#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:51 GMT TreeBASE (cc) 1994-2008 Study reference: Woudenberg J.H., Hanse B., Van leeuwen G., Groenewald J.Z., & Crous P.W. 2017. Stemphylium revisited. Studies in Mycology, 87: 77–103. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S26426] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=150; TAXLABELS Alternaria_alternata_GV14.634a1 'Stemphylium amaranthi CBS_124650' 'Stemphylium amaranthi CBS_124651' 'Stemphylium amaranthi CBS_124746' 'Stemphylium amaranthi CBS_124750' 'Stemphylium amaranthi CBS_124753' 'Stemphylium amaranthi CBS_124984' 'Stemphylium amaranthi CBS_124985' 'Stemphylium amaranthi CBS_136589' 'Stemphylium armeriae CBS_338.73' 'Stemphylium astragali CBS_116583' 'Stemphylium beticola CBS_116599' 'Stemphylium beticola CBS_133512' 'Stemphylium beticola CBS_133892' 'Stemphylium beticola CBS_136590' 'Stemphylium beticola CBS_136699' 'Stemphylium beticola CBS_137492' 'Stemphylium beticola CBS_141024' 'Stemphylium beticola CBS_141025' 'Stemphylium beticola CBS_141026' 'Stemphylium beticola CBS_378.54' Stemphylium_beticola_GV11.196a1.3 Stemphylium_beticola_GV12.275a1 Stemphylium_beticola_GV12.276a1 Stemphylium_beticola_GV12.287a1 Stemphylium_beticola_GV12.336a1 Stemphylium_beticola_GV12.356a1 Stemphylium_beticola_GV12.367a1 Stemphylium_beticola_GV12.368a1 Stemphylium_beticola_GV12.403a1 Stemphylium_beticola_GV13.425a1 Stemphylium_beticola_GV13.436c2 Stemphylium_beticola_GV14.693a1 Stemphylium_beticola_IFZ2013.024 Stemphylium_beticola_IFZ2013.035 Stemphylium_beticola_IFZ2014.020 'Stemphylium botryosum CBS_116596' 'Stemphylium botryosum CBS_714.68' 'Stemphylium callistephi CBS_527.50' 'Stemphylium canadense CBS_116602' 'Stemphylium canadense CBS_118081' 'Stemphylium chrysanthemicola CBS_117255' 'Stemphylium drummondii CBS_346.83' 'Stemphylium eturmium CBS_109845' 'Stemphylium eturmium CBS_122124' 'Stemphylium eturmium CBS_122641' 'Stemphylium eturmium CBS_124652' 'Stemphylium eturmium CBS_133528' 'Stemphylium eturmium CBS_138495' 'Stemphylium eturmium CBS_668.80' 'Stemphylium gracilariae CBS_115179' 'Stemphylium gracilariae CBS_115180' 'Stemphylium gracilariae CBS_125060' 'Stemphylium gracilariae CBS_273.55' 'Stemphylium gracilariae CBS_308.36' 'Stemphylium gracilariae CBS_482.90' 'Stemphylium halophilum CBS_337.73' 'Stemphylium halophilum CBS_410.73' 'Stemphylium ixeridis CBS_124748' 'Stemphylium lancipes CBS_101217' 'Stemphylium lancipes CBS_116584' 'Stemphylium lancipes CBS_133314' 'Stemphylium loti CBS_407.54' 'Stemphylium lucomagnoense CBS_116601' 'Stemphylium lycii CBS_115192' 'Stemphylium lycii CBS_116582' 'Stemphylium lycii CBS_124982' 'Stemphylium lycii CBS_125240' 'Stemphylium lycii CBS_125241' 'Stemphylium lycopersici CBS_116585' 'Stemphylium lycopersici CBS_116587' 'Stemphylium lycopersici CBS_120325' 'Stemphylium lycopersici CBS_120326' 'Stemphylium lycopersici CBS_122639' 'Stemphylium lycopersici CBS_122803' 'Stemphylium lycopersici CBS_123008' 'Stemphylium lycopersici CBS_124980' 'Stemphylium lycopersici CBS_124981' 'Stemphylium lycopersici CBS_124983' 'Stemphylium lycopersici CBS_135778' 'Stemphylium lycopersici CBS_321.87' 'Stemphylium lycopersici CBS_333.73' 'Stemphylium lycopersici CBS_436.76' 'Stemphylium lycopersici CBS_463.78' 'Stemphylium majusculum CBS_133424' 'Stemphylium majusculum CBS_717.68' 'Stemphylium novae-zelandiae CBS_138157' 'Stemphylium novae-zelandiae CBS_138295' 'Stemphylium paludiscirpi CBS_109842' 'Stemphylium sarciniforme CBS_110049' 'Stemphylium sarciniforme CBS_116579' 'Stemphylium sarciniforme CBS_116581' 'Stemphylium sarciniforme CBS_133723' 'Stemphylium sarciniforme CBS_136810' 'Stemphylium sarciniforme CBS_138345' 'Stemphylium sarciniforme CBS_335.33' 'Stemphylium sarciniforme CBS_364.49' 'Stemphylium simmonsii CBS_116598' 'Stemphylium simmonsii CBS_116603' 'Stemphylium simmonsii CBS_116604' 'Stemphylium simmonsii CBS_133515' 'Stemphylium simmonsii CBS_133518' 'Stemphylium simmonsii CBS_133894' 'Stemphylium simmonsii CBS_134496' 'Stemphylium simmonsii CBS_716.68' 'Stemphylium solani CBS_116586' 'Stemphylium solani CBS_118082' 'Stemphylium solani CBS_408.54' 'Stemphylium symphyti CBS_115268' 'Stemphylium symphyti CBS_118796' 'Stemphylium symphyti CBS_138069' 'Stemphylium symphyti CBS_138070' 'Stemphylium trifolii CBS_116580' 'Stemphylium triglochinicola CBS_718.68' 'Stemphylium vesicarium CBS_109843' 'Stemphylium vesicarium CBS_109844' 'Stemphylium vesicarium CBS_115182' 'Stemphylium vesicarium CBS_115204' 'Stemphylium vesicarium CBS_122640' 'Stemphylium vesicarium CBS_123005' 'Stemphylium vesicarium CBS_123803' 'Stemphylium vesicarium CBS_124279' 'Stemphylium vesicarium CBS_124747' 'Stemphylium vesicarium CBS_124749' 'Stemphylium vesicarium CBS_124751' 'Stemphylium vesicarium CBS_124752' 'Stemphylium vesicarium CBS_125242' 'Stemphylium vesicarium CBS_133474' 'Stemphylium vesicarium CBS_133737' 'Stemphylium vesicarium CBS_133905' 'Stemphylium vesicarium CBS_133914' 'Stemphylium vesicarium CBS_138138' 'Stemphylium vesicarium CBS_155.24' 'Stemphylium vesicarium CBS_156.45' 'Stemphylium vesicarium CBS_157.24' 'Stemphylium vesicarium CBS_184.25' 'Stemphylium vesicarium CBS_191.86' 'Stemphylium vesicarium CBS_192.86' 'Stemphylium vesicarium CBS_205.82' 'Stemphylium vesicarium CBS_273.31' 'Stemphylium vesicarium CBS_274.31' 'Stemphylium vesicarium CBS_307.36' 'Stemphylium vesicarium CBS_311.92' 'Stemphylium vesicarium CBS_322.49' 'Stemphylium vesicarium CBS_368.59' 'Stemphylium vesicarium CBS_370.51' 'Stemphylium vesicarium CBS_406.76' 'Stemphylium vesicarium CBS_486.92' 'Stemphylium vesicarium CBS_715.68' Stemphylium_vesicarium_GV11.355a1.2 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=357; TAXLABELS Alternaria_alternata_GV14.634a1 'Stemphylium amaranthi CBS_124650' 'Stemphylium amaranthi CBS_124651' 'Stemphylium amaranthi CBS_124746' 'Stemphylium amaranthi CBS_124750' 'Stemphylium amaranthi CBS_124753' 'Stemphylium amaranthi CBS_124984' 'Stemphylium amaranthi CBS_124985' 'Stemphylium amaranthi CBS_133539' 'Stemphylium amaranthi CBS_134164' 'Stemphylium amaranthi CBS_134500' 'Stemphylium amaranthi CBS_136589' 'Stemphylium amaranthi CBS_138299' 'Stemphylium amaranthi CBS_138519' 'Stemphylium armeriae CBS_338.73' 'Stemphylium astragali CBS_116583' 'Stemphylium beticola CBS_116599' 'Stemphylium beticola CBS_133512' 'Stemphylium beticola CBS_133892' 'Stemphylium beticola CBS_136590' 'Stemphylium beticola CBS_136699' 'Stemphylium beticola CBS_137492' 'Stemphylium beticola CBS_141024' 'Stemphylium beticola CBS_141025' 'Stemphylium beticola CBS_141026' 'Stemphylium beticola CBS_378.54' Stemphylium_beticola_GV11.196.a1.3 Stemphylium_beticola_GV12.275a1 Stemphylium_beticola_GV12.276a1 Stemphylium_beticola_GV12.287a1 Stemphylium_beticola_GV12.336a1 Stemphylium_beticola_GV12.356a1 Stemphylium_beticola_GV12.367a1 Stemphylium_beticola_GV12.368a1 Stemphylium_beticola_GV12.403a1 Stemphylium_beticola_GV13.425a1 Stemphylium_beticola_GV13.436c2 Stemphylium_beticola_GV14.693a1 Stemphylium_beticola_IFZ22013.024 Stemphylium_beticola_IFZ22013.035 Stemphylium_beticola_IFZ22014.020 'Stemphylium botryosum CBS_116596' 'Stemphylium botryosum CBS_133292' 'Stemphylium botryosum CBS_133293' 'Stemphylium botryosum CBS_133738' 'Stemphylium botryosum CBS_134149' 'Stemphylium botryosum CBS_136587' 'Stemphylium botryosum CBS_136805' 'Stemphylium botryosum CBS_136822' 'Stemphylium botryosum CBS_136933' 'Stemphylium botryosum CBS_137037' 'Stemphylium botryosum CBS_138762' 'Stemphylium botryosum CBS_714.68' 'Stemphylium callistephi CBS_527.50' 'Stemphylium canadense CBS_116602' 'Stemphylium canadense CBS_118081' 'Stemphylium chrysanthemicola CBS_117255' 'Stemphylium drummondii CBS_133521' 'Stemphylium drummondii CBS_136821' 'Stemphylium drummondii CBS_137084' 'Stemphylium drummondii CBS_346.83' 'Stemphylium eturmiunum CBS_109845' 'Stemphylium eturmiunum CBS_122124' 'Stemphylium eturmiunum CBS_122641' 'Stemphylium eturmiunum CBS_124652' 'Stemphylium eturmiunum CBS_133461' 'Stemphylium eturmiunum CBS_133526' 'Stemphylium eturmiunum CBS_133528' 'Stemphylium eturmiunum CBS_133543' 'Stemphylium eturmiunum CBS_134165' 'Stemphylium eturmiunum CBS_134473' 'Stemphylium eturmiunum CBS_136569' 'Stemphylium eturmiunum CBS_136572' 'Stemphylium eturmiunum CBS_136593' 'Stemphylium eturmiunum CBS_136594' 'Stemphylium eturmiunum CBS_136614' 'Stemphylium eturmiunum CBS_136616' 'Stemphylium eturmiunum CBS_136798' 'Stemphylium eturmiunum CBS_136806' 'Stemphylium eturmiunum CBS_136809' 'Stemphylium eturmiunum CBS_136811' 'Stemphylium eturmiunum CBS_136815' 'Stemphylium eturmiunum CBS_136942' 'Stemphylium eturmiunum CBS_137493' 'Stemphylium eturmiunum CBS_138495' 'Stemphylium eturmiunum CBS_668.80' 'Stemphylium gracilariae CBS_115179' 'Stemphylium gracilariae CBS_115180' 'Stemphylium gracilariae CBS_125060' 'Stemphylium gracilariae CBS_273.55' 'Stemphylium gracilariae CBS_308.36' 'Stemphylium gracilariae CBS_482.90' 'Stemphylium halophilum CBS_337.73' 'Stemphylium halophilum CBS_410.73' 'Stemphylium ixeridis CBS_124748' 'Stemphylium ixeridis CBS_138522' 'Stemphylium lancipes CBS_101217' 'Stemphylium lancipes CBS_116584' 'Stemphylium lancipes CBS_133314' 'Stemphylium loti CBS_136565' 'Stemphylium loti CBS_136574' 'Stemphylium loti CBS_136575' 'Stemphylium loti CBS_136581' 'Stemphylium loti CBS_136584' 'Stemphylium loti CBS_136585' 'Stemphylium loti CBS_407.54' 'Stemphylium lucomagnoense CBS_116601' 'Stemphylium lycii CBS_115192' 'Stemphylium lycii CBS_116582' 'Stemphylium lycii CBS_124982' 'Stemphylium lycii CBS_125240' 'Stemphylium lycii CBS_125241' 'Stemphylium lycii CBS_136592' 'Stemphylium lycii CBS_136941' 'Stemphylium lycii CBS_137135' 'Stemphylium lycopersici CBS_116585' 'Stemphylium lycopersici CBS_116587' 'Stemphylium lycopersici CBS_120325' 'Stemphylium lycopersici CBS_120326' 'Stemphylium lycopersici CBS_122639' 'Stemphylium lycopersici CBS_122803' 'Stemphylium lycopersici CBS_123008' 'Stemphylium lycopersici CBS_124980' 'Stemphylium lycopersici CBS_124981' 'Stemphylium lycopersici CBS_124983' 'Stemphylium lycopersici CBS_133468' 'Stemphylium lycopersici CBS_133728' 'Stemphylium lycopersici CBS_133919' 'Stemphylium lycopersici CBS_134314' 'Stemphylium lycopersici CBS_135159' 'Stemphylium lycopersici CBS_135168' 'Stemphylium lycopersici CBS_135169' 'Stemphylium lycopersici CBS_135172' 'Stemphylium lycopersici CBS_135178' 'Stemphylium lycopersici CBS_135179' 'Stemphylium lycopersici CBS_135180' 'Stemphylium lycopersici CBS_135181' 'Stemphylium lycopersici CBS_135184' 'Stemphylium lycopersici CBS_135185' 'Stemphylium lycopersici CBS_135193' 'Stemphylium lycopersici CBS_135194' 'Stemphylium lycopersici CBS_135195' 'Stemphylium lycopersici CBS_135778' 'Stemphylium lycopersici CBS_136342' 'Stemphylium lycopersici CBS_136577' 'Stemphylium lycopersici CBS_136818' 'Stemphylium lycopersici CBS_138073' 'Stemphylium lycopersici CBS_138083' 'Stemphylium lycopersici CBS_138320' 'Stemphylium lycopersici CBS_138493' 'Stemphylium lycopersici CBS_138494' 'Stemphylium lycopersici CBS_138504' 'Stemphylium lycopersici CBS_138505' 'Stemphylium lycopersici CBS_321.87' 'Stemphylium lycopersici CBS_333.73' 'Stemphylium lycopersici CBS_436.76' 'Stemphylium lycopersici CBS_463.78' 'Stemphylium majusculum CBS_133424' 'Stemphylium majusculum CBS_717.68' 'Stemphylium novae-zelandiae CBS_138157' 'Stemphylium novae-zelandiae CBS_138295' 'Stemphylium paludiscirpi CBS_109842' 'Stemphylium sarciniforme CBS_110049' 'Stemphylium sarciniforme CBS_116579' 'Stemphylium sarciniforme CBS_116581' 'Stemphylium sarciniforme CBS_133513' 'Stemphylium sarciniforme CBS_133523' 'Stemphylium sarciniforme CBS_133525' 'Stemphylium sarciniforme CBS_133723' 'Stemphylium sarciniforme CBS_136566' 'Stemphylium sarciniforme CBS_136803' 'Stemphylium sarciniforme CBS_136810' 'Stemphylium sarciniforme CBS_136823' 'Stemphylium sarciniforme CBS_138345' 'Stemphylium sarciniforme CBS_335.33' 'Stemphylium sarciniforme CBS_364.49' 'Stemphylium simmonsii CBS_116598' 'Stemphylium simmonsii CBS_116603' 'Stemphylium simmonsii CBS_116604' 'Stemphylium simmonsii CBS_133515' 'Stemphylium simmonsii CBS_133518' 'Stemphylium simmonsii CBS_133894' 'Stemphylium simmonsii CBS_134496' 'Stemphylium simmonsii CBS_716.68' 'Stemphylium solani CBS_116586' 'Stemphylium solani CBS_118082' 'Stemphylium solani CBS_134293' 'Stemphylium solani CBS_408.54' Stemphylium_sp._Fig._1_Clade_1_CBS_133406 Stemphylium_sp._Fig._1_Clade_1_CBS_133463 Stemphylium_sp._Fig._1_Clade_1_CBS_133472 Stemphylium_sp._Fig._1_Clade_1_CBS_133479 Stemphylium_sp._Fig._1_Clade_1_CBS_133835 Stemphylium_sp._Fig._1_Clade_1_CBS_136570 Stemphylium_sp._Fig._1_Clade_1_CBS_136726 Stemphylium_sp._Fig._1_Clade_1_CBS_136796 Stemphylium_sp._Fig._1_Clade_1_CBS_136799 Stemphylium_sp._Fig._1_Clade_1_CBS_136808 Stemphylium_sp._Fig._1_Clade_1_CBS_136943 Stemphylium_sp._Fig._1_Clade_1_CBS_137045 Stemphylium_sp._Fig._1_Clade_1_CBS_137081 Stemphylium_sp._Fig._1_Clade_1_CBS_137085 Stemphylium_sp._Fig._1_Clade_1_CBS_137479 Stemphylium_sp._Fig._1_Clade_1_CBS_137480 Stemphylium_sp._Fig._1_Clade_1_CBS_138502 Stemphylium_sp._Fig._1_Clade_1_CBS_138503 Stemphylium_sp._Fig._1_Clade_7_CBS_133532 Stemphylium_sp._Fig._1_Clade_7_CBS_134178 Stemphylium_sp._Fig._1_Clade_7_CBS_134949 Stemphylium_sp._Fig._1_Clade_7_CBS_136340 Stemphylium_sp._Fig._1_Clade_7_CBS_136351 Stemphylium_sp._Fig._1_Clade_7_CBS_136939 