#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:38 GMT TreeBASE (cc) 1994-2008 Study reference: Shirakawa M., & Tanaka M. 2020. Two new deer truffle species, Elaphomyces marmoratus and Elaphomyces fuscus spp. nov., from a secondary forest in Japan. Mycoscience, 61(6): 315–322. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S25876] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=61; TAXLABELS Elaphomyces_aff._barrioi_1_EU846311 Elaphomyces_aff._barrioi_2_EU837229 Elaphomyces_aff._granulatus_KR029763 Elaphomyces_aff._muricatus_KR029739 Elaphomyces_aff._muricatus_KR029740 Elaphomyces_asperulus_KR029755 Elaphomyces_asperulus_KX165345 Elaphomyces_asperulus_KX165347 Elaphomyces_asperulus_KX165351 Elaphomyces_asperulus_KX238791 Elaphomyces_asperulus_KX238833 Elaphomyces_barrioi_KR029745 Elaphomyces_barrioi_KX238848 Elaphomyces_cf._pusillus_KR029756 Elaphomyces_cf._pusillus_KR029757 Elaphomyces_citrinopapillatus_KR029762 Elaphomyces_citrinopapillatus_KR029765 Elaphomyces_decipiens_DQ974740 Elaphomyces_decipiens_KR029742 Elaphomyces_decipiens_KX238832 Elaphomyces_fuscus_LC500967 Elaphomyces_fuscus_LC523911 Elaphomyces_granulatus_KR029767 Elaphomyces_granulatus_f._granulatus_EU784197 Elaphomyces_granulatus_f._granulatus_KX238835 Elaphomyces_granulatus_f._pallidosporus_KX238846 Elaphomyces_hassiacus_KX238834 Elaphomyces_marmoratus_LC500961 Elaphomyces_marmoratus_LC500962 Elaphomyces_marmoratus_LC500963 Elaphomyces_marmoratus_LC500965 Elaphomyces_marmoratus_LC500966 Elaphomyces_muricatus_KR029730 Elaphomyces_muricatus_var._muricatus_EU784198 Elaphomyces_muricatus_var._muricatus_KR029733 Elaphomyces_muricatus_var._muricatus_KX238843 Elaphomyces_muricatus_var._reticulatus_KX238841 Elaphomyces_muricatus_var._reticulatus_KX238851 Elaphomyces_muricatus_var._variegatus_KR029736 Elaphomyces_muricatus_var._variegatus_KX238850 Elaphomyces_papillatus_var._papillatus_KX238819 Elaphomyces_papillatus_var._papillatus_KX238825 Elaphomyces_pusillus_KR029760 Elaphomyces_pusillus_KR029761 Elaphomyces_quercicola_KX238837 Elaphomyces_quercicola_KX238838 Elaphomyces_roseoviolaceus_KR029751 Elaphomyces_roseoviolaceus_KR029752 Elaphomyces_striatosporus_KR029748 Elaphomyces_striatosporus_KX238790 Elaphomyces_sulphureopallidus_KX238830 Elaphomyces_tropicalis_LC010285 Elaphomyces_tropicalis_LC010286 Elaphomyces_violaceoniger_KX238857 Elaphomyces_violaceoniger_KX238858 Pseudotulostoma_japonicum_KU934217 Uncultured_Elaphomyces_Fr170629_LC500968 Uncultured_Elaphomyces_Mr170419_LC500964 Uncultured_Elaphomyces_YM1169_LC175081 Uncultured_Elaphomyces_YM756_LC175082 Uncultured_fungus_Se3_204_AB807936 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M53567] TITLE Elaphomyces_ITS_sequences; LINK TAXA = Taxa1; DIMENSIONS NCHAR=541; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Elaphomyces_aff._barrioi_1_EU846311 AGTACGGGTCCC-GGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCC-GGAATGCTGCCCCCGGGCCCGTGCCCGCCGGGGACCTCTCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCTC--------GGGGGGACGGGCCCGAAAGGCAGTGGCGGCACCCGGAGACCTGGTCCCTTCGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCGGCTGGCCACGCCCCGGGAGCCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_aff._barrioi_2_EU837229 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCAGGGATGCTGCCCCCGGGCCTGTGCCCGCCGGAGAC----CTCGAAATGCTACTGTGGTCCATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCCC--------GGGGGGACGGGCCCGAAAGGCAGTGGCGGCACCCGGGGACTTGGT-CC{GT}TCGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCGGCTGGCCATGCCCCGGGAGCCTGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_aff._granulatus_KR029763 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCCCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTTGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_aff._muricatus_KR029739 AGTATGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCGCCCCCGGGCCCGTGCCCGCCGGAGA-CTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAAC{AG}CACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGCTCA---- Elaphomyces_aff._muricatus_KR029740 AGTATGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCGCCCCCGGGCCCGTGCCCGCCGGAGA-CTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_asperulus_KR029755 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_asperulus_KX165345 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_asperulus_KX165347 