#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:01 GMT TreeBASE (cc) 1994-2008 Study reference: Masumoto H., & Degawa Y. 2020. Multiclavula petricola sp. nov. (Cantharellales, Basidiomycota), a new clavarioid and lichenized fungus growing on rocks. Mycoscience, 61(4): 155-159. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S25585] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=14; TAXLABELS Clavulina_caespitosa_DQ056371 Clavulina_cinerea_AY456339 Hydnum_albidum_MH379883 Hydnum_subconnatum_MH379930 Multiclavula_corynoides_U66440 Multiclavula_ichthyiformis_DQ492694 Multiclavula_mucida_DQ521417 Multiclavula_mucida_EU909345 Multiclavula_mucida_KM248921 'Multiclavula petricola H_Masumoro_356_holotype' 'Multiclavula petricola NBRC_XXXXX_ex_type' Multiclavula_vernalis_U66439 Sistotrema_brinkmanii_AY781270 Sistotrema_raduloides_KF218969 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M57491] TITLE Multiclavula_ITS_v191227_petricola; LINK TAXA = Taxa1; DIMENSIONS NCHAR=441; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Clavulina_caespitosa_DQ056371 GGGGTTTGATGCTGGTGCATGTGCTTGCCCCGACAATTTCAACACCTGTGCACGCTGGTGGGGGTCTCCTCCGCTTACAATAATGAACGTATTGTGCCCGCAAGGCTACTTATTACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCACGAAATTCTCAAGCTGATGATGATCATCATCTTGGTTTTGGGCTTTGCCGTTTTGGGAGGCTGGCCTTAAAAGTATTAGCTGATCCTGTGTGGACTGGTTCTACTCAGCGTGATAATAATCGATCGTGAGGACATCTTTTGGGATGGCCGGTATCAATTGGGTTGCTCATAGTC Clavulina_cinerea_AY456339 TGGGGTTGATGCTGGTGCATGTGCTCGCCCTGACAATTTCAACACCTGTGCACATTTTGGCGATTTTCTTGCGCTGTCAATGTTGAACGTCTTTGTGCCGCAAGGCTTAATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCATTAAATTCTCAAGCTGATGGTTTTTGTCTCCTTGGTTTTGGGCTTTGCCGTATTGGGAGGCTGGCCTTAAAAGCATTAGCTGATCCTTTGCGGACTGGTTCTACTCAGCGTGATAATAGTCGATCGTGAGGACATCTTTTGGGATGGCCAGTCCTCATTGGGTTGCTTATAGAC Hydnum_albidum_MH379883 GAGGGTTGATGCTGGTGCATGTGCTCGCTCTTCTGATTTATACACCTGTGCACTCCTTTGGGGCTTATAAACCTTGTGAACAGTGAATGTTTGTCTGCCATAAGGCAAATTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTCTGGTATTCCGGGGAGCACACCTGTTCGAGTGTCATTGAACTCTCAAACAGGTAGTTGCTGCTGGTTTGGATCTGGACTCTGCTGCATTCATGGGCTAGTCTTAAATGTATTAGCTGGTCCTCTGAGGTTTGGTTCTACTCGGCGTGATAATTATCTAACGTGAGGACGGTCTCAGGACTGGCCATGCTCTCTTGGATTGCTTCTAAAT Hydnum_subconnatum_MH379930 