Stemphylium_sp._Fig._1_Clade_7_CBS_137055 Stemphylium_sp._Fig._1_Clade_7_CBS_137418 Stemphylium_sp._Fig._1_Clade_7_CBS_137419 'Stemphylium symphyti CBS_115268' 'Stemphylium symphyti CBS_118796' 'Stemphylium symphyti CBS_133300' 'Stemphylium symphyti CBS_133301' 'Stemphylium symphyti CBS_133302' 'Stemphylium symphyti CBS_136568' 'Stemphylium symphyti CBS_138069' 'Stemphylium symphyti CBS_138070' 'Stemphylium symphyti CBS_138075' 'Stemphylium symphyti CBS_138891' 'Stemphylium trifolii CBS_116580' 'Stemphylium trifolii CBS_133466' 'Stemphylium trifolii CBS_136700' 'Stemphylium trifolii CBS_136723' 'Stemphylium trifolii CBS_136724' 'Stemphylium trifolii CBS_136725' 'Stemphylium triglochinicola CBS_133731' 'Stemphylium triglochinicola CBS_133732' 'Stemphylium triglochinicola CBS_133739' 'Stemphylium triglochinicola CBS_133740' 'Stemphylium triglochinicola CBS_133744' 'Stemphylium triglochinicola CBS_133747' 'Stemphylium triglochinicola CBS_133748' 'Stemphylium triglochinicola CBS_718.68' 'Stemphylium vesicarium CBS_109843' 'Stemphylium vesicarium CBS_109844' 'Stemphylium vesicarium CBS_115182' 'Stemphylium vesicarium CBS_115204' 'Stemphylium vesicarium CBS_122640' 'Stemphylium vesicarium CBS_123005' 'Stemphylium vesicarium CBS_123803' 'Stemphylium vesicarium CBS_124279' 'Stemphylium vesicarium CBS_124747' 'Stemphylium vesicarium CBS_124749' 'Stemphylium vesicarium CBS_124751' 'Stemphylium vesicarium CBS_124752' 'Stemphylium vesicarium CBS_125242' 'Stemphylium vesicarium CBS_133459' 'Stemphylium vesicarium CBS_133467' 'Stemphylium vesicarium CBS_133473' 'Stemphylium vesicarium CBS_133474' 'Stemphylium vesicarium CBS_133475' 'Stemphylium vesicarium CBS_133477' 'Stemphylium vesicarium CBS_133478' 'Stemphylium vesicarium CBS_133481' 'Stemphylium vesicarium CBS_133519' 'Stemphylium vesicarium CBS_133533' 'Stemphylium vesicarium CBS_133540' 'Stemphylium vesicarium CBS_133541' 'Stemphylium vesicarium CBS_133652' 'Stemphylium vesicarium CBS_133659' 'Stemphylium vesicarium CBS_133663' 'Stemphylium vesicarium CBS_133668' 'Stemphylium vesicarium CBS_133672' 'Stemphylium vesicarium CBS_133673' 'Stemphylium vesicarium CBS_133676' 'Stemphylium vesicarium CBS_133677' 'Stemphylium vesicarium CBS_133737' 'Stemphylium vesicarium CBS_133742' 'Stemphylium vesicarium CBS_133821' 'Stemphylium vesicarium CBS_133825' 'Stemphylium vesicarium CBS_133834' 'Stemphylium vesicarium CBS_133893' 'Stemphylium vesicarium CBS_133905' 'Stemphylium vesicarium CBS_133914' 'Stemphylium vesicarium CBS_134156' 'Stemphylium vesicarium CBS_134977' 'Stemphylium vesicarium CBS_136306' 'Stemphylium vesicarium CBS_136353' 'Stemphylium vesicarium CBS_136567' 'Stemphylium vesicarium CBS_136571' 'Stemphylium vesicarium CBS_136586' 'Stemphylium vesicarium CBS_136588' 'Stemphylium vesicarium CBS_136591' 'Stemphylium vesicarium CBS_136610' 'Stemphylium vesicarium CBS_136615' 'Stemphylium vesicarium CBS_136732' 'Stemphylium vesicarium CBS_136733' 'Stemphylium vesicarium CBS_136736' 'Stemphylium vesicarium CBS_136741' 'Stemphylium vesicarium CBS_136742' 'Stemphylium vesicarium CBS_136743' 'Stemphylium vesicarium CBS_136744' 'Stemphylium vesicarium CBS_136745' 'Stemphylium vesicarium CBS_136759' 'Stemphylium vesicarium CBS_136760' 'Stemphylium vesicarium CBS_136797' 'Stemphylium vesicarium CBS_136800' 'Stemphylium vesicarium CBS_136802' 'Stemphylium vesicarium CBS_136804' 'Stemphylium vesicarium CBS_136807' 'Stemphylium vesicarium CBS_136812' 'Stemphylium vesicarium CBS_136813' 'Stemphylium vesicarium CBS_136814' 'Stemphylium vesicarium CBS_136816' 'Stemphylium vesicarium CBS_136817' 'Stemphylium vesicarium CBS_136824' 'Stemphylium vesicarium CBS_136825' 'Stemphylium vesicarium CBS_136934' 'Stemphylium vesicarium CBS_136935' 'Stemphylium vesicarium CBS_136950' 'Stemphylium vesicarium CBS_136951' 'Stemphylium vesicarium CBS_136953' 'Stemphylium vesicarium CBS_136955' 'Stemphylium vesicarium CBS_136957' 'Stemphylium vesicarium CBS_136958' 'Stemphylium vesicarium CBS_136960' 'Stemphylium vesicarium CBS_137082' 'Stemphylium vesicarium CBS_137139' 'Stemphylium vesicarium CBS_137146' 'Stemphylium vesicarium CBS_137155' 'Stemphylium vesicarium CBS_137490' 'Stemphylium vesicarium CBS_137491' 'Stemphylium vesicarium CBS_137922' 'Stemphylium vesicarium CBS_138087' 'Stemphylium vesicarium CBS_138088' 'Stemphylium vesicarium CBS_138089' 'Stemphylium vesicarium CBS_138090' 'Stemphylium vesicarium CBS_138138' 'Stemphylium vesicarium CBS_138333' 'Stemphylium vesicarium CBS_138421' 'Stemphylium vesicarium CBS_138484' 'Stemphylium vesicarium CBS_138520' 'Stemphylium vesicarium CBS_138765' 'Stemphylium vesicarium CBS_155.24' 'Stemphylium vesicarium CBS_156.45' 'Stemphylium vesicarium CBS_157.24' 'Stemphylium vesicarium CBS_184.25' 'Stemphylium vesicarium CBS_191.86' 'Stemphylium vesicarium CBS_192.86' 'Stemphylium vesicarium CBS_205.82' 'Stemphylium vesicarium CBS_273.31' 'Stemphylium vesicarium CBS_274.31' 'Stemphylium vesicarium CBS_307.36' 'Stemphylium vesicarium CBS_311.92' 'Stemphylium vesicarium CBS_322.49' 'Stemphylium vesicarium CBS_368.59' 'Stemphylium vesicarium CBS_370.51' 'Stemphylium vesicarium CBS_406.76' 'Stemphylium vesicarium CBS_486.92' 'Stemphylium vesicarium CBS_715.68' Stemphylium_vesicarium_GV11.355.a1.2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M56674] TITLE Stemphylium_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=545; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternata_GV14.634a1 ATCATTACACAAATATGAAGGCGGGCT-GGAACCTC-------TCGGGG-TTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGG-TTCGCCCACCACTAGGAC--AAACATAAACC----TTTTGTAATTGCAATCAGCGTCAGTA-ACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTC--GCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCT------------TTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124650' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124651' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124746' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124750' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124753' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124984' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_124985' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_133539' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_134164' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_134500' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_136589' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_138299' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium amaranthi CBS_138519' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium armeriae CBS_338.73' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTCTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium astragali CBS_116583' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_116599' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_133512' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_133892' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_136590' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_136699' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_137492' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_141024' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_141025' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium beticola CBS_141026' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGAC????????????????????? 'Stemphylium beticola CBS_378.54' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV11.196.a1.3 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.275a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.276a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.287a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.336a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.356a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.367a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.368a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV12.403a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV13.425a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV13.436c2 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_GV14.693a1 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_IFZ22013.024 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_IFZ22013.035 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_beticola_IFZ22014.020 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_116596' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_133292' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_133293' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_133738' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_134149' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_136587' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_136805' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_136822' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_136933' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_137037' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_138762' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium botryosum CBS_714.68' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium callistephi CBS_527.50' ATCATTACACAAT-ATGAAAGCGGGCTGGGGACCTCACTTCGGTGCGGGCCTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCATTCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACATTTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium canadense CBS_116602' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTCCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium canadense CBS_118081' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT--------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium chrysanthemicola CBS_117255' ATCATTACACAAT-ATGAAAGCAGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT-----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium drummondii CBS_133521' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium drummondii CBS_136821' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium drummondii CBS_137084' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium drummondii CBS_346.83' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACC???????????????????? 'Stemphylium eturmiunum CBS_109845' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_122124' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_122641' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_124652' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_133461' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_133526' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_133528' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_133543' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_134165' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_134473' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136569' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136572' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136593' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136594' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136614' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136616' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136798' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136806' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136809' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136811' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136815' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_136942' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_137493' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_138495' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium eturmiunum CBS_668.80' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_115179' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_115180' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_125060' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGGCCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_273.55' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_308.36' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium gracilariae CBS_482.90' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium halophilum CBS_337.73' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTAGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATAC-----TTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium halophilum CBS_410.73' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTAGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATACT---TTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium ixeridis CBS_124748' ATCATTACACAAT-ATGAAAGCGGGCTGGCGGCCTCACTTCGGTGAGGGCGTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCTCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCCGGTTGAGCAACCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium ixeridis CBS_138522' ATCATTACACAAT-ATGAAAGCGGGCTGGCGGCCTCACTTCGGTGAGGGCGTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCTCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCCGGTTGAGCAACCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lancipes CBS_101217' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lancipes CBS_116584' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lancipes