#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:44 GMT TreeBASE (cc) 1994-2008 Study reference: Frankiewicz K., Oskolski A., Banasiak L., Fernandes F., Reduron J., Reyes-betancort J.A., Szczeparska L., Al-sarraf M., Baczynski J., & Spalik K. 2020. Parallel evolution of arborescent carrots (Daucus) in Macaronesia. American Journal of Botany, 107(3): 1-19. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S24902] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=60; TAXLABELS Anthriscus_sylvestris Daucus_annuus Daucus_arcanus Daucus_aureus Daucus_bicolor Daucus_bischoffii Daucus_carota_subsp_azoricus Daucus_carota_subsp_carota Daucus_carota_subsp_gummifer Daucus_carota_subsp_halophilus Daucus_conchitae Daucus_decipiens Daucus_dellacellae Daucus_durieua Daucus_edulis Daucus_elegans Daucus_glochidiatus Daucus_guttatus Daucus_incognitus Daucus_insularis Daucus_involucratus Daucus_littoralis Daucus_mirabilis Daucus_montanus Daucus_muricatus Daucus_pumilus Daucus_pusillus Daucus_rouyi Daucus_setifolius Daucus_syrticus Daucus_tenuisectus Daucus_tenuissimus Ekimia_bornmuelleri Ekimia_petrophila Ferula_communis Glaucosciadium_cordifolium Laser_affine Laser_archangelica Laser_carduchorum Laser_stevenii Laser_trilobum Laserpitium_gallicum Laserpitium_halleri Laserpitium_krapfii Laserpitium_latifolium Laserpitium_peucedanoides Laserpitium_pseudomeum Orlaya_grandiflora Siler_montanum Silphiodaucus_hispidus Silphiodaucus_prutenicus Thapsia_eliasii Thapsia_garganica Thapsia_gummifera Thapsia_meoides Thapsia_nestleri Thapsia_tenuifolia Thapsia_thapsioides Thapsia_transtagana Thapsia_villosa ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M51396] TITLE Daucus_Habit_and_anatomy_matrix; LINK TAXA = Taxa1; DIMENSIONS NCHAR=10; FORMAT DATATYPE=Standard SYMBOLS= "0 1 2" MISSING=? GAP= -; CHARSTATELABELS 1 Reproductive_strategy / monocarpic polycarpic, 2 Lifespan / annual biennial_to_triennial perennial, 3 Raunkiaer_life_form / therophyte hemicryptophyte 'chamaephyte/rosette plant', 4 Growth_rings / absent only_one present, 5 Wood_porosity / 'semi-ring-porous' 'diffuse-porous', 6 Scalariform_pitting_common / absent present, 7 Pervasive_parenchyma / absent present, 8 Libriform_fibers / absent present, 9 Rays_composed_of_mostly_upright_and_square_cells / true false, 10 Ray_formation / present_in_early_wood delayed_or_rays_absent, ; MATRIX Anthriscus_sylvestris 121??????? Daucus_annuus 000??????? Daucus_arcanus 000??????? Daucus_aureus 011??????? Daucus_bicolor 000??????? Daucus_bischoffii 0220100100 Daucus_carota_subsp_azoricus 021??????? Daucus_carota_subsp_carota 0110100100 Daucus_carota_subsp_gummifer 0111?10100 Daucus_carota_subsp_halophilus 011??????? Daucus_conchitae 000??????? Daucus_decipiens 0220100110 Daucus_dellacellae 1210111100 Daucus_durieua 000??????? Daucus_edulis 12201111{01}0 Daucus_elegans 0120100101 Daucus_glochidiatus 000??????? Daucus_guttatus 000??????? Daucus_incognitus 000??????? Daucus_insularis 0210100100 Daucus_involucratus 000??????? Daucus_littoralis 000??????? Daucus_mirabilis 121??????? Daucus_montanus 000??????? Daucus_muricatus 000??????? Daucus_pumilus 0001?11100 Daucus_pusillus 000??????? Daucus_rouyi 1210100100 Daucus_setifolius 121??????? Daucus_syrticus 000??????? Daucus_tenuisectus 000??????? Daucus_tenuissimus 0220100100 Ekimia_bornmuelleri 121??????? Ekimia_petrophila 121??????? Ferula_communis 1212011010 Glaucosciadium_cordifolium 121??????? Laser_affine 121??????? Laser_archangelica 121??????? Laser_carduchorum 121??????? Laser_stevenii 121??????? Laser_trilobum 121??????? Laserpitium_gallicum 12120111?0 Laserpitium_halleri 1210?11000 Laserpitium_krapfii 121??????? Laserpitium_latifolium 1210011100 Laserpitium_peucedanoides 1210?111?0 Laserpitium_pseudomeum 121??????? Orlaya_grandiflora 0002000100 Siler_montanum 1210?110?0 Silphiodaucus_hispidus 011??????? Silphiodaucus_prutenicus 0110111100 Thapsia_eliasii 121??????? Thapsia_garganica 1210?11000 Thapsia_gummifera 121??????? Thapsia_meoides 121??????? Thapsia_nestleri 121??????? Thapsia_tenuifolia 121??????? Thapsia_thapsioides 121??????? Thapsia_transtagana 121??????? Thapsia_villosa 1210?11000 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M51397] TITLE Daucus_Molecular_matrix_trimmed; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4438; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anthriscus_sylvestris ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCTCAAGCGGAATGACCCGTTAACTCGTTAAAACATCGGGCAAGCGTTAGGGGGCCCAAGGTCCCCTCTTTGCGATCCCGTGGTGGTTGTCCCCTCACTCAACCAACCAAATAAATCAACCGGGCGCTGACGGCGCCAAGGAAATTAATATTGAATTGATTGTTAGCTTCTCGTTCGCGGGAAGCGGCGTCAATCTGAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTAGTTGCCCCTGACCAAACATCTTCTAAGAGATTTGTCGGTTTGGGGCGGAAATTAGCCTCCTGTGCCATGTGTGCGGCTGGCGTAAAACTGAGTCTATGGTGACGAATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGTCCGTCATCTTATACGGCTCAATGACCCTTAGGCGCCAAAAACTTTG-GCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGC-TTTTTAGATAACTAAGCATATTAATTTTTATATTTTTAAATATTGTATTCTTTTATTTTGTTTTTTATCCTATTGGATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTAGTCGCTATTTTAGTTGGAGGGTTAACTCATGACTTTTATTTTCCCAATATATGAAGGAATAAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGATTTGGATTCATAGGTTACATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTATACAATGGAGCCCGTAATGAAATTTTTT-TTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTATTCTATTAACGGA-----TTTTTTTTTTATGAATCCATAT------------------------------------------------------------------TTTGCATTTCCCAT-TTATAAAATAAAAAAATCCCACAATTCACTCATTCTTCATGGAATCATATAGATG-ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATAAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGTAAATAAATTTATAAAACATT--CCTGTAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTTTATAAAATATC---AAAATAGATTAAAATTCTACCATTATTATGATATTACATAGTCCAATCTG--CTTGAATACCAGAAAAATGAATGGATTTGGCATTTGATCTTTTCGATAAGATAAAACA-TAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTC--ACATAGAAGAGAGGTGTTTTACCTATATAATTTTTAGCATACGCTAAGGATTGTGGAGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGT-------AAGATATATCTATCTATATATAAGTCTTCCCCTTCTTTTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGATAATTC-CCTATAGGC------------AACATATAGAAATAAGAAAACCTATTAGATAT-CCGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCGAAATGGATAAATTGAAAATAAAAAATACTGAATAAACAC-TGATTGGTTATGTATCCTTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTTGATATT-CAAATCCAAGATTAATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCAC------ATTTCACTTTTCAATATAAAAA-AGGTGGGGGTAAGTTTTTAGGCATTGTGTTTGTGTATTTTGAGATACTATACAAT--AAATCGAAGAAGTGGATCCAATTAAATCAAAAAGAGGAGAGGGCCCTTCTTTTCGGAAA---AGAATTAATAAAAATGGGCTTCAAGATACAAGTAAAAGGGGGTTCAGTAATCCAC--CCTTAAGCAGTAAAATTTACATCTTTTTTTGTATTCTTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAACGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCATAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCCTTCTTTTATAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCTATCGCATATAGACTTTA--GGCGTCGTGGCATAACCGTCGAGGCGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCGCTTAAATTAAAATTCAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTAACACTTTTTTGAATAAATAATTAAAAAAATATAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTATTACATCCGCCATCTTTTCTATGAATGAAGGTGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGACTCCTTATTTTTGTTAGGTTGTAATGAAGAATATAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAAGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATCTAAATCGAAAGGATCCAATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATAGAGCGCGTATATTATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACGGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAAT----ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAA--AAATAAATTGCCTAAATA-TTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAAAGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTATATATGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGCCTTATTCATTTACTTAGATCTATCCCAA Daucus_annuus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGCAAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAATAAAATGCACAAGACGAATTAGGGACTATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCACTGAGGGCATCTTTCACAACTCTCTGACTTAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAATCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTTTGTGAACCCAAGGCAGGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGTGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTTTTTATTTTAATATAGTATTATTATTTTATTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATATTTTGCATTTCCCATCTTATAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGCATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTCCATATCTGGAATAGAATATATGAAATACGTATTAACTATGAACGGGAGAATAAATAAAATCCTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAACATTGCCCTGGAAACAGAATTCTGCTACTTAGGCTTATGAAGTTATGGAATTTTGTATAGAATATCTCCAAAATAGATTCCATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACAAAAAAAATGAATGGATTCGGCATTTGATCTTTTCAATAAGATAAAACAGTAGAACTCA------------------------TTTTTAGTACTTAAACACATTTATAGATTCAATTTTTCAAAGAAAAGGATTC--ACATAGAAGAGAGGTGCTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGT---------ACAGATATAGGCAGATATGAGATATCTCTATCTATATATAAGTCTTCCCCCTCTATTTTTATTCCATTAAAATTCAAATTGGAAACACAAAAATTTCCTGAGAATTC-CCTATAGGGAACATATTTAAAAAAATATATAAATAAGATAACCAATTTGATATGCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGTATCATTTTTGAGTTTCTTGTGTCATTAGGAA-AAAATTGGATATTCTAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCCAATTTGCCATCAAGTTGTTTTTTGTGACTAAAAATCTACATTTTATTTATACTTTTCAATTTCAACAAAAGAGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCGCAATCGAAGAAGTGGCTAAAATTAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCCAGAATAAAT-AAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCTCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATT-GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAAATTGTATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_arcanus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAACGACCTGTTAACATGTATAAACCACGGGCAAGCACTGGGGGTCCTCGGGTCCACAGTCTGCGAACCCAAGGCAGTTGTCCCCTTACTCCACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTCC-TCCGCATCCCGTTCACGGGATGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCTCCCGGAGATCTTCTATTCGGGGCGGAGATTGGCCTCCCGTGCCTTCTGTGCGGCTGGCTGAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCACCACCGTAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTCTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACA{AG}GAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAATTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_aureus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGGGCGCAGCTGGGTGCCTTGGTCCCCCCGTTCGCAAACCCAAGGCGGGTGTCCTCCTATGCACTTGTCAAAAAAACTCAACTGGGCGCTAGCTGCGCCAAGGAAGTAGATGATGAATTGTCCGTCCGCATCTCGTTCGCGGGAAGTGGCGGCAGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCGTGGGAGATTCTTTGTTTGGGGCGGAAATTGGCCTCCCGTGCCGTTTGCGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGTGCGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGTGCCCACCGCAGTTGGGAACTCGAGGGCCCTTGGGCACTACGAAATGTGTGCCCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATCGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAACGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGA{AG}ACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTATACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_bicolor ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACCCCGGGCAAGCATTGGGGGTCCTTGGGTCCCCAGTTTGCGAACCCGAGGCAGTTGTCCCCTTATTCCACTGCCTAACGAAATCAACTGGGCGTTAGACGCGCCAAGGAACTAAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAATCATCTCTCTCGGAGATTTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGATGGCTCAAAAATGAGTCTCTGGTGATGGACGACACAACATCGGTGGTTGTAACAAGACCTTCTTGTGTTGTTGTGCGAGCCCACCACCGTAGGAAACTCGAGGGCCCTTAGTCACTACGAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAAAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTTAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTC-GGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_bischoffii TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGCAAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAATAAAATGCACAAGACGAATTAGGGACTATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCACTGAGGGCATCTTTCACAACTCTCTGACTTAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAATCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGTGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCG-----------CTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTTTTT-TTTTAATATAGTATTATTATTTTATTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAAATTGTATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGAGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_carota_subsp_azoricus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACTCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_carota_subsp_carota ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGTCACCTTATCCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_carota_subsp_gummifer ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAA-TATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_carota_subsp_halophilus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACTCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_conchitae ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACCTCGGGCAAGCATTGGGGGTCCTTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCTTATTCCACTGCCTAACAAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCTTCTGGAGATTTTCTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTCTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCGCCACCGTAGGAAACTCGAGGACCCTTAGGCACTACGAAATGTGTGCATTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{ACG}{AG}CGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAATAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAAAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTACGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGAAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTGGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACC{CT}ACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_decipiens TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGACGGCCAAGCATGAGCAAAAGATACATTAGCATCCTTTAATCAACACAAGGCACAACGGACTTCCGTAAGGGACAACTATCTCGGAAAAGTATGGGCCAAGACCATAATCGATTACTGGTTCCGCATTCAAGATTTCTCTCTACACATGGACTTCCGACACTTACAAGACCAAAAGTAAATGAAAGGACGAAAGACCATGTTAGATTCATTGGCAGTCTCGCACAAAATAAAGTGCACGAGACAAATTAGGGACTATGGGACATCGAAATTCCATCATAATAGGTATACTGCGCAGGGCACCAATCTCACCGAGGGCGTAATTTACAGCTCTCCGACAGAATGAACATGTAAGACCAAACAGTTGTCGCTGCCGAGACAGGGATCCAACCGACCGGGACATCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCATCGGGGGGCCTTTGGTCCTCTGTTTGCAAACCCAAGGCAGGTGTCCCCTTATTCCCCCGCCTAACGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGTAAATAATGAATTGTTCGTCCGCATCTTGTTCGCGAGAAGCGGCGGCAGTCTAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAATCATCTCCTTGGGAGAATTTTTGTTTGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCATGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCACTACAGTAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTTAAATATCGTATTATTATTTTTTTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAA-TCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAGGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATTCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAAGGGATTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_dellacellae ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCAACCGTGGGCCTTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGTCCCCTTATTCCCCCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAAAAATGAATTGTTCATCCGCATTTCGTTCGCGGGAAGTGGTGGCAGTCCAAAACAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTTAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCTAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTGAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_durieua ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACCCCGGGCAAGCATTGGGGGTCCTCGGGTCCCCGGTCTGCGAACCCAAGGCAGTTGTCCCCTTGCTCCACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATCGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCCTTGGGAGATTTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGCTGGCTCAAAATTGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTCTTGTTGTTGTGTGAGCCCATCACCGTAGGAAACTCGAGGGCCCTTAGGCACTAAAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGAATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATAACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTAGAATCTATATAATAATAAAGATTAAATGAGACAAAAAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGCAAGGGGGAAGAAAAAATGAGTTAAATCCCATTCTAATTGATTTTATAAACTCCTTTGCCATTAATGAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_edulis TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCAAGCATGAGCAAAAGATACATTAGCATCCTTTAATCAACACAAGGCACAACGGACTTCCGTAAGGGACAACTATCTCGGAAAAGTATGGGCCAAGACCATAATCGATTACTGGTTCCGCATTCAAGATTTCTCTCTGCACATGGACTTCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGAAAGACCATGTTAGATTCATTGGCAGTCTCGCACAAAATAAAGTGCACGAGACAAATTAGGGACAATGGGACATCGAAATTCCATCATACTAGGTATACTGTGCAGGGCACCAATCTCACCAAGGGCGTAATTTACAGCTCTCTGACAGAATGAACATGTAAGACCAAGCAGTTGTCGCTGCCAAGGCAGGGATCCAACCGACCGGGACATCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCATCGGGGGGCCTTTGGTCCTCTGTTTGCAAACCCAAGGCAGGTGTCCCCTTATTCCCCCGCCTCACGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGTAAATAATGAATTGTTCGTCCGCATCTTGTTCGCGGGAAGCGGCGGCAGTCTAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAGTCATCTCCTTGGGAGATTTTTTGTTTGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCACTACAGTAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTGATATTTTTAAATATCGTATTATTATTTTTTTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCCTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCC--------TGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAGGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATTCCAGAACAAGGAAAGGCCGTTTTTAAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGATTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCCTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_elegans TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCAAAGGCCTAGCATGAGCAAAAGATACATTAGCATCCTTTACTCAACACACGGCACAACGGACTTCCATAAGCGACATCTATCTCCGAAGAGTATGGGCCAAGACCATAATCAATTACTGGTTCCGCTTTCAAGATTTCTGACTATACATGGACTTTCGACTCTTACAAGACCAAGAGGAAATGGA--GGCCGAAGACCATGTTAGACTCATTGGCAGTCTCACACAAAATAAAAGGCACGAGACAAATTAAGGACTATGGGACATCGAAATTCCATCATAACAGGTATATTGCGCAGGTCACCAATCTCACCGAAGTCATAATTTACAGCTCTACGACAGAATGAACACGTAAGACCAAGCAGTTGTCGCTGCCTAGACAGGGATCCAACCGCACGGCACATCGAATCCTGCGATACTAGAAGGACCCGTTAACATGTAAAAACACTGGGCAAGCAACGGGGGGCCTTTGGCCTGCTGTTTGCAAACCCAAGGCAGG-GTCCCCAAATTCCCCTGCCTAATGAAATCAATTGGGCGTTGAATGCGCCAAGGAAGTGAGTAATGAATTGTTCGTCTGCATCTCGTTCGCGGGAAGTGGCGGCAGTCTAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCTCCTGACCAATCATCTCCTTCGGTGATTTTTTGATTGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGTGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAAAAGACCTTCTTGTGTTGTTGTGTATGCCCATTGTAGTAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCATTTTGGAGAGTTTCTTCTCATCCAGCTCCTCGCGACTAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGTTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTTAAATATTGTATTAGTATTTATTTTATTTCTTTTTATCCTGTTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACGAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATCAATCCATATTGATTGATGCTTTATTACATTGC-TTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTATAAAGAAATTAAGGAAATAGCAAATATGTCATGGTTACAGCAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGAGACCTAAAAGATTTAATGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATAGAAGGGAAGCCAAAATTAAGGAAAACGTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCTTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTACTGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGGTCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGGAATTGGGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGATAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGCTTTTTTCAGGAAGGGGGAAGCACAAATGAGTTAAATCCCGTTATAATTGATTTTATCAACCCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_glochidiatus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACCCCGGGCAAGCATTGGGGGTCCTCGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCTTACTCCACTGCCTAACGAAATCAACCGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTTCGTCCGCGTCCCGGTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCCTTCGGAGACTTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTCCGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCACCACCGTAGGAAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAAAAAAATCCCAATATTCACTCATTATTCATGGAATCATATGGATGGATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTGCATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCGTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAATATTGGCCTGGAAACAGAATTCTGCTACTTAGGCTTATAAAGTTATGGAATTTTGTATAGAATATCTCGAAAATAGATTCAATTTCTACCATTATTATGATATTCCATATTCCAATCTGTCCTTGAATACCAAAAAAATGAATGGATTCGGCATTTGATCTTTTCAATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTC-CACATATAAGAGAGGTGTTTTACCTATAGAATTTTTAGTCTACGCTAAGGGTTGTGAGGTATATAAGAGGGGTTGT---------ACAGATATAGACAGATATAAGATATCTCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTGGAAAGAAAAAAATTTCATGAGAATTC-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTTGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTGAGTTTCTTGTGTCATTAGGAA-AAAATTGGATATTCAAAATTCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCCAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATATACATTTTAATTATACTTTTCAATAATAACAGAAGCGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCCAAATCGAAGAAGTGGATAAAATAAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCAATAATAAAA-AAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCT------------AAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATTCTTTATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTAT---ATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTCTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTCTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_guttatus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACATCGGGCAAGCATTGGGGGTCCTCGGGTCCCCAGTTTGTGAACCCAAGGCAGTTGTCCCCTCTCTCTACTGCCTAACAAAATCAACTGGGCGCTTGACGCGCCAAGGAAAAAAATATTGAATTGTTCGTCTACATCCCGTCCATGGGAAGCGACGACAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCTCTCGGAGACTTCTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGAATACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGTCCACCACCGTAGGAAACTCGAGGGCCCTTGGGCACCACTATACGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTAACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGATAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAATAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTCAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_incognitus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAATACCCTGGGCAAGCATCGGGGGGCCTTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCCTACTCCACTGCCTAATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTTGCATCCCGTTCACGGGAAGTGGCGGCAATCTAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCTGTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCTGACCAAGCATCTCTTTGTGAGATCTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTGTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGCTGTGTATGCCCACTACTGTAGGAAACTCGAGGGCCCTCAGGCACTACAAAAT-TGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTAAAATATTGTATTAATAT------------TTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCAATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTAGGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTTAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAATAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAAGAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATTATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTTAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTATTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTACTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_insularis TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGCAAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAATAAAATGCACAAGACGAATTAGGGACTATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCACTGAGGGCATCTTTCACAACTCTCTGACTTAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAATCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTAGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGCATGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTTTCGTTCGCGGGAAG-GGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTTTTTATTTTAATATAGTATTATTATTTTATTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAAATTGTATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_involucratus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAATCATCGGGCAAGCATTGGGGGTCCTTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCTTATTCCACTGCCTAATGAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTTCGTCTGCATCCCGTTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTGCCCCTGACCAAGCATCTCTTCTGGAGATTTTCTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTCTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCGCCACTGTAGGAAACTCGAGGACCCTTAGGCACTACGAAATGTGTGCATTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAA-AAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAAAAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTATTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTATATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGAAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCTACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_littoralis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACTTCGGGCAAGCATTGGGGGTCCTTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCTTACTCCATTGCCTAACGAAATCAACCGGGCGCTAGACGCGCCAAGGAACTAAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAATCATCTCTCTTGGAGATTTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGATGGCTTAAAAATGAGTCTCTGGTGATGGACGACACAACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCACCATCGTAGGAAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACATATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAACTAAATTTCTAAAACATTGACCTGTAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCA-AAAAATGAATGTATTCGGCATTTGATCTTTTCAATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTAAGACATAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAG--------GAGGGGTTGT---------ACAGATATAGACAGATAT-AGATATCTCTATCTATATAGAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATAAAAATTGGAAACAAAAAAATTTCCTGAGAATTC-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTTGATATGCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGTATCATTTTTGAGTTTCTTGTGTCATTAGGA--AAAATTGGATATT-CAAATTCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCTACATTTTAATTCTACTTTTCAATAATAACAAAAGCGAGGGGAAGTTTTTAGGCATTGTGTTTATGTGTTTTGAGATACTATACAATCAAAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTCCTTTTCGGAAACCCATAATAAAT-AAAAAA-GCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCC------------AAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAAAAAAAAATGAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_mirabilis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAATACTCGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCAACTGCGGGTCTTTGGTCCCCTGTCTGCAAACCCACGGCAGGTGTCCCCTTCTTCCCCTGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGATGTAAAAAATGAATTGTTTGTCCGCATCTCGTTCGCGGGAAGTGGCGGCAGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTTACAAATCATCTCCT{CG}GAGAGATTAGATGTTTGGGGCGGAAATTGGCCTCCCGTGCCTCTTGTGCGGTTGGCTCAAAAATGAGTCTTTGGTGATGGGCATCATGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCACACCAGTAGGAAACTCGA-GGCCCTTGGGCACTACAAAATGTGTGCACTTCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Daucus_montanus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAGGGCCAAGCATGATCAAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACGACGGACATTCGTGAGGGACATTTATATCGGAAAAGTACGGGCAAGGACCATAACCGATTACTGGTTCTGCATTCAAGATTTCTTGCA--ACATGACCTTCCAACACTTACAAAACCAAAAGGAAATGAAAGAGAGGGAGGCCATGTTAGATTCATTGTCAATCTCGCACAAAATAAAGTGCGCGAGATTAATTAGGGACTATGGGACTGTGACATTCCATCATAAAAGGTATATTGCGCAGGGCACCAGTCTCACCAAGGGCCTATTATAAAGCTCTCCGACAGAATGAACATGTAAGACCAAGCGGTTGTCGCTGCCAAGACAGGGATCCAACCAACCGGGACATCGAATCCTGCGATACTAGAATGACCCGTTAACATGTATAAACCCCGGGCAAGCATTGGGGGTCCTCGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGTCCCCTTACTCCACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTTCGTCCGCGTCCCGGTCACGGGAAGTGGCGGCAGTCTACAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCTTTCGGAGACTTTTTGTTCGGGGCGGAGATTGGCCTCCCGTGCCTTCCGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGCGTTGTTGTGTGAGTCCACCACCGTAGGAAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTAAAATATTGTATTAATAT------------TTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGGTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATAAAAGAACTAGTCT{CT}TGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTC---AGCCAATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTCTTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATA-----AAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGATAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTAT---ATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTCTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCAAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_muricatus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCTGTGAACATGTAAAAACACTGGGGAAGCAATGGGGGGTCTTTGGTCTCCGGTCTGCGAACCCAAGGCAGGTGTCTCTTTATTCCCCTGCCTAACGAAATCAACTGGGCGCTTAATGCGCCAAGGAAGTAAATAATGAATTGTCTGTCCGCATCTCGTTCGCGGGAAGTGGCGGCAGTCTAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTAACCAATCATCTCCTTGTGAGATTTTTTGTTTGAGGCGGAGATTGGCCTCCCGTGCTGTTTGCGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACAACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCCCCACAACAGGGAACTCGAGGGCCCTTAGGCACTACGAAATGTGTGCGCTTGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCTATTCCGGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTTAATTGTCTCAATAACTGTATAATCGATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTAGAATTTATTTTATCAACTCGTTTGCCATTAATTTAAATTCTATACGTATACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_pumilus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCAACTTCGGACCTGTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGTCCCCTTATTCCCCTGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTCCGCATCTCGTTCGCGGGAAGTGGCGGCAGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCCGGAGATTATTTGTTTGGGGCGGAAACTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCGCCACAGTAGGGAACTCGAGGGCCCTTGGGCACTACAGAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTT--TTTTTTAAATATAGTATTATTATTTTTTTTTTTTCCTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAAAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAAATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAACCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTT-AAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTTAATTGTCTCAATAATTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_pusillus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCAAGCATGATCAAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACAACGGACATTCGTGAGGGACATTTATATCGAAAAAGTACGGGCAAGGCCCATAATCGATTACTGGTTCTGCATTCAAGATTTCTTGCA--ACATGACCTTCCAACACTTACAAAACCAAAAGGAAATGAAAGAGAGGGAGGCCATGTCAAATTCATTGTCAATCTCGCACAAAATAAAATGCACGAGATTGATAAGGGACTATGGGACCTTGACATTCCATCATAAGAGGTATATTGCGCAGGGCACCAATCTCACCAAGGGCCTAATATAAAGCTCTCCGACAAAATGAACATGTAAGACCAAGCGGTTGTCGCTGCCAGGACAGGGATCCAACCAACCGGGACATCGAATCCTGCGATACTAGAACGACCTGTTAACATGTATAAACCACGGGCAAGCACTGGGGGTCCTCGGGTCCACAGTCTGCGAACCCAAGGCAGTTGTCCCCTTACTCCACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACTAAATATTGAATTGTCC-TCCGCATCCCGTTCACGGGATGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAGCATCTCTCTCGGAGATCTTCTATTCGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTGAGCCCACCACCGTAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTAAAATATTGTATTAATAT------------TTTTTATCCTATTGGATTGAGCAAGAATTATCAATTCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTC---AGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCG-AATTCTGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCAT-ATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTCTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAATTATGGGTACAAATGATTTTGTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTGTAATTGATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_rouyi TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGCAAAAGATACGTTAGCATCATTTACTCAACACAAAGCGGAACGGACTTCCGTAACGGACATATATCTCAGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTCAGTCTCACACAAAATAAAGTGCACAAGACGAATTAGGGACTATGGGACATCAAAATTCCATCACAATAGGTATATTGCGCAGGGCACCAATCACACTGAGGGCATCGTTCACAACTCTCTGACTTAATGAACATGTAAGACCTAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGACATCGAATCCTGCGATACCAGAATGACCCGTTAACATGTTAAAACACTGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGTCACCTTATTCCCCCGCCAAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTCCGCATCTCGTTCGCGGGATGTGGCGGCAGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGCAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTACCCAAACATCTCCTCGGGAGATTATTTGTTTGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACTACAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTT-----TTTTAATATAGTATTATTATTTTATTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACAGATTCGTTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAAAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAAACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAAAAATAAATTAAGGAAATACCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCCTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_setifolius ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAACACTGGGCAAGCAACTGGGGGCCTTTGGTCCCTGGTCGGCAAACCCAAGGTAGGTGTCCCCTTTTTCCCCCGCCTAACAAAATCAACTGGGCGCTAAATGCGCCAAGGAACTAAATAATGAATTGTTCGTCTGCATCTCGTTCGCGAGAAGTGGCGACAGTCGAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCTCCTAGCCAATCATCTCCTTGGGAGAATTTTTGTTTGGGGCGGAGATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGTCCACCATAGTAGGGAACTCGAGGGCCCTTGGGCACTACAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGAAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTTGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAAGCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGTTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTCAAAGTTTGAACTCCGTACTTTTTTTGATGTACCTACTTGAGCCGAATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATGGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATGGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCATTTTTAAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTGTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_syrticus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGATACCAGAATGACCTGTTAACATGTAAAAACACTGGGCAAGCAACTGTGGGCCTTTGGTCCCCCTTTTGCAAACCCAAGGCAGGTGTCACCTTATTCCCTTGCCTAAGAAAATCAACTGGGCGCTAGATGCGCCAAGGAAA-AAATAATGAATTGTTCGTCCGCATCTCGTTTACGGGAAGTGGCGGCAGTCTAAAATAAAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGCGGAAATTGGCCTCCCGTGCCTTTCGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATTGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGCACTTGAGGGCCCTTGGGCACTGCAAAATGTGTGCACTTTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCACGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Daucus_tenuisectus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATACTAGAATGA-CCGTGAACATGTAAAAACACTGGGCAAGCAAT-GGGGGCCCTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGTCCCCTTATTCCCCTGCCTGATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGTAAATAATGAATTGTTTGTCCGCATCTCGTTCGCGGGAAGTGGCGGCAGTCTATAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCTCTGACAAATCATCTCCTTGGGAGATTTTTTGTTCGTGGCGGAGATTGGCCTCCCGTGTCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTATGTTGTTGTGTATGCCCACCATAGGAGGGAACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCTAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTATAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT-GGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Daucus_tenuissimus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGCAAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTACAAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAATAAAATGCACAAGACGAATTAGGGACTATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCACTGAGGGCATCTTTCACAACTCTCTGACTTAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAATCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTCTGTGAACCCAAGGC{AC}GGTGTCACCTTATTCCCTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGTAAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGCGGTCCAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTATTTGTTCGGGGTGGAAATTGGCCTCCCGTGCCTTTTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAATGTGTGCACTTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATCAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTTTTTATTTTAATATAGTATTATTATTTTATTTTTTTCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATAAAAATATAAGGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTAAATTGTCTCAATAATTGTATAAATTGTATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGGAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTCTTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Ekimia_bornmuelleri ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAATAGCAGAATGACCCGTTAACTTGTAAAAACACCGGGCAAGCGTCGGGGGGCCTTGGGTCCCCTGTTTGCAAACCCATGGCTGGTGTCCCCTGACTCCATCGGCCAACGAAAACAATCGGGCGCAGACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTCGCTTCTCGTTCGTGGGAAGCGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTTCCTGGGTGTCATGCATCACGTTGCCCATGACCAAACATCTCTTTAGGTGATTTCTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGCGGCTGGCTCAAAAATTAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTATATGCTCGTCACCTCAGTCAGCTCAAGGGCCCTTAGGCGCCACAAAATGTGTGCGCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTCTTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAATATATCAATATATAAATTGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATAAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCAGTATAATTTATTTTATCAACTCCTTTGCCATTAATTCGAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Ekimia_petrophila ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAATAGCAGAATGACCCGTTAACTCGTAAAAACACAGGGCAAGCATCGGGGGGCCTTGGGTCCCCTGTTTGCAAACCCAAGGTTGGTGTCCCCTGATTCCACTGGCCAATGAAATCAATCGAGCGCAAACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTCGCTTCTCGTTCACGGGAAGCGGCGCCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTTCCTGGGTGTCACGCATCGCGTTGCCCCTGACCACACATCTCTTTAGGTGATTTCTGGTTTGGGGCAGATATTGGCCTCCCGTGCCTTGTGCGCGGCTGGCTCAAAAATTAGTATCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTATGCTCGTCACCTCAGTCAACTCGAGGGCCCTTAGGTGTCACAAAATGTGTGCGCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATAGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATGGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGGGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGAATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGAT{CT}TTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAAT---------TGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAAGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATTGAAAGGATCCAATTCAGTCAAGTTTTTAATTAAAAGGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATATAAAGAAATCGCAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCCATATAATAATAAAGATTAAATGAGCCAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Ferula_communis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAATAGCAGAATGACCTGTTAACAAGTAAAAACATCGGGCAAGCTTTGGGGGGCCTATGGTCCCCTATTTGCGAACCCAAGGTAGGTGTCCCCTCACTCCACCGGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTTCG-TCGCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTGCCCCCGACCAAACATCTCTTTAGGAGAGTTCCGGTTTGGGGCGGATACTGGCCTCCCGTTCCTTGTGTGCGGCTGGCGCAAAAATGAGTCTCTAGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCCGTCACCTTAGTAAGCTCAAGGACCCTTAGGCGCCATAAAATATGGGCGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCAT-TTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATT--CCTGGAAACATAATTCTCCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATC---AAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTG--CTTGAATACCATAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGA--------TAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTC--ACAGAGAAGAGAGGTTTTTTACCTATAGAATTTTTAGCATACGCTAAGGATTGTGAAGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATAT-AGATATATCTATCTATATATAAGTCTTCTCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACAAAAAAATTTCCTGAGAATTC-CCTATAGGC------------AACATATATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCGAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAC-TGATTTGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTTGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAA----AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAAT--CAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAA---AGAATAAATAAAAACAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCAC--CCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTATGATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAATAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGA-TTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTCACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATAT--ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAAATATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCTAA Glaucosciadium_cordifolium ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGAATCCTGTGATAGCAGAATGACCCGTTAACATGTAAAAACACCGGGCAAGCGTCGGGGGGCCTAAGGCACCCTGTTTGCTAACCC-AGGCAGGTGTCCCCTCAGTCTACCGGCCTATTAAATCAACAGGGCACTGACTGTGCCAAGGAAATTGATATTGAGTTGTTCGTTCGCTTCTCGTTTGCGGGCAGCGGCGTCAATCGGAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGTAGCCAATAGGCCTAGGGCATGTCTGCCTGGGTGTCACGCATCTTGTTGCCCTTGACCAAACACATCTTTTGGGGAGTGCAGGTTTGGGGCGGATACTGGCCTCCCGTGCCTTCAGCGCGGCTGGCCCAAAAATGAGTCTCTGGCGATGGACGTCATGACAGCGGTGGTTGGAAGAATACCTTCTTGTCTTGTCGTGTATGCCCGTCACCTTAGCCAGCTCTAGGACCCTTTGGTGCCACAAACTGTGTGCGTTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCAT-TTATAAAATATAAAAATCCCGCTATTCACTCATTCTTCATGGAATCATATAGATG-ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAATAGATACAAATGGAAATAAATTTCTAAAACATT--CCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATC---AAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTG--CTTGAATACCAGAAAAATGAATGGATTCGGAATTTGATCTTTTCGATAAGATAAAACA-TAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTC--ACAGAGAAGAGAGGTTTTTTACCTATATAATTTTTAGCATACGCTAAGGATTGTGAAGTATATAAGAGGGGTTGTATTT--------GATATAGTCAGATAT-AGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTC-CCTATAGTCAACATATATAAAAACATATATAAATAAGAAAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCGAAATGGATAAATTTAAAATAAAAAATACTTAATAAACAC-TGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTTGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACT--TTTTTTGTGACTAAAAATCCAC------ATTTTACTTTTCAATATAAA----AGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAAT--CAATCGAAGAAGTGGATCAAATTAAATCAAAAATAGGAGAGGGCCCTTATTTTCGGAAA---AGAATTAATAAAAACAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCAC--CCTTAAGCAGGAAAATTTCCA--------TTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTACCTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTC-GGGGGAGTAGACTACTCAATAATTTCACATTTCTTTGAATAAAGAATTCAAAAAATATAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTATAATTTAAAAGTCCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCATGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTATATCCGCCATCTTTTCTATGAATGAAGGTGCTCTTGACCCGACATCTGTTCTGTTTTCACTAGAATCCTTATTTTTGTTAGGTTGTAATGAATAATATAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAAGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAAAAAAGTCTTTCGATTCAAAGTGTACCGCGCGGGAATCGAGCGTGTATATTATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATATT----ATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAA-GAAATAAATTGCCTAAAGATTTTTTCCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGTAACGGGGAAGAAAAAAAGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTAGAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAAGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laser_affine ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACACGTAAAAAAACCGGGCAAGCGTCGGGGGGTCTTGGGTCCCCTGTTTGCAAACCCAAGGCAGGTGTCCCCTGACTCTACCAGCCAATGAATTCAACTGGGCGCTTACTGCGCCAAGGAAGTTAATAATGAATTGTTCGTTCACTTCCCGTTTGTAGGAAGTGGCGTCAGTCTGAAACACAAACGACTCTCGGCAACGGA{AT}ATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTAACAAAACATCCCTTTAGGAGGTTTTTGGTTTGGGGCCGATATTGGCCTCCCGTGCCTTGTGCGTGGCTGGCTCAAAAATGAGTCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTCGTGTTGTTGTGTATGCCCGTCACCTCATTAAGCTCAAGGGCCCTTAGGTGCCACAAAATGTGTGTGCTTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTTTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACAGATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAATACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCACAGAGAAGAGGGGTGTTTTTGACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATTAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTTAAATTTTAAACACAAAAATTTCCTGAGAATTCGCCTATAGGCAACATATATAAAAACATACATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATACATATTGTTATAATCAAAATGGAGAAATTCAAACTAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTGGATATTCGAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATACACATTTTAATTTGACTTTTCAATAAAAACA--AGTGAGGGGAAGCTTTTAGGCATTGTGTTTGTGTGTTTTGAAATACTATACAATCGCAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCT-CTT-----------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTGGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTATAAAGAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTTATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTTAATAAAGAATTCAAAAAATATAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCTATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAATAAAAAGGATCCCAGAACAAGGAAACGCC-TTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGATAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATCTTTTT-TTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGCTTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATATGTGGACAATACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laser_archangelica ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACACGTAAAAACACTGGGCAAGCGTTGGGGGGTCTTGGTTCCCCTGTTTGCAAACCCAAGGCAGGTGTCCCCTGACTCTACCGGCCAATGAAATCAACCGGGCGCTTATTGCGCCAAGGAAGTTAATAATGAATTGTTCGTTCGCTTCCCGTTCGTAGGAAGTGGCGTCACTCTGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTAATCAAACATCCCTTTAGGAGATTTTTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGTGGCTGGCTCAAAAATGAGTCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGTGTGCTTGTCACCTCATTCAGCTCAAGGGCCCTTAGGTGCCACAAAATGTGTGTGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCATTTCCCATCTTATAAAATATAAAAATTCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTGACGAAGTTATGGAATTTTGTATAGAATATATCAAAAATAGATTCAATTTCTACCATTATTATGATATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATCTAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCCGACAGAGAAGAGGGGTGTTTTACCTATAGAATTTTTAGTCTACGCTAAGGATTGTGAGGTATATAAGAAGGGTTGTATTTATTAAACAGATATAGGCAGATATCAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCACCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATTCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGATAAATTGAAACTAAAAAATACTGAATAAACAGTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAATTTTTAATATT-AAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTTATTTGACTTTTCAATAGAAACC-AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCCCAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTTCTTT--------------------AACGCAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTAATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTACGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTT-AGGGCATCGTGGCATAACTGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGAGGGAGTAGACTACTCAATAATTTCACATTCTTTTTAATAAAGAATTCAAAAAATATAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTTTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTGCGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laser_carduchorum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCTTGCGATAGCAGAATGACCTGTCAACACGTAAAAACATCGGGCAAGCGTCGGGGGGCCTTGGGTCCCTTGTCTGCAAACCCAAGGCAGGTGTCACCTGACTCCACCGGCCAACATAATCAACCGGGCGCTTATTGCGCCAAGGAAGTTAATAATGAATTGTTCGTTCGCTTCTTGTTCGCAGGAAGTGGCGTCAGTCCAAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACACATTTTGTTGCCTCGGACTAAACATCTCTTTAGGAGTTTTTTGGTTTGGGACAGATATTGGCCTCCCGTGCTTTGTGCACGGTTGGCTCAAAAATGAGTCTTTGGTGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCGTCACCTTAGTCAGCTCAAAGGCCCTTAGGTGCCACAAAATGTGTGTGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACAGATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCCGACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATCAGATATATCCATCTATATATAAGTCTTCCCCTTCTATTTTTATTACATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCACCTATAGGCAACATATATAACAACATATATAAATAAGATAACCAATTAGATATGCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTTGATATTCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCACCAACTTTTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACATAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACC-AGAATAAATAAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCGCCTTAAGCAGGAAAATTTCCATCTATTTTTTT-------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTATAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTTAATAAAGAATTCAAAAAATATAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATG-TTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTTCTTTGCCATTAATTATAATTCTATACGTAGACAATACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laser_stevenii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACACGTAAAAACATTGGGCAAGCGTCGGGGGGCCTTGGGTCCCCTGATTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAATAAAGAATTGTTCGTTCACTTCTTGTTCGCAGGAAGTGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTGCCCTTGACTAAACATCTCTTTAGGAGATTTTTGGTTTGGGACAGATATTGGCCTCCCGTGCCTTGCGCGCGGCTGGCTTAAAAATGAATCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTATGCCCGTCACCTCAGTCAGCTCAAGGGCCCTTAGGTGCCACAAAATGTGTGTGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATATAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTGACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCACACAGAGAAGAGGGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGA----------TATTAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCGCCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGATAAATTGAAACTAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAATTTTGATATTCTAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATAGAAACA-TAGTGAGGGGAAGTTTTTAGACATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCT-CTT-----------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTAATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTCGGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGAAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATTCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTTAATAAAGAATTTAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAAAGTTTATATGATTCTTTGATAGAAAAAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTTCCTAAAGATCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGTAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTCTCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laser_trilobum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATTGCAGAATGACCTGTTAACACGTAAAAACATCGGGCAAGCATCGGGGGGCCTTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCTGATTCCACCGGCCAACGAAATCAATTGGGCGCTGACTGCGCCAAGGAAGTTAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGTCAGTCTGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTTTGCCTGGGTGTCACGCATCGCGTTGCCCCTGACCAAACATCTCTTTATGAGATTTTTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGCGCATGGCTGGCTCAAAAATGAGTCTTTGGTGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCGTCACCTCAGTCATCTCAAGGGCCCTTAGGTGCCACAAAATGTGTGTGCTCCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTTAAATACCGTATTATTTTTTTTTGTTTTGCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCGTTATTGGCTCGAAGCTCTTA-TTTTTTTGTTCTAGGAACGGATTCGTTTTCTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTACTCAATAATTTCAC-TTTTTTTTAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTCTGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCATTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAAAAAATTGCCTAAAGATCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTGATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCGTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laserpitium_gallicum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGAATCCTGTGATAGTAGAATGACCCGTTAACTAGTAAAAACATTGGGCAAGCGTCTGGGGGCCTTGGGTCCCTTGATTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCGGCCAACGAAATCAATCGGGCGCTGAATGCGCCAAGGAAATTAATAAAGAATTGTTTGTTCGCTTCTCGT----GGGAAGCGGCGTCATTCCGAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCG--ATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATCGTGTTGCCCCTGACCAAACATCTGTTTAAGAGACTTCTGGTTTGGGGCGGATATTGGCCTTCCGTGCCTTGTGCTCGGCTTGCTAAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCTGTCACCATAGTTAGCTCAAGGGCCCTTAGGCGCCACGAAATGTGTGTGTTTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAGAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTTTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATC-TTTCGATAAGATAAAATACTAAAACTCAGAAACAATAGAATATAGAGTAGATCTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCAGACAAAAAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGG---------TTAAACAGATATAGGCAGATAT-AGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTGGAAACACAACAATTTCCTGAGAATTCCGCAACAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATTCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGTACCATTTTTTAGTTTCTTGTGTCATTAGGAAAAGAATTGGATATTCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTTTTTTTTGTGACTAAAAATCCACCTTTTAATTTTACTTTTCAATATAAACA-TAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCGCAATCGAAGAAGTGGATAAAATGAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCGAGAATAAAT-AAAAAAAGC-TCAAG-----------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGGAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAACAAAAAAAAGGGCATTTTTAGTTATACTTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTC-TCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTTTAGAATTTAAAAGTTCGAACTCCTTATTTTTATTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTAGATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTCTAATTCTATACGTAGACAAAACTACAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAGCTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laserpitium_halleri ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACAAGTAAAAACATCGGGCAAGCGTCGGGGGCCTTTGGGTCCCTTGATTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCAGCCAACGAAATCAATCGGGCGCTGAATGCGCCAAGGAAATTAATAAAGAATTGTTTGTTCGCTTCTCGT----GGGAAGCGGCATCAAATCGAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGC-AAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGC{CT}GAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTGTTTAAGAGACTTTTGGTTTGGGGCGGATATTGGCCTTCCGTGCCTTGTGC{CT}CGGCTTGCTCAAAAATGAGTCTTTGGCGATGGATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCTGTCACCTTAGTTAGCTCAAGGGCCCTTAGGCGCCACGAAATGTGTGCGTTTCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Laserpitium_krapfii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACATGTAAAAACATCGGGCAAGCGTCAGGGAGCTTTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCTGACTCCACCGGCAAACAAAATCAATCGGGCGCTGAATGCGCCAAGGAAATTAATAAAGAATTGTTCGTTCTCTTCTCGTTTGCGGGAAGCGGCGTCAGTCCAAAACAAAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCTTGACCAAACATCTCTTTTGGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCTGTGCCTTGTGCGCGGCTGGCTAAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCTGTCACCTTAGTCAGCTCAAGGGCCCTTAGGCGCCAAGAAATGTGTGCGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATATTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCC--CATATCTGAAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATGGTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTG-CCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCT--AAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACATTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTC-TACAAAGAAGAGAGGCATTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGG---------TTAAACAGATATAGGCAGATATCAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTGGAAACACAACAATTTCCTGAGAATTCCCCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATTCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATAAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAGAATTTGATATTCGAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACCTTTTAATTTGACTTTTCAATATAAACA--AGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCGCAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTTC-------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAAC-AAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTTTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGATACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATGTCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCACTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTCTAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Laserpitium_latifolium ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGGTAGCAGAATGACCTGTTAACACGTAAAAACATTGGGCAAGCGTCAGGGGCCCTTGGGTCCCCTGTTTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCGGCCAACAAAATCAACCGGGTGCTGAATGCACCAAGGAAATTAATAAAGAATTGTTCGTTCTCTTCTTGTTCGCGGGAAGTGGCGTCAGTCCAAAACAAAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTTCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCTTTAGGAGATTTCTGGTTTGGTGCGGATATTGGCCTCCTGTGCCTTGTGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCTGTCACCTTAGTGAGCTCAAGGGCCCTTGGGCGCCACGAAATGTGTGCGCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAAC-AAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGTATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGATACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTTTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAAT----------------TTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCTAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTATTTAGATCTATCCCAA Laserpitium_peucedanoides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAACATGTAAAAACATCGGGCAAGCGTCACGGGGCCTTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCTTACTCCACCGGCCAACAAAATCAACCGGGCGCTGAATGCGCCAAGGAAATTAATAAAGAATTGTTCGTTCTCTTCTCGTTTGCGGGAAGTGGCGTCAGTCCAAAACAAAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCTTGACCAAACATCTCTTTTGGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCTGTGCCTTGTGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCTGTCACCTTAGTCAGCTCAAGGGCCCTTAGGCGCCAAGAAATGTGTGCGCTTCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Laserpitium_pseudomeum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCTGTTAATACGTAAAAACATCGGGCAAGTTTCAGGGGGCCTTGGGTCCCCTGTTTGCAAACCCAAGGCAAGTGTCCCCTGACTCCACCGGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTCGCTCCCCGTTTGTGGGAAGCGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCTCCTGGCCAAACATCTCTCTAGGAGATTTTCGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGCGGCTGGCTCAAAAATGAGTCTTTGGTGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGTATGC---TCACCTTAGTCAGCTCAAGGGCCCTTAGGCGCCACAAAATGTTTGCGCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTGGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT-GGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGCTTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Orlaya_grandiflora TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCTAGCATGAGTTCTAGATGCATTAGCATCCTAGAGTCAACACAAGGCACAACGAACTTTCGTGAGGGACATTTAATACGGAAAAGTATGGGCCAACACCCAAACCGATCAACGATTCCGCATACAAGATTTCTGGCAACACATGGACATCCGATGCTCTCAAGACCGAAAGGAAATGAAAGGGCAAAGATCCATGTTAGTTTCTTTGTTTATCTCGCACAACATAAGAAGCGCGAGACAAATAAGGGACCGTGGGACTCCAAAATTCCTTCAAACTAGGTA-GTTGTACAGGGGACCATGCACACCGAAGGCTCAATTCTTAGCTCTCGGACAGAATGAACATGTATGAACAAGTGGTTGTCGCTGCCTTGACAGGGATCCAACCAACCGGGACATCGAATCCTGCGAGAGCAGAATGACCCGTAAACATGTAAAAACATCGGGGAAGTAACAGGGGGCC-TTGGTCCCTTGTATGCAAACCCAAGGCAGGTGTCCCCTTATTCCACCAGCCAATGAAATCAACCGGGCGCTAACTGCGCCAAGGAAGTTAAAAATGAATTGTTCGTTCGCTTCTCGTTTGTGGGAAGCGGCGTCAGTTGGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGTGTTGCCCCAGTCCAAGCATCCCTCTAGGAGATTTTTGGATTGGGGCGTAAATTGGCCTCCCGTGCCTTGCGTGCGGCTGGCTCAAATGCGAGCCTCTAGAGATGGAGATCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTTTTGTCGTGTATGGCCGTCACCTTAGTTTGCTCGAGGGCCCTATGGCACCACAAAATGTGTGCGCTTCAGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATAATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTATAAATATCGTATTATTTTTTTATGTTCTATATTTTTTTTGTTTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCCTTTCGTCGCTATTTTAGTTGTATGGTTAACTAATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCAATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCACCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTC------TTTTTTTTCTATGAACGAATTCATTTTTTTTTTTATGAATCCATATTGATTCATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAAATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAATACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTAGCCATCGCATATA{AG}ACTTTAAGGGCGTCGTGGCATAACCGTCGAGGGGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTC-CATTTTTT-TAATAAATAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAACCCCC-CGG--TTT-CCGGAAAACTGAG-AAAAAGTAGATTTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGTAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATATAGGATCCTATCCCAAT------GTGTGGATTTTTCTTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATAAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTTAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATGCCAGAACAAGGAAACGCCGTTTTTTAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAGACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGCTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGCTTTTTTCAGGAAGGGGTAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGT---------------------------- Siler_montanum TTGAGACAAGCATATGA{CT}TACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCTGAAGGCCTCGCATGAGCACAAGATGCATTATCATCCTACAGTCAACACAAGGCACAACAGACTTTCGTGAGGGACATTTAATTCGGACAAACAAGGGCCAAGACCCGAACCGATCAATGGTTCTGCCTACAAGATTTCTAGCGACTCATGGACATCCGATGCTTACAAGACCGAATGGAAACGTAAGGTAGGACGTCCATGTTAGTTTCGTTGTCTGACTCGCACAACATAAGGAGCACGAGACAAATAAGGGACCATGGGACTATGGAATTCCGTCAAAATAGGTATGTTGCACAGGGGACCAAGCACGCCGAAGCCAAA{AT}TTTTTAGCTCTCGGACAGAATGAACATGTATGAACAAGCGGTTGTCGCTGCCGAGACAGGGATCCAACCAACCGGTACATCGAATCCTGCGATAGCAGAATGACCCGTTAACACGTAAAAACATCGGGCAAGCGTCGGGGGGCCTTGTGTCCCCTGTTTGCAAACCCAAGGTAGGTGTCCCCTAACTCTACCGGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTTGCTTCTCGTTCGCGGGAAGTGGCGTCAGTCCGAAACATAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGG{CT}{CT}GAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCAAACATCTCTCTAGGAGATTTTCGGTTTGGGGCGGATATTGGCCTCCTGTGCCTTGTGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACGTTGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGTATGCCCGTCACCTCAGTCAGCTTAAGGGCCCTTAGGCGCAACAAAATGTGTGCG{CT}TTCGGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTTAAATATCGTATTCTTTTTTTTTGTTTTGCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCGTTTTCTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATATTTTGCATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGATTCCATTGTTCAAAGAAAAGGATTCCGACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATCAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATGACAATTTGAAACACAAAAATTTCCTGAGAATTCACCTATAGGCAACATATATAAAAACATAGATAGAGAAGATAACCAATTAGATGT-CTGTGGAACAATTTATGTTCTGGGGTTTACATATACCCATATATAATGTTATAGTCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAATTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTTGATATTCAAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCACCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAGAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACC-AGAATAAATAAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCGCCTTAAGCAGGAAAATTTCCATCGATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCACGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGGCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCGTAATTAAGGAAAAGCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATTTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAACTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACACCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTATTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Silphiodaucus_hispidus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTAGCCGAAGGCCTAGCATGATCAAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACAACGAACTTTCGTAAGGGACATTTTTCTCGGAAAAGTATGGGCCTAGACCATAACCGATTAGTGGTTCCGCATTCAAGATATCTGGCAACACA{AT}GGGCATCCGATGCTTACAAGACCAAATGGAAATGAAAGGGCGGAATACCATGTTAGATTCATTGTCAGTCACGCACAACATAAAGAGCGCGAGACAAATAAGGGACCATGGGACTCCAGGATTCCATCATAATAGGTATGTCGCACAGGGGACCAAGCACACCAAAGGCAAAATTTAAAGCTCTCGGACAAAATGAACAAGCATGACCAAGCAGTTGTCGCTGCCGAGACAGGGATCCAACAAACCGGGACATCGAATCCTGCGCTACTAGAATGACCCGCTAACATGT-AAAACACCGGGCAAGCATCGGGGGGCGTT-GGTCCCTTGTCTGCAAACCCAAGGCAGGTGCCCCCTTACTCCACTGCCTAATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGTTAATAATGAATTGTTCGTTCGCATCTCGTTCGCGGGAGGCGGCGGCAGTTGAAAACAAAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTGCCCCTGACCAAGCACCTCTCTGGGAGACTTTTGGTTTGGGGCGGAGATTGGCCTCCCGTGTCTTGTACGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGTATGCCCATTACCTTAGTCGACTCGAGGGCCCTTAGGCACTACAAAATGTGTGCACTTCA-------------------GCTCCTCGCGAATAATAAAATTTGCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATTTTTATATTTTTAAATATCGTATTATTTTTTTTTGTTTTGCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCATCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGATGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGATTTCAAAAAATATAAATATAAAGGAAGCCGTAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAAAT{CT}TTTTTTTGGGGGGGCTCGAGAATTTAAAAGTT{CT}GAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Silphiodaucus_prutenicus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTAGCCGAAGGCCTGGCATGATCAAAAGATACATTAGCATCATTGAGTCAACACAAGGCACAACGAACTTTCGTAAGGGACATTTTTCTCGGAAAAGTATGGGCCTAGACCATAACCGATTAATGGTTC{CT}GCATTCAAGATTTCTGGCAACACATGGACATCCGATGCTTACAAGACCAAATGGAAATGAAAGGGCGGAATACCATGTTAGATTCATTGTCA{AG}TCACGCACAACATAAATAGCACGAGACAAATAAGGGACCATGGGACTCCAGGATTCCATCATAATAGGTATGTCGCACAGGGGACCAAGCACACCGAAGGCAAAAATTAAAGCCCTCGGACATAATGAACAAGCATGACCAAGCAGTTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGACATCGAATCCTGCGCTACCCGAATGACCCGCTAACATGTAAAAACACCGGGCAAGCATCGGGGGCCGTTGGGTCCCTTGTCTGCAAACCCAAGGCAGGTGCCCCCTTATTCCACCGCCTAATCAAATCAACTGGGCGCTAAATGCGCCAAGGAAATTAATAATGAATTGTTCGTTCGCATCTCGTTCACGGGAGGCGGCGGCAGTTGAAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTGCCCCTAACCAAGCACCTCTCTGGGAGATTTTTGGTTTGGGGCGGAGATTGGCCTCCCGTGTCTTGTGCGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACATCACGACATCGGTGGTTGTAAGAAGCCCTTCTTGTGTTGTTGTGTATGCCCATTACCTTAGTTGACTCGAGGGCCCTTAGGCATTACAAAATGTGTGCACTTCAGAGAGTTTCTTCTCATCCAGCTCCTCGCAAATAATAAAATTTTCAAAATGTCTATTATCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA--------TTTTTAAATATCGTATTATTTTTTTTTGTTTTGCTTTTTATCCTATTGGATTGAGCAAAAATTAGCAATCCAAGAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCATCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCCATATTGATTGATGCTTTATTACATTGCTTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGATGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATATAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTACTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCGATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTTGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATTGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTAGAATTTATTTTATCAACTCCTTTGCCATTAATTAAAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_eliasii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAAAACATTGGGCAAGCGTCGGGGGGCCTTCGGTCCCCTGTTTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCAGCCAACGAAATCAACCGGGCGCTGATTGCGCCAAGGAAGTTATTAACGAATTGTTCGTTCGCTTCTCGTTTTCGGGAAGCGGCGTCAGTCCGGAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTGTTCCTGACCAAACATCTCTTTACGAGATTTCTGGTTTGGGGCGGATACTGGCCTCCCGTGCCTTGTGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCCGTCACCTTAGCCAGCTCAAGGGCCCTTAGGCGCAACAAAATGTGTGCGCCTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATCAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTTATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAATAGAGGTGTTTTACCTATAGAATTTTTAGTATCCGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTCTTAAACGGATATAGGCAGATAT------AATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATACTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATAGGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACA-CAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCGAGAAGAAATCAAAAAAGGCTTTAAGATACAA-----------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTTAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTAGACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_garganica ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGAATCCTACGATAGTAGAATGACCCGCTAACATGTAAAAACATTGGGCAAGCATCGGGGGGCCTTGCGTCCCCTGTTTGCAAACCCAAGGTAGGTGTCCCCCGAC---ACCAGCCAACGAAATCAACCGGGCGCTGAATGCGTCAAGGAAGTTAAGAACGAATTGTTCGTTCGCTTCTCCTTTGCGGGAAGCGGCGTCAGTCCGAACCACGAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTGCCCTTGACCAAACATCTCTTTAGGAGATTTCTGGTTTGGGGTGGATTTTGGCCTCCCGTGCCTTGAGCATGGATGGCTCAAAAATGAGTCTTTGGCAATGGATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGCATGCCTGTTGCCTTAGATAGCTCAAGGGCCCTTAGGTGTCACAAAATATGTGCGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTCTAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATGGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATAAGATATATCTATCTATATATAAGTCTTCTCCTTCTATTTTTATTCCATGAAAATTAAAATTGGAAACACAAAAATTTCCTGAGAATTGTCCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGATAAATTGAAAATCAAAAATACTGAATAAACACTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTGTATATTCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTAAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAGAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCGAGAATAAA-AAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTTATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGGGGAGTCACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTTGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGTTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACAGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCGAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTCTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAAAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATAGAAAGGATCTGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCATTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAATATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_gummifera ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTACAAACATTGGGCAAGTGTCGGGGGGCCCTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCTGGCTCCACTGGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAAGAATGAATTGTTCGTTCGCTTCTCCTTCGCGGGAGGCGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTGCTCCTGACCAAACATCTCTTTAGGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGTGGATGGCTTAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGCATGCCTGTCGCCTTAGCTAGCTCAAGGGCCCTTAGGCGCCACAAAATGTGTGCGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAACTAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAAC-------CTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTC--ACAGAGAAGAGAGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATAT-AGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATTAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATTCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTGGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACACTAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCCAGAATAAATAAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATGTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCGAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTGAATTAAAAAGTCAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTAGATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_meoides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTACAAACATTGGGCAAGTGTCGGGGGGCCCTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTG---------TCCACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAAGAATGAATTGTTCGTTCGCTTCTCCTTCGCGGGAAGCGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCACGTTGCTCCTGACCAAACATCTCTTTAGGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGTGGATGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGCATGCCTGTCGCCTTAGCTAGCTCAAGGACCCTTGGGCGCCACAAAATGTGTGCGCTTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCAAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAA--AAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTC-AAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAATTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTAGAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_nestleri ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAAAACATTGGGCAAGTGTCGGGGGGCCTTGGATCCCCTGTTTGCAAACCCAAGGCAGGTGTCCCCTGACTCCACCAGCCAACAAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTCGCTTCTTGTTTGCGGGAAGCGGCGTCAGTCCGGAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACG{CT}ATCGCGTTGTTCCTGACCAAACATCTGTTTACGAGATTTATGGTTTGGGGCGGATACTGGCCTCCCGTGCCTTGTGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCCGTCACCTTAGCCAGCTCAAGGGCCCTTAGGCGTCACAAAATGTGTGCGCCTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTTATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATCCGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTCTTAAACGGATATAGGCAGATAT------AATCTATCTATATATAAGTCTTCCCCTTATATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATACTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATAGGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACA-CAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCGAGAATAAATCAAAAAAGGC-TCAAGATACA------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGAAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGCTTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTAGACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_tenuifolia ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTACGATAGTAGAATGACTCGCTAACATGTAAAAACATTGGGCAAGTGTCCGGGGGCTTACGGTCCCCCGTTTGCAAACCCACGGTAGGTGTCCCTTGACTCCACCAGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAACTTAAGAATGAATTTTTCGTTCGCTTCACCCTTGTGGGAAGTGACGTTAGTTCGAAACACAAAT-ACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACTCATCTTGTCGCCCCCG-CCAAACATCTCTTTTGGAGATTTCCGGTTTGGGGCGGATATTGGCCTCCCATGCCTTGTGCATGGATGGCTCAAAAATGAGTCTTTGGCGATGGATGTCGCGACATTGGTGGTTGTAA-AAAACCTTCTTGTCTTGTCGTTCATGCCCGTTGTCTTAGCCAGCTCAAAGGCCCTTACGCGCCACAAAATGGGTGCGCTTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCC-GCATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATC-TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTG-CCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCT-AAAAATAGATTAAATTTCTACCATTATTATGCTATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAAC-------CTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTC--ACAGAGAAGAGGGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATAT-AGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG-CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATTCTGTGTAACAATTTATGTTCTGGGGTTTACATATCCCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTGGATATT-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACACTAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCCAGAATAAATAAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATATAAAGGAAGCCATAATTAAGGAAAACCCCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTCAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATCAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATTCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTCTAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_thapsioides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGCAGAATGACCCGTTAACACGTACAAACATTGGGCAAGTGTCGGGGGGCCCTGTGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCTGACTCCACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAAGAATGAATTGTTCGTTCGCTTCTCCTTTACGGGAAGCGGCGTCAGTCCGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAAACCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTGCTCCTGACCAAACATCTATTTAGGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGCGTGGATGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGCATGCCTGTCGCCATAGCTAGCTCAAGGGCCCTTAGGCGCCACAAAATGTGTGCGCTTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTATAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAAATCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAAGAGAGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATAGCAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGACCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAA-AAAATGGGATATTCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACATAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCTAGAATAAATAAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAAAAAATGAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCAAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAAAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTC-AAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAATTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTAGAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_transtagana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGATAGTAGAACGACCCGCTAACATGTAAAATCATTGGGCAAGTGTTGGGGGGCCTTGCGTCCCCTGTTTGCAAACCCAAGGTAGGTGTCCTCTGAC---ACCGGCCAATGAAATCAACCGGGCGCTGAATGCGTCAAGGAAGCTAAGAATGAATTGTTCGTTCGCTTCTCCTTTGCGGGGAGCGGCGTCAGTCCGAACCACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCATGCATCGCGTTGCCCCTGACCAAACATCTCTTTAGGAGATTTTTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTCGTGCATGGCTGGCTAAAAAATGAGTCTTTGGCGATGGACGTGGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGCATGCCTGTTGCCTTAGCCAGCTCAAGGGCCCTTAGGCGTCACAAAATATGTGTGCTTGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTCTAAAATAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATGGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATAAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGTCCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGATAAATTGAAAATCAAAAATACTGAATAAACACTTGATTAGTTATGTATCATTTTTTAGTTTCTTGTGTCATTAGGAAAAAAATTGTATATTCCAAATCCAAGACTCATTCATGAATTTGAAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAGAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGGCCCTTCTTTTCGGAAACCGAGAA-AAA-AAAAAAAGGCTTCAAGATACAAGTAAAAAGAGGTTCAGTAATCCACCCCCTTAAGCAGGAAAATTTCCATCTATTTTTTTATTATTTGTGTGATTTGATCGAAATTCTTATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGGGGAGTCACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTTGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGTTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCGAAATATAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTCTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAAAAACTATGGATTCCTCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATAGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCATTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAATATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGCGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA Thapsia_villosa ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTAATAACATTGGGCAAGTGCAGCGGGGCCTTGGGTCCCTTGCTTGCAAACCTAAGGCAGGTGTCCACTGACTCCACCTGCCAATGGAATCAACCGGGCGCTGACTGCGCCAAGGAAGTTAATAACGAATTGTTCGTTCGCTTCTTGTTTGAGGGAAGCAGCGTCAGTCCGGAACATAAATGACTCTCGGCAACGGATATCCTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTGTTCCTGACTAATTATCTCTTTAAGAGATTTCTGGTTTGGGGCGGATATTGGCCTCCCGTGCCTTGTGTGCGGCTGGCTCAAAAATGAGTCTCCGGCGATGGAAGTCGCGACATTGGTGGTTGTAAGAACACCTTCTTGTCTTGTCGTGTATGCCCGTCCCCTTAACTA{AG}CTCAAGGGCCCTTAGGTGCCACAAAATGTGTGCGCTTAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGCATTTCCCATCTTCTAAAATAGAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGAATCTAGCAATGATGGAATTTTTATTATGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTATACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGATATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATGGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATAGATTCCATTGTTCAAAGAAAAGGATTCATACAGAGAAGAGAGTTTTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAGAGGGGTTGTATTTATTAAACAGATATAGGCAGATATCAGATATATCTATCTATATATAAGTCTTCCCCTTCTATTTTTATTCCATGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGAGGCATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATCCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATATATATTGTTATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGTATCATTTTTTAGTTTCTTATGTCATTAGGAAAAAAATTGTATATTCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCCATCCACT--TTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACATTAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGTTCCTTTTTTTCGGAAACCCAGAATAAATAAAAAAAGGCT----------------------------------------------------------------------------GTGTGATTTGATCGAAATTCTGATTTTACAGATGATTCGGAATGAAACTCTGTTATCCCATTCCGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAACAAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAGAAATAAATTAAGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCAATAATTTCACATTTTTTTGAATAAAGAATTCAAAAAATCTAAATAAAAAGGAAGCCATAATTAAGGAAAACCTCCTTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGATATCCTATAGAGGATCCTATCCCAATGATCCGGTGTGGATTTTT--------ATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTACATGATGGAGCTCGGGTAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGATTTTATATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAAAAGGATCCCAGAACAAGGAAACGCCGTTTTTCAATTGTCTCAATAACTGTATAATCTATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAA----TTTTTCAGGAAGGGGGAAGAAAAAATGAGTTAAATCCCATTATAATTTTTTTTATCAACTCCTTTGCCATTAATTATAATTCTATACGTAGACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTACTTAGATCTATCCCAA ; END; BEGIN SETS; CHARSET rpoC1 (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 2882-3607; CHARSET rpl16 (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 1049-1622; CHARSET ETS (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 1-456; CHARSET ITS (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 457-1048; CHARSET rps16 (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 3608-4438; CHARSET rpoB (CHARACTERS = Daucus_Molecular_matrix_trimmed) = 1623-2881; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M51398] TITLE Daucus_Molecular_matrix_untrimmed; LINK TAXA = Taxa1; DIMENSIONS NCHAR=6043; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anthriscus_sylvestris --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCTC---AAGCGGAATGACCCGTTAACTCGT-TAAAACATCGGGCAAGCGTT--AGGGGG-CC--CAAGGTCCCCTCTTTGCGATCCCGTGGTGGTTGT-CCCCTCAC--GGGTGTCA-ACCAACCAAATAAATCAACCGGGCGCTGACGGCGCCAAGGAAAT-TAATATTGAATTGATTGTTAGCTTCTCGTTCGCGGGAAGCGGCGTC--AATCTGAAACAC-AAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTAGTTGCCCCCTGACCAAACTAATCTTCTAAGA-GAT-TTT-GTCGGTTTGGGGG-CGGAAATTAGCCTCCTGTGCCATGT--TGTGCGGCTGGCGTAAAACTGAGTCTATGGTGACGAATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTCCGTC-ATCTTATACG-GCTCAATGACCCTTAGGCGCCAA--AAAC-TTTG-GCACTTCGA-------------------------------------------------------------GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTATTCATTTGTATATCTTGC-TTTTTAGATAACTAAGCATATTAA-T------ATTTTATATTTTTAAATATTGTATTCTTTTTTTATGTTATAACGAATATTTATTTTGTTTT-----TTATCCTATTGGATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTAGTCGCTATTTTAGTTGGAGGGTTAACTCATGACTTTTATTTTCCCAATATATGAAGGAATAAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGATTTGGATTCATAGGTTACATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTATACAATGGAGCCCGTAATGAAATTTTTT-TTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTTTATTCTATTAACGGA-----TTTTTTTTTTATGAATCC------ATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCAT-TTATAAAAT--AAAAAAATCCCACAATTCACTCATTCTTCATGGAATCATATAGATG--ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATAAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGTAAATAAATTTATAAAACATT--CCTGTAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTTTATAAAATATC---AAAATAGATTAAAATTCTACCATTATTATGAT---------ATTACATAGTCCAATCTG--CTTGAATACCAGAAAAATGAATGGATTTGGCATTTGATCTTTTCGATAAGATAAAACA-TAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTC----------------------------------ACATAGAAGAGAGGTGTTTTACCTATATAATTTTTAGCATACGCTAAGGATTGT-------------------GGAGTATATAAGAGGGGTTGTATTTTTTATTAAACAGA-TATAGT--------AAGATATATC------TATCTATATATAAGTCTTCCCCTTCTTTT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGATAATTC----------------------------CCTATAGGC------------AACATATAGAAATAAGAAAACCTATTAGATAT--------------------------------------------------------------------------------CCGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCGAAATGGATAAATTGAAAATAAAAAATACTGAATAAACAC-TGATTGGTTATGT------ATCCTTTTTTAGTTTCTTGTGTCATTAGGAAAACAAAATTTGATATT--CAAATCCAAGATTAATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCAC------ATTTCACTTTTCAATATAAAAA-------AGGTGGGGGTAAGTTTTTAGGCATTGTGTTTGTGTATTTTGAGATACTATACAAT----AAATCGAAGAAGTGGATCCAATTAAATCAAAAAGAGGAGAGGG-CCCTTCTTTTCGGAAA----AGAATTAAT-----AAAAATGGGCTTCAAGATACAAGTACAAAAAAGGGGGTTCAGTAATCCAC----------------------CCTTAAGCAGTAAAATTTACATCTTT-TTTTG-TATTCTTT---------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAACGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCATAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCCTTCTTTTATATTCTTTTTTAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCTATCGCATATAG------ACTTTA--GGCGTCGTGGCATAACCGTCGAGGCGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCGCTTAAATTAAAATTCAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTAACA-CTTTTTTTTTTTATTTTTGAATAAATAATTA-AA-------AAAA-TATAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT--------GGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTATTACATCCGCCATCTTTTCTATGAATGAAGGTGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGACTCCTTATTTTTGTTAGGTTGTAATGAAGAATATAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAAGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATCTAAATCGAAAGGATCCAATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATAGAGCGCGTATATTATTCTTTGAT-------AGA-----------AAGAAATCACAATAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACGG---------------ATTTAAAAC---AAAGAAA----AAAGGATCCCAGAACAAGGAAACGCCGTTTTTTCAATTGTCTCAATAACTGTATAAT----------------------------------------------------AATAA---------------------TATAATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAA--AAATAAATTGCCTAAATA----TTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTTTC------AGGAAGGGGGAAG---AAAAAAAGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTATATATGTAGACAAAAACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGCCTTATTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_annuus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGC-AAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAAT-AAAATGCACAAGACGAATTAGGGAC--TATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCATCTGAGGGCAT-CTTTCACAACTCTCTGACT-TAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAA------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTTTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-TGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA-----------------------------------------------------------------------------------------------------------------GAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTTTTTATTTTAATATAGTATTATTAT---------------------TTTATTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT-AAAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-CATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTCCATATCTGGAATAGAATATATGAAATACGTATTAACTATGAACGGGAGAATAAATAAAATCCTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAACATTGCCCTGGAAACAGAATTCTGCTACTTAGGCTTATGAAGTTATGGAATTTTGTATAGAATATCTCCAAAATAGATTCCATTTCTACCATTATTATGATATTAAATCGATTACATATTCCAATCTGTACTTGAATACAAAAAAAATGAATGGATTCGGCATTTGATCTTTTCAATAAGATAAAACAGTAGAACTCA------------------------TTTTTAGTACTTAAACACATTTATA--GTATTCAATTTTTCAAAGAAAAGGATTC----------------------------------ACATAGAAGAGAGGTGCTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT------------------TGAGGTATATAAGAGGGGTTGT------------ACAGA-TATAGGCAGATAT-GAGATATCTCTATCTATATCTATATATAAGTCTTCCCCCTCTATT-------TTTATTCCATTTAAAATTCAAATTGGAAACACAAAAATTTCCTGAGAATTC----------------------------CCTATAGGGAACATATTTAAAAAAATATATAAATAAGATAACCAATTTGATAT-------------------------------------------------------------------------------GCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGT------ATCATTTTTGAGTTTCTTGTGTCATTAGGAA---AAAATTGGATATTC-TAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCCAATTTGT-CCATCAAGTTGTTTTTTGTGACTAAAAATCTACATTTTATTTATACTTTTCAATTTCAACAAGTATAAAAGAGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCA-GCAATCGAAGAAGTGGCTAAAATTAAATCAAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACCGCAGAATAAAT------AAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCC--------------------TCTTAAGCAGGAAAATTTCCATCTAT-TTTTT-TATTATT----------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT-GGGGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C--TTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAAATTGTATAATCTATATCTATAAT--------------------AA---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_arcanus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAACGACCTGTTAACATGT-ATAAACCACGGGCAAGCACT--GGGGGT-CC--TCGGGTCCACAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAC--GGGTGTCC-ACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTCC-TCCGCATCCCGTTCACGGGATGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAGAAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCTCCCGG-AGA--TC-TTCTATTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTCTG-TGTGCGGCTGGCTGAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCACC-ACCGTAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTCTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACA{AG}GAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAATTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_aureus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACACTGGGGGCGCAGC--TGGGTG-CCATTTGGTCCCCCCGTTCGCAAACCCAAGGCGGGTGT-CCTCCTAT-GTGGTGGCA-CTTGTCAAAAAAACTCAACTGGGCGCTAGCTGCGCCAAGGAAGT-AGATGATGAATTGTCCGTCCGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCGTGGG-AGA-TTTACTTTGTTTAGGGG-CGGAAATTGGCCTCCCGTGCCGTTTGTTGCGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGTGCGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GTGCCCACC-GCAGTTGGGA-ACTCGAGGGCCCTTGGGCACTAC-AGAAA-TGTGTGCCCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CT--------------------------------------------------------------------------------------------------TGAGTTGGTACGGAAAT---------------------------------------------------------------------------------------------AGGATCCCCAATCGCCGGAGATAA-------AAGGTTAATATGAGAAAACATAAGTAAACGTGCTTCCGCTTGAGCCTC----AAAAGA---------------------------------------------------------TAAAGGCACATGAACAGCCATTTGATCCCCGTCAAAGTCTGC-------------------------------------------------------------------------------------------------ATTGAATCCTTTACGAAC--TAATGGATGTAAAC-------------AAATAGCACGACCCTCCACTAAAACAGGCTGGAATG--CCTGTATACCTAATC---------------------------------------T---------------------------------------------------------------------ATGCAGAGTAGGTGCTCTATTTAGCAATACAGGATGC---------------------CCCCGCA------TAACTTCCCGAAGTATTT----------------------CCCATACAATCGGTTTT----------------------------TTTTCCCAAATTTTACTCTTAGCAACTCCTATATTCGAAGCAAGCTGTTGTCTAATTA------------GACTACGAATTACAAATGTCTGGAAAAGCTCTATTGCTATTTCGCGGGGCAATCCGCATTGATATAAT--GAAAGTGAGGGGCCCACG-------------------------------------ACAATGACGGAACGCCCTGAATAATCGACTCGTTTGCCAAGCAAAGTCTGGCGAAATC-TTCCCT---------------------------------------------------------------------------GTGCGACTTGAAGGACACGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATCGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAACGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAATAATA----------------TATATATATAATAATAAAGATTAAATGA{AG}ACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAT------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT--------------------------------------------------------------------------------------------------------------- Daucus_bicolor --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACCCCGGGCAAGCATT--GGGGGT-CC--TTGGGTCCCCAGTTTGCGAACCCGAGGCAGTTGT-CCCCTTAT--GGGGTTCC-ACTGCCTAACGAAATCAACTGGGCGTTAGACGCGCCAAGGAACT-AAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAATC--ATCTCTCTCGG-AGATTTT-TTTTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGATGGCTCAAAAATGAGTCTCTGGTGATGGACGACACAACATCGGTGGTTGTAACAAGACCTTCTTGTGTTGTTGTGC--GAGCCCACC-ACCGTAGGAA-ACTCGAGGGCCCTTAGTCACTAC-AGAAA-TGTGTGCACTTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAT---------AAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTTAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTC-GGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTT-ATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TC-----T---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_bischoffii TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGC-AAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAAT-AAAATGCACAAGACGAATTAGGGAC--TATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCATCTGAGGGCAT-CTTTCACAACTCTCTGACT-TAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAA------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-TGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA----------------------------------------------------------------------------------------------------------------------------CTCATCCAGCTCCTCGCAGAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTTTTT-TTTTAATATAGTATTATTAT---------------------TTTATTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTCA------------ATAAACCTTACATATGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAAATTGTATAATCTATATCTATAAT--------------------AA---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGAGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_carota_subsp_azoricus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACTCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_carota_subsp_carota --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTCCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT---TGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_carota_subsp_gummifer --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAA-TATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG-AAAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_carota_subsp_halophilus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACTCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT---GGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_conchitae --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACCTCGGGCAAGCATT--GGGGGT-CC--TTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAT--GGGTGTCC-ACTGCCTAACAAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCTTCTGG-AGA-TTT-TTCTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTCTG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCGCC-ACCGTAGGAA-ACTCGAGGACCCTTAGGCACTAC-AGAAA-TGTGTGCATTCGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{ACG}{AG}CGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAATAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAAAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCCTTTGGTCTACGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT---{GT}GGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGAAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTGGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACC{CT}ACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_decipiens TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGACGGCCAAGCATGAGC-AAAAGATACATTAGCATCCTTTAATCAACACAAGGCACAACGGACTTCCGTAAGGGACAACTATCTCGGAAAAGTATGGGCCAAGACCATAATCGATTACTGGTTCCGCATTCAAGATTTCTCTCTACACATGGACTTCCGACACTTAC-AAGACCAAAAGTAAATGAAAGGACGAAAGACCATGTTAGATTCATTGGCAGTCTCGCACAAAAT-AAAGTGCACGAGACAAATTAGGGAC--TATGGGACATCGAAATTCCATCATAATAGGTATACTGCGCAGGGCACCAATCTCATCCGAGGGCGT-AATTTACAGCTCTCCGACA-GAATGAACATGTAAGACCAAACAGTTGTCGCTGCCGAGACAGGGATCCAACCGACCGGGACA------------------------------------------------------TCGAATCCTGCGATACTACTAGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCATC--GGGGGG-CC--TTTGGTCCTCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTTAT-TGGGTGTCC-CCCGCCTAACGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTCCGCATCTTGTTCGCGAGAAGCGGCGGC--AGTCTAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAATC--ATCTCCTTGGG-AGA-TAT-TTTTGTTTAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCATGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCACT-ACAGTAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGA-----------------------------------------------------------------------------------------------------------------GAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTTAAATATCGTATTATTAT------------------TTATTTTTTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTAGTTATATTGCGAATCTTTTAGATAAACCTCTTAAAGAATTAGAAGGCCTAGTATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAA-TC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTTTGGGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAGGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAGGTTGGAAGACGAAAGGATTTTTTGGTCAGACGTATGGAATTAGCGAAGCGTGCGACTTGAAGGACACGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATTCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTAT--------------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAAGGGATTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TCTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGTTGCAATTGATGTTCGATCCCGAAGAGAAGGAAGAGATTTTCGGAACGTAGGTTTTTATGATCCGATAAAGAATCAAAGTTATTTAAACGTT Daucus_dellacellae --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCAAC--CGTGGG-CC--TTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGT-CCCCTTAT--GGGTGTCC-CCCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAAAAATGAATTGTTCATCCGCATTTCGTTCGCGGGAAGTGGTGGC--AGTCCAAAACAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTTAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCTAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTGAATTGTCTCAATAACTGTATAATCTAT---------ATCTATAATAATAATAAAGATAAAGATTAAA---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATC--------------------------------------------------------------------------------------------- Daucus_durieua --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACCCCGGGCAAGCATTTGGGGGGT-CC--TCGGGTCCCCGGTCTGCGAACCCAAGGCAGTTGT-CCCCTTGC--GGGTGTCC-ACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATCGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCCTTGGG-AGA-TTT-TTTTGTTCGGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGCTGGCTCAAAATTGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTCTTGTTGTTGTGT--GAGCCCATC-ACCGTAGGAA-ACTCGAGGGCCCTTAGGCACTAA-CAAAA-TGTGTGCACTTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTTTG-GGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGAATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATAACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTAGAATCTAT---------------------------------------A---TCTATAATCTA--------------------TAATATAATAATAAAGATTAAATGAGACAAAAAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGCAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TCTAATTGATTTTATAAACTCCT------TTGCCATTAATGAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_edulis TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCAAGCATGAGC-AAAAGATACATTAGCATCCTTTAATCAACACAAGGCACAACGGACTTCCGTAAGGGACAACTATCTCGGAAAAGTATGGGCCAAGACCATAATCGATTACTGGTTCCGCATTCAAGATTTCTCTCTGCACATGGACTTCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGAAAGACCATGTTAGATTCATTGGCAGTCTCGCACAAAAT-AAAGTGCACGAGACAAATTAGGGAC--AATGGGACATCGAAATTCCATCATACTAGGTATACTGTGCAGGGCACCAATCTCATCCAAGGGCGT-AATTTACAGCTCTCTGACA-GAATGAACATGTAAGACCAAGCAGTTGTCGCTGCCAAGGCAGGGATCCAACCGACCGGGACA------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCATC--GGGGGG-CC--TTTGGTCCTCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTTAT-TGGGTGTCC-CCCGCCTCACGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTCCGCATCTTGTTCGCGGGAAGCGGCGGC--AGTCTAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAGTC--ATCTCCTTGGG-AGA-TTT-TTTTGTTTAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCACT-ACAGTAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGA------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTGATATTTTTAAATATCGTATTATTAT------------------TTCTTTTTTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCCTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCC--------------TGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTTT---GGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAGGGAAACTTTCACGTCCGGTTTTGAAGGGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTAC{AG}ATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATTCCAGAACAAGGAAAGGCCG-TTTTTAAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTAT--------------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGATTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCCTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_elegans TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCAAAGGCCTAGCATGAGC-AAAAGATACATTAGCATCCTTTACTCAACACACGGCACAACGGACTTCCATAAGCGACATCTATCTCCGAAGAGTATGGGCCAAGACCATAATCAATTACTGGTTCCGCTTTCAAGATTTCTGACTATACATGGACTTTCGACTCTTAC-AAGACCAAGAGGAAATGGA--GGCCGAAGACCATGTTAGACTCATTGGCAGTCTCACACAAAATAAAAAGGCACGAGACAAATTAAGGAC--TATGGGACATCGAAATTCCATCATAACAGGTATATTGCGCAGGTCACCAATCTCATCCGAAGTCAT-AATTTACAGCTCTACGACA-GAATGAACACGTAAGACCAAGCAGTTGTCGCTGCCTAGACAGGGATCCAACCGCACGGCACA------------------------------------------------------TCGAATCCTGCGA---TACTAGAAGGACCCGTTAACATGT-AAAAACACTGGGCAAGCAACG-GGGGGG-CC--TTTGGCCTGCTGTTTGCAAACCCAAGGCAGG-GT-CCCCAAAT--GGGTGTCC-CCTGCCTAATGAAATCAATTGGGCGTTGAATGCGCCAAGGAAGT-GAGTAATGAATTGTTCGTCTGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCTAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CTCCTGACCAATC--ATCTCCTTCGG-TGA-TTT-TTTTGATTAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGTGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAAAAGACCTTCTTGTGTTGTTGTGT--ATGCCCATT-GTAGTAGGGA-ACTCGAGGGCCCTTAGGCACTAC-GAAAA-TGTGTGCATTTTGA------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GACTAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGTTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTTAAATATTGTATTAGTAT---------------------TTATTTTATT-----TCTTTTTATCCTGTTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACGAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA-TTTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATCAATCC------ATATTGATTGATGCTTTATATTACATTGC----TTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------TAAA-----GAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGCAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGAGACCTAAAAGATTTAATGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAG-AAGGGAAGCCAAAATTAAGGAAAACGTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT-----GGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCTTTA------CTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCGTTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTACTGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGGTCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGGAATTGGGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAATAAT--------------------AATAATAAAGATAAAGATTAAATGAGATAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGC----TTTTTTC------AGGAAGGGGGAAG--ACACAAATGAGTTAAATCCCGT---------TATAATTGATTTTATCAACCCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_glochidiatus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACCCCGGGCAAGCATT--GGGGGT-CC--TCGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAC--GGGCGTCC-ACTGCCTAACGAAATCAACCGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTTCGTCCGCGTCCCGGTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCCTTCGG-AGA-TCT-TTTTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTCCG-CGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCACC-ACCGTAGGAA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAATAAAAAAAAATCCCAATATTCACTCATTATTCATGGAATCATATGGATG-GATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTGCATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCGTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAATATTGGCCTGGAAACAGAATTCTGCTACTTAGGCTTATAAAGTTATGGAATTTTGTATAGAATATCTCGAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTCCATATTCCAATCTGTCCTTGAATACCAAAAAAATGAATGGATTCGGCATTTGATCTTTTCAATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTC---------------------------------CACATATAAGAGAGGTGTTTTACCTATAGAATTTTTAGTCTACGCTAAGGGTTGT-------------------GAGGTATATAAGAGGGGTTGT------------ACAGA-TATAGACAGATAT-AAGATATCTC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTGGAAAGAAAAAAATTTCATGAGAATTC----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTTGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGTTATAATATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTGAGTTTCTTGTGTCATTAGGAA---AAAATTGGATATTC-AAAATTCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCCAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATATACATTTTAATTATACTTTTCAATAATAACAG------AAGCGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCA-CAAATCGAAGAAGTGGATAAAATAAAATCAAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC-AATAATAAAA------AAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCT--------------------------------AAATTTCCATCTAT-TTTTT-TATTATTTTC-------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATTCTTTATTC-AA-------AAAA-TATAAATATAAAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT------TGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT------------------------------ATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTCTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCATTCTAATTGATCTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_guttatus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACATCGGGCAAGCATT--GGGGGT-CC--TCGGGTCCCCAGTTTGTGAACCCAAGGCAGTTGT-CCCCTCTC--GGGTGTCT-ACTGCCTAACAAAATCAACTGGGCGCTTGACGCGCCAAGGAAAA-AAATATTGAATTGTTCGTCTACATCCCGTCCATGGGAAGCGACGAC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCTCTCGG-AGA-GCT-TCTTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTTCG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGAATACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGTCCACC-ACCGTAGGAA-ACTCGAGGGCCCTTGGGCACCAC-ATATA-CGTGTGCACTTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTAACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT------TGGGGGGGCTCGATAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAATAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAATATAT----------------CTATAATATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG-AAAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTCAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_incognitus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAATACCCTGGGCAAGCATC--GGGGGG-CC--TTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCCTAC-GGGGTGTCC-ACTGCCTAATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTTGCATCCCGTTCACGGGAAGTGGCGGCAAAATCTAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCTGTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTG-CCCCTGACCAAGC--ATCTCTTTGTG-AGA-TTC-TTTTGTTCTGGGG-CGGAGATTGGCCTCCCGTGCCTTGTG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGCTGTGT--ATGCCCACT-ACTGTAGGAA-ACTCGAGGGCCCTCAGGCACTAC-AAAAA-T-TGTGCACTTCGA-------------------------------------------------------------GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTAAAATATTGTATTAATAT--------------------------------------TTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCAATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTAGGAGATGACTC-------------ATAAACCTTACATATTAGATGGAATTTTATATCGTTGTTTTTTCTCCCCTTC------TTTCACCCTCCCGTTTATCCACATCTTTCTTCTTCTCTTCACAACTTAGAATCATATTTTTTCTTTTGTTTATGCAAAAAAGATTTCAGTTGCTACAGCGATATGACTGATATATCATATCTTGACTGTTTTTTTGGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTC------TATAGTTATTTGTTTATACAAAAAAAGCCGGTCTTTTTTTTCTTTAATCCTAACCCTAAAAAACCAACGAGTCGCAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTGTATTTTACAGATGATTTAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAATAAATTAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAATAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAAGAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT----GGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA------CTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGACTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTAGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATTATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTTAATAACTGTATAATCTAT---------------------------------------A---TCTATAATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTATTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTACT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_insularis TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGC-AAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAAT-AAAATGCACAAGACGAATTAGGGAC--TATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCATCTGAGGGCAT-CTTTCACAACTCTCTGACT-TAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTAGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGCATGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTTTCGTTCGCGGGAAG-GGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCTGGCTCTC-GCATCGATGAAG-AACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGATTGTGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGGAGGA-----------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAATT-------TTTTTTTTATTTTAATATAGTATTATTAT---------------------TTTATTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAAATTGTATAATCTATATCTATAAT--------------------AA---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGTTGCA--------------------------------------------------------------------------------------- Daucus_involucratus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAATCATCGGGCAAGCATT--GGGGGT-CC--TTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAT--GGGTGTCC-ACTGCCTAATGAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTTCGTCTGCATCCCGTTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTG-CCCCTGACCAAGC--ATCTCTTCTGG-AGA-TTT-TTCTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTCTG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCGCC-ACTGTAGGAA-ACTCGAGGACCCTTAGGCACTAC-AGAAA-TGTGTGCATTTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA------AAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAAAAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTATTAACTTGAGTAAAGAGTAGATCTTTTTTTT------TGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTATATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGAAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCTACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_littoralis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACTTCGGGCAAGCATT--GGGGGT-CC--TTGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAC--GGGGGTCC-ATTGCCTAACGAAATCAACCGGGCGCTAGACGCGCCAAGGAACT-AAATATTGAATTGTTCGTCCGCATCCCGTTCACGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAATC--ATCTCTCTTGG-AGA-TTT-TTTTGTTCGGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGATGGCTTAAAAATGAGTCTCTGGTGATGGACGACACAACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCACC-ATCGTAGGAA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACATATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAACTAAATTTCTAAAACATTGACCTGTAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCA-AAAAATGAATGTATTCGGCATTTGATCTTTTCAATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTAA--------------------------------GACATAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAG--------GAGGGGTTGT------------ACAGA-TATAGACAGATAT--AGATATCTC------TATCTATATAGAAGTCTTCCCCTTCTATT-------TTTATTCCATTGAAAATAAAAATTGGAAACAAAAAAATTTCCTGAGAATTC----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTTGATAT-------------------------------------------------------------------------------GCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGTTATAATATAATCAAAATGGAGACATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGT------ATCATTTTTGAGTTTCTTGTGTCATTAGGA----AAAATTGGATATT--CAAATTCAAGACTCATTCATGAATTTGCAGCCAGGAGTAAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCTACATTTTAATTCTACTTTTCAATAATAACAA------AAGCGAGGGGAAGTTTTTAGGCATTGTGTTTATGTGTTTTGAGATACTATACAATCA-AAAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTCCTTTTCGGAAACC-CATAATAAAT------AAAAAA-GCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCC--------------------------------AAATTTCCATCTAT-TTTTT-TATTATTT-C-------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTAT---------AAAA-----AAAATGAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT----GGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_mirabilis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAA---TACTCGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCAAC--TGCGGG-TC--TTTGGTCCCCTGTCTGCAAACCCACGGCAGGTGT-CCCCTTCT--GGGTGTCC-CCTGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGATGTAAAAAAATGAATTGTTTGTCCGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTTACAAATC--ATCTCCT{CG}GAG-AGA-TTT-AGATGTTTAGGGG-CGGAAATTGGCCTCCCGTGCCTCTGG-TGTGCGGTTGGCTCAAAAATGAGTCTTTGGTGATGGGCATCATGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCACA-CCAGTAGGAA-ACTCGA-GGCCCTTGGGCACTAC-AAAAA-TGTGTGCACTTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Daucus_montanus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAGGGCCAAGCATGATC-AAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACGACGGACATTCGTGAGGGACATTTATATCGGAAAAGTACGGGCAAGGACCATAACCGATTACTGGTTCTGCATTCAAGATTTCTTGCA--ACATGACCTTCCAACACTTACAAAAACCAAAAGGAAATGAAAGAGAGGGAGGCCATGTTAGATTCATTGTCAATCTCGCACAAAAT-AAAGTGCGCGAGATTAATTAGGGAC--TATGGGACTGTGACATTCCATCATAAAAGGTATATTGCGCAGGGCACCAGTCTCATCCAAGGGCCTAATTATAAAGCTCTCCGACA-GAATGAACATGTAAGACCAAGCGGTTGTCGCTGCCAAGACAGGGATCCAACCAACCGGGACA------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-ATAAACCCCGGGCAAGCATT--GGGGGT-CC--TCGGGTCCCCAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAC--GGGTGTCC-ACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTTCGTCCGCGTCCCGGTCACGGGAAGTGGCGGC--AGTCTACAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCTTTCGG-AGA-TCT-TTTTGTTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTCCG-CGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGCGTTGTTGTGT--GAGTCCACC-ACCGTAGGAA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGG------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTAAAATATTGTATTAATAT--------------------------------------TTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGGTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATAAAAGAACTAGTCT{CT}TGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTAAATTTTTTC---AGCCAATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTC--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTAGATGGAATTTTATATCGTTGTTTTTTCTCTCCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATA------AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCGATAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT------------------------------ATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TCTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCAAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_muricatus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCTGTGAACATGT-AAAAACACTGGGGAAGCAAT--GGGGGG-TC--TTTGGTCTCCGGTCTGCGAACCCAAGGCAGGTGT-CTCTTTAT--GGGTGTCC-CCTGCCTAACGAAATCAACTGGGCGCTTAATGCGCCAAGGAAGT-AAATAATGAATTGTCTGTCCGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCTAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTAACCAATC--ATCTCCTTGTG-AGA-TTTATTTTGTTTAGAGG-CGGAGATTGGCCTCCCGTGCTGTTTG-TGCGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACAACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCCCC-ACAACAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AGAAA-TGTGTGCGCTTGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCTATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT-------GGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTTAATTGTCTCAATAACTGTATAATCGAT---------------------------------------A---TCTATAATCTA-------------------TAATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TAGAATTTATTTTATCAACTCGT------TTGCCATTAATTTAAATTCTATACGTAT------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_pumilus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCAAC--TTCGGA-CC--TGTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGT-CCCCTTAT--GGGTGTCC-CCTGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTCCGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCCAAAACACTAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCCGG-AGA-TTT-ATTTGTTTAGGGG-CGGAAACTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCGCC-ACAGTAGGGA-ACTCGAGGGCCCTTGGGCACTAC-AAGAA-TGTGTGCACTTCGA-------------------------------------------------------------GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTT--TTTTTTAAATATAGTATTATTATT-----------------TTATTTTTTTTTT-----TCCTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAAAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAAATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAACCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTTC------TTTCACCCTCCCGTTTATCCACATCTTTCTTCTTCTCTTCACAACTTAGAATCATATTTTTTCTTTTGTTTATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACTGATATATCATATCTTGACTG-TTTTTTGGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTATAGTTATTTGTTTATAC-AAAAAAGCTGGTCTTTTTTTTCTTTAATCCTAACCCTAAAAAACCAACGAGTCGCAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGCGACTTGAAGGACACGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTCTGTGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATT-TAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTTAATTGTCTCAATAATTGTATAATCTAT-----------------------------------------------------------------------------AATAATAATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGTTGCAATTGATGTTCGATCCCGAAGAGAAGGAAGAGATCTTCGGAACGTAGGTTTTTATGATCCGATAAAGAATCAAAGTTATTTAAACGTT Daucus_pusillus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCAAGCATGATCAAAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACAACGGACATTCGTGAGGGACATTTATATCGAAAAAGTACGGGCAAGGCCCATAATCGATTACTGGTTCTGCATTCAAGATTTCTTGCA--ACATGACCTTCCAACACTTAC-AAAACCAAAAGGAAATGAAAGAGAGGGAGGCCATGTCAAATTCATTGTCAATCTCGCACAAAAT-AAAATGCACGAGATTGATAAGGGACTATATGGGACCTTGACATTCCATCATAAGAGGTATATTGCGCAGGGCACCAATCTCATCCAAGGGCCTAAATATAAAGCTCTCCGACA-AAATGAACATGTAAGACCAAGCGGTTGTCGCTGCCAGGACAGGGATCCAACCAACCGGGACA------------------------------------------------------TCGAATCCTGCGA---TACTAGAACGACCTGTTAACATGT-ATAAACCACGGGCAAGCACT--GGGGGT-CC--TCGGGTCCACAGTCTGCGAACCCAAGGCAGTTGT-CCCCTTAC--GGGTGTCC-ACTGCCTAACGAAATCAACTGGGCGCTAGATGCGCCAAGGAACT-AAATATTGAATTGTCC-TCCGCATCCCGTTCACGGGATGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAGC--ATCTCTCTCGG-AGA--TC-TTCTATTCAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACAACACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--GAGCCCACC-ACCGTAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGG------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTAAAATATTGTATTAATAT--------------------------------------TTTTTATCCTATTGGATTGAGCAAGAATTATCAATTCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATAAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTC---AGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTGTTTTTTATAAATCCATATTGATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTAGATGGAATTTTATATCGTTGTTTTTTCTCCCCTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTGCGATGTGTGATTTGAT-CG-AATTCTG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATT--------CC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAAGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCATGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCAT-ATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AAAAAATATAAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGTTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAACTCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC----------------------------------------GATCCGGTGTGGATTTTGATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGTAGAGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTCTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAATTATGGGTACAAATGA---TTTTTGTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TGTAATTGATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_rouyi TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGC-AAAAGATACGTTAGCATCATTTACTCAACACAAAGCGGAACGGACTTCCGTAACGGACATATATCTCAGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTCAGTCTCACACAAAAT-AAAGTGCACAAGACGAATTAGGGAC--TATGGGACATCAAAATTCCATCACAATAGGTATATTGCGCAGGGCACCAATCACATCTGAGGGCAT-CGTTCACAACTCTCTGACT-TAATGAACATGTAAGACCTAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGACA------------------------------------------------------TCGAATCCTGCGA---TACCAGAATGACCCGTTAACATGT-TAAAACACTGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGT-CACCTTAT--GGGCGTCC-CCCGCCAAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTCCGCATCTCGTTCGCGGGATGTGGCGGC--AGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGCAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTACCCAAAC--ATCTCCTCGGG-AGA-TTT-ATTTGTTTAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACTACAAAAAA-TGTGTGCACTTCGA------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTT-----TTTTAATATAGTATTATTAT---------------------TTTATTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACAGATTCGTTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTATATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAAAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAAACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------AAAA-----TAAATTAA-GGAAATACCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTTT-TGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCCTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTCAGACGTATGGAAT--------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTTAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_setifolius --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGACCCGTTAACATGT-AAAAACACTGGGCAAGCAAC--TGGGGG-CC--TTTGGTCCCTGGTCGGCAAACCCAAGGTAGGTGT-CCCCTTTT--GGGTGTCC-CCCGCCTAACAAAATCAACTGGGCGCTAAATGCGCCAAGGAACT-AAATAATGAATTGTTCGTCTGCATCTCGTTCGCGAGAAGTGGCGAC--AGTCGAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CTCCTAGCCAATC--ATCTCCTTGGG-AGA-TATATTTTGTTTAGGGG-CGGAGATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGTCCACC-ATAGTAGGGA-ACTCGAGGGCCCTTGGGCACTAC-AAAAA-TGTGTGCACTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGAAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTT-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAAGCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGTTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCGAGAATTTCAAAGTTTGAACTCCGTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGAATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTACTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATGGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATGGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCA-TTTTTAAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTAT-----------------------------AATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTGTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATTG-------------------------------------------------------------------------------------------- Daucus_syrticus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACCTGTTAACATGT-AAAAACACTGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCCTTTTGCAAACCCAAGGCAGGTGT-CACCTTAT---GGTTTCC-CTTGCCTAAGAAAATCAACTGGGCGCTAGATGCGCCAAGGAAA--AAATAATGAATTGTTCGTCCGCATCTCGTTTACGGGAAGTGGCGGC--AGTCTAAAATAAAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-CGGAAATTGGCCTCCCGTGCCTTTTG-CGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATTGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGC-ACTTGAGGGCCCTTGGGCACTGCAAAAAA-TGTGTGCACTTTGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT----GGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTA{CT}GGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC----------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCACGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAATCTAT---------------------------------------A---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Daucus_tenuisectus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TACTAGAATGA-CCGTGAACATGT-AAAAACACTGGGCAAGCAAT---GGGGG-CC--CTTGGTCCCCTGTCTGCAAACCCAAGGCAGGTGT-CCCCTTAT--GGGTGTCCTCCTGCCTGATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGT-AAATAATGAATTGTTTGTCCGCATCTCGTTCGCGGGAAGTGGCGGC--AGTCTATAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTG-CCTCTGACAAATC--ATCTCCTTGGG-AGA-TTTATTTTGTTCAGTGG-CGGAGATTGGCCTCCCGTGTCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGATGGGCGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTATGTTGTTGTGT--ATGCCCACC-ATAGGAGGGA-ACTCGAGGGCCCTTAGGCACTAC-AAAAA-TGTGTGCACTTCGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGTGTGATTTGAT-CTAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------TAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT---------GGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C--TTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTAGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGAAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Daucus_tenuissimus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCAGGCCGAAGGCTAAGCATGAGC-AAAAGATACATTAGCATCCATTACTCAACACAAAGCGCAACGGACTTCCGTAGCGGACATATATCTCGGAAAAGTATGGACCAAGTCCATAATCGATTACCAGTTCCGCATTCAAGATTTCCCTCAACACATGGACTCCCGACACTTAC-AAGACCAAAAGGAAATGAAAGGGCGGAAGACCATGTTAGATTCATTGTTAGTCTTGCACAAAAT-AAAATGCACAAGACGAATTAGGGAC--TATGGGACATCGATATTCCATCACGATAGGTATATTACGCAGGGCACCAATCTCATCTGAGGGCAT-CTTTCACAACTCTCTGACT-TAATGAACATGTAAGACCAAGCGATTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGAAA------------------------------------------------------TCGAATCCTGTGA---TACCAGAATGACTTGTTAACATGT-AACAACAACGGGCAAGCAAC--TGTGGG-CC--TTTGGTCCCCTGTCTGTGAACCCAAGGC{AC}GGTGT-CACCTTAT---GGTTTCC-CTCGCCTAATAAAATCAACTGGGCGCTAGATGCGCCAAGGAAGT-AAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGGC--GGTCCAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCCAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCCTCGAG-AGA-TTT-ATTTGTTCAGGGG-TGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGT--ATACCCGCC-GCAGTAGGGA-ACTCGAGGGCCCTTGGGCACAGC-AAAAATTGTGTGCACTTCGA---------------------------------------------------------------------------------CTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATCAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTTTTTATTTTAATATAGTATTATTAT---------------------TTTATTTTTT-----TCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTTATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTTATTTCTACAATGGAGCTCATAATTAACTTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTCATAAACCTTACATATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTTCTCCCCTTC------TTTCACCCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATTAGAAGGCCTAGTATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATAAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTGCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TAAAAATAT-AAGGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTTGGGGGGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----C-TTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATATAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTCGATTTATGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTCAGACGTATGGAATTAGCGAA-------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTCGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTAAATTTAAAAGTAAAATTTGTTGAAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA------AGATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTAAATTGTCTCAATAATTGTATAAATTGTATAATCTATATCTATAAT--------------------AA---TCTATAAT-----------------------AATAATAAAGATAAAGATTAAATGAGACAAACAGGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA----TTTTTTC------AGGGAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTCTTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGTTGCAATTGATGTTCGA--------------------------------------------------------------------------- Ekimia_bornmuelleri --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAA---TAGCAGAATGACCCGTTAACTTGT-AAAAACACCGGGCAAGCGTC--GGGGGG-CC--TTGGGTCCCCTGTTTGCAAACCCATGGCTGGTGT-CCCCTGAC--GGGTGTCC-ATCGGCCAACGAAAACAATCGGGCGCAGACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTCGCTTCTCGTTCGTGGGAAGCGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTTCCTGGGTGTCATGCATCACGTTG-CCCATGACCAAAC--ATCTCTTTAGG-TGA-TTT-TCTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGT--TGCGCGGCTGGCTCAAAAATTAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTAT--ATGCTCGTC-ACCTCAGTCA-GCTCAAGGGCCCTTAGGCGCCAC--AAAA-TGTGTGCGCTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTCTTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAATATATCAATATATAAATTGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA-------AATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATAAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAG---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTCGAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Ekimia_petrophila --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAA---TAGCAGAATGACCCGTTAACTCGT-AAAAACACAGGGCAAGCATCG-GGGGGG-CC--TTGGGTCCCCTGTTTGCAAACCCAAGGTTGGTGT-CCCCTGAT--GGGTGTCC-ACTGGCCAATGAAATCAATCGAGCGCAAACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTCGCTTCTCGTTCACGGGAAGCGGCGCC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTTCCTGGGTGTCACGCATCGCGTTG-CCCCTGACCACAC--ATCTCTTTAGG-TGA-TTT-TCTGGTTT-GGGG-CAGATATTGGCCTCCCGTGCCTTGT--TGCGCGGCTGGCTCAAAAATTAGTATCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGT--ATGCTCGTC-ACCTCAGTCA-ACTCGAGGGCCCTTAGGTGTCAC--AAAA-TGTGTGCGCTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGATCAGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATGGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGGGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGAATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-----TT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGAT{CT}TTTTTTTT------TGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA-----TTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCC?CTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTATGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC-------------------------------------------------TGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAAGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATTGAAAGGATCCAATTCAGTCAAGTTTTTAATTAAAAGGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------ATA-----------AAGAAATCGCAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAAACAAAGAAATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCCAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGCCAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Ferula_communis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAA---TAGCAGAATGACCTGTTAACAAGT-AAAAACATCGGGCAAGCTTT--GGGGGG-CC--TATGGTCCCCTATTTGCGAACCCAAGGTAGGTGTACCCCTCAC--GGGTGTCC-ACCGGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAAT-TAATACTGAATTGTTCG-TCGCTTCTCGTTCGCGGGCAGCGGCGTC--AGTCTGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTG-CCCCCGACCAAAC--ATCTCTTTAGG-AGA-TGT-TCCGGTTTGGGGG-CGGATACTGGCCTCCCGTTCCTTGT--TGTGCGGCTGGCGCAAAAATGAGTCTCTAGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCCGTC-ACCTTAGTAATGCTCAAGGACCCTTAGGCGCCAT--AAAA-TATGGGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCAT-TTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG--ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATT--CCTGGAAACATAATTCTCCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATC---AAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTG--CTTGAATACCATAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGA--------TAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTC----------------------------------ACAGAGAAGAGAGGTTTTTTACCTATAGAATTTTTAGCATACGCTAAGGATTGT-------------------GAAGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT--AGATATATC------TATCTATATATAAGTCTTCTCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACAAAAAAATTTCCTGAGAATTC----------------------------CCTATAGGC------------AACATATATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCGAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAC-TGATTTGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTTGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAA----------AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAAT----CAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAA----AGAATAAAT-----AAAAACAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCAC----------------------CCTTAAGCAGGAAAATTTCCATCTAT-TTTTTGTATTATTT--------------------------------------------------------------------GTGTGATTTGAT-CGAAATTATG-ATTTTACAGATGATTCAGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAATAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT--------GGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTCAGACGTAT-------------------------------CGATCCGGTGTGGA-TTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTCACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAGTATACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAGAAA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATAT--------------------------------------------------------------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAGAAAAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAAATATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCTAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Glaucosciadium_cordifolium --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGAATCCTGTGA---TAGCAGAATGACCCGTTAACATGT-AAAAACACCGGGCAAGCGTC--GGGGGG-CC--TAAGGCACCCTGTTTGCTAACCC-AGGCAGGTGT-CCCCTCAG--GGGTGTCT-ACCGGCCTATTAAATCAACAGGGCACTGACTGTGCCAAGGAAAT-TGATATTGAGTTGTTCGTTCGCTTCTCGTTTGCGGGCAGCGGCGTC--AATCGGAAACAC-AAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGTAGCCAATAGGCCTAGGGCATGTCTGCCTGGGTGTCACGCATCTTGTTG-CCCTTGACCAAAC--ACATCTTTTGG-GGA-TGT-GCAGGTTT-GGGG-CGGATACTGGCCTCCCGTGCCTTCT--AGCGCGGCTGGCCCAAAAATGAGTCTCTGGCGATGGACGTCATGACAGCGGTGGTTGGAAGAATACCTTCTTGTCTTGTCGTGTGAATGCCCGTC-ACCTTAGCCA-GCTCTAGGACCCTTTGGTGCCAC--AAAC-TGTGTGCGTTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCAT-TTATAAAAT--ATAAAAATCCCGCTATTCACTCATTCTTCATGGAATCATATAGATG--ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTC---CATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAAT--TTTCTACTCAAGTTGGAATTTGAGAAATAGATACAAATGGAAATAAATTTCTAAAACATT--CCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATC---AAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTG--CTTGAATACCAGAAAAATGAATGGATTCGGAATTTGATCTTTTCGATAAGATAAAACA-TAAAACTCAGAAACAATAGAATATAGAGTCTATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTC----------------------------------ACAGAGAAGAGAGGTTTTTTACCTATATAATTTTTAGCATACGCTAAGGATTGT-------------------GAAGTATATAAGAGGGGTTGTA---TTT--------GA-TATAGTCAGATAT--AGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTC----------------------------CCTATAGTCAACATATATAAAAACATATATAAATAAGAAAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCGAAATGGATAAATTTAAAATAAAAAATACTTAATAAACAC-TGATTAGTTATGTATCATCATCATTTTTTAGTTTCTTGTGTCATTAGGAAAACAAAATTTGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACT--TTTTTTGTGACTAAAAATCCAC------ATTTTACTTTTCAATATAAA----------AGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAAT----CAATCGAAGAAGTGGATCAAATTAAATCAAAAATAGGAGAGGG-CCCTTATTTTCGGAAA----AGAATTAAT-----AAAAACAGGCTTCAAGATACAAGTACAAAAAAAGAGGTTCAGTAATCCAC----------------------CCTTAAGCAGGAAAATTTCCA---------TTGTATTATTT--------------------------------------------------------------------GTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTACCTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTC-GGGGGAGTAGACTA--CTCAATAATTTCACA--TTTCT----TTATTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT-----GGGGGGGGCTCTATAATTTAAAAGTCCGAACTCCTTA-----TTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCATGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGGGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTCAGACGTAT-------------------------------CGATCCGGTGTGGATTTTTATTCTTATATCCGCCATCTTTTCTATGAATGAAGGTGCTCTTGACCCGACATCTGTTC--TGTTTTCACTAGAATCCTTATTTTTGTTAGGTTGTAATGAATAATATAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAAGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAAAAAAGTCTTTCGATTCAAAGTGTACCGCGCGGGAATCGAGCGTGTATATTATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCGTTTTTTCAATTGTCTCAATAACTGTATATT------------------------------------------------------------------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAA-GAAATAAATTGCCTAAAGA--TTTTTTTCCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTTTTTCAGTAACGGGGAAGAAAA----AAAAAAAAGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTAGAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAAGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Laser_affine --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACACGT-AAAAAAACCGGGCAAGCGTC--GGGGGG-TC--TTGGGTCCCCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCT-ACCAGCCAATGAATTCAACTGGGCGCTTACTGCGCCAAGGAAGT-TAATAATGAATTGTTCGTTCACTTCCCGTTTGTAGGAAGTGGCGTC--AGTCTGAAACAC-AAACGACTCTCGGCAACGGA{AT}ATCCCGGCTCTCTGCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTAACAAAAC--ATCCCTTTAGG-AGG-ATT-TTTGGTTTGGGGG-CCGATATTGGCCTCCCGTGCCTTGTG-TGCGTGGCTGGCTCAAAAATGAGTCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTCGTGTTGTTGTGT--ATGCCCGTC-ACCTCATTAA-GCTCAAGGGCCCTTAGGTGCCAC--AAAA-TGTGTGTGCTTTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTTATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTTTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTACAGATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAATACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------CAGAGAAGAGGGGTGTTTTTGACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATATAAAGGATTGTGAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATATTTAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCAATGAAAATTTAAATTTTAAACACAAAAATTTCCTGAGAATTCGC--------------------------CCTATAGGCAACATATATAAAAACATACATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATC-ACATATTGT-----TATAATCAAAATGGAGAAATTCAAACTAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTGGATATTC-GAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATACACATTTTAATTTGACTTTTCAATAAAAACA--------AGTGAGGGGAAGCTTTTAGGCATTGTGTTTGTGTGTTTTGAAATACTATACAATCCAGCAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTG-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------TAAA-----GAAATTAAGGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAAAATTACGGGATTTATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTTAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT---GGGGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA-------TTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGCTTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCTATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAT-AA----AAAGGATCCCAGAACAAGGAAACGCC--TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGATAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--GTCTTTTT-TTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGC--TTTTTTTTC------AGGAAGGGGGAAG---AAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATATGTGG------ACAATACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTAGCTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Laser_archangelica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACACGT-AAAAACACTGGGCAAGCGTT--GGGGGGATC--TTGGTTCCCCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCT-ACCGGCCAATGAAATCAACCGGGCGCTTATTGCGCCAAGGAAGT-TAATAATGAATTGTTCGTTCGCTTCCCGTTCGTAGGAAGTGGCGTC--ACTCTGAAACAC-AAACGACTCTCGGCAACGGATATCTCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTAATCAAAC--ATCCCTTTAGG-AGA-ATT-TTTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGTG-TGCGTGGCTGGCTCAAAAATGAGTCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGT--GTGCTTGTC-ACCTCATTCA-GCTCAAGGGCCCTTAGGTGCCAC--AAAA-TGTGTGTGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTCATTTCCCATCTTATAAAAT--ATAAAAATTCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTGACGAAGTTATGGAATTTTGTATAGAATATATCAAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATCTAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCC--------------------------------GACAGAGAAGAGGGGTGTTTTACCTATAGAATTTTTAGTCTACGCTAAGGATTGT-------------------GAGGTATATAAGAAGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-CAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCACTGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCAG--------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATTATAAAAACATATATAAACTTAAGATAACCAATTAGATATCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATT-ATATATTGT-----TATAATCAAAATGGATAAATTGAAACTAAAAAATACTGAATAAACAGTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AATTTTTAATATT--AAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGCACCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTTATTTGACTTTTCAATAGAAACC-------AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCC-CCAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTTCTTT--------------------------AACGCAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCCTTAAGTTCAGTAATCCACCGCCTTAAGCAGGAAAATTTCCATCTAT-TTTTTATATTATTT--------------------------------------------------------------------GTGTGATTTGAT-CGAAATTCTA-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAAAC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTT-AGGGCATCGTGGCATAACTGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGAGGGAGTAGACTA--CTCAATAATTTCACA-TTCTTT-------TTTTTTAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTTTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT-----GGGGGGGGCTCTAGAATTTAAAAGTGCGAACTCCTTA------TTTTTTTTT-ATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--GTCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG---AAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGT------------------------------------------------------------------------------------------- Laser_carduchorum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCTTGCGA---TAGCAGAATGACCTGTCAACACGT-AAAAACATCGGGCAAGCGTC--GGGGGG-CC--TTGGGTCCCTTGTCTGCAAACCCAAGGCAGGTGT-CACCTGAC--GGGTGTCC-ACCGGCCAACATAATCAACCGGGCGCTTATTGCGCCAAGGAAGT-TAATAATGAATTGTTCGTTCGCTTCTTGTTCGCAGGAAGTGGCGTC--AGTCCAAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACACATTTTGTTG-CCTCGGACTAAAC--ATCTCTTTAGG-AGT-ATT-TTTGGTTTGGGGATCAGATATTGGCCTCCCGTGCTTTGTT-TGCACGGTTGGCTCAAAAATGAGTCTTTGGTGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCGTC-ACCTTAGTCA-GCTCAAAGGCCCTTAGGTGCCAC--AAAA-TGTGTGTGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTTATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTACAGATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCC--------------------------------GACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-CAGATATATC------CATCTATATATAAGTCTTCCCCTTCTATTTTTATTATTTATTACA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCA---------------------------CCTATAGGCAACATATATAACAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------GCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATAGATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTTGATATTC-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCACCAACTTTTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACATA--GAAAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC--AGAATAAAT-----AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCGA-------------------CCTTAAGCAGGAAAATTTCCATCTAT-TTTTTGT---------------------------------------------------------------------------GTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTAGGGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------TAAA-----TAAATTAAGGGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAGACTTTAACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA--TTTTT-------TTTTTTAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTG------GGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA-----TTTTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGATAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--GTCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATG---CTTTTTTTC------AGGAAGGGGGAAG---AAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTTCT------TTGCCATTAATTATAATTCTATACGTAG------ACAATACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCGT------------------------------------------------------------------------------------------- Laser_stevenii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACACGT-AAAAACATTGGGCAAGCGTC--GGGGGG-CC--TTGGGTCCCCTGATTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCC-ACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAATAAAGAATTGTTCGTTCACTTCTTGTTCGCAGGAAGTGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTG-CCCTTGACTAAAC--ATCTCTTTAGG-AGA-ATT-TTTGGTTTGGGGATCAGATATTGGCCTCCCGTGCCTTGTG-CGCGCGGCTGGCTTAAAAATGAATCTTTGGCGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGT--ATGCCCGTC-ACCTCAGTCA-GCTCAAGGGCCCTTAGGTGCCAC--AAAA-TGTGTGTGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTCATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATATAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTGACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCACATATAGATTCCATTGTTCAAAGAAAAGGATTCACAGAGAAGAGGGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTAA-----------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-----------TAT-TAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTCG---------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATC-ATATATTGT-----TATAATCAAAATGGATAAATTGAAACTAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAATTTTGATATTC-TAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATAGAAACA-------TAGTGAGGGGAAGTTTTTAGACATTGTGTTTGTGTGTTTTGAGATACTATACAATCC-ACAATCGAAGAGGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTCTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTGCGATGTGTGATTTGAT-CGAAATTCTA-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTC-GGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGAAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATTCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTTAATAAAGAATTT-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT----GGGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA-------TTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGCTTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAAAGTTTATATGATTCTTTGAT-------AGA-----------AAAAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTTCCTAAAGA--GTCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGTAAG---AAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTCTCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTAGCTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Laser_trilobum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TTGCAGAATGACCTGTTAACACGT-AAAAACATCGGGCAAGCATC--GGGGGG-CC--TTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGTCCCCCTGAT--GGGTGTCC-ACCGGCCAACGAAATCAATTGGGCGCTGACTGCGCCAAGGAAGT-TAATAATGAATTGTTCGTTCGCTTCTCGTTCGCGGGAAGTGGCGTC--AGTCTGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTTTGCCTGGGTGTCACGCATCGCGTTG-CCCCTGACCAAAC--ATCTCTTTATG-AGAATTT-TTTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGTG-CGCATGGCTGGCTCAAAAATGAGTCTTTGGTGATGGACGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCGTC-ACCTCAGTCA-TCTCAAGGGCCCTTAGGTGCCAC--AAAA-TGTGTGTGCTCCGA-------------------------------------------------------------GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-TTTTTCTATTTTATATTTTTAAATACCGTATTATTTTTTTATGTTATAACGAATATTTTTTTTGTTTT-----GCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCGTTATTGGCTCGAAGCTCTTA---TTTTTTTGTTCTAGGAACGGATTCGTTTTCTTTTTTATGAATCC------ATATTGATTGATGCTT--TATTACATTGCTTTTTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTGTTTTTTCTACCCTTCTTTCACCCTTCCGTTTATCCACATCTTTCTTCTTCTCTTCACAACTTAGAATCAGATTTTTTCTTTTGTTTATGCAAAAAAGATTTCAGTTGCTACAGCGATATGACCGATATATCATATCTTGACTGGTTTTTTGGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTATAGTTATTTGTTTATAC-AAAAAAGCCGGTCTTTTTTTTCTTTAATCCTAACCCTAAAAAACCAACGAGTCGCAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAGTTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTTATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCAC-----TTT-------TTTTTTAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT-----GGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA----TTTTTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGCTTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTCTGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA-------AATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCA-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAAAAAATTGCCTAAAGA--GTCTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG---AAAAAATGAGTTAAATCCCAT---------TATAATTGATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCGTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Laserpitium_gallicum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGAATCCTGTGA---TAGTAGAATGACCCGTTAACTAGT-AAAAACATTGGGCAAGCGTC--TGGGGG-CCTTTTGGGTCCCTTGATTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCC-ACCGGCCAACGAAATCAATCGGGCGCTGAATGCGCCAAGGAAAT-TAATAAAGAATTGTTTGTTCGCTTCTCGT----GGGAAGCGGCGTC--ATTCCGAAACAC-AAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCG--ATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATCGTGTTG-CCCCTGACCAAAC--ATCTGTTTAAGCAGA-TCT-TCTGGTTTGGGGG-CGGATATTGGCCTTCCGTGCCTTGT--TGCTCGGCTTGCTAAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCTGTC-ACCATAGTTA-GCTCAAGGGCCCTTAGGCGCCAC--GAAA-TGTGTGTGTTTTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--AGAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTTTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATC-TTTCGATAAGATAAAATACTAAAACTCAGAAACAATAGAATATAGAGTAGATCTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------GACAAAAAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGG------------TTAAACAGA-TATAGGCAGATAT--AGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCAGTGAAAATTAAAATTGGAAACACAACAATTTCCTGAGAATTCCCTAATTTCCTGAGAATTCAGCCTATAGGCAACAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATG-----------------------------------------------------------------------------ATCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATA-ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ACCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AGAATTGGATATTC-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTTTTTTTTGTGACTAAAAATCCACCTTTTAATTTTACTTTTCAATATAAACA-------TAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCA-GCAATCGAAGAAGTGGATAAAATGAAATCAAAAAGAGGAAAGGGGCCCTTCTTTTCGGAAACC-GAGAATAAAT------AAAAAAAGCTCAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGGAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAAC--AAAAAAAAGGGCATTTTTAGTTATACTTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTCAAA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTC-TCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTTTAGAATTTAAAAGTTCGAACTCCTTA---TTTTTATTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTCGGGGT--AGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAG------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTCTAATTCTATACGTAG------ACAAAACTACAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAGCTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Laserpitium_halleri --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACAAGT-AAAAACATCGGGCAAGCGTC--GGGGGC-CT-TTTGGGTCCCTTGATTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCC-ACCAGCCAACGAAATCAATCGGGCGCTGAATGCGCCAAGGAAAT-TAATAAAGAATTGTTTGTTCGCTTCTCGT----GGGAAGCGGCATC--AAATCGAAACAC-AAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGC-AAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGC{CT}GAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTGTTTAAGCAGA-TCT-TTTGGTTTGGGGG-CGGATATTGGCCTTCCGTGCCTTGT--TGC{CT}CGGCTTGCTCAAAAATGAGTCTTTGGCGATGGATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCTGTC-ACCTTAGTTA-GCTCAAGGGCCCTTAGGCGCCAC--GAAA-TGTGTGCGTTTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Laserpitium_krapfii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACATGT-AAAAACATCGGGCAAGCGTC--AGGGAG-CTTTTTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGT-CCCCTGAC--GGGTGTCC-ACCGGCAAACAAAATCAATCGGGCGCTGAATGCGCCAAGGAAAT-TAATAAAGAATTGTTCGTTCTCTTCTCGTTTGCGGGAAGCGGCGTC--AGTCCAAAACAA-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCTTGACCAAAC--ATCTCTTTTGG-AGA-TTT-TCTGGTTTGGGGG-CGGATATTGGCCTCCTGTGCCTTGT--TGCGCGGCTGGCTAAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCTGTC-ACCTTAGTCA-GCTCAAGGGCCCTTAGGCGCCAA--GAAA-TGTGTGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATATTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATGCAATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCC--CATATCTGAAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATGGTTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTG-CCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCT--AAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACATTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATAGCG-ATTCCATTGTTCAAAGAAAAGGATTC---------------------------------TACAAAGAAGAGAGGCATTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTG------------------GAGGTATATAAGAGGGG------------TTAAACAGA-TATAGGCAGATATTCAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTGGAAACACAACAATTTCCTGAGAATTCC---------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATATG-----------------------------------------------------------------------------ATCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATC-ATATATTGT-----TATAATAAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AGAATTTGATATTC-GAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACCTTTTAATTTGACTTTTCAATATAAACA--------AGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATCCAGCAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGGGCCCTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAAC---AAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTTTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGATACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA--TTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTG------GGGGGGGGCTCGAGAATTTAAAAGTTAGAACTCCTTA----TTTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATGTCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCACTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTCTAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCA-------------------------------------------------------------------------------------------- Laserpitium_latifolium --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGG---TAGCAGAATGACCTGTTAACACGT-AAAAACATTGGGCAAGCGTC--AGGGGC-CCTTTTGGGTCCCCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTGAC--TGGTATCC-ACCGGCCAACAAAATCAACCGGGTGCTGAATGCACCAAGGAAAT-TAATAAAGAATTGTTCGTTCTCTTCTTGTTCGCGGGAAGTGGCGTC--AGTCCAAAACAA-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTTCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCTTTAGG-AGA-TTT-TCTGGTTTGGGTG-CGGATATTGGCCTCCTGTGCCTTGT--TGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCTGTC-ACCTTAGTGA-GCTCAAGGGCCCTTGGGCGCCAC--GAAA-TGTGTGCGCTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTTGTAAC---AAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGTATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGATACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-TTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTTTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTTT----GGGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA-----TTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCGCTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC--------------------------------------------------------TTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCA-GGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCTAGAGTTTATATGATTCTTTGAT-------AGAAAGGAAATCACAAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGATTTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-TTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCA-------------------------------------------------------------------------------------------- Laserpitium_peucedanoides --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAACATGT-AAAAACATCGGGCAAGCGTC--ACGGGG-CCTTTTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGT-CCCCTTAC--GGGTGTCC-ACCGGCCAACAAAATCAACCGGGCGCTGAATGCGCCAAGGAAAT-TAATAAAGAATTGTTCGTTCTCTTCTCGTTTGCGGGAAGTGGCGTC--AGTCCAAAACAA-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCTTGACCAAAC--ATCTCTTTTGG-AGA-TTT-TCTGGTTTGGGGG-CGGATATTGGCCTCCTGTGCCTTGT--TGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCTGTC-ACCTTAGTCA-GCTCAAGGGCCCTTAGGCGCCAA--GAAA-TGTGTGCGCTTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Laserpitium_pseudomeum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCTGTTAATACGT-AAAAACATCGGGCAAGTTTC--AGGGGG-CC--TTGGGTCCCCTGTTTGCAAACCCAAGGCAAGTGT-CCCCTGAC--GGGTGTCC-ACCGGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTCGCTCCCCGTTTGTGGGAAGCGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CTCCTGGCCAAAC--ATCTCTCTAGG-AGA-TTT-TTCGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGTG-TGCGCGGCTGGCTCAAAAATGAGTCTTTGGTGATGGATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGT--ATGC---TC-ACCTTAGTCA-GCTCAAGGGCCCTTAGGCGCCAC--AAAA-TGTTTGCGCTTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAACTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTGGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-TTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT---------GGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGC-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Orlaya_grandiflora TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCCGAAGGCCTAGCATGAGT-TCTAGATGCATTAGCATCCTAGAGTCAACACAAGGCACAACGAACTTTCGTGAGGGACATTTAATACGGAAAAGTATGGGCCAACACCCAAACCGATCAACGATTCCGCATACAAGATTTCTGGCAACACATGGACATCCGATGCTCTC-AAGACCGAAAGGAAATGAAAGGGCAAAGATCCATGTTAGTTTCTTTGTTTATCTCGCACAACAT-AAGAAGCGCGAGACAAATAAGGGAC--CGTGGGACTCCAAAATTCCTTCAAACTAGGTA-GTTGTACAGGGGACCATGCACA-CCGAAGGCTC-AATTCTTAGCTCTCGGACAGAAATGAACATGTATGAACAAGTGGTTGTCGCTGCCTTGACAGGGATCCAACCAACCGGGACA------------------------------------------------------TCGAATCCTGCGA---GAGCAGAATGACCCGTAAACATGT-AAAAACATCGGGGAAGTAAC--AGGGGG-CC---TTGGTCCCTTGTATGCAAACCCAAGGCAGGTGT-CCCCTTAT--TGGTGTCC-ACCAGCCAATGAAATCAACCGGGCGCTAACTGCGCCAAGGAAGT-TAAAAATGAATTGTTCGTTCGCTTCTCGTTTGTGGGAAGCGGCGTC--AGTTGGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGTGTTG-CCCCAGTCCAAGC--ATCCCTCTAGG-AGA-TTT-TTTGGATTGGGGG-CGTAAATTGGCCTCCCGTGCCTTGTG-CGTGCGGCTGGCTCAAATGCGAGCCTCTAGAGATGGAGATCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTTTTGTCGTGT--ATGGCCGTC-ACCTTAGTTT-GCTCGAGGGCCCTATGGCACCAC--AAAA-TGTGTGCGCTTCAA----------------------------------------------------------------------------------------------------------------TGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TAATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-TTTTTCTATTTTATATTTATAAATATCGTATTATTTT---------------------TTTATGTTCTAACGAATATTTTTTTTGTTTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCCTTTCGTCGCTATTTTAGTTGTATGGTTAACTAATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCAATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCACCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTC--------TTTTTTTTCTATGAACGAATTCATTTTTTTTTTTATGAATCC------ATATTGATTCATGCTT--TATTACATTGC---TTTTTTATGAGACTTTATGAAATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAATACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTAGCCATCGCATATA{AG}------ACTTTAAGGGCGTCGTGGCATAACCGTCGAGGGGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTACTCTCAATAATTTC-------CAT-------TTTTTTAATAAATAATTC-AA-------AAAATTCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCCCC--CGG--TTT-CCGGAAAACTGAG-AAAAAGTAGATTTTTTTTTT------GGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGTAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATATAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCCCTTTTTTTT?CTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC----------------------------------------------GTGTGGATTTTTCTTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATAAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTTAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTAAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAATAAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATGCCAGAACAAGGAAACGCCG-TTTTTTAATTGTCTCAATAACTGTATAATCTAT-----------------------------------------------------------------------------AATAAAGATAAAGATTAAATGAGACAGACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGC---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGC--TTTTTTTTC------AGGAAGGGGTAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGT--------------------------------------------------------------------------------------------------------------------------------------------- Siler_montanum TTGAGACAAGCATATGA{CT}TACTGGCAGGATCAACCAGGTAGCATTCCTTCTTGCTGAAGGCCTCGCATGAGC-ACAAGATGCATTATCATCCTACAGTCAACACAAGGCACAACAGACTTTCGTGAGGGACATTTAATTCGGACAAACAAGGGCCAAGACCCGAACCGATCAATGGTTCTGCCTACAAGATTTCTAGCGACTCATGGACATCCGATGCTTAC-AAGACCGAATGGAAACGTAAGGTAGGACGTCCATGTTAGTTTCGTTGTCTGACTCGCACAACAT-AAGGAGCACGAGACAAATAAGGGAC--CATGGGACTATGGAATTCCGTCAAAATAGGTATGTTGCACAGGGGACCAAGCACG-CCGAAGCCAA-A{AT}TTTTTAGCTCTCGGACAGAAATGAACATGTATGAACAAGCGGTTGTCGCTGCCGAGACAGGGATCCAACCAACCGGTACA------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGTTAACACGT-AAAAACATCGGGCAAGCGTC--GGGGGG-CC--TTGTGTCCCCTGTTTGCAAACCCAAGGTAGGTGT-CCCCTAAC--GGGTGTCT-ACCGGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTTGCTTCTCGTTCGCGGGAAGTGGCGTC--AGTCCGAAACAT-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGG{CT}{CT}GAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTG-CCCCTGACCAAAC--ATCTCTCTAGG-AGA-TTT-TTCGGTTTAGGGG-CGGATATTGGCCTCCTGTGCCTTGTG-TGTGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACGTTGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTCGTGT--ATGCCCGTC-ACCTCAGTCA-GCTTAAGGGCCCTTAGGCGCAAC--AAAA-TGTGTGCG{CT}TTCGA------------------------------------------------------------------------------------------ATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGC-GAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-TTTTTCTATTTTATATTTTTAAATATCGTATTCTTTTTTTATGTTATAACGAATATTTTTTTTGTTTT-----GCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAG----AAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCGTCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTCCCAATAGATGAAAGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCGTTTTCTTTTTTATGAATCC------ATATTGATTGATGCTT--TATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATATCGTTGTTTTTGTTTTTTCTCCCCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACATAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGATATTAAATCGATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACAGTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACACATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCC--------------------------------GACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-CAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCACTGAAAATGACAATTTGAAACACAAAAATTTCCTGAGAATTCAG--------------------------CCTATAGGCAACATATATAAAAACATAGATAGAGAAGATAACCAATTAGATGT--------------------------------------------------------------------------------CTGTGGAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATAATGT-----TATAGTCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAATTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTTGATATTCCAAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGA-CCACCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAGA--GAAAAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATTAAATCAAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC--AGAATAAAT-----AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCGA------------------GCCTTAAGCAGGAAAATTTCCATCGAT-TTTTTGTATTATTT-T------------------------------------------------------------------GTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCACGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGGCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA--TTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCGTAATTAAGGAAAAGCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT-------GGGGGGGGCTCTAGAATTTAAAAGTTCGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATTTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAACTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACACCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA-TTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTATTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Silphiodaucus_hispidus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTAGCCGAAGGCCTAGCATGATC-AAAAGATACATTAGCATCCTTGAGTCAACACAAGGCACAACGAACTTTCGTAAGGGACATTTTTCTCGGAAAAGTATGGGCCTAGACCATAACCGATTAGTGGTTCCGCATTCAAGATATCTGGCAACACA{AT}GGGCATCCGATGCTTAC-AAGACCAAATGGAAATGAAAGGGCGGAATACCATGTTAGATTCATTGTCAGTCACGCACAACAT-AAAGAGCGCGAGACAAATAAGGGAC--CATGGGACTCCAGGATTCCATCATAATAGGTATGTCGCACAGGGGACCAAGCACA-CCAAAGGCAA-AATTTAAAGCTCTCGGACA-AAATGAACAAGCATGACCAAGCAGTTGTCGCTGCCGAGACAGGGATCCAACAAACCGGGACA------------------------------------------------------TCGAATCCTGCGC---TACTAGAATGACCCGCTAACATGT--AAAACACCGGGCAAGCATC--GGGGGG-CG--TT-GGTCCCTTGTCTGCAAACCCAAGGCAGGTGC-CCCCTTAC--GGGTGTCC-ACTGCCTAATGAAATCAACTGGGCGCTAAATGCGCCAAGGAAGT-TAATAATGAATTGTTCGTTCGCATCTCGTTCGCGGGAGGCGGCGGC--AGTTGAAAACAAAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTG-CCCCTGACCAAGC--ACCTCTCTGGG-AGA-TCT-TTTGGTTTAGGGG-CGGAGATTGGCCTCCCGTGTCTTG---TACGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTTGTTGTGT--ATGCCCATTAACCTTAGTCG-ACTCGAGGGCCCTTAGGCACTAC--AAAA-TGTGTGCACTTCAA------------------------------------------------------------------------------------------------------------------------------------GCTCCTCGC-GAATAATAAAATTTGCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA-T-------TTTTATATTTTTAAATATCGTATTATTTT--------------------TTTTTTGTTTT-----GCTTTTTATCCTATTGGATTGAGCAAAAATTATCAATCCAAGAAGAAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCATCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTA--TTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGATGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGATTTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCGTAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAAAT{CT}TTTTTTT--------GGGGGGGCTCGAGAATTTAAAAGTT{CT}GAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTT{CT}TTTTGCTAGGCCCATAGCTAAAAAACTCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Silphiodaucus_prutenicus TTGAGACAAGCATATGACTACTGGCAGGATCAACCAGGTAGCATTCCTTCTAGCCGAAGGCCTGGCATGATC-AAAAGATACATTAGCATCATTGAGTCAACACAAGGCACAACGAACTTTCGTAAGGGACATTTTTCTCGGAAAAGTATGGGCCTAGACCATAACCGATTAATGGTTC{CT}GCATTCAAGATTTCTGGCAACACATGGACATCCGATGCTTAC-AAGACCAAATGGAAATGAAAGGGCGGAATACCATGTTAGATTCATTGTCA{AG}TCACGCACAACAT-AAATAGCACGAGACAAATAAGGGAC--CATGGGACTCCAGGATTCCATCATAATAGGTATGTCGCACAGGGGACCAAGCACA-CCGAAGGCAA-AAATTAAAGCCCTCGGACA-TAATGAACAAGCATGACCAAGCAGTTGTCGCTGCCGAGACAGGGATCCAACCAACCGGGACA------------------------------------------------------TCGAATCCTGCGC---TACCCGAATGACCCGCTAACATGT-AAAAACACCGGGCAAGCATC--GGGGGC-CG--TTGGGTCCCTTGTCTGCAAACCCAAGGCAGGTGC-CCCCTTAT--GGGTGTCC-ACCGCCTAATCAAATCAACTGGGCGCTAAATGCGCCAAGGAAAT-TAATAATGAATTGTTCGTTCGCATCTCGTTCACGGGAGGCGGCGGC--AGTTGAAAACACAAAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTTAGGGCACGTCTGCCTGGGTGTCACGCATTGTGTTG-CCCCTAACCAAGC--ACCTCTCTGGG-AGA-TTT-TTTGGTTTAGGGG-CGGAGATTGGCCTCCCGTGTCTTG---TGCGCGGCTGGCTCAAAAATGAGTCTCTGGTGATGGACATCACGACATCGGTGGTTGTAAGAAGCCCTTCTTGTGTTGTTGTGT--ATGCCCATT-ACCTTAGTTG-ACTCGAGGGCCCTTAGGCATTAC--AAAA-TGTGTGCACTTCAA---------------------------------------------------------------------------------------------------------------ATGAGAGTTTCTTCTCATCCAGCTCCTCGC-AAATAATAAAATTTTCAAAATGTCTATTA-TCATTTGTATATCTTGCTTTTTTAGCTAACTAAACATATTAA----------------TTTTTAAATATCGTATTATTTT---------------------TTTTTGTTTT-----GCTTTTTATCCTATTGGATTGAGCAAAAATTAGCAATCCAAGAAGAAAGATAAAGTTTTCACGGGCGAATATTGACTCTTTTCATCGCTATTTTAGTTGTAGGGTTAACTCATGACTTTTCTTTTACCAATAGATGAAAGAACTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGATTTCAATAGATTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTAC-TTAATGGTTAGGTCTGATTTCTACAATGGAGCTCATAATTCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTTTGTTCTATGAACGGATTCATTTTGTTTTTTATGAATCC------ATATTGATTGATGCTTTATATTACATTGC---TTTTTTATGAGACTTTATGAGATGACTC-------------ATAAACCTTACATATTGGATGGAATTTTATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGATGTATTCAATACTCCCAAATAACAAGGGGAATTTATCTATGGTCGATTTCGTAACA-AAAAAAATAGGCATTTTTAGTTATATCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTCAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TATAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCTTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT------GGGGGGGGGCTCGAGAATTTAAAAGTTCGAACTCCTTA-----CTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCGATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCGGATCTAGATTTACGGATTATTATAGCTTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC----------------------------------------GATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTTGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATTGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGATAGAAAGAAGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTGATTTAAA-------AATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATATAATAATAAAAATAGAATATAGAATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGATTTTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA---TTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TAGAATTTATTTTATCAACTCCT------TTGCCATTAATTAAAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAATGGAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_eliasii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGCTAACACGT-AAAAACATTGGGCAAGCGTC--GGGGGG-CC--TTCGGTCCCCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCC-ACCAGCCAACGAAATCAACCGGGCGCTGATTGCGCCAAGGAAGT-TATTAACGAATTGTTCGTTCGCTTCTCGTTTTCGGGAAGCGGCGTC--AGTCCGGAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCTAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTG-TTCCTGACCAAAC--ATCTCTTTACG-AGA-TTT-TCTGGTTT-GGGG-CGGATACTGGCCTCCCGTGCCTTGT--TGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCCGTC-ACCTTAGCCA-GCTCAAGGGCCCTTAGGCGCAAC--AAAA-TGTGTGCGCCTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATCAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTTATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAATAGAGGTGTTTTACCTATAGAATTTTTAGTATCCGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTCTTAAACGGA-TATAGGCAGATAT-------AATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------ACTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATA-ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATAGGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACA-------CAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACCGGAGAAGAAAT-----CAAAAAAGGCTTTAAGATACAA----------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACCGGGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTTAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-TTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------TGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA----TTTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGTAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AAAAAGAAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------AATATCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTAGACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_garganica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGAATCCTACGA---TAGTAGAATGACCCGCTAACATGTAAAAAACATTGGGCAAGCATCG-GGGGGG-CC--TTGCGTCCCCTGTTTGCAAACCCAAGGTAGGTGT-CCCCCGAC-----------ACCAGCCAACGAAATCAACCGGGCGCTGAATGCGTCAAGGAAGT-TAAGAACGAATTGTTCGTTCGCTTCTCCTTTGCGGGAAGCGGCGTC--AGTCCGAACCAC-GAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTG-CCCTTGACCAAAC--ATCTCTTTAGG-AGA-TTT-TCTGGTTT-GGGG-TGGATTTTGGCCTCCCGTGCCTTGT--AGCATGGATGGCTCAAAAATGAGTCTTTGGCAATGGATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGC--ATGCCTGTT-GCCTTAGATA-GCTCAAGGGCCCTTAGGTGTCAC--AAAA-TATGTGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTCTAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATGGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-AAGATATATC------TATCTATATATAAGTCTTCTCCTTCTATT-------TTTATTCCAGTGAAAATTAAAATTGGAAACACAAAAATTTCCTGAGAATTGT---------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCAAAATGGATAAATTGAAAATCAAAAATACTGAATAAACACTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTGTATATTCACAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTAAAATTTGC-CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAG------AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC-GAGAATAAA------AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCCG-------------------CCTTAAGCAGGAAAATTTCCATCTAT-TTTTTGTATTATTT---------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTT-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGGGGAGTCACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTTGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGTTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACAGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCGAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTG------GGGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTC-----TTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGACGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AAAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATAGAAAGGATCTGATTCAGTCAAGTTTTTAATTCAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCA-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAATA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_gummifera --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGCTAACACGT-ACAAACATTGGGCAAGTGTC--GGGGGG-CC--CTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTGT-CCCCTGGC--GGGTTTCC-ACTGGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAAGAATGAATTGTTCGTTCGCTTCTCCTTCGCGGGAGGCGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTG-CTCCTGACCAAAC--ATCTCTTTAGG-AGA-TTT-TCTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGT--TGCGTGGATGGCTTAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGC--ATGCCTGTC-GCCTTAGCTA-GCTCAAGGGCCCTTAGGCGCCAC--AAAA-TGTGTGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAACTAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTCAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAAC-------CTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--GAATTCCATTGTTCAAAGAAAAGGATTC----------------------------------ACAGAGAAGAGAGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTA------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT--AGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TTAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------TCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTGGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACAC------TAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACCGCAGAATAAAT-----AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCC--------------------CCTTAAGCAGGAAAATTTCCATCTAT-GTTTTGTATTATTT-T-------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-TTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCGAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTATTTTTTTTTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTGAATTAAAAAGTCAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAG------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_meoides --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGCTAACACGT-ACAAACATTGGGCAAGTGTC--GGGGGG-CC--CTGGGTCCCCTGTTTGCAAACCCAAGGCTGGTG-----------------TCC-ACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAAGAATGAATTGTTCGTTCGCTTCTCCTTCGCGGGAAGCGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCACGTTG-CTCCTGACCAAAC--ATCTCTTTAGG-AGA-TTT-TCTGGTTTTGGGG-CGGATATTGGCCTCCCGTGCCTTGT--TGCGTGGATGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGC--ATGCCTGTC-GCCTTAGCTA-GCTCAAGGACCCTTGGGCGCCAC--AAAA-TGTGTGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGATGTGTGATTTGATACGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA----TTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCAAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT-------GGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA----TTTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AA---AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTC-AAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAATTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTAGAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_nestleri --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGCTAACACGT-AAAAACATTGGGCAAGTGTC--GGGGGG-CC--TTGGATCCCCTGTTTGCAAACCCAAGGCAGGTGT-CCCCTGAC--GGGTGTCC-ACCAGCCAACAAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTCGCTTCTTGTTTGCGGGAAGCGGCGTC--AGTCCGGAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACG{CT}ATCGCGTTG-TTCCTGACCAAAC--ATCTGTTTACG-AGA-TTT-TATGGTTT-GGGG-CGGATACTGGCCTCCCGTGCCTTGT--TGCGCGGCTGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGT--ATGCCCGTC-ACCTTAGCCA-GCTCAAGGGCCCTTAGGCGTCAC--AAAA-TGTGTGCGCCTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--ATAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTTATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATCCGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTCTTAAACGGA-TATAGGCAGATAT-------AATC------TATCTATATATAAGTCTTCCCCTTATATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------ACTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATA-ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATAGGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACA-------CAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACCGGAGAATAAAT-----CAAAAAAGGC-TCAAGATACA-----------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACCGGGGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACATTTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA-TTTTTTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGAAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AAAAAGAAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------AAT-TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATTAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGC-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTAGACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_tenuifolia --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTACGA---TAGTAGAATGACTCGCTAACATGT-AAAAACATTGGGCAAGTGTC--CGGGGG-CT-TTACGGTCCCCCGTTTGCAAACCCACGGTAGGTGT-CCCTTGAC--GGGTGTCC-ACCAGCCAATGAAATCAACCGGGCGCTGACTGCGCCAAGGAACT-TAAGAATGAATTTTTCGTTCGCTTCACCCTTGTGGGAAGTGACGTT--AGTTCGAAACAC-AAAT-ACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACTCATCTTGTCG-CCCCCG-CCAAAC--ATCTCTTTTGG-AGA-TTT-TCCGGTTTGGGGG-CGGATATTGGCCTCCCATGCCTTGT--TGCATGGATGGCTCAAAAATGAGTCTTTGGCGATGGATGTCGCGACATTGGTGGTTGTAA-AAAACCTTCTTGTCTTGTCGTTC--ATGCCCGTT-GTCTTAGCCA-GCTCAAAGGCCCTTACGCGCCAC--AAAA-TGGGTGCGCTTTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG--ATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCC-GCATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATC-TTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTG-CCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCT-AAAAATAGATTAAATTTCTACCATTATTATGCT---------ATTACATATTCCAATCTGT-CTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAAC-------CTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTC----------------------------------ACAGAGAAGAGGGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGATTATAGGCAGATAT--AGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCA-TGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTG----------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------TCTGTGTAACAATTTATGTTCTGGGGTTTACATATCCCCAT--ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACATTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTGGATATT--CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACAC------TAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACCGCAGAATAAATAAAAAAAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCCC-------------------CCTTAAGCAGGAAAATTTCCATCTATGTTTTTGTATTATTT-T-------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA--TTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAT-AAAGGAAGCCATAATTAAGGAAAACCCCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT-------GGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA--TTTTTTTTTTTTTTATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCTACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTCTAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTCAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATCAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAGTTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATTCCAT---------TATAATTTTTTTTATCAACTCCTTTGCCATTGCCATTAATTCTAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_thapsioides --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGCAGAATGACCCGTTAACACGT-ACAAACATTGGGCAAGTGTC--GGGGGG-CC--CTGTGTCCCCTGTTTGCAAACCCAAGGCTGGTGT-CCCCTGACGGGGGTGTCC-ACCAGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAAGAATGAATTGTTCGTTCGCTTCTCCTTTACGGGAAGCGGCGTC--AGTCCGAAACAC-AAACGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAAACCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTG-CTCCTGACCAAAC--ATCTATTTAGG-AGA-TTT-TCTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTTGT--TGCGTGGATGGCTCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGC--ATGCCTGTC-GCCATAGCTA-GCTCAAGGGCCCTTAGGCGCCAC--AAAA-TGTGTGCGCTTCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTATAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTATAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAAATCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAAGAGAGGCGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGG--------GGATTGTGAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAG-CAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCATTGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGA---------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACAGTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAA---AAAATGGGATATTCCCAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGC-CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTCACTTTTCAATATAAACAT------AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC-TAGAATAAAT-----AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCCT-------------------CCTTAAGCAGGAAAATTTCCATCTAT-TTTTTGTATTATTT-T-------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----AAAATGAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA-TTTTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCAAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTG------GGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA--TTTTTTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAAATATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAACAAAAAAA-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AATAT---------------------AATAATAAAGATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTC-AAAAATGAAATAAATTGCCTAAAGA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACGTGAATTATGGGTACAAATGA--TTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTAGAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_transtagana --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGA---TAGTAGAACGACCCGCTAACATGT-AAAATCATTGGGCAAGTGTT--GGGGGG-CC--TTGCGTCCCCTGTTTGCAAACCCAAGGTAGGTGT-CCTCTGAC-----------ACCGGCCAATGAAATCAACCGGGCGCTGAATGCGTCAAGGAAGC-TAAGAATGAATTGTTCGTTCGCTTCTCCTTTGCGGGGAGCGGCGTC--AGTCCGAACCAC-AAATGACTCTCGGCAACGGATATCCCGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCATGCATCGCGTTG-CCCCTGACCAAAC--ATCTCTTTAGG-AGA-TTT-TTTGGTTTGGGGG-CGGATATTGGCCTCCCGTGCCTCGT--TGCATGGCTGGCTAAAAAATGAGTCTTTGGCGATGGACGTGGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGC--ATGCCTGTT-GCCTTAGCCA-GCTCAAGGGCCCTTAGGCGTCAC--AAAA-TATGTGTGCTTGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTCTAAAAT--AAAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTCTGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTCTACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATGGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATAGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAAGAGAGGTGTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGT-------------------GAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-AAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCAGTGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGT---------------------------CCTATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT--------------------------------------------------------------------------------CTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCAT--ATATATTGT-----TATAATCAAAATGGATAAATTGAAAATCAAAAATACTGAATAAACACTTGATTAGTTATGT------ATCATTTTTTAGTTTCTTGTGTCATTAGGAAA--AAAATTGTATATTCACAAATCCAAGACTCATTCATGAATTTGAAGCCAGGAGTCAATAGTTAATGGTTCAAATTTGC-CCATCAACTTGTTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAG------AAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGG-CCCTTCTTTTCGGAAACC-GAGAA-AAA------AAAAAAAGGCTTCAAGATACAAGT----AAAAAGAGGTTCAGTAATCCACCCC-------------------CCTTAAGCAGGAAAATTTCCATCTAT-TTTTTGTATTATTT---------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTT-ATTTTACAGATGATTCGGAATGAAACTCTGTCATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGGGGAGTCACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTTGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGTTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCGAAATAT-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTT--------GGGGGGGCTCTATAATTTAAAAGTTAGAACTCCTTC------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCAGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAGACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGACGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTTATTCTTACATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AAAAACTATGGATTCCTCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATAGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGAGTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCA-TTTTTCAATTGTCTCAATAACTGTATAATCTAT------------------------------------------------AAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAATA---TTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAATGA-TTTTTTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGCGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- Thapsia_villosa --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAA---TAGCAGAATGACCCGCTAACACGT-AATAACATTGGGCAAGTGCA--GCGGGG-CC--TTGGGTCCCTTGCTTGCAAACCTAAGGCAGGTGT-CCACTGACGGGGGTATCC-ACCTGCCAATGGAATCAACCGGGCGCTGACTGCGCCAAGGAAGT-TAATAACGAATTGTTCGTTCGCTTCTTGTTTGAGGGAAGCAGCGTC--AGTCCGGAACAT-AAATGACTCTCGGCAACGGATATCCTGGCTCTC-GCATCGATGAAG-AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGTTG-TTCCTGACTAATT--ATCTCTTTAAG-AGA-TTT-TCTGGTTTTGGGG-CGGATATTGGCCTCCCGTGCCTTGT--TGTGCGGCTGGCTCAAAAATGAGTCTCCGGCGATGGAAGTCGCGACATTGGTGGTTGTAAGAACACCTTCTTGTCTTGTCGTGT--ATGCCCGTC-CCCTTAACTA-{AG}CTCAAGGGCCCTTAGGTGCCAC--AAAA-TGTGTGCGCTTAGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGCATTTCCCATCTTCTAAAAT--AGAAAAATCCCACTATTCACTCATTATTCATGGAATCATATAGATG-AATCTAGCAATGATGGAATTTTTATTATGTTTACTGAATCACATGAAATTGAACCCAACTCCTACATATCTGGAATAGAATGTATGAAATACGTATTAACTATGAACGGGGGAATAAATAAAATCATTTATACTCAAGTTGGAATTTGAGAAACAGATACAAATGGAAATAAATTTCTAAAACATTGACCTGGAAACAGAATTCTGCTACTTAGGCTTACGAAGTTATGGAATTTTGTATAGAATATCTCAAAAATAGATTAAATTTCTACCATTATTATGAT---------ATTACATATTCCAATCTGTACTTGAATACCAGAAAAATGAATGGATTCGGCATTTGATCTTTTCGATAAGATAAAACACTAAAACTCAGAAACAATGGAATATAGAGTCGATTTTTTAGTACTTAAACATATTTATA--G-ATTCCATTGTTCAAAGAAAAGGATTCA--------------------------------TACAGAGAAGAGAGTTTTTTTACCTATAGAATTTTTAGTATACGCTAAGGATTGTGAGGTATA----------TGAGGTATATAAGAGGGGTTGTA---TTTATTAAACAGA-TATAGGCAGATAT-CAGATATATC------TATCTATATATAAGTCTTCCCCTTCTATT-------TTTATTCCACTGAAAATTAAAATTTGAAACACAAAAATTTCCTGAGAATTGAG-------------------CCTATA-GGCATAGGCAACATATATAAAAACATATATAAATAAGATAACCAATTAGATAT-------------------------------------------------------------------------------CCTGTGTAACAATTTATGTTCTGGGGTTTACATATACCCATACATATATTGT-----TATAATCAAAATGGAGAAATTGAAAATAAAAAATACTGAATAAACA-TTGATTAGTTATGT------ATCATTTTTTAGTTTCTTATGTCATTAGGAAA--AAAATTGTATATTC-CAAATCCAAGACTCATTCATGAATTTGCAGCCAGGAGTCAATAGTTAATGGTTCAAATTTG--CCATCCACT--TTTTTTGTGACTAAAAATCCACATTTTAATTTTACTTTTCAATATAAACAT------TAGTGAGGGGAAGTTTTTAGGCATTGTGTTTGTGTGTTTTGAGATACTATACAATC--ACAATCGAAGAAGTGGATAAAATT-----AAAAAGAGGAAAGGT-TCCTTTTTTTCGGAAACC-CAGAATAAAT-----AAAAAAAGGCT---------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGCGATGTGTGATTTGAT-CGAAATTCTG-ATTTTACAGATGATTCGGAATGAAACTCTGTTATCCCATTCACTCCAACC--GGGATGCCTTGGACCTGACATGTAGCTTAGGAGGAGTAACATGAAGCTCAGAATTTA-GGGTGTATTCAATACTCCCAAATAACAAGGGGAATTGATCTATGGTCGATTTCGTAAC--AAAAAAATAGGCATTTTTAGTTATACCTCGTAAAAAAGACTTTTTCCTTTGTGGAATTAACCTGCTCCTTTCTTTTA----------GAAA-----TAAATTAA-GGAAATAGCAAATATGTCATGGTTACAGTAGTCTATCCATCGCATATAG------ACTTTAAGGGCATCGTGGCATAACCGTCGAGGTGAAGTCGGGACCTAAAAGATTTAACGGAACGGTACATAGACAAGTAAATCCCTTATGAATTTCAAGGTACTCACTTTAATTAAAATTAAGAATTACGGGATTCATCATTCGGGGGGAGTAGACTA--CTCAATAATTTCACA---TTTT-------TTTTTGAATAAAGAATTC-AA-------AAAA-TCTAAATAA-AAAGGAAGCCATAATTAAGGAAAACCTCC-TTGGTCCTCGCTGGTAACTTGAGTAAAGAGTAGATCTTTTTTTT------GGGGGGGGCTCTAGAATTTAAAAGTTAGAACTCCTTA------TTTTTTTTTGATGTACCTACTTGAGCCGGATGAAAGGAAACTTTCACGTCCGGTTTTGAA-GGGGGGGATATCCTATAGAGGATCCTATCCCAATTTTTCTTTTGCTAGGCCCATAGCTAAAAAACCCACTTTTTTACGATTACGAGGTTTGTTCGAATATGAAATCCAATCCTGGAAATACAGCATCCCACTTTTTTTTACTACCCAAGGCTTTGATACATTTCGAAATCGAGAGATCTCTACTGGAGCCGGTGCTATCCGAGAACAATTAGCCGATCTAGATTTACGGATTATTATAGATTCTTCATTGGTAGAATGGAAAGAGTTGGGGGAAAACGGTCCCACAGGGAATGAGTGGGAAGATCGAAAAGTTGGAAGACGAAAGGATTTTTTGGTC---------------------------------------CGATCCGGTGTGGATTTTT--------ATCCGCCATCTTTTCTATGAATGAAGATGCTCTTGACCCGACATCTGTTC--TGTTTTAACTAGAATCCTTATTTTTGTTAGGTTGTAATGAAAAATAGAG--TACATGATGGAGCTC-GGGT--AGAAACTATGGATTCATCTTTCAGGGGGCAAGAATCTAGGGTTAATACCAATCAATAAATTGGAACAACTTCGTAAGTATATCAATATATAAATCGAAAGGATCCGATTCAGTCAAGTTTTTAATTAAAAAGTAAAATTTGTTGGAATTGAGAAAAGTCTTTCGATTCAAAGTGTATCGCGCGGGAATCGAGATTTTATATGATTCTTTGAT-------AGA-----------AAGAAATCACAA-AAGGGGTATGTTGCTGCCATTTTGTAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCACTG---------------ATTTAAAAC---AAAG-AA----AAAGGATCCCAGAACAAGGAAACGCCG-TTTTTCAATTGTCTCAATAACTGTATAATCTAT---------------------------------------A---TCTATAAT---------------------------ATAATAATAAAGATTAAATGAGACAAACAAGAGGGGGTTAAAGACCATTCAAAAAATGAAATAAATTGCCTAAAGA--TTTTTTTTCTTTTAAGCTATTTGAGAATTATCCAACTTGAGTTATGGGTACAAA--------TTTTTC------AGGAAGGGGGAAG--AAAAAAATGAGTTAAATCCCAT---------TATAATTTTTTTTATCAACTCCT------TTGCCATTAATTATAATTCTATACGTAG------ACAAAACTCCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGTTTCTAGGGGGGGTCTTGTTCATTTA-CTTAGATCTATCCCAAT-GAGCCGTCTATCGAATCG-------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET ETS (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 1-464; CHARSET rps16 (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 4917-6043; CHARSET rpoB (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 2210-3721; CHARSET rpoC1 (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 3722-4916; CHARSET ITS (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 465-1215; CHARSET rpl16 (CHARACTERS = Daucus_Molecular_matrix_untrimmed) = 1216-2209; END; BEGIN TREES; TITLE Daucus_Dated_Phylogeny; LINK TAXA = Taxa1; TRANSLATE 1 Anthriscus_sylvestris, 2 Daucus_annuus, 3 Daucus_arcanus, 4 Daucus_aureus, 5 Daucus_bicolor, 6 Daucus_bischoffii, 7 Daucus_carota_subsp_azoricus, 8 Daucus_carota_subsp_carota, 9 Daucus_carota_subsp_gummifer, 10 Daucus_carota_subsp_halophilus, 11 Daucus_conchitae, 12 Daucus_decipiens, 13 Daucus_dellacellae, 14 Daucus_durieua, 15 Daucus_edulis, 16 Daucus_elegans, 17 Daucus_glochidiatus, 18 Daucus_guttatus, 19 Daucus_incognitus, 20 Daucus_insularis, 21 Daucus_involucratus, 22 Daucus_littoralis, 23 Daucus_mirabilis, 24 Daucus_montanus, 25 Daucus_muricatus, 26 Daucus_pumilus, 27 Daucus_pusillus, 28 Daucus_rouyi, 29 Daucus_setifolius, 30 Daucus_syrticus, 31 Daucus_tenuisectus, 32 Daucus_tenuissimus, 33 Ekimia_bornmuelleri, 34 Ekimia_petrophila, 35 Ferula_communis, 36 Glaucosciadium_cordifolium, 37 Laser_affine, 38 Laser_archangelica, 39 Laser_carduchorum, 40 Laserpitium_gallicum, 41 Laserpitium_halleri, 42 Laserpitium_krapfii, 43 Laserpitium_latifolium, 44 Laserpitium_peucedanoides, 45 Laserpitium_pseudomeum, 46 Laser_stevenii, 47 Laser_trilobum, 48 Orlaya_grandiflora, 49 Siler_montanum, 50 Silphiodaucus_hispidus, 51 Silphiodaucus_prutenicus, 52 Thapsia_eliasii, 53 Thapsia_garganica, 54 Thapsia_gummifera, 55 Thapsia_meoides, 56 Thapsia_nestleri, 57 Thapsia_tenuifolia, 58 Thapsia_thapsioides, 59 Thapsia_transtagana, 60 Thapsia_villosa; TREE TREE1 = [&R] (((((34:12.033286785585052,33:12.033286785585052):8.867345223233833,(((59:4.9890328609194,53:4.9890328609194):7.971840600606301,((58:3.3929927601821817,55:3.3929927601821817):4.001501177578236,(54:5.5210405225899795,57:5.5210405225899795):1.873453415170438):5.566379523765283):2.9964043192161007,(60:14.363739701135525,(52:4.729749211780652,56:4.729749211780652):9.633990489354952):1.5935380796062972):4.943354228076885):0.9047570579625663,((40:7.595192625496747,41:7.595192625496747):8.866594804684553,(43:8.801648240185601,(42:3.2055383250291776,44:3.2055383250291776):5.596109915156424):7.660139189995698):5.343601636599953):1.0338831139530456,(((49:14.665927101308396,45:14.6659271013084):4.467297243592638,(((46:11.523176689836381,47:11.523176689836301):1.3897964937794995,(38:8.98108444132125,37:8.98108444132125):3.93188874229455):2.9190770476731007,39:15.832050231289097):3.3011741136120367):1.3770540004980596,(((50:3.410280102257307,51:3.410280102257307):9.793387681919793,((19:6.560957406823549,(((21:1.5922786287224966,11:1.5922786287224966):2.071485313892497,((27:0.39537744683310905,3:0.39537744683310905):2.96669850395231,((5:1.9625307019484506,22:1.9625307019484506):1.1536172252817476,18:3.116147927230191):0.24592802355522814):0.30168799182957073):0.6787212817732016,(14:3.493175802719101,(24:1.7575584495735477,17:1.7575584495735477):1.7356173531455497):0.8493094216691013):2.218472182435347):3.8173980022801555,(((31:6.6792875785072745,25:6.6792875785072745):1.3204408214973657,(29:7.421042412494599,(4:6.683735451682894,((23:4.388671644579448,13:4.388671644579448):1.1766529378827517,(((30:1.8471850000045968,(((10:0.054013894715581046,7:0.054013894715581046):0.29340765820785997,(8:0.17958711049431209,9:0.17958711049430853):0.16783444242913959):0.22580120829404393,(20:0.2811277302927966,(6:0.1299218892301326,(32:0.06901839654029907,2:0.06901839654030262):0.060903492689829974):0.15120584106264623):0.29209503092470257):1.2739622387870977):1.159730039427803,28:3.0069150394324):1.1236739558727464,26:4.130588995305146):1.4347355871570535):1.118410869220698):0.7373069608117016):0.578685987510041):0.5477829803506662,(16:7.767338955842346,(15:3.5419144467296473,12:3.5419144467296473):4.2254245091127025):0.7801724245129567):1.8308440287483947):2.8253123750732954):6.2013780777463055,48:19.405045861923405):1.1052324834755929):2.3289938353353996):0.6614016319759557,((36:12.169338255605052,1:12.169338255605052):2.718045130110953,35:14.887383385716003):8.61329042699445); END;