#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:18 GMT TreeBASE (cc) 1994-2008 Study reference: Yamamoto K., Yasuda M., Ohmae M., Sato H., & Orihara T. 2020. Isaria macroscyticola, a rare entomopathogenic species on Cydnidae (Hemiptera), is a synnematous form and synonym of Purpureocillium lilacinum (Ophiocordycipitaceae). Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S25381] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=15; TAXLABELS 'Isaria macroscyticola 170628-1' Purpureocillium_atypicola_CBS744.73 Purpureocillium_atypicola_NBRC101761 Purpureocillium_lavendulum_CBS731.73 Purpureocillium_lavendulum_FMR10376 Purpureocillium_lilacinum_BCC15610 Purpureocillium_lilacinum_BCC2012 Purpureocillium_lilacinum_CBS284.36 Purpureocillium_lilacinum_CBS431.87 Purpureocillium_lilacinum_FMR7231 Purpureocillium_lilacinum_JCM8437 Purpureocillium_sodanum_IBRC.M30175 Purpureocillium_sodanum_UFMGCB14228 Purpureocillium_takamizusanense_NBRC108982 Purpureocillium_takamizusanense_NBRC110232 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M52420] TITLE Cydnidae_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=505; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Isaria macroscyticola 170628-1' -------TACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_atypicola_CBS744.73 -------------------ATACTCCCAAACCCCCTGCGAACCGTACCACAGTTGCCTCGGCGGGACCGCCCCGG-CGCCGGCCTTCGCGGCGGCGCCGGATCCAGGCGCCCGCCGCAGGGACCCGCAAAACTCCTGCATCGCGCCC--CTGCGGCGCTCTACTCTCTGAGTGTCACGA---TGAGAAAATGAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCGGGCCCCC---GGGGCCCCGGCGTTGGGGGACGGCGGCACCGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCGCCCTCCCCTGCGCAGTAA-GCAAACCTCGCACCGGGGCGCGGAGGCGGTCACGCCGTAAACGCTCAA Purpureocillium_atypicola_NBRC101761 GGATCATTACAGAGTTACAATACTCCCAAACCCCCTGCGAACCGTACCACAGTTGCCTCGGCGGGACCGCCCCGG-CGCCGGCCTTCGCGGCGGCGCCGGATCCAGGCGCCCGCCGCAGGGACCCGCAAAACTCCTGCATCGCGCCC--CTGCGGCGCTCTACTCTCTGAGTGTCACGA---TGAGAAAATGAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCGGGCCCCC---GGGGCCCCGGCGTTGGGGGACGGCGGCACCGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCGCCCTCCCCTGCGCAGTAA-GCAAACCTCGCACCGGGGCGCGGAGGCGGTCACGCCGTAAACGCTCAA Purpureocillium_lavendulum_CBS731.73 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGACCGCCCCGGCCG-------CCGCGCCGGCGCCGGACTCAGGCGCCCGCCGCAGGGACCCAAGACTCTTTTGCATTACGCCCAACGGCGGGAATTTTTTCTCTGAG-TGCATAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCTCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGACGGTCACGCCGTAAACGCCCAA Purpureocillium_lavendulum_FMR10376 -----------GAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGACCGCCCCGGCCG-------CCGCGCCGGCGCCGGACTCAGGCGCCCGCCGCAGGGACCCAAAACTCTTTTGCATTACGCCCAACGGCGGGAATTTTTTCTCTGAG-TGCATAAGC-AAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCTCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGACGGTCACGCC------------ Purpureocillium_lilacinum_BCC15610 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_lilacinum_BCC2012 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCGGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_lilacinum_CBS284.36 -----------GAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCC------------ Purpureocillium_lilacinum_CBS431.87 --ATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGG-CTCGGTGTTGGGGGACGG---ACCA--CGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_lilacinum_FMR7231 -----------GAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCC------------ Purpureocillium_lilacinum_JCM8437 -----------GAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCC------------ Purpureocillium_sodanum_IBRC.M30175 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCGGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_sodanum_UFMGCB14228 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCGGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCG------------------------------------------------------------------------------ Purpureocillium_takamizusanense_NBRC108982 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCCCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCGGCCCCCGCGCCGGCGCCGGGCCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCCCCGGGCGGGATTGTTTCTCTGAG-TGCACAAGC-AAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA Purpureocillium_takamizusanense_NBRC110232 GGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCCCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCGGCCCCCGCGCCGGCGCCGGGCCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCCCCGGGCGGGATTGTTTCTCTGAG-TGCACAAGC-AAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAGGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAACGCCCAA ; END; BEGIN TREES; TITLE Cydnidae_ITS; LINK TAXA = Taxa1; TRANSLATE 1 'Isaria macroscyticola 170628-1', 2 Purpureocillium_lilacinum_CBS284.36, 3 Purpureocillium_lilacinum_CBS431.87, 4 Purpureocillium_lilacinum_BCC15610, 5 Purpureocillium_lilacinum_BCC2012, 6 Purpureocillium_lilacinum_FMR7231, 7 Purpureocillium_lilacinum_JCM8437, 8 Purpureocillium_sodanum_IBRC.M30175, 9 Purpureocillium_sodanum_UFMGCB14228, 10 Purpureocillium_lavendulum_FMR10376, 11 Purpureocillium_lavendulum_CBS731.73, 12 Purpureocillium_takamizusanense_NBRC108982, 13 Purpureocillium_takamizusanense_NBRC110232, 14 Purpureocillium_atypicola_CBS744.73, 15 Purpureocillium_atypicola_NBRC101761; TREE tree_1 = [&R] ((((12:1.0E-6,13:0.001993):0.012522,(((3:1.0E-6,(1:1.0E-6,((6:1.0E-6,7:1.0E-6):1.0E-6,2:1.0E-6):1.0E-6):1.0E-6):1.0E-6,4:1.0E-6):0.001969,(9:1.0E-6,(8:1.0E-6,5:1.0E-6):1.0E-6):1.0E-6):0.002222):0.012493,(10:1.0E-6,11:0.00197):0.008311):0.082676,(15:1.0E-6,14:1.0E-6):0.082676); END;