CBS_133314' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136565' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136574' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136575' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136581' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136584' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_136585' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium loti CBS_407.54' ATCATTACACAATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTT--TTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lucomagnoense CBS_116601' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAA------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_115192' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_116582' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_124982' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_125240' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_125241' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_136592' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_136941' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycii CBS_137135' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_116585' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_116587' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_120325' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_120326' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_122639' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_122803' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_123008' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_124980' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_124981' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_124983' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_133468' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_133728' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_133919' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_134314' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135159' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAACCC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135168' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135169' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135172' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135178' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135179' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135180' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135181' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135184' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135185' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135193' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135194' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135195' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_135778' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_136342' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_136577' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_136818' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138073' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138083' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138320' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138493' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138494' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138504' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_138505' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_321.87' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_333.73' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_436.76' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium lycopersici CBS_463.78' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA--------TTTTCTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium majusculum CBS_133424' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium majusculum CBS_717.68' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium novae-zelandiae CBS_138157' ATCATTACACAAT-ATGAAAGCGGGTTGGTGGCGTCATCTCGGTGAGGC-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAAAT-TTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATC---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium novae-zelandiae CBS_138295' ATCATTACACAAT-ATGAAAGCGGGTTGGTGGCGTCATCTCGGTGAGGC-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAAAT-TTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATC---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium paludiscirpi CBS_109842' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_110049' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT----TTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_116579' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_116581' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_133513' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT----TTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_133523' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_133525' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT----TTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_133723' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_136566' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_136803' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGG????? 'Stemphylium sarciniforme CBS_136810' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_136823' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_138345' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_335.33' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium sarciniforme CBS_364.49' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGA-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_116598' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_116603' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_116604' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_133515' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_133518' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_133894' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_134496' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium simmonsii CBS_716.68' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium solani CBS_116586' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium solani CBS_118082' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium solani CBS_134293' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium solani CBS_408.54' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_133406 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_133463 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_133472 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_133479 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_133835 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAA------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136570 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136726 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136796 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136799 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136808 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_136943 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_137045 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_137081 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_137085 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGG?????? Stemphylium_sp._Fig._1_Clade_1_CBS_137479 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_137480 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_138502 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_1_CBS_138503 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_133532 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_134178 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_134949 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_136340 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_136351 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_136939 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_137055 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_137418 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_sp._Fig._1_Clade_7_CBS_137419 ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_115268' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_118796' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_133300' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_133301' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_133302' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_136568' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_138069' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_138070' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_138075' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium symphyti CBS_138891' ATCATTACACAAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_116580' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_133466' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_136700' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_136723' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_136724' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium trifolii CBS_136725' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133731' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133732' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133739' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133740' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133744' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133747' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_133748' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium triglochinicola CBS_718.68' ATCATTACACAAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_109843' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_109844' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_115182' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_115204' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_122640' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_123005' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_123803' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_124279' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_124747' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_124749' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_124751' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_124752' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_125242' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133459' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133467' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133473' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133474' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133475' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133477' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133478' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133481' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133519' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133533' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133540' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133541' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133652' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133659' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133663' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133668' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133672' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133673' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133676' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133677' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133737' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133742' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133821' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133825' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133834' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133893' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133905' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_133914' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_134156' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_134977' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136306' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136353' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136567' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136571' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136586' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136588' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136591' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136610' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136615' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136732' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136733' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136736' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136741' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136742' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136743' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136744' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136745' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136759' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136760' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136797' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136800' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136802' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136804' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136807' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACAT------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136812' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136813' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136814' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136816' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136817' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136824' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136825' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136934' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136935' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136950' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136951' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136953' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136955' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136957' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136958' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_136960' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137082' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137139' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137146' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137155' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137490' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137491' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_137922' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138087' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138088' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138089' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138090' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138138' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138333' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138421' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138484' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138520' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_138765' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_155.24' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_156.45' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_157.24' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_184.25' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_191.86' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_192.86' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_205.82' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_273.31' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_274.31' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_307.36' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_311.92' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_322.49' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_368.59' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_370.51' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_406.76' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_486.92' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC 'Stemphylium vesicarium CBS_715.68' ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Stemphylium_vesicarium_GV11.355.a1.2 ATCATTACACAAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGG-CTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGG-TTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M56675] TITLE Stemphylium_ITS_GAPDH_CALD; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2001; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternata_GV14.634a1 ATCATTACACAAAT-ATGAAGGCGGGCT-GGAACCTC-------TCGGGGT-TACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGA--CAAACATAAACC----TTTTGTAATTGCAATCAGCGTCAGTA-ACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTC--GCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC------------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAA-CTCGTCGATACAATC-TACCAGAGCTGACCGCA-TGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACA-GCCGCGGCCATCCA--AGTTGCG-----AAAACAGTCCTTGC-GATGCGCTAGAGCTCCTCTG--TGGTCGCAGAATGCAGGCTAACA--CATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT????????????????????????CCC-ATCCTTTGCCATGCCGCGCGGCTGCCTGGTAGCCCTGGGGCCTG----------CG-CAATCACGAAC---------------ATGCAGCTG--ACGACGT-CG-TGTTGTAGGACAAGGATGGCGATGGTCAGTACTCTCCCT--------CCAAACTCCCTTCCACACACACACACTCTCTCTCTCCCTCTCTGCCTTCAAAGCAATGCCGCATCTCCAGCCTACGCAATCAGCAGAGGGGCCCGAGCGAGGCTTGCTGGCTAGGGGTCCAAA-------CCACCGCCCACA-----------GCTACAACACCACGCCATCCACCCTACTCCATAGCAAGCACAACTGACGACGATGCGCCACAGGTCAAATCACCACCAAGGAGCTAGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTCCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATTGACTTCCCAGGTG----CGCCCCTCCCTACCTGTCCAAAGTACC----------ACAGCTA-ACTTTTGCAGAATTCCTTACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGATAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTTACAGCTGCCTGTATCA-----CAAGTGCGATGCTAACACACACCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124650' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124651' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124746' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCAAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124750' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCAAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTCTTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124753' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCAAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTCTTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124984' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_124985' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium amaranthi CBS_136589' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AACACATTCTTTGCTGGCAATATA--TCACGCC-----TTTACTCGGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTGAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTTTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAATTTGCCTTGGC---TTATTCATGTACTAACTCCACCCAGACAACGAGTT- 'Stemphylium armeriae CBS_338.73' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTCTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GAAAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGATTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCATCCAGACAACGAGTT- 'Stemphylium astragali CBS_116583' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAATAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCAC-GGCGGTTGGAGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAACT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAAGATGGCGATGGTTAGTAGTCCCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGTGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_116599' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_133512' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_133892' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_136590' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_136699' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_137492' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT?????????????????????????????????????????ACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_141024' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_141025' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_141026' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGAC?????????????????????GCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium beticola CBS_378.54' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAATGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACTACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV11.196a1.3 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.275a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.276a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.287a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.336a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.356a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.367a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.368a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV12.403a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV13.425a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV13.436c2 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_GV14.693a1 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTATC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_IFZ2013.024 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_IFZ2013.035 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- Stemphylium_beticola_IFZ2014.020 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGTCATATCATAGCTAACGGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGCCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATGTG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACATCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-AAACCCCTACTAACCC-GACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAGAATTCGCCCTAGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium botryosum CBS_116596' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGGC-TCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAACTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATCCGATCGCGGGCGGTTGGGGGCCATTTGT--TGCTAGTATATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGTGTCAATCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAATGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCGTG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCCCACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCGATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTAGTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium botryosum CBS_714.68' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGGC-TCCAGCTCGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------CTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAACTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATCCGATCGCGGGCGGTTGGGGGCCATTTGT--TGCTAGTATATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGTGTCAATCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCGTG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCCCACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCGATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTAGTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium callistephi CBS_527.50' ATCATTACAC-AAT-ATGAAAGCGGGCTGGGGACCTCACTTCGGTGCGGGCCTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCATTCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACATTTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-ACCGCCAATTCTGCCACATCAAAGCTAACTGCG-TCTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AACACAGTC-TTCCTGACAATCCG--CTGCGCG-----TTCCATCTGATCGC-GGCGGCTGGGGACCGTTTGT--TGCTAGTAGATTGCAGGCTAACATCCATCTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGCCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCC---------------CGGCTGCCTGG-AGCCTTGTCGTCAA----------CA-CCATGCACGTG---------------TTGTTGCTAACACATGTT-GT-CTCAACAGGACAAGGATGGCGATGGTTAGTCATCTCCTCTCCTCATATCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCGGCCCGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACCATCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCGCAATCCTCCGCTTCCCGACTCACG-AACCCCCCACTAACCA-CACCCTCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGTGCTCAAGATTTGCATTGAC---TTTGTCAAATACTGACTCTACCCAGACAACGAGTT- 'Stemphylium canadense CBS_116602' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTCCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGACGTATCGTCTTCCGCAATGCGTAAGTTTGATTGGA-CCCGTCAATTCTGCCATTTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AATACATTCTTTGCTAGCAATCCA--CCACGTC-----TTTCTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCACGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATGCTGCTAACACATGTT-CT-CTGTATAGGACAAGGACGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGTCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTACTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGACTCATC-CAACCCATACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTTATGACTTCTATCGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAGAATTTGCCTTGGC---TTCTTCAAATACTAACTCAACCCAGACAACGAGTT- 'Stemphylium canadense CBS_118081' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGACGTATCGTCTTCCGCAATGCGTAAGTTTGATTGGA-CCCGTCAATTCTGCCATTTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AATACATTCTTTGCTAGCAATCCA--CCACGTC-----TTTCTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCACGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATGCTGCTAACACATGTT-CT-CTGTATAGGACAAGGACGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGTCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTACTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGACTCATC-CAACCCATACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTTATGACTTCTATCGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAGAATTTGCCTTGGC---TTCTTCAAATACTAACTCAACCCAGACAACGAGTT- 'Stemphylium chrysanthemicola