 163 Onosma_rhodopea, 164 Oreocarya_flavoculata, 165 Oreocarya_suffruticosa, 166 Paracaryum_ancyritanum, 167 Paracaryum_cappadocicum, 168 Paracaryum_laxiflorum, 169 Paracaryum_polycarpum, 170 Paracaryum_racemosum, 171 Paracaryum_rugulosum, 172 Pardoglossum_cheirifolium, 173 Pardoglossum_watieri, 174 Pectocarya_lateriflora, 175 Pectocarya_penicillata, 176 Pectocarya_setosa, 177 Pentaglottis_sempervirens, 178 Phacelia_campanularia, 179 Phacelia_sericea, 180 Plagiobothrys_congestus, 181 Plagiobothrys_fulvus, 182 Plagiobothrys_humilis, 183 Plagiobothrys_kunthii, 184 Plagiobothrys_linifolius, 185 Plagiobothrys_myosotoides, 186 Pseudomertensia_primuloides, 187 Pseudomertensia_trollii, 188 Pulmonaria_angustifolia, 189 Rindera_caespitosa, 190 Rindera_graeca, 191 Rindera_lanata, 192 Rindera_schlumbergeri, 193 Rindera_tetraspis, 194 Rochelia_cancellata, 195 Rochelia_cardiosepala, 196 Rochelia_persica, 197 Rochelia_retorta, 198 Sinojohnstonia_moupinensis, 199 Solenanthus_albiflorus, 200 Solenanthus_apenninus, 201 Solenanthus_atlanticus, 202 Solenanthus_circinatus, 203 Solenanthus_coronatus, 204 Solenanthus_hirsutus, 205 Solenanthus_karateginus, 206 Solenanthus_tubiflorus, 207 Solenanthus_turkestanicus, 208 Stephanocaryum_olgae, 209 Suchtelenia_calycina, 210 Thyrocarpus_glochidiatum, 211 Tournefortia_hirsutissima, 212 Tournefortia_ternifolia, 213 Trachelanthus_cerinthoides, 214 Trachelanthus_hissaricus, 215 Trachystemon_orientalis, 216 Trichodesma_africana, 217 Trichodesma_calcaratum, 218 Trichodesma_calycosum, 219 Trichodesma_physaloides, 220 Trichodesma_zeylanicum, 221 Trigonocaryum_involucratum, 222 Trigonotis_amblyosepala, 223 Trigonotis_formosana, 224 Trigonotis_guilielmi, 225 Trigonotis_jinfoshanica, 226 Trigonotis_peduncularis; TREE tree_1 = [&R] (((56:0.01325983716000001,57:0.05332194989):0.008697835013000005,((211:0.008792981625000001,212:0.005841920096999992):0.03690425367,((23:0.02760949868000001,22:0.014576993360000012):0.01761271922999999,(178:0.031553515549999994,179:0.01874876298):0.02558174602999999):0.0026719589310000014):0.0031719718240000028):0.054997508249999986,((55:0.02815218941,(10:0.008550544559999984,9:0.003551460458999983):0.011490055080000006):0.009997071234999988,(((138:0.028313224379999974,(215:0.00891238349700002,(18:0.016302257459999997,((7:0.03978102546000001,15:0.03962226097000002):0.001801043888999987,(177:0.018079932270000015,(188:0.019912375580000002,148:0.021933686000000008):0.018890879050000003):8.24445799500001E-4):0.001820837359000016):1.00000049998994E-6):0.01067631299000002):0.01006205402999999,(137:0.017597672169999995,((21:0.027139725500000017,114:0.03093752899000002):0.0016172947900000012,((68:0.005492465815000014,(19:0.01939691649,(111:0.004015294964999999,(112:8.361447141000122E-4,113:0.004022368427000017):1.00000049998994E-6):0.0027099195889999927):7.912486703000043E-4):0.00596840201099999,((12:0.0032154290949999997,11:1.00000050001769E-6):0.014679430739999999,(79:0.007628207041000007,(163:0.02081948826999999,(52:0.010542276820000002,(54:0.004294758997999998,53:0.0013089710969999974):0.0013165155960000036):0.029982999379999986):0.0019412750649999977):7.051140440000048E-4):8.475486149999989E-4):8.736531416000115E-4):1.00000049998994E-6):0.025015272189999993):0.003224738704000002,(((105:9.305866083999942E-4,106:0.0019498160900000006):0.062247144000000004,(20:0.011723812349999974,(216:0.005693734078000001,(217:0.0030632166660000126,(219:0.002814450097999993,(220:0.007242371255999996,218:0.004412272229000008):9.797224273999927E-4):0.0013602174710000137):0.001032816217999999):0.010108794749999983):0.008759891107000012):0.0025541383129999984,(((((208:0.01603799233,115:0.015903445109999997):0.014681443510000003,(13:0.021646812860000003,(116:0.006843429181000005,(119:0.008983735475000004,(120:0.002210647177000008,(118:0.003491251264999995,117:0.0030147831180000195):0.004063151916999991):0.0018320029289999873):1.00000049998994E-6):0.00801860348400002):0.0037238512459999984):0.0017824801149999847,((161:0.003312182274000014,160:0.004377576271000022):1.00000049