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCT----------- Elaphomyces_asperulus_KX165351 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_asperulus_KX238791 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_asperulus_KX238833 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTTCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_barrioi_KR029745 AGTACGGGTCTCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGG------AGCCCCCGGGCCCGTGCCCGCCGGAGACCTCTCTCGAAACGCTACCGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGGAAGCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCTCT-------GGGGGGACGGGCCCGAAAGGCAGTGGCGGCACCCGGAGACCTGGT-CCTTCGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCGGCTGGCCACGCCCCGGGAGCCTGTCGAACGATCGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_barrioi_KX238848 AGTACGGGTCTCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGG------AGCCCCCGGGCCCGTGCCCGCCGGAGACCTCTCTCGAAACGCTACCGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGGAAGCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCTCT-------GGGGGGACGGGCCCGAAAGGCAGTGGCGGCACCCGGAGACCTGGT-CCTTCGGGCGGTGATGCATGGGTCTTTTATCCACCGTCCGGCTGGCCACGCCCCGGGAGCCTGTCGAACGATCGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_cf._pusillus_KR029756 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACCGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGTCGACGTCCACCCGTGGCCGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_cf._pusillus_KR029757 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACCGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGTCGACGTCCACCCGTGGCCGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_citrinopapillatus_KR029762 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCCCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTTGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCAGATCAGGTA Elaphomyces_citrinopapillatus_KR029765 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCCCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTTGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_decipiens_DQ974740 AGTGCGGGTCCCGGGGGG-TAGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGTGGGCCCGTCAGGCCGCCGGGAGCGCTGCCCCCGGGCCTGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGT-CCTTTGGGCGGTGATACATGGGTCTTTCTTCCACCGTCCCGCTGGCCACGCCCCGAGAGCCTGTCGAACGATTGGTC-TCCCCTTTAGG-TGACCTCG--------- Elaphomyces_decipiens_KR029742 AGTGCGGGTCCCGGGGGA-TAGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCA-AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGT-CCTTTGGGCGGTGATACATGGGTCTTTCTTCCACCGTCCCGCTGGCCACGCCCCGAGAGCCTGTCGAACGATTGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_decipiens_KX238832 AGTGCGGGTCCCGGGGGG-TAGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGTCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGCCCGCCGGAGACCCCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTA-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCACCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGT-CCTTTGGGCGGTGATACATGGGTCTTTCTTCCACCGTCCCGCTGGCCACGCCCCGAGAGCCTGTCGAACGATTGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_fuscus_LC500967 ------------GGGGGGCCCGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCTGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTTGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCCATCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCCCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_fuscus_LC523911 ------------GGGGGGCCCGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCTGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTTGAAATGCTACTGTGGTCAATGCTGTTTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCCATCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCCCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCCGTCGAACGATC---------------------------------- Elaphomyces_granulatus_KR029767 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_granulatus_f._granulatus_EU784197 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGA----TCGTTCCCCTTAGGTG---------------- Elaphomyces_granulatus_f._granulatus_KX238835 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_granulatus_f._pallidosporus_KX238846 AGCGTGGGTCCCGGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGAT------ Elaphomyces_hassiacus_KX238834 