CBS_117255' ATCATTACAC-AAT-ATGAAAGCAGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT-----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAGCCCCGTCAAATCGGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AGGTCAATATTTCCTGGCAATCCA-TCCACGCG-----TTTCTTCTGATCGC-TGCGATTGGAAGCCACTTGT--TGCTCGTGGATCACAGGCTGACGTCCCTGCAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTTACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTTGTAAGTCGCT-TCCCGGCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGCAGTCAATCATCACCACCA-CCACCATGACG---------------CTCCTGCTAACACATGCC-CC-CTCTGTAGGACAAGGATGGCGATGGTCAGTAGCCGCTTC--------TCCAATCCACGCCC------GCGCCCTCTC------------------------------------------------------------------------------------CCCCCGAAG-------CCAGCGCCTGAT-----------GCCCAGTCTGCACGCCCCTCATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCAATTCTCCCGTGTCCCATTCACC-CGACCCTTGCTGACCC-CATGCCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAACTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCACAATCTGCCCTGGT---TTCTTCAAACACTAACACCACCCAGACAACGAGTT- 'Stemphylium drummondii CBS_346.83' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACC????????????????????GCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCACGTAAAAGCTAACCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGCCACTC-TTGCCGATAATCTG--CTGCGCGTTCCTTTCCTTTTGACCGC-CGCGGTTGGGGGCCATTTGT--TGCTAGTGCATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCCTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGGCTTGTCGTCCA----------CAGCCATGGCCATG---------------TTGTTGCTAACACATGTT-CT-CTCTACAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------CCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGTGGT-----------CCTCAGTCTGTACGCGTCGCACAACA---------GACAATCGCTGACCATGTTGCGCCACAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTTGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATCCTCCGATTCCCCACTCACC-AAACCCTTACTGACCA-CACCCCCTAGAGTTCCTTACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAAGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAAAATTTGTCCTGAC---CTCTTCAAATGCTAACTTCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_109845' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATATTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_122124' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCA-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_122641' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATTGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATATTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_124652' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTTGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATATTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_133528' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT????????????????????????????CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_138495' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTTGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium eturmium CBS_668.80' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTATTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGGGGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCCC--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATATTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAGACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGTCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_115179' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_115180' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAGCCGCGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCAGCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_125060' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGGCCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCTGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_273.55' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_308.36' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium gracilariae CBS_482.90' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTACGCG-----TTCCATATGATCGC-GGCGGTTGGAGGACATTTGT--TCCTAGTGGATTACAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAAACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCTCTCTTCGTAAGTAGCT-TTCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium halophilum CBS_337.73' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTAGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATAC-----TTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCTATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CTACGCA-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCTATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCCGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAAGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAAATTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium halophilum CBS_410.73' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTAGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATAC---TTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCTATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CTACGCA-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCTATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCCGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAAGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAAATTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium ixeridis CBS_124748' ATCATTACAC-AAT-ATGAAAGCGGGCTGGCGGCCTCACTTCGGTGAGGGCGTCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCTCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCCGGTTGAGCAACCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCGTCGATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATTCCCGGGTAC-AAGACAGTC-TTCTCGCGAATCCG--CTGCGCG-----TTCCATCTGGTCGC-GGCGGTTGGGAGCCATTTAT--CGCTAGTGGATTGCAGGCTAACGTTCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAATCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAACTTGCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGCCGTCAA----------CA-CCATGGCCGTG---------------TTGTTGCTAACATATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCCAACTCACGCCC------GCGCACTGC--------------------------------------------------------------------------------------TCCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCGCGCGTCTCACGCCA---------GACAATCGCTGACCATGTTGCGCCGCAGGCCAAATCACTACCAAGGAGCTCGGGACCGTTATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCCGGTA----CCTCCATACTCCGACTGCCAACTCACC-AACCCCTCACTAACCA-CAT-CTCCAGAGTTCCTCACCATGATGGCACGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGAGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTCTTCAAACACTAACTCCACCCAGACAATGAGTT- 'Stemphylium lancipes CBS_101217' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCACATCAAAACTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGATAGTC-TCCCTGACAATCCG--CTGCGCG-----TTCCATCTGATCGT-GGCGATTGG-GGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACAATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGCGGAGCTAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCATGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT??????????????????????????C-TCCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCGTG---------------TTGTTGCTAACCCATGTT-CC-CTCTACAGGACAAGGATGGCGATGGTCAGTAGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCACCCTGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCCACTCACC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAAGATTTGCCTTGAC-TATTTTCCAAATACTGACTCCACCCAGACAACGAGTT- 'Stemphylium lancipes CBS_116584' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCACATCAAAACTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGATAGTC-TCCCTGACAATCCG--CTGCGCG-----TTCCATCTGATCGT-GGCGATTGG-GGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACAATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGCGGAGCTAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCATGAGACATACAAGTCCGACATCGAG???????????????????????????????????????????????????????????????????????????????CCTTGTCGTCAA----------CA-CCATGACCGTG---------------TTGTTGCTAACCCATGTT-CC-CTCTACAGGACAAGGATGGCGATGGTCAGTAGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCACCCTGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCCACTCACC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAAGATTTGCCTTGAC-TATTTTCCAAATACTGACTCCACCCAGACAACGAGTT- 'Stemphylium lancipes CBS_133314' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCACATCAAAACTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGATAGTC-TCCCTGACAATCCG--CTGCGCG-----TTCCATCTGATCGT-GGCGATTGG-GGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACAATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGCGGAGCTAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCATGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCGTG---------------TTGTTGCTAACCCATGTT-CT-CTCTACAGGACAAGGATGGCGATGGTCAGTAGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCACCCCGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCCACTCACC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAAGATTTGCCTTGAC-TATTTTCCAAATACTGACTCCACCCAGACAACGAGTT- 'Stemphylium loti CBS_407.54' ATCATTACAC-AATAATGAAAGCGGGCT-GGAACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGACTTATTCACCCATGTCTTTTGCGCACTTTTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCCACCCTAAACC--TTTTTTGCAATTGCAATCCGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT--TTTTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAACCAGCCTGGGTGGAGCATCCATCAAGACGTCA---------TTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGCCGATTCTGCCATGTCAAAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGAGAATCTTCCCTGGCAATCTG--CCACGCG-----TTTCTTGTGATCGC-TGCGATTGGAAGCCATTTGTTGTGCTCGTAGATCACAGACTAACGACCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTTGTCGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTTAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT????????????????????????????????????GCTTGACGCGCGGCTGCCTGG-AGCCTTGCCGTCAA-CACCACCACCA-CCACCATGGCC---------------GTCCTGCTAACACATGCC-CC-CGCTACAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAGTCGACGCCC------GCGCCCGCT--------------------------------------------------------------------------------------GCCCGAAG-------CCCGCTCCTGGT-----------GCTCGGTCTGCACGCCTCTCGCACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----GCCCAATTCTCCCCCGTCCCACTCCCC-AAACCCTTGCTGACCC-CACTCCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACGTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAAGACGGTGATGGCCGCATCGACTGTAGGTGCCCAGCATTTGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lucomagnoense CBS_116601' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA------ATTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGTGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAATGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycii CBS_115192' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CCACGCC-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AACCCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAAATCGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycii CBS_116582' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATACATTCTTTGCTGGCAATCTA--CCACGCC-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCATACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AACCCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTCAGAAATTGCCTTGGC---TTCTTCGAATACTAACCCCACCCAGACAACGAGTT- 'Stemphylium lycii CBS_124982' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CCACGCC-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AACCCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTTAGAAATTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycii CBS_125240' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CCACGCC-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AACCCCTTACTAACCC-CACACTCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTTAGAAATTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycii CBS_125241' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTCTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTCATTGAA-CCCGTCAATTCTGCCATGTCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCCGTGAGTATCCCCGGATAC-AATATATTCTTTGCTGGCAATCTA--CCACGCC-----TTTGTTCTGATCGC-CGCAAT-----GCCAGTTGT--TGCTAGTAGATCACAGGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATTCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTGGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCCCTGTCCGGCTCACC-AACCCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTTAGAAATTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_116585' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_116587' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_120325' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_120326' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCGTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_122639' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_122803' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_123008' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_124980' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_124981' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_124983' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA--------TTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_135778' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTCCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_321.87' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_333.73' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTCTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_436.76' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCTCGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium lycopersici CBS_463.78' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTTACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-------TTGTCTCTCACGAGACTCGCCTTAAAATCATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCCTA--------TTTTCTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGACTGAA-CCCACCGCTTTTGCCATGTCAAAGCTAATCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATC-TTCCCGAAAATCCG--CTGCGCG-----TTCCATTTGATCGC-GGCGGTTGGGCGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTCGCT-TCCCGTCGGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCGA----------CA-CCATGGCCATG---------------TTGCTGCTAACACATGTT-CG-CTTTGCAGGACAAGGACGGCGATGGTCAGTAGTCTCCTC--------TCCGGCCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGGAG-------CCCGCCCCCAGT----------CCCCCAGCCTGCACGCCTCTCACACCA---------CACAGCCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCGGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTACCTCCCTCCATACTCGGGCTGCCAACTCACC-AGCCCCTCACTAACCACCGCACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGCGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGTCACGTCATGACTTCTATTGGCGAGAAGTTGACCGACGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGTATCGACTGTGGGTGCTCAAAATCTGCCTTGAC---TTTCTCAAACGCTAACTCCACCCAGACAACGAGTT- 'Stemphylium majusculum CBS_133424' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-TCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGTCCTTGGTCTGCCCTCGGTCTGCACACGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACTAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium majusculum CBS_717.68' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTCAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-AGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-TCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACACCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGTCCTTGGTCTGCCCTCGGTCTGCACACGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACTAAAACCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTAAAGAGTTGCTCTGGT---TTCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium novae-zelandiae CBS_138157' ATCATTACAC-AAT-ATGAAAGCGGGTTGGTGGCGTCATCTCGGTGAGGCC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAAAT-TTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATC---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTGATTGAA-CCCATCAATTCTGCCATACCAAAGCTAACCGCGTTTTCACAGGGTCGAGCACAACGATGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCAGTAAGTAATCCCGGATAC-AAGACAATC-TTCTCGACAATCCA--CTGCGCG-----TTCCTTTTGATCGC-AGCGGTTGGCGGCCATTTGT--TGCTAGTGCATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAAATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACAATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCTTGGAGCGAGACCGGCGCCTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTTATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAT-AGCCTCGTCGCCCA----------CA-CCATGGCCATG---------------TTGTTGCTAACATATGTT-CT-CTCTACAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCCAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ATCCGAAG-------CCAGCTCGTGGT-----------CCCCAGTCTGCACGCCTCTCGTACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAGTCCTCCGATTCCCGACTCACC-AACCCCTTACTGACCA-CACCCCCCAGAGTTCCTTACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGCGCTCAAAATTTGCCCTGAC---TTTTTCAAATACTAACTTTACCCAGACAACGAGTT- 'Stemphylium novae-zelandiae CBS_138295' ATCATTACAC-AAT-ATGAAAGCGGGTTGGTGGCGTCATCTCGGTGAGGCC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAAAT-TTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCATC---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTGATTGAA-CCCATCAATTCTGCCATACCAAAGCTAACCGCGTTTTCACAGGGTCGAGCACAACGATGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCAGTAAGTAATCCCGGATAC-AAGACAATC-TTCTCGACAATCCA--CTGCGCG-----TTCCTTTTGATCGC-AGCGGTTGGCGGCCATTTGT--TGCTAGTGCATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAAATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACAATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCTTGGAGCGAGACCGGCGCCTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTTATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCTTGACGCGCGGCTGCCTAT-AGCCTCGTCGCCCA----------CA-CCATGGCCATG---------------TTGTTGCTAACATATGTT-CT-CTCTACAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCCAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ATCCGAAG-------CCAGCTCGTGGT-----------CCCCAGTCTGCACGCCTCTCGTACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAGTCCTCCGATTCCCGACTCACC-AACCCCTTACTGACCA-CACCCCCCAGAGTTCCTTACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGCGCTCAAAATTTGCCCTGAC---TTTTTCAAATACTAACTTTACCCAGACAACGAGTT- 'Stemphylium paludiscirpi CBS_109842' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGCATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCAATTCTCCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AATACATTCTTTGCTTGCAATCCA--CCACGCC-----TTTCTTCTGATCGT-CGCGGT-----GCCAGTCGT--TGCTAGTAGATCACAAGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATGCTGCTAACACATGCTCTCACTCTATAGGACAAGGACGGCGATGGTTAGTAGCCTCTTC--------TCGAACCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCTGAT-----------GCCCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATGCTCCCCTGTCCGACTCACC-CAACCCATAGTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCTCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCTTAGAATTTGCCTTAGC---TTCTTCATATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium sarciniforme CBS_110049' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACAT----TTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGACGGAGACAATCTTGTCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAATAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGGCGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCC---------------GTCCTGCTAACACACGCT--C-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATCCACGCCCACGCCCGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAAAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_116579' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGATGGAGACAATCTTGCCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAG???????????????????AGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTGGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCT---------------GTCCTGCTAACACACGCTCCC-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATTCACGCCCACGCCTGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAATGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAGAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_116581' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACA------TTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGACGGAGACAATCTTGTCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAATAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGGCGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCC---------------GTCCTGCTAACACACGCT--C-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATCCACGCCCACGCCCGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAAAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_133723' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGATGGAGACAATCTTGCCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTGGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCT---------------GTCCTGCTAACACACGCT-CC-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATTCACGCCCACGCCTGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAATGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAGAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_136810' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACA------TTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGACGGAGACAATCTTGTCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAATAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTTGGCGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCC---------------GTCCTGCTAACACACGCT--C-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATCCACGCCCACGCCCGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAAAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_138345' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGATGGAGACAATCTTGCCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTGGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCT---------------GTCCTGCTAACACACGCT-CC-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATTCACGCCCACGCCTGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAATGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAGAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_335.33' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGATGGAGACAATCTTGCCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTGGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCT---------------GTCCTGCTAACACACGCT-CC-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATTCACGCCCACGCCTGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAATGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAGAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium sarciniforme CBS_364.49' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCATCTCGGTGAGGAC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TATTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGCC-------TTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCCGCCTGGGTGGAGCGTCCATCAAGACCACATTTTTTTTTTTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTTGATTCTGCCAGGCCATAGCTAACCGCG-TCCCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGAGATGGAGACAATCTTGCCTGGCAGTCCCGTCCACGCG-----TTTCTTCTGGTCGC-TGCGATTGGAAGCCATTTGT--TGCTCGTGCATCACAGGCTAACGTCCCTGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCCGATGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCTTTCTCCCTCTTCGTAAGTAGCT-TCCCGTCTGCTGGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGGCT---------------GTCCTGCTAACACACGCT-CC-CCCCATAGGACAAGGATGGCGATGGTCAGTAGCCTCTTC--------TCCAATTCACGCCCACGCCTGCGCCCGCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------CCCCAGTCTGCACGCCTCTCACACCG---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCCCTATTCTCCCATGTCCCACTCACC-AAACCCCTGCTAACCC-CACATCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATTCGGGAAGCTTTCAAGGTCTTTGACCGCGACAACAATGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTACGTGTTCAGAATTTGCCTTGGC---TTCTCCAAATACTAACTCCACCCAGACAACGAATT- 'Stemphylium simmonsii CBS_116598' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCGTTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACT-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTAGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium simmonsii CBS_116603' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCGTATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACT-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium simmonsii CBS_116604' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCGTATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACT-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium simmonsii CBS_133515' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT???????????????????????????????????TGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCAGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAATGAGTT- 'Stemphylium simmonsii CBS_133518' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCAGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAATGAGTT- 'Stemphylium simmonsii CBS_133894' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGATATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTCGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTGAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTACTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGTGATGGTTAGTAGTCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-TAACCCTTACTAACCC-CACAACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACACAGACAACGAGTT- 'Stemphylium simmonsii CBS_134496' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCAGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAATGAGTT- 'Stemphylium simmonsii CBS_716.68' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCATCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCGCGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCATAGCTGACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCTGGATAC-AAAACAATCTTTCCTGGCAGTCCG--CCACGCG-----TTTCTTCTGATCGC-TGCGATGGGAAGTCATTTGT--TGCTGGTGGATCACAGGCTAACGTCTCTGTAGGCGTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAAGCATTCTCCCTCTTCGTAAGTAGCT-TCCCGCCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA-------CACCA-CCACCATGACC---------------ATGTTGCTAATGCATATG-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGCCTCTTT--------TCCAATTCACGCCC------GCGCCCTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCCTGAT-----------GCTCAGTCTGCACGCGTCTTATACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATTCTCCCGTGTCGCACTTACC-TAACCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCAGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGATGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATCGACTGTGGGTGCCCAGAATTCGCCCTGGC---TTCTTCAAATACTAACTCCACCCAGACAATGAGTT- 'Stemphylium solani