998994E-6,((156:0.00267753090899997,((158:1.00000049998994E-6,157:0.02449972266):1.00000049998994E-6,(152:1.00000050001769E-6,159:1.00000050001769E-6):0.004728366044999988):8.873725422000045E-4):0.008745141002000023,(45:0.002968218023999991,((155:8.083169600999751E-4,153:0.008419510365999971):0.007600925684000004,(139:0.011917419819999997,(150:0.003926220115999995,(151:0.010259001649999988,154:0.011203316359999993):1.00000050001769E-6):0.011946783339999989):0.0013760484929999928):8.793123552000015E-4):1.00000050001769E-6):0.0012387397049999915):0.006706287696999991):1.00000050001769E-6,(69:0.030631685019999993,((78:0.01764273942000001,209:0.0035695338190000203):0.01267194411,(((72:1.00000050001769E-6,70:8.766198470000208E-4):8.67193792099985E-4,(76:0.007937991419000007,(48:0.0026369640020000307,(73:0.002648083539000007,(74:0.010283768589999992,(14:1.00000049998994E-6,(75:0.001841412232999995,(71:1.00000050001769E-6,(59:1.00000050001769E-6,58:0.00434896707900001):0.008822891755999984):1.00000050001769E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000050001769E-6):1.00000050001769E-6):1.00000049998994E-6):9.757566644000015E-4):0.0058666997690000056,((((2:0.008892142140000003,66:1.00000050000382E-6):0.008918889442999997,(63:0.004245058386000006,61:1.00000049998994E-6):0.007496970810000003):0.003170979471000007,(62:0.0037899541669999953,(67:1.00000050001769E-6,(91:1.00000050001769E-6,(64:0.002829582903999983,65:0.01908584387999998):1.00000050001769E-6):1.00000050001769E-6):1.00000049998994E-6):0.009249990507000011):0.0012986222799999947,((99:0.0013113028839999985,83:0.005321742727999984):0.0013042609479999856,((90:1.00000049998994E-6,(98:0.004600383693000018,(194:0.0017569331360000051,(196:1.00000050001769E-6,(195:8.842511766000011E-4,197:0.0030324219879999947):1.00000050001769E-6):1.00000049998994E-6):0.0033839729370000182):0.006720545677999984):0.0011394397410000034,(((97:1.00000050001769E-6,(87:1.00000050001769E-6,89:1.00000050001769E-6):1.00000050001769E-6):0.0017722384130000046,((92:1.00000050001769E-6,102:1.00000050001769E-6):8.783155820999977E-4,(95:1.00000050001769E-6,(81:1.00000049998994E-6,84:1.00000049998994E-6):1.00000050001769E-6):1.00000050001769E-6):9.154601758999958E-4):0.0018275588660000008,(162:0.004854531300999998,(86:1.00000049998994E-6,(82:1.00000050001769E-6,(103:1.00000050001769E-6,(88:8.599072731999835E-4,(85:1.00000049998994E-6,(96:1.00000050001769E-6,(101:1.00000050001769E-6,(93:1.00000049998994E-6,(100:1.00000049998994E-6,(104:0.0036265376469999944,94:1.00000050001769E-6):9.125328218999862E-4):1.00000049998994E-6):1.00000050001769E-6):1.00000050001769E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000050001769E-6):1.00000050001769E-6):1.00000049998994E-6):9.766030824999994E-4):1.00000050001769E-6):0.002338068258999987):1.00000049998994E-6):0.0012431802400000302):0.005203377562999989):0.007796441867000015):0.007598210375999975):0.0018093001640000217):0.0019170348269999804,(((198:0.029123447100000005,((224:0.001757411665,226:9.981872090999988E-4):1.00000050000382E-6,(223:1.00000050000382E-6,(222:1.00000050000382E-6,225:1.00000050000382E-6):0.0017408117580000049):1.00000050000382E-6):0.009147163808):0.007658588396999996,((187:0.007936069556,186:0.005072881166000007):0.010656826640000006,(140:0.035975704750000004,(144:0.013904427809999995,(145:0.03271610157,((143:0.014734329280000014,142:0.004786195599000009):0.008720753723000005,(146:0.0047032763499999936,141:0.017029959559999988):0.006678588402000002):0.0024657162410000044):0.0016492602339999995):0.007719505121999995):0.017933033020000003):0.006685521301999994):0.01401941311999999,((((31:0.017541952249999992,(39:0.0033551482769999946,46:0.007431836597999994):0.001444675248000002):0.018637048390000008,(121:0.012747135689999994,((133:0.031599112979999996,1:0.007208272954999997):0.002314252128999994,(136:0.02465032687999999,((124:0.02666788933,(125:0.007069535909000002,132:0.008620218590000006):0.0036105871329999983):1.00000050000382E-6,((131:0.012703848260000011,128:0.007157169974999988):0.007109271244999993,((129:0.006220304035999991,127:1.00000049998994E-6):0.008867282413,((135:0.004948866274000013,126:0.004154467799):0.001005452657,(130:0.013522397810000003,(134:8.019468513000005E-4,123:0.007245143494999995):1.00000049998994E-6):0.0029665356059999926):0.0010029801989999976):0.003022007910999991):1.00000050000382E-6):0.005457300553999997):0.003205754098999994):1.00000050000382E-6):0.01925479193):0.004156989025000002,((38:0.005803674546999996,(43:0.0017175586329999937,50:8.497910503000028E-4):0.007030075923999998):1.00000050000382E-6,(51:0.014647977209999996,((29:0.009701475481000005,(60:0.03405239705,((28:0.01552174894000001,(174:0.0054450101380000004,175:0.005382710417000003):0.011718976330000005):7.544296044000032E-4,((24:0.037991560199999996,80:0.013082426940000003):6.601215447999964E-4,(27:0.0015996999820000052,(26:7.977917941000001E-4,(164:0.002398119774999999,165:0.009248955556):1.00000050000382E-6):1.00000050000382E-6):0.001675417791):1.00000050000382E-6):7.842034549999932E-4):0.0031445163609999938):1.00000050000382E-6,((77:0.01631704550999999,176:0.016785483950000013):7.98692982299995E-4,(((5:0.00835205311199999,6:0.003782029414999999):0.0090449388,(4:1.00000049998994E-6,3:0.005695549585999993):0.006551901409000013):0.007576597815999994,(25:0.06105276976,(181:0.010945958420000013,(185:0.007140051408999995,((184:1.00000049998994E-6,182:1.00000049998994E-6):1.00000049998994E-6,(180:9.860004610000028E-4,183:0.0016526142839999869):8.113805196000023E-4):0.007316299892999992):0.004917305041000006):0.005201917893999999):1.00000050000382E-6):1.00000050000382E-6):0.008221903227999997):0.002020346667999995):0.006186702645):0.005968473991000006):0.00977901690199999,(((149:0.006791869423000002,147:0.010733277210000003):0.012876113509999995,(16:0.006480889811999999,(17:1.00000050000382E-6,(8:0.004770974466,210:0.017264302309999993):1.00000050000382E-6):0.007705427752000005):1.00000050000382E-6):0.009800533836999997,(221:0.028468983089999997,((122:0.0038903788850000037,((32:0.002590987180000004,30:0.0015501781249999957):0.0031171516419999934,((203:1.00000050000382E-6,(189:0.007871111491000005,207:0.009555741737999987):0.0017284780790000065):0.0034675297949999934,(108:0.004832935388000004,(107:0.012548403700000002,(214:0.006406727389,(205:0.0014335586530000027,(190:0.016466587370000008,201:0.007839570864):1.00000050000382E-6):1.00000050000382E-6):0.004374543435000003):0.006220564082999994):9.462806612000052E-4):0.0024006723440000016):1.00000050000382E-6):0.003012008923999998,(109:0.002672383841999998,((191:0.017988422990000003,(173:0.00569003573900001,172:0.01994507411999999):0.005554424894999993):0.0037095024549999994,(34:7.551198082999949E-4,((41:0.0022321353179999975,(193:0.004940715747000002,200:1.00000049998994E-6):0.004322279724000011):0.001552961936999997,(44:1.00000050000382E-6,((49:7.521683489000036E-4,35:1.00000050000382E-6):7.492478831000043E-4,(42:0.003977120697,((170:0.003933279702999989,168:0.007381107117000005):7.269515537999954E-4,(202:0.009119455855000014,(110:0.00302310751599999,(37:7.549401725999993E-4,((171:0.002224023614999987,(166:1.00000049998994E-6,167:7.394927709999943E-4):1.00000049998994E-6):7.383575632000094E-4,((169:0.002958969356999991,192:0.0015146484130000026):0.001467961005999996,(206:0.0015179255299999916,((40:7.628164071999954E-4,33:0.00392593055599999):7.730343117000049E-4,((204:7.530190462000097E-4,199:0.007800956447999996):0.0030906777730000112,(213:0.005024192902000013,(47:0.004726373350000007,36:0.0048264668249999865):1.00000049998994E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000049998994E-6):1.00000049998994E-6):0.0010494900899999937):0.001024817468000011):0.004258137632000003):1.00000050000382E-6):1.00000050000382E-6):1.00000050000382E-6):1.00000050000382E-6):1.00000050000382E-6):0.009490937418):0.0038149579169999975):0.0022326191100000004):0.010756679429999999):0.008623951116999998):0.0043720773649999906):0.020014724890000002):0.017088901510000004):0.0076188589560000075):0.009136220604999995):0.005884710836000007):0.05499750825); END;