AGCGTGGGTCCCGGGGGGGCGGGGCCCTAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCTGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGGCGTCCACCCACGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCTCTGGGGCGGTGATACATGGGTTGGTCTTCCGCCGCTCTGT{AT}GGCCATGCTCCGGGGGCCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_marmoratus_LC500961 AGTACGGGTCCC-------TCCGGGGCCAGACCTCCCACCCTTGTCGAAGGTACCGTGTTGCTTTGGCGGGCCCGCCCGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Elaphomyces_marmoratus_LC500962 ----------------------GGGCCCAGACCTCCCACCCTTGTCGAAGGTACCGTGTTGCTTTGGCGGGCCCGCCCGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Elaphomyces_marmoratus_LC500963 ------------------------------ACCTCCCACCCTTGTCGAAGGTACCGTGTTGCTTTGGCGGGCCCGCCCGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Elaphomyces_marmoratus_LC500965 --------------------------------CTCCCACCCTTGTCGAAGGTACCGTGTTGCTTTGGCGGGCCCGCCCGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Elaphomyces_marmoratus_LC500966 -----------------------------------------------------------------------------CGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_KR029730 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCCCCTGGAGACTTGGT-CCTTCGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_var._muricatus_EU784198 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGC{CT}TGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCCCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACTGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTG----TTCCTCCTTAGGTGACCTCGATCA----- Elaphomyces_muricatus_var._muricatus_KR029733 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCCCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACTGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_var._muricatus_KX238843 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGT{CG}TGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCCCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_var._reticulatus_KX238841 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTTTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_var._reticulatus_KX238851 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTTTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_muricatus_var._variegatus_KR029736 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGCCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTT---------------- Elaphomyces_muricatus_var._variegatus_KX238850 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAATGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCTGCGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGCCCC------------------------------------------------------------------- Elaphomyces_papillatus_var._papillatus_KX238819 AGCGCGGGTCCCGGGGGGTTGGGGGCCCAGACCTCCCACCCTTGTCGAATGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGTCCGTCGGAGATCTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCGCCCGGGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGT-CCTTTGGGTGGTGATACATGGGTGTTTCTTCCACCGCTCTGCTGGCCACGCTCCGGGGGCCTGTCGGACGAACGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_papillatus_var._papillatus_KX238825 AGCGCGGGTCCCGGGGGGTTGGGGGCCCAGACCTCCCACCCTTGTCGAATGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGTCCGTCGGAGATCTCCCTCGAAACGCTACCGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCGCCCGGGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGT-CCTTTGGGTGGTGATACATGGGTGTTTCTTCCACCGCTCTGCTGGCCACGCTCCGGGGGCCTGTCGGACGAACGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_pusillus_KR029760 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACCGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGTCGACGTCCACCCGTGGCCGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_pusillus_KR029761 AGCGTGGGTCCCGGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACCGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGTCGACGTCCACCCGTGGCCGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_quercicola_KX238837 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCACCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTTGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGTGGCTGGGGGGGCGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_quercicola_KX238838 AGTACGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCACCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTTGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGTGGCTGGGGGGGCGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_roseoviolaceus_KR029751 