CBS_116586' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-ACCGTCAATTCTGCCATATCAAAGCTAACTGCG-TCTCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAGACAGTC-TTCCCGGCAATCCG--CTGCGCG-----TTCCATCTGATCGC-GGCGGTTGGGGACCGTTTGT--TGCTGGTAGATTGCAGGCTAACATCGATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACAGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCCTGACGCCCGGCTGCCTGG-AGCCTTGTCGTCAT----------TA-CCATGCCCGTGTTGTTGTTGTTGTTTTTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTGGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGCAG-------CCGGCCCGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATTGACTTTCCAGGTA----CCGCAATCCTCCGCTTCCCGATTCACG-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGATACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGATGGCCGCATCGACTGTAGGTGCTCAAGATTTGCTTCGACTTTTTTTTCAAATACTGACTCTACCCAGACAACGAGTT- 'Stemphylium solani CBS_118082' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-ACCGTCAATTCTGCCATATCAAAGCTAACTGCG-TCTCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAGACAGTC-TTCCCGGCAATCCG--CTGCGCG-----TTCCATCTGATCGC-GGCGGTTGGGGACCGTTTGT--TGCTGGTAGATTGCAGGCTAACATCGATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACAGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCCTGACGCCCGGCTGCCTGG-AGCCTTGTCGTCAT----------TA-TCATGCCCGTGTTGTTGTTGTTGTTTTTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTGGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGCAG-------CCGGCCCGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATTGACTTTCCAGGTA----CCGCAATCCTCCGCTTCCCGATTCACG-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGATACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGATGGCCGCATCGACTGTAGGTGCTCAAGATTTGCTTCGAC-TTTTTTTCAAATACTGACTCTACCCAGACAACGAGTT- 'Stemphylium solani CBS_408.54' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA---------TTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-ACCGTCAATTCTGCCATATCAAAGCTAACTGCG-TCTCACAGGATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCAGATAC-AAGACAGTC-TTCCCGGCAATCCG--CTGCGCG-----TTCCATCTGATCGC-GGCGGTTGGGGACCGTTTGT--TGCTGGTAGATTGCAGGCTAACATCGATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACAGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCCGTCTGCCTGACGCCCGGCTGCCTGG-AGCCTTGTCGTCAT----------TA-TCATGCCCGTGTTGTTGTTGTTGTTTTTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTGGTCTCCTC--------TCCAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGCAG-------CCGGCCCGCACT-----------CCTCAGACTGCACGCGTCTCACACCA---------GACAACCGCTGACCATGTTGCGCCGCAGGCCAAATCACCACCAAGGAGCTTGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATTGACTTTCCAGGTA----CCGCAATCCTCCGCTTCCCGATTCACG-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGATACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGATGGCCGCATCGACTGTAGGTGCTCAAGATTTGCTTCGACTTTTTTTTCAAATACTGACTCTACCCAGACAACGAGTT- 'Stemphylium symphyti CBS_115268' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGGCAATCAG--CTGCGCG-----TTCCATCTGATCGC-TGCGGTTGGAAGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCTTGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAACT-TCCCGTCTGCTTGGGGTG-----------------------------------------------------------------TTGTTGCTAACACACGTT-CG-CTCCATAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCGAACCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGAAGCCAGCTCCCAGCTCCCAGC-----------CCCCAGTCTGCACGCGTCTCACCCCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCAACTCGCC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATTGACTGTAGGTGCTCACAATCTGCCTTGAA---TTTTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium symphyti CBS_118796' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCAACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGGCAATCAG--CTGCGCG-----TTCCATCTGATCGC-TGCGGTTGGAAGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCTTGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAACT-TCCCGTCTGCTTGGGGTG-----------------------------------------------------------------TTGTTGCTAACACACGTT-CG-CTCCATAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCGAACCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGAAGCCAGCTCCCAGCTCCCAGC-----------CCCCAGTCTGCACGCGTCTCACCCCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCAACTCGCC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATTGACTGTAGGTGCTCACAATCTGCCTTGAA---TTTTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium symphyti CBS_138069' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGGCAATCAG--CTGCGCG-----TTCCATCTGATCGC-TGCGGTTGGAAGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCTTGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAATGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAACT-TCCCGTCTGCTTGGGGTG-----------------------------------------------------------------TTGTTGCTAACACACGTT-CG-CTCCATAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCGAACCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGAAGCCAGCTCCCAGCTCCCAGC-----------CCCCAGTCTGCACGCGTCTCACCCCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCAACTCGCC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATTGACTGTAGGTGCTCACAATCTGCCTTGAA---TTTTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium symphyti CBS_138070' ATCATTACAC-AAT-ATGAAAGCGGGCT-GGGACCTCACTTCGGTGCGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAACGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA----------TTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAA-CCCGTCGATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAGTC-TTCCCGGCAATCAG--CTGCGCG-----TTCCATCTGATCGC-TGCGGTTGGAAGCCATTTGT--TGCTAGTGGATTGCAGGCTAACGTCCTTGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAATGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAACT-TCCCGTCTGCTTGGGGTG-----------------------------------------------------------------TTGTTGCTAACACACGTT-CG-CTCCATAGGACAAGGATGGCGATGGTTAGTAGTCTCCTC--------TCGAACCCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCTGAAGCCAGCTCCCAGCTCCCAGC-----------CCCCAGTCTGCACGCGTCTCACCCCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCCATACTCCGACTGCCAACTCGCC-AACCCCTCACTAACCA-CAC-CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGTGACGGCCGCATTGACTGTAGGTGCTCACAATCTGCCTTGAA---TTTTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium trifolii CBS_116580' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACC-TTTTTTTGTAATTGCAATCAGCGTCAGTACACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCCTGGTTGAGCATCCATCAAGACCACA-----------TTTTAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGTAATGCGTAAGTTTGACTGAA-CCCGTCAATCCTGCCATATCAAAGCTAACCGCG-TTTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AAGACAATCTTTCCTGGCAATCCG--CCACACG-----TTTCCTCTGATCAC-TGCGATTGGAAGACATTTGT--TGCTCGTGGATCACAGGCTAACGTCCATGCAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCCTCCGCTGACGCTCCTATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCC-TCCCGTCTGCTCGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACAAATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTGAGTAGCCTCTTC--------CCGAATCCACGCCC------GCGCATTCT--------------------------------------------------------------------------------------GCCCGAAG-------CCAGCTCCCGAT-----------CCTCAGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCTAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCCCCCATGTCCGACTCACC-AAGCCCTTACTAACGC-CACACCACAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGAGAAGCCTTCAAGGTCTTTGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGATGGTGACGGCCGCATCGACTGTAGGTGTTCAGAATCTGCCTTGGC---TTCTTCAAATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium triglochinicola CBS_718.68' ATCATTACAC-AAT-ATGAAAGCGGGTTGGGGACCTCATTTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCATCAGGACCCAACCATAAACC--TTTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT----TTTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA------TTTTTTTTAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTTCGCAATGCGTAAGTTTGATTGAA-CCCGTCAAATCTCCCATATCAAAGCTAACCGCG-TTTCACAGGGTTGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATCCCCGGATAC-AATACATTCCTTGCTGGCAATCCA--ACACGCC-----TTTCTTCTGATCGC-CGCAAT-----GTCAGTTGT--TGCTAGTAGATCACAAGCTAACGTCCATGTAGGCGTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGAAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCATTCTCCCTCTTCGTAAGTAGCA-CCCCGTGTGCTTGACGCGCGGCTGCCTAG-AGCCATGTCGTCAA----------CA-CCACCATGACC---------------ATCCTGCTAACACATGTT-CT-TCTTATAGGACAAGGACGGCGATGGTTAGTAGCCTATTC--------TCGAATTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------GCCCGAAG-------CTAGCTTCTGAT-----------GCTCAGTCTGCACGCGTCTTACACCA---------GACAATCACTGACCATGTTGCGCCGCAGGTCAAATCACGACCAAGGAGCTCGGTACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCCGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATATCCCCATGTTCGACTCACC-AAGCCCTTACTAACCC-CACACCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCCTTCAAGGTCTTCGACCGCGACAACAACGGTTTCATCTCCGCCGCCGAACTGCGCCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTCGATGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTCAGAATTTGCCTTGGC---TTCTTCATATACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_109843' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_109844' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_115182' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_115204' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA------TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_122640' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT?????????????????????????????CCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_123005' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_123803' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_124279' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_124747' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_124749' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_124751' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_124752' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_125242' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATCCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_133474' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_133737' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT?????????????????????????????????TCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_133905' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_133914' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_138138' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_155.24' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_156.45' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_157.24' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_184.25' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_191.86' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC????TATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAG???????????????????AGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATCCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_192.86' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_205.82' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_273.31' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_274.31' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_307.36' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_311.92' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_322.49' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--CCCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_368.59' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_370.51' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_406.76' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAAAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_486.92' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- 'Stemphylium vesicarium CBS_715.68' ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- Stemphylium_vesicarium_GV11.355a1.2 ATCATTACAC-AAT-ATGAAAGCGGGTT-GGGACCTCACCTCGGTGAGGGC-TCCAGCTTGTCTGAATTATTCACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACC---TTTTTGTAATTGCAATCAGCGTCAGTAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC------TTTGTCTCTCACGAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTGAATCAGCCTTGGTTGAGCATCCATCAAGACCACA-------TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAAGTTTGATTGAG-CCCGTTAATTCTGCCATATCAAAGCTAACCGCG-TCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATCCCCGGATAC-AAGACAGTC-TTCCCGACAATCCG--CTGCGCG-----TTCCATATGATCGC-GGCGGTTGGAGGCCATTTGT--TCCTAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTAGGCCTTCTCCCTCTTCGTAAGTAGCT-CCCTGTCTGCTTGACGCGCGGCTGCCTAG-AGCCTTGTCGTCAA----------CA-CCATGACCATG---------------TTGTTGCTAACACATGTT-CT-CTCTATAGGACAAGGATGGCGATGGTTAGTAGTCCCCCT--------TCGAACTCACGCCC------GCGCACTCT--------------------------------------------------------------------------------------ACCCGAAG-------CCAGCTCGCAGT-----------CCTCGGTCTGCACGCGTCTCACACCA---------GACAATCGCTGACCATGTTGCGCCGCAGGTCAAATCACCACCAAGGAGCTCGGAACCGTCATGCGCTCGCTCGGCCAAAATCCCAGCGAGTCTGAGCTACAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCAGGTA----CCTCAATTCTCCGACTACCAACTCACCAAAACCCTCACTAACCA-CA--ACCCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGATTCGGGAAGCCTTCAAGGTCTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCTGAACTGCGTCACGTCATGACTTCTATTGGCGAGAAATTGACCGATGACGAGGTTGACGAGATGATCCGGGAGGCTGACCAGGACGGCGACGGCCGCATCGACTGTAGGCGCTAAAGAGTTGCTCTGGT---TCCTTCAAACACTAACTCCACCCAGACAACGAGTT- ; END; BEGIN TREES; TITLE Stemphylium_ITS_ML; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_alternata_GV14.634a1, 2 'Stemphylium amaranthi CBS_124650', 3 'Stemphylium amaranthi CBS_124651', 4 'Stemphylium amaranthi