GAGGGTTGATGCTGGTACATGTGCTCACTCTTCTGATTTATACACCTGTGCACTCCTTTGGAGCTTAATAGCCCTATGAGTAATGGATGTTTATGTGCCACAAGGCAATTTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTCTGGTATTCCGGGGAGCACACCTGTTCGAGTGTCATTAAGCTATCAAATGGGTGTTTTCAGTCAGTTTGGATTTGGGCTTTGCTGCATTAATGGGCTAGTCTTAAATATATTAGCTGGTCCTTTGAGGTTTGGTTCTACTCAGCGTGATAATTATCTAACGTGAGGACAGTTTCAGAACTGGCCATACTCTCTTGGATTGCTTCTAAAC Multiclavula_corynoides_U66440 GGAAGCTGATGCCTGGGCGTGTGCTCGCTTCCTGCAAATCTACACCTGTGCACAGAAAGGGATCCTGAACGCTCTTGAAATCTTGAACGTCCGCGAGCCGCAAGGCTAATCAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTCGTTATTGTCGGCTTGGACGTGGACTCTGACGTAAGAGAAGACTGGTCTAAAATACATTAGCTGACCCTTTGTGGTTCGGTTCTACTCGACGTGATAAATATCTATCGCGAGGACATCCCCAGGGATGGCCGGACTCGCCCGGGACGCTTCTAATC Multiclavula_ichthyiformis_DQ492694 GGAAGTTGACGCCGGGGCATGTGCTCACTTTCTACAAATCTACACCTGTGCACACTGTTGAGGCTCTGAACCTCTTGAAACCTTGAACGTTATTGTGCCGAAAGGCTAACTCATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTTATGAAGCTCTCAAGCTGATTATTATTGTAAGCTTGGATTTGGACTTTGGAGTCAGATAGCCCTGGTCTTAAATACATTAGCTGACCCTCTGTGGATCGGTTCTACTCGACGTGATAAGTATCAATCGTGAGGACATTCTTAGGGATGGCCGGGATCACCAGGGACGCTTACAATT Multiclavula_mucida_DQ521417 GGAAGCTGATGCCTGGGCGTGTGCTCGCTTCCTGCAAATCTACACCTGTGCACAGAAACGGATCCTGAACGCTCTTGAAATCTTGAACGTCCGCGAGCCGTAAGGCTAATCAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTATCAAGCTGGTTGTTATTGTCAGCTTGGATATGGACCTTGACGTAAGAGAAGACTGGTCCGAAATGCATTAGCTGACCCTTTGTGGTTCGGTTCTACTCGACGTGATAAATATCGATCGCGAGGACATCTCCAGGGATGGCCGGATTTGCCTGGGACGCTCCTAATC Multiclavula_mucida_EU909345 GGAAGCTGATGCCTGGGCGTGTGCTCGCTTCCTGCAAATCTACACCTGTGCACAGAAACGGATTCTGAACGCTCTTGAAATCTTGAACGTCCGCGAGCCGTAAGGCTAATCAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTTGTTATTGTCAGCTTGGATATGGACCTTGACGTAAGAGAAGACTGGTCCGAAATGCATTAGCTGACCCTTTGTGGTTCGGTTCTACTCGACGTGATAAATATCGATCGCGAGGACATCTCCAGGGATGGCCGAATTTGCCTGGGACGCTCCTAATC Multiclavula_mucida_KM248921 GGAAGCTGATGCCTGGGCGTGTGCTCGCTTCCTGCAAATCTACACCTGTGCACAGAAACGGATCCTGAACGCTCTTGAAATCTTGAACGTCCGCGAGCCGCAAGGCTAATCAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTTGTTATTGTCAGCTTGGATATGGACCTTGACGTAAGAGAAGACTGGTCCGAAATGCATTAGCTGACCCTTTGTGGTTCGGTTCTACTCGACGTGATAAATATCGATCGCGAGGACATCTCCAGGGATGGCCGGATTTGCCTGGGACGCTCCTAATC 'Multiclavula petricola H_Masumoro_356_holotype' AGAAGCGGATGCTGGGGCATGTGCACGCTTCTCCCAAATTTACACCTGTGCACTCTACTGGGATCTGGATGCTCTTGCAACCTTGAATGATAGCGTGCCACACGGCTAACTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTCATTGTTGTGAGCTTGGATGTGAGCCGTGTCGCATGAGAGGACTGGTTCTAAATGCATTAGCTGACCCTTTGTGTCTCGGTTCTACTCGACGTGATAAGTATCACTCGTGAGGACATTTTAAAAGATGGCCAAGTACACCTGGGACGCTCCTAATC 'Multiclavula petricola NBRC_XXXXX_ex_type' AGAAGCGGATGCTGGGGCATGTGCACGCTTCTCCCAAATTTACACCTGTGCACTCTACTGGGATCTGGATGCTCTTGCAACCTTGAATGATAGCGTGCCACACGGCTAACTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTCATTGTTGTGAGCTTGGATGTGAGCCGTGTCGCATGAGAGGACTGGTTCTAAATGCATTAGCTGACCCTTTGTGTCTCGGTTCTACTCGACGTGATAAGTATCACTCGTGAGGACATTTTAAAAGATGGCCAAGTACACCTGGGACGCTCCTAATC Multiclavula_vernalis_U66439 GGAGGTTGATGCCAGGGCGCGTGCTCGCTTCCTGCAAATCCACACCTGTGCACAGTGTGGGACTCTGAAAGCTCTTGAAATCTCGAATGTTCTCGAGCCGCAAGGCTAACTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAGCTCTCAAGCTGGTTGTTATTGTCGGCTTGGATATGGATTTTGGCGCCAGAGAGGACTAGTCCTAAATGCATTAGCTGACCCTTTGTGGTTCGGTTCTACTCAACGTGATAAGTATCAATCGTGAGGACATCTCCAGGGATGGCCGGATGCGCCTGGGACGCTTCTAATC Sistotrema_brinkmanii_AY781270 GGGAGTTGATGCTGGGGCATGTGCTCGCTTCCGACAAATCTACACCTGTGCACACTGTGAGGGCACGAAAGCACCTATGAAATCGCACGTACTTGCGTCGTATGGCTAAATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAACTCTCAAGCTAGATGTTAGTGTCAGCTTGGTTTTGGACTCTGCTGTTCTGGAAGGCTGGTCTCAAATGTATTAGCTGGCTCTTTTGGGATTGGTTCTACTCAGCGTGATAATCTATGACCGTGAGGACATCTCTCGGGATGGCCAAGCCTGCCTGAACTGCTTCTAACT Sistotrema_raduloides_KF218969 GAGAGTTGATGACTGTGCAAGTGCTCACTGTCTTAATATCTGCACCTGTGCACTGGCTTGGTTCAGGCATGTCTTTATAATCCTGAATGTTCTTTTGCTGCAAGGCAAACTATAACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGGAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTCGAGTGTCATTACACTCTCAAGCCAGATGTTCTTATGAGTTTGGATTTGGACTTTGCTGTGAAGGCAAGCTGGTCTTAAATAGAGTAGCTGGCCCATTGAAGCTTGGTTCTACTTGGCGTGATAATTATCTGGCGCAAGGACATTCTCGGGAGTGGCCAATCTTTGTTGGACTGCTTCTAACT ; END; BEGIN TREES; TITLE Multiclavula_ITS_v191227_petricola; LINK TAXA = Taxa1; TRANSLATE 1 Clavulina_caespitosa_DQ056371, 2 Clavulina_cinerea_AY456339, 3 Hydnum_albidum_MH379883, 4 Hydnum_subconnatum_MH379930, 5 Multiclavula_corynoides_U66440, 6 Multiclavula_ichthyiformis_DQ492694, 7 Multiclavula_mucida_DQ521417, 8 Multiclavula_mucida_EU909345, 9 Multiclavula_mucida_KM248921, 10 'Multiclavula petricola H_Masumoro_356_holotype', 11 'Multiclavula petricola NBRC_XXXXX_ex_type', 12 Multiclavula_vernalis_U66439, 13 Sistotrema_brinkmanii_AY781270, 14 Sistotrema_raduloides_KF218969; TREE tree_1 = [&R] (((1:0.110793,2:0.046506):0.129352,(14:0.239939,(3:0.047771,4:0.06138):0.106537):0.068673):0.0346295,(13:0.144519,((6:0.105242,(10:1.0E-6,11:1.0E-6):0.136698):0.003837,(12:0.03317,(5:0.029438,(9:1.0E-6,(7:0.002245,8:0.004452):0.002192):0.011131):0.045405):0.036816):0.092049):0.0346295); END;