AGCGTGGGTCCCGGGGGCCCGGGGGCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_roseoviolaceus_KR029752 AGCGTGGGTCCCGGGGGCCCGGGGGCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_striatosporus_KR029748 AGCGCGGGTTCCGGGGGGTTGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGTCCGTCGGAGATCTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCGCCCGGGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGT-CCTTTGGGTGGTGATACATGGGTGTTTCTTCCACCGCTCTGCTGGCCACGCTCCGGGGGCCTGTCGAACGAACGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_striatosporus_KX238790 AGCGCGGGTTCCGGGGGGTTGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGTCCGTCGGAGATCTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCGCCCGGGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGT-CCTTTGGGTGGTGATACATGGGTGTTTCTTCCACCGCTCTGCTGGCCACGCTCCGGGGGCCTGTCGAACGAACGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_sulphureopallidus_KX238830 AGCGCGGGTCCCGGGGGGTTGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCTGCCCCCGGGCCCGTGTCCGTCGGAGATCTCCCTCGAAACGCTACTGTGGTCAATGCTGTCTGAGTG-GTGAGAAATTGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCGGCGTCCGCCCGGGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGT-CCTTTGGGTGGTGATACATGGGTGTTTCTTCCACCGCTCTGCTGGCCACGCTCCGGGGGCCTGTCGAACGAACGGTC-TCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_tropicalis_LC010285 AGCGTGGGTCCCGGCGGGGCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCGGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCCGCCGGGGACCTCCCTTGAAATGCTACTGTGGTTAATGCCGTCTGAGTGTGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACACCCTCAAGCCCCGCTTGGCTGGTTGGGCCGGCGTCCACCCACGGCCGGGGGGACGGGCCCGAAAGGTAGTGGCGGCTCCCGGAGGG-TGGTCCTTTGGGGCGGTGATACATGGGTTGGTCTTCCGCCGCTCCGTTGGCCGCGCTCCGGGTGCCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_tropicalis_LC010286 AGCGTGGGTCCCGGCGGGGCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCGGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCCGCCGGGGACCTCCCTTGAAATGCTACTGTGGTTAATGCTGTCTGAGTGTGCGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACACCCTCAAGCCCCGCTTGGCTGGTTGGGCCGGCGTCCACCCACGGCCGGGGGGACGGGCCCGAAAGGTAGTGGCGGCTCCCGGAGGG-TGGTCCTTTGGGGCGGTGATACATGGGTTGGTCTTCCGCCGCTCCGTTGGCCGCGCTCCGGGTGCCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Elaphomyces_violaceoniger_KX238857 AGAATGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAG{AC}GAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGCGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGTGGTGATGCATGGGTCTTTCATCCACCGTCCCGTT{AG}GCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCG{AG}ATCAGGTA Elaphomyces_violaceoniger_KX238858 AGAATGGGTCCCGGGGGG-TGGGGGCCCAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAACGCCGCCCCCGGGCCTGTGCCCGCCGGAGA-CTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTC-TTGAGAAATTGATC--AAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCTGCTTGGCTTGTTGGGCCAGCGTCCGCCCGCGGCTGGGGGGATGGGCCCGAAAGGCAGTGGCGGCTCCTGGAGACTTGGT-CCTTTGGGTGGTGATGCATGGGTCTTTCATCCACCGTCCCGTTGGCCACGCCCCGGGAGTCTGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Pseudotulostoma_japonicum_KU934217 AGTGAGGGTTCC-------CGGGGGCCCAACCCTCTCCCCCGTGTTGACCGTACCGTGTTGCTTCGGCGGGTCGGCCGGGCCGCCGAGGGCGGGG----GGGGCCTGTGCCCGCCGGAGA-ATGGAGGGAGAACTTCTGGTTGTTATTGCGGTCTGAGTCA-------TCCAATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCATATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCGT-CCCTCAAGCCCGGCTTGGGT-GTTGGGCCGTCGTCCCTGCGCCGCCGGCGGGATGGGTCTGAAAGGCAGTGGCGGCGCCCGTGTTCGGGGT-CCCTGGAGCGC--ATGGGGGGGTTGATGATCCACCGCTCTGCAGG----GCCCCGG------GTCGGGGTGCTGGCCCATCTCTCAAGGTTGACCTCGGA------- Uncultured_Elaphomyces_Fr170629_LC500968 ---------------------------------------------------------GTTGCTTCGGCGGGCCCGCCTGGCCGCCGGGAGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTTGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCCATCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCCCCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGGTTGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCCGTCGAACGATCGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Uncultured_Elaphomyces_Mr170419_LC500964 --------------------------------CTCCCACCCTTGTCGAAGGTACCGTGTTGCTTTGGCGGGCCCGCCCGGCCGCCGGGAACGCGGCCCCCGGGCCAGTGCCCGCCGGAGA-CCCCCTCCAAACACTATTGTGGTCAATACGGTCTGAGT-GGTACGGAATGGATCAGAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCAT-CCCTCAAGCTTCGCTTGGCTGGTTGGGCCAGCGTCCACCTGTGGCTAGGGGGACGGGCCCAAAAGGCAGTGGCGGCTCCGGGGGACTTGGGTCCTCGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCCTGGGTCATGCCCCGGGAGTCTGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA Uncultured_Elaphomyces_YM1169_LC175081 ------------GGGGGGCCGGGGCCCTAGACCTCCCACCCTTGTCGATCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGAGCGCCGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTTCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCTGGGGGGACGGGCCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCCGTTGGCCACGCTCCGGGGGTCCGTCGAACGATTGGTCTTCCCCTTTAGGTTGACCTCGGATCAGGTA Uncultured_Elaphomyces_YM756_LC175082 ------------GGGGGCCCGGGGCCCTAGACCTCCCACCCTTGTCGATTGTACCGTGTTGCTTCGGCGGGCCCGCCAGGCCGCCGGGCGCGTTGCCCCCGGGCCCGTGCCCGCCGGAGACCTCCCTCGAAATGCTACTGTGGTCAATGCTGTCTGAGTGGGTGAGAAATTGATCAGTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCTGCCCGGGGGGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGACGTCCACCCGTGGCCGGGGGGACGGACCCGAAAGGCAGTGGCGGCTCCCGGAGGG-TGGTCCCTTGGGGCGGTGATACATGGGTTGATCTTCCACCGCTCTGTTGGCCACGCTCCGGGGGTCTGTCGAACGATTGGTCTTCTCCTTTAGGTTGACCTCGGATCAGGTA Uncultured_fungus_Se3_204_AB807936 AGTACGGGTCCC-------CCGGGGCCCAGACCTCCCACCCGTGTCGACCGTACCGTGTTGCTTCGGCGGGCCCGCCT---------GAACGCGGCCCCCGGGCGCGTGCCCGCCGGAGA-CCCCCTCCAAACACTACTGTGGTTAATACTGTCTGAGTGGGTAAGAAATTGATCAACAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCTCCCCGGTCCCCCGGGGAGCATGCCTGTCCGAGCGTCATTGCCATCCCCTCAAGCTCCGCTTGGCTGGTTGGGCCGGCGTCCACCGGTGGT-----GGACGGGCCTGAAAGGCAGTGGCGGCTCCCGGGGACTCTGGTCCCTGGGGCGGTGATGCATGGGTCTTTCATCCACCGTCCCACGGGCCATGCCCCGGGAGTCGGTCGAACGATCGGTCTTCCCCTGTAGGTTGACCTCGGATCAGGTA ; END; BEGIN TREES; TITLE Elaphomyces_ITS; LINK TAXA = Taxa1; TRANSLATE 1 Elaphomyces_marmoratus_LC500966, 2 Elaphomyces_marmoratus_LC500965, 3 Uncultured_Elaphomyces_Mr170419_LC500964, 4 Elaphomyces_marmoratus_LC500963, 5 Elaphomyces_marmoratus_LC500962, 6 Elaphomyces_marmoratus_LC500961, 7 Uncultured_Elaphomyces_Fr170629_LC500968, 8 Elaphomyces_fuscus_LC500967, 9 Elaphomyces_fuscus_LC523911, 10 Elaphomyces_citrinopapillatus_KR029765, 11 Elaphomyces_citrinopapillatus_KR029762, 12 Elaphomyces_pusillus_KR029761, 13 Elaphomyces_pusillus_KR029760, 14 Elaphomyces_cf._pusillus_KR029757, 15 Elaphomyces_cf._pusillus_KR029756, 16 Elaphomyces_roseoviolaceus_KR029752, 17 Elaphomyces_roseoviolaceus_KR029751, 18 Uncultured_Elaphomyces_YM756_LC175082, 19 Uncultured_Elaphomyces_YM1169_LC175081, 20 Elaphomyces_tropicalis_LC010286, 21 Elaphomyces_tropicalis_LC010285, 22 Elaphomyces_violaceoniger_KX238858, 23 Elaphomyces_violaceoniger_KX238857, 24 Elaphomyces_muricatus_var._reticulatus_KX238851, 25 Elaphomyces_muricatus_var._variegatus_KX238850, 26 Elaphomyces_barrioi_KX238848, 27 Elaphomyces_granulatus_f._pallidosporus_KX238846, 28 Elaphomyces_muricatus_var._muricatus_KX238843, 29 Elaphomyces_muricatus_var._reticulatus_KX238841, 30 Elaphomyces_quercicola_KX238838, 31 Elaphomyces_quercicola_KX238837, 32 Elaphomyces_granulatus_f._granulatus_KX238835, 33 Elaphomyces_hassiacus_KX238834, 34 Elaphomyces_asperulus_KX238833, 35 Elaphomyces_decipiens_KX238832, 36 Elaphomyces_sulphureopallidus_KX238830, 37 Elaphomyces_papillatus_var._papillatus_KX238825, 38 Elaphomyces_papillatus_var._papillatus_KX238819, 39 Elaphomyces_asperulus_KX238791, 40 Elaphomyces_striatosporus_KX238790, 41 Elaphomyces_asperulus_KX165351, 42 Elaphomyces_asperulus_KX165347, 43 Elaphomyces_asperulus_KX165345, 44 Pseudotulostoma_japonicum_KU934217, 45 Elaphomyces_granulatus_KR029767, 46 Elaphomyces_aff._granulatus_KR029763, 47 Elaphomyces_asperulus_KR029755, 48 Elaphomyces_striatosporus_KR029748, 49 Elaphomyces_barrioi_KR029745, 50 Elaphomyces_decipiens_KR029742, 51 Elaphomyces_aff._muricatus_KR029740, 52 Elaphomyces_aff._muricatus_KR029739, 53 Elaphomyces_muricatus_var._variegatus_KR029736, 54 Elaphomyces_muricatus_var._muricatus_KR029733, 55 Elaphomyces_muricatus_KR029730, 56 Elaphomyces_aff._barrioi_1_EU846311, 57 Elaphomyces_aff._barrioi_2_EU837229, 58 Elaphomyces_muricatus_var._muricatus_EU784198, 59 Elaphomyces_granulatus_f._granulatus_EU784197, 60 Elaphomyces_decipiens_DQ974740, 61 Uncultured_fungus_Se3_204_AB807936; TREE Fig._3 = [&R] ((((((((((((((24,29),(30,31)),(55,(28,(54,58)))),(25,53)),(22,23)),(51,52)),(57,(56,(26,49)))),(61,(1,(2,(3,(4,(5,6))))))),(60,(35,50))),(37,(36,(38,(40,48))))),((20,21),33)),(((((14,15),13),12),(((16,17),18),(34,((39,41),(42,(43,47)))))),((8,9),7))),((19,(27,(32,(45,59)))),((11,46),10))),44); END;