CBS_124746', 5 'Stemphylium amaranthi CBS_124750', 6 'Stemphylium amaranthi CBS_124753', 7 'Stemphylium amaranthi CBS_124984', 8 'Stemphylium amaranthi CBS_124985', 9 'Stemphylium amaranthi CBS_133539', 10 'Stemphylium amaranthi CBS_134164', 11 'Stemphylium amaranthi CBS_134500', 12 'Stemphylium amaranthi CBS_136589', 13 'Stemphylium amaranthi CBS_138299', 14 'Stemphylium amaranthi CBS_138519', 15 'Stemphylium armeriae CBS_338.73', 16 'Stemphylium astragali CBS_116583', 17 'Stemphylium beticola CBS_116599', 18 'Stemphylium beticola CBS_133512', 19 'Stemphylium beticola CBS_133892', 20 'Stemphylium beticola CBS_136590', 21 'Stemphylium beticola CBS_136699', 22 'Stemphylium beticola CBS_137492', 23 'Stemphylium beticola CBS_141024', 24 'Stemphylium beticola CBS_141025', 25 'Stemphylium beticola CBS_141026', 26 'Stemphylium beticola CBS_378.54', 27 Stemphylium_beticola_GV11.196.a1.3, 28 Stemphylium_beticola_GV12.275a1, 29 Stemphylium_beticola_GV12.276a1, 30 Stemphylium_beticola_GV12.287a1, 31 Stemphylium_beticola_GV12.336a1, 32 Stemphylium_beticola_GV12.356a1, 33 Stemphylium_beticola_GV12.367a1, 34 Stemphylium_beticola_GV12.368a1, 35 Stemphylium_beticola_GV12.403a1, 36 Stemphylium_beticola_GV13.425a1, 37 Stemphylium_beticola_GV13.436c2, 38 Stemphylium_beticola_GV14.693a1, 39 Stemphylium_beticola_IFZ22013.024, 40 Stemphylium_beticola_IFZ22013.035, 41 Stemphylium_beticola_IFZ22014.020, 42 'Stemphylium botryosum CBS_116596', 43 'Stemphylium botryosum CBS_133292', 44 'Stemphylium botryosum CBS_133293', 45 'Stemphylium botryosum CBS_133738', 46 'Stemphylium botryosum CBS_134149', 47 'Stemphylium botryosum CBS_136587', 48 'Stemphylium botryosum CBS_136805', 49 'Stemphylium botryosum CBS_136822', 50 'Stemphylium botryosum CBS_136933', 51 'Stemphylium botryosum CBS_137037', 52 'Stemphylium botryosum CBS_138762', 53 'Stemphylium botryosum CBS_714.68', 54 'Stemphylium callistephi CBS_527.50', 55 'Stemphylium canadense CBS_116602', 56 'Stemphylium canadense CBS_118081', 57 'Stemphylium chrysanthemicola CBS_117255', 58 'Stemphylium drummondii CBS_133521', 59 'Stemphylium drummondii CBS_136821', 60 'Stemphylium drummondii CBS_137084', 61 'Stemphylium drummondii CBS_346.83', 62 'Stemphylium eturmiunum CBS_109845', 63 'Stemphylium eturmiunum CBS_122124', 64 'Stemphylium eturmiunum CBS_122641', 65 'Stemphylium eturmiunum CBS_124652', 66 'Stemphylium eturmiunum CBS_133461', 67 'Stemphylium eturmiunum CBS_133526', 68 'Stemphylium eturmiunum CBS_133528', 69 'Stemphylium eturmiunum CBS_133543', 70 'Stemphylium eturmiunum CBS_134165', 71 'Stemphylium eturmiunum CBS_134473', 72 'Stemphylium eturmiunum CBS_136569', 73 'Stemphylium eturmiunum CBS_136572', 74 'Stemphylium eturmiunum CBS_136593', 75 'Stemphylium eturmiunum CBS_136594', 76 'Stemphylium eturmiunum CBS_136614', 77 'Stemphylium eturmiunum CBS_136616', 78 'Stemphylium eturmiunum CBS_136798', 79 'Stemphylium eturmiunum CBS_136806', 80 'Stemphylium eturmiunum CBS_136809', 81 'Stemphylium eturmiunum CBS_136811', 82 'Stemphylium eturmiunum CBS_136815', 83 'Stemphylium eturmiunum CBS_136942', 84 'Stemphylium eturmiunum CBS_137493', 85 'Stemphylium eturmiunum CBS_138495', 86 'Stemphylium eturmiunum CBS_668.80', 87 'Stemphylium gracilariae CBS_115179', 88 'Stemphylium gracilariae CBS_115180', 89 'Stemphylium gracilariae CBS_125060', 90 'Stemphylium gracilariae CBS_273.55', 91 'Stemphylium gracilariae CBS_308.36', 92 'Stemphylium gracilariae CBS_482.90', 93 'Stemphylium halophilum CBS_337.73', 94 'Stemphylium halophilum CBS_410.73', 95 'Stemphylium ixeridis CBS_124748', 96 'Stemphylium ixeridis CBS_138522', 97 'Stemphylium lancipes CBS_101217', 98 'Stemphylium lancipes CBS_116584', 99 'Stemphylium lancipes CBS_133314', 100 'Stemphylium loti CBS_136565', 101 'Stemphylium loti CBS_136574', 102 'Stemphylium loti CBS_136575', 103 'Stemphylium loti CBS_136581', 104 'Stemphylium loti CBS_136584', 105 'Stemphylium loti CBS_136585', 106 'Stemphylium loti CBS_407.54', 107 'Stemphylium lucomagnoense CBS_116601', 108 'Stemphylium lycii CBS_115192', 109 'Stemphylium lycii CBS_116582', 110 'Stemphylium lycii CBS_124982', 111 'Stemphylium lycii CBS_125240', 112 'Stemphylium lycii CBS_125241', 113 'Stemphylium lycii CBS_136592', 114 'Stemphylium lycii CBS_136941', 115 'Stemphylium lycii CBS_137135', 116 'Stemphylium lycopersici CBS_116585', 117 'Stemphylium lycopersici CBS_116587', 118 'Stemphylium lycopersici CBS_120325', 119 'Stemphylium lycopersici CBS_120326', 120 'Stemphylium lycopersici CBS_122639', 121 'Stemphylium lycopersici CBS_122803', 122 'Stemphylium lycopersici CBS_123008', 123 'Stemphylium lycopersici CBS_124980', 124 'Stemphylium lycopersici CBS_124981', 125 'Stemphylium lycopersici CBS_124983', 126 'Stemphylium lycopersici CBS_133468', 127 'Stemphylium lycopersici CBS_133728', 128 'Stemphylium lycopersici CBS_133919', 129 'Stemphylium lycopersici CBS_134314', 130 'Stemphylium lycopersici CBS_135159', 131 'Stemphylium lycopersici CBS_135168', 132 'Stemphylium lycopersici CBS_135169', 133 'Stemphylium lycopersici CBS_135172', 134 'Stemphylium lycopersici CBS_135178', 135 'Stemphylium lycopersici CBS_135179', 136 'Stemphylium lycopersici CBS_135180', 137 'Stemphylium lycopersici CBS_135181', 138 'Stemphylium lycopersici CBS_135184', 139 'Stemphylium lycopersici CBS_135185', 140 'Stemphylium lycopersici CBS_135193', 141 'Stemphylium lycopersici CBS_135194', 142 'Stemphylium lycopersici CBS_135195', 143 'Stemphylium lycopersici CBS_135778', 144 'Stemphylium lycopersici CBS_136342', 145 'Stemphylium lycopersici CBS_136577', 146 'Stemphylium lycopersici CBS_136818', 147 'Stemphylium lycopersici CBS_138073', 148 'Stemphylium lycopersici CBS_138083', 149 'Stemphylium lycopersici CBS_138320', 150 'Stemphylium lycopersici CBS_138493', 151 'Stemphylium lycopersici CBS_138494', 152 'Stemphylium lycopersici CBS_138504', 153 'Stemphylium lycopersici CBS_138505', 154 'Stemphylium lycopersici CBS_321.87', 155 'Stemphylium lycopersici CBS_333.73', 156 'Stemphylium lycopersici CBS_436.76', 157 'Stemphylium lycopersici CBS_463.78', 158 'Stemphylium majusculum CBS_133424', 159 'Stemphylium majusculum CBS_717.68', 160 'Stemphylium novae-zelandiae CBS_138157', 161 'Stemphylium novae-zelandiae CBS_138295', 162 'Stemphylium paludiscirpi CBS_109842', 163 'Stemphylium sarciniforme CBS_110049', 164 'Stemphylium sarciniforme CBS_116579', 165 'Stemphylium sarciniforme CBS_116581', 166 'Stemphylium sarciniforme CBS_133513', 167 'Stemphylium sarciniforme CBS_133523', 168 'Stemphylium sarciniforme CBS_133525', 169 'Stemphylium sarciniforme CBS_133723', 170 'Stemphylium sarciniforme CBS_136566', 171 'Stemphylium sarciniforme CBS_136803', 172 'Stemphylium sarciniforme CBS_136810', 173 'Stemphylium sarciniforme CBS_136823', 174 'Stemphylium sarciniforme CBS_138345', 175 'Stemphylium sarciniforme CBS_335.33', 176 'Stemphylium sarciniforme CBS_364.49', 177 'Stemphylium simmonsii CBS_116598', 178 'Stemphylium simmonsii CBS_116603', 179 'Stemphylium simmonsii CBS_116604', 180 'Stemphylium simmonsii CBS_133515', 181 'Stemphylium simmonsii CBS_133518', 182 'Stemphylium simmonsii CBS_133894', 183 'Stemphylium simmonsii CBS_134496', 184 'Stemphylium simmonsii CBS_716.68', 185 'Stemphylium solani CBS_116586', 186 'Stemphylium solani CBS_118082', 187 'Stemphylium solani CBS_134293', 188 'Stemphylium solani CBS_408.54', 189 Stemphylium_sp._Fig._1_Clade_1_CBS_133406, 190 Stemphylium_sp._Fig._1_Clade_1_CBS_133463, 191 Stemphylium_sp._Fig._1_Clade_1_CBS_133472, 192 Stemphylium_sp._Fig._1_Clade_1_CBS_133479, 193 Stemphylium_sp._Fig._1_Clade_1_CBS_133835, 194 Stemphylium_sp._Fig._1_Clade_1_CBS_136570, 195 Stemphylium_sp._Fig._1_Clade_1_CBS_136726, 196 Stemphylium_sp._Fig._1_Clade_1_CBS_136796, 197 Stemphylium_sp._Fig._1_Clade_1_CBS_136799, 198 Stemphylium_sp._Fig._1_Clade_1_CBS_136808, 199 Stemphylium_sp._Fig._1_Clade_1_CBS_136943, 200 Stemphylium_sp._Fig._1_Clade_1_CBS_137045, 201 Stemphylium_sp._Fig._1_Clade_1_CBS_137081, 202 Stemphylium_sp._Fig._1_Clade_1_CBS_137085, 203 Stemphylium_sp._Fig._1_Clade_1_CBS_137479, 204 Stemphylium_sp._Fig._1_Clade_1_CBS_137480, 205 Stemphylium_sp._Fig._1_Clade_1_CBS_138502, 206 Stemphylium_sp._Fig._1_Clade_1_CBS_138503, 207 Stemphylium_sp._Fig._1_Clade_7_CBS_133532, 208 Stemphylium_sp._Fig._1_Clade_7_CBS_134178, 209 Stemphylium_sp._Fig._1_Clade_7_CBS_134949, 210 Stemphylium_sp._Fig._1_Clade_7_CBS_136340, 211 Stemphylium_sp._Fig._1_Clade_7_CBS_136351, 212 Stemphylium_sp._Fig._1_Clade_7_CBS_136939, 213 Stemphylium_sp._Fig._1_Clade_7_CBS_137055, 214 Stemphylium_sp._Fig._1_Clade_7_CBS_137418, 215 Stemphylium_sp._Fig._1_Clade_7_CBS_137419, 216 'Stemphylium symphyti CBS_115268', 217 'Stemphylium symphyti CBS_118796', 218 'Stemphylium symphyti CBS_133300', 219 'Stemphylium symphyti CBS_133301', 220 'Stemphylium symphyti CBS_133302', 221 'Stemphylium symphyti CBS_136568', 222 'Stemphylium symphyti CBS_138069', 223 'Stemphylium symphyti CBS_138070', 224 'Stemphylium symphyti CBS_138075', 225 'Stemphylium symphyti CBS_138891', 226 'Stemphylium trifolii CBS_116580', 227 'Stemphylium trifolii CBS_133466', 228 'Stemphylium trifolii CBS_136700', 229 'Stemphylium trifolii CBS_136723', 230 'Stemphylium trifolii CBS_136724', 231 'Stemphylium trifolii CBS_136725', 232 'Stemphylium triglochinicola CBS_133731', 233 'Stemphylium triglochinicola CBS_133732', 234 'Stemphylium triglochinicola CBS_133739', 235 'Stemphylium triglochinicola CBS_133740', 236 'Stemphylium triglochinicola CBS_133744', 237 'Stemphylium triglochinicola CBS_133747', 238 'Stemphylium triglochinicola CBS_133748', 239 'Stemphylium triglochinicola CBS_718.68', 240 'Stemphylium vesicarium CBS_109843', 241 'Stemphylium vesicarium CBS_109844', 242 'Stemphylium vesicarium CBS_115182', 243 'Stemphylium vesicarium CBS_115204', 244 'Stemphylium vesicarium CBS_122640', 245 'Stemphylium vesicarium CBS_123005', 246 'Stemphylium vesicarium CBS_123803', 247 'Stemphylium vesicarium CBS_124279', 248 'Stemphylium vesicarium CBS_124747', 249 'Stemphylium vesicarium CBS_124749', 250 'Stemphylium vesicarium CBS_124751', 251 'Stemphylium vesicarium CBS_124752', 252 'Stemphylium vesicarium CBS_125242', 253 'Stemphylium vesicarium CBS_133459', 254 'Stemphylium vesicarium CBS_133467', 255 'Stemphylium vesicarium CBS_133473', 256 'Stemphylium vesicarium CBS_133474', 257 'Stemphylium vesicarium CBS_133475', 258 'Stemphylium vesicarium CBS_133477', 259 'Stemphylium vesicarium CBS_133478', 260 'Stemphylium vesicarium CBS_133481', 261 'Stemphylium vesicarium CBS_133519', 262 'Stemphylium vesicarium CBS_133533', 263 'Stemphylium vesicarium CBS_133540', 264 'Stemphylium vesicarium CBS_133541', 265 'Stemphylium vesicarium CBS_133652', 266 'Stemphylium vesicarium CBS_133659', 267 'Stemphylium vesicarium CBS_133663', 268 'Stemphylium vesicarium CBS_133668', 269 'Stemphylium vesicarium CBS_133672', 270 'Stemphylium vesicarium CBS_133673', 271 'Stemphylium vesicarium CBS_133676', 272 'Stemphylium vesicarium CBS_133677', 273 'Stemphylium vesicarium CBS_133737', 274 'Stemphylium vesicarium CBS_133742', 275 'Stemphylium vesicarium CBS_133821', 276 'Stemphylium vesicarium CBS_133825', 277 'Stemphylium vesicarium CBS_133834', 278 'Stemphylium vesicarium CBS_133893', 279 'Stemphylium vesicarium CBS_133905', 280 'Stemphylium vesicarium CBS_133914', 281 'Stemphylium vesicarium CBS_134156', 282 'Stemphylium vesicarium CBS_134977', 283 'Stemphylium vesicarium CBS_136306', 284 'Stemphylium vesicarium CBS_136353', 285 'Stemphylium vesicarium CBS_136567', 286 'Stemphylium vesicarium CBS_136571', 287 'Stemphylium vesicarium CBS_136586', 288 'Stemphylium vesicarium CBS_136588', 289 'Stemphylium vesicarium CBS_136591', 290 'Stemphylium vesicarium CBS_136610', 291 'Stemphylium vesicarium CBS_136615', 292 'Stemphylium vesicarium CBS_136732', 293 'Stemphylium vesicarium CBS_136733', 294 'Stemphylium vesicarium CBS_136736', 295 'Stemphylium vesicarium CBS_136741', 296 'Stemphylium vesicarium CBS_136742', 297 'Stemphylium vesicarium CBS_136743', 298 'Stemphylium vesicarium CBS_136744', 299 'Stemphylium vesicarium CBS_136745', 300 'Stemphylium vesicarium CBS_136759', 301 'Stemphylium vesicarium CBS_136760', 302 'Stemphylium vesicarium CBS_136797', 303 'Stemphylium vesicarium CBS_136800', 304 'Stemphylium vesicarium CBS_136802', 305 'Stemphylium vesicarium CBS_136804', 306 'Stemphylium vesicarium CBS_136807', 307 'Stemphylium vesicarium CBS_136812', 308 'Stemphylium vesicarium CBS_136813', 309 'Stemphylium vesicarium CBS_136814', 310 'Stemphylium vesicarium CBS_136816', 311 'Stemphylium vesicarium CBS_136817', 312 'Stemphylium vesicarium CBS_136824', 313 'Stemphylium vesicarium CBS_136825', 314 'Stemphylium vesicarium CBS_136934', 315 'Stemphylium vesicarium CBS_136935', 316 'Stemphylium vesicarium CBS_136950', 317 'Stemphylium vesicarium CBS_136951', 318 'Stemphylium vesicarium CBS_136953', 319 'Stemphylium vesicarium CBS_136955', 320 'Stemphylium vesicarium CBS_136957', 321 'Stemphylium vesicarium CBS_136958', 322 'Stemphylium vesicarium CBS_136960', 323 'Stemphylium vesicarium CBS_137082', 324 'Stemphylium vesicarium CBS_137139', 325 'Stemphylium vesicarium CBS_137146', 326 'Stemphylium vesicarium CBS_137155', 327 'Stemphylium vesicarium CBS_137490', 328 'Stemphylium vesicarium CBS_137491', 329 'Stemphylium vesicarium CBS_137922', 330 'Stemphylium vesicarium CBS_138087', 331 'Stemphylium vesicarium CBS_138088', 332 'