#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:04 GMT TreeBASE (cc) 1994-2008 Study reference: Yamamoto K., Ohmae M., & Orihara T. 2019. Metarhizium brachyspermum sp. nov. (Clavicipitaceae), a new species parasitic on Elateridae from Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S24184] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Metacordyceps_taii_CQM1 Metarhizium_alvesii_CG1123 'Metarhizium anisopliae ARSEF_7487' Metarhizium_baoshanense_BUM63.4 Metarhizium_baoshanense_CCTCCM2016589 'Metarhizium brunneum ARSEF_2107' Metarhizium_campsosterni_HMIGD20884 Metarhizium_campsosterni_HMIGD20885 'Metarhizium guizhouense ARSEF_5714' 'Metarhizium guizhouense ARSEF_6238' 'Metarhizium guizhouense CBS_258.90' 'Metarhizium indigoticum TNS_F18553' Metarhizium_kalasinense_BCC53581 Metarhizium_kalasinense_BCC53582 'Metarhizium lepidiotae ARSEF_7488' 'Metarhizium majus ARSEF_1015' 'Metarhizium majus ARSEF_1914' 'Metarhizium majus ARSEF_1946' 'Metarhizium majus ARSEF_4566' 'Metarhizium pingshaense CBS_257.90' 'Metarhizium robertsii ARSEF_727' Metarhizium_sp._M1 Metarhizium_sp._M2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M52682] TITLE Metarhizium_brachyspermum; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1200; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Metacordyceps_taii_CQM1 GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAGGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCAAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAAACCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Metarhizium_alvesii_CG1123 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGGAAGTCGCCTGCCTCCATGTCGAATCTTATAGAAGCTTTTATACTGACTTGCTTGCCGTAGGGGTATGTTTCGGAGTCTACACTCTTCGCCGTCTCGAGTTTTTGATAACTAACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAATCCCTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCATGTCGACCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATGTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGGATGTCTCTGTGTCTCT--GGCTGTTGAAACCACAATATTGCCGTTGTTTTCAGAAGAAGAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATACTGTTGTCCCGACTTGAATGCTAATGCCCCTCCCACAGACGCTCCCG---------------------- 'Metarhizium anisopliae ARSEF_7487' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATCATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAGCACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTTCATTTCGAACTTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGTTTCGGAGCCTACACTTTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAGACCACTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGGGTG--TCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGAAAAAACAAGAAACTAACTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATACTTTTCTCCCAAATTGAATGCTAATGCCCCTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA Metarhizium_baoshanense_BUM63.4 ----------CATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCAAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACCCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAATTTTTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Metarhizium_baoshanense_CCTCCM2016589 ----------CATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCAAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACCCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAATTTTTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Metarhizium brunneum ARSEF_2107' ------GGGTC-TTACCGAGTTATCC-ACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTCAAATCATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAGCCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGTTTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCACTCCGATTAATGATCTGCTATTGTTTGGCGATGAACACTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCATCTGTCGAGGGTGTCTCTTTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGAAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCCAACTGACCGCATACTGTTCTCCCAAATTGAATGCTAATGCCCCCCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA Metarhizium_campsosterni_HMIGD20884 ----------CATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATTAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Metarhizium_campsosterni_HMIGD20885 ----------CATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATTAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Metarhizium guizhouense ARSEF_5714' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCAAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAAACCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTCGTAGAAGCTGTTATACTGACTTGATTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTCATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTG-CTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGGAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTTCCAAATTGAATGCTAATACCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium guizhouense ARSEF_6238' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCAAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAAACCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGATTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTG-CTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGGAACTACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTTCCAAATTGAATGCTAATACCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium guizhouense CBS_258.90' ------------------------CCAACTCCCA-CCCCCGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCAAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAAACCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTCGTAGAAGCTGTTATACTGACTTGATTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTGGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTG-CTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGGAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTTCCAAATTGAATGCTAATACCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium indigoticum TNS_F18553' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGCATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACGCTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Metarhizium_kalasinense_BCC53581 ----------CATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAACTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATGAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTCGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTGAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCCTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTAACCGCATGCTGTTCTCCCGAATTGAATGCTAATCCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA Metarhizium_kalasinense_BCC53582 GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAACTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATGAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTCGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTGAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCCTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTAACCGCATGCTGTTCTCCCGAATTGAATGCTAATCCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGA- 'Metarhizium lepidiotae ARSEF_7488' GCGGAGGGATCATTATCGAGTTGTTAAACTCCCAACCCCTGTGAACTATACCTGTAACTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTATTAAGTATCTTCTGAGTGGT-AAGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGCCCCCCGTGGACTTGGTGTTGGGGATCGGCGAGGCTGTCTTCCCGTCCCCTAAATTTTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACGGGACCCGGTGAGGTCCACTGCCGAAAACCCCCCAACTTTTTACAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCTATTTCGAATCTTGTAGAAGTTGTTATACTGACTTGTTTGTCGTAGGGGTATGTTTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTAACTGGTCGTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCTCCCCGATTAATGATCTGCTATTGTGTGGCGATAAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGGGTGTCTCTGTGTGTCTCTGGCTGTTGAAATCACAATATTATCGTTGCTTTCAGAAGAAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCCCATACTGTTCTCCCGACTTGAATGCTAATGCCCCTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium majus ARSEF_1015' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCTCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGGATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACACCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACGATTGAGAAGTTCGAGAAGGTAAGCCAAACTCCTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTACTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACTATACCCCGCCAGCTGTCGAGGGTGTCTCTGCGTGTCTCTGGCTGTTAAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGAATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTCCCGAATTGAATGCTAATGCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium majus ARSEF_1914' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCTCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGGATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACACCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACGATTGAGAAGTTCGAGAAGGTAAGCCAAACTCCTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTACTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACTATACCCCGCCAGCTGTCGAGGGTGTCTCTGCGTGTCTCTGGCTGTTAAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGAATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTCCCGAATTGAATGCTAATGCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium majus ARSEF_1946' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCTCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGGATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACACCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACT-ATCGTAAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACGATTGAGAAGTTCGAGAAGGTAAGCCAAACTCCTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTACTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACTATACCCCGCCAGCTGTCGAGGGTGTCTCTGCGTGTCTCTGGCTGTTAAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGAATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTCCCGAATTGAATGCTAATGCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium majus ARSEF_4566' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTTGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACTCCTCCGATTAATGATCTGCTATGGTTTGGCGATGAACATTACTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTATGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACTATACCCCGCCAGCTGTCGAGGGTGTCTCTGCGTGTCTCTGGCTGTTAAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTGATTTGAATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTCCCGAATTCAATGCTAATGCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium pingshaense CBS_257.90' GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGCGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAGCACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACTTTGTAGAAGCTGTTGTACTGACTTGCTTGTCGTAGGGGTATGTTTCGGAGCCTACACTCTTCGCCGTCCCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCACTCCGATTAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCATCATACCCCGCCAGCTGTCGAGGGTGTCTCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCAGACTTTTCTCCTAAATTGAATGCTAATGCCCCTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA 'Metarhizium robertsii ARSEF_727' GCGGAAGGATCATT-CCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTATTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAGGACCCGGCGCGGTCCACTGCCGAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTTATCGTAAGTCGCCTGCCTCCATTTCGAACCTTATAGAAGCTGTT-TACTGACTTGCTTGTCGTAGGGGTATGTTTCGGAGCCTACACTCTTCGCCGTCCCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCACTCCGATTAATGATCT-TTATTGTTTGGCGATGAACATTATTGAGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGACACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGGGTGTCTCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGAAAAAACGTGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTGACTTGCGCAAACTGACCGCATACTTTTCTCCTAAATTGAATGCTAATGCCCCTCCCACAGATGCTCCCGGTCACCGTGACTTTATCAAGAA Metarhizium_sp._M1 GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCTCGCCGGGGACCCAAACCTTCTGGATTTTTAATAAGTATCTTCTGAGTGGTTAAAGAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAG-------------------------------------------------------------------------AAGTCGCCTGCCTCCATTTCGAACCTTGTAGAAGCTGTTATACTGACTTGCTTGTCGTAGGGGTATGATTCGGAGCCTACACTCTTCGCCGTCTCGAGTTTGTGATAACTGACTGGTCCTCACAGCCACGTCGACTCCGGCAAGTCTACCACCACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGTTCGAGAAGGTAAGCCAAACCCCTCCGATGAATGATCTGCTATTGTTTGGCGATGAACATTATTGGGTTTCCCGCTGCCTGTCGGCCATTACCCCTCACTGTGGCACGAAAATTTTCGCGGGGCCTTATCTTGGACTTTGGTGGGGCACCATACCCCGCCAGCTGTCGAGAGTGTCTCTGTGTGTCTCTGGCTGTTGAAACCACAATATTGTCGTTGCTTTCAGAGGGAAAAACATGAAACTAATTTGGATCGCTGTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGACTTGCGCAAACTGACCGCATGCTGTTCTCCCGAATTGAATGCTAATCCCACTCCCACAGACGCTCCCGGTCACCGTGACTTTATCAAGAA Metarhizium_sp._M2 GCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGGATTTTTAATAAGTATCTTCTGAGTGGTTAAAGAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCGTCCCTTAAATTGTTGGCGGTCTCCCGGGCCCTCCTCTGCCAGAGTAAAACACTCCAACAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET 5TEF_exon_1 (CHARACTERS = Metarhizium_brachyspermum) = 621-711; CHARSET 5TEF_exon_2 (CHARACTERS = Metarhizium_brachyspermum) = 963-1101; CHARSET ITS (CHARACTERS = Metarhizium_brachyspermum) = 1-488; CHARSET 5TEF_exon_3 (CHARACTERS = Metarhizium_brachyspermum) = 1169-1200; CHARSET 5TEF_intron_2 (CHARACTERS = Metarhizium_brachyspermum) = 712-962; CHARSET 5TEF_intron_3 (CHARACTERS = Metarhizium_brachyspermum) = 1102-1168; CHARSET 5TEF_intron_1 (CHARACTERS = Metarhizium_brachyspermum) = 489-620; END; BEGIN TREES; TITLE Metarhizium_brachyspermum; LINK TAXA = Taxa1; TRANSLATE 1 'Metarhizium majus ARSEF_1015', 2 'Metarhizium majus ARSEF_1914', 3 'Metarhizium majus ARSEF_1946', 4 'Metarhizium majus ARSEF_4566', 5 'Metarhizium guizhouense ARSEF_5714', 6 'Metarhizium guizhouense ARSEF_6238', 7 'Metarhizium guizhouense CBS_258.90', 8 Metacordyceps_taii_CQM1, 9 Metarhizium_kalasinense_BCC53581, 10 Metarhizium_kalasinense_BCC53582, 11 Metarhizium_campsosterni_HMIGD20885, 12 Metarhizium_campsosterni_HMIGD20884, 13 Metarhizium_sp._M1, 14 Metarhizium_sp._M2, 15 'Metarhizium pingshaense CBS_257.90', 16 'Metarhizium robertsii ARSEF_727', 17 'Metarhizium anisopliae ARSEF_7487', 18 'Metarhizium brunneum ARSEF_2107', 19 'Metarhizium indigoticum TNS_F18553', 20 Metarhizium_baoshanense_CCTCCM2016589, 21 Metarhizium_baoshanense_BUM63.4, 22 'Metarhizium lepidiotae ARSEF_7488', 23 Metarhizium_alvesii_CG1123; TREE Imported_tree_1 = [&R] (23:0.01278477077633044,(22:0.024462146301692824,((18:0.007707649822646451,(17:0.00660721965883881,(15:0.006416440287150388,16:0.00621330268606909)50:0.0018598943115502604)77:0.0010700633826167415)77:0.0022470140364470024,((4:0.004241870063061004,(2:9.7529141180379E-7,(1:9.7529141180379E-7,3:9.7529141180379E-7)25:9.7529141180379E-7)99:0.0033656185717784943)94:0.0051164579175446995,((20:9.7529141180379E-7,21:9.7529141180379E-7)99:0.011581871707958597,(19:0.004232206098824942,((11:9.7529141180379E-7,12:9.7529141180379E-7)73:0.002196942631088262,((6:8.479907113077308E-4,(5:8.458772150635732E-4,(7:0.0013085807779673552,8:0.002124293719276568)64:0.0012580853307870513)60:8.349252012153884E-4)88:0.005953753031803757,((9:9.7529141180379E-7,10:9.7529141180379E-7)100:0.0059310249386188224,(13:8.98086357609269E-4,14:9.7529141180379E-7)90:0.0017975338636183368)19:9.7529141180379E-7)17:0.003365208871036587)35:9.7529141180379E-7)18:9.7529141180379E-7)53:9.7529141180379E-7)76:0.0037073729855166275)99:0.007381753444213344):0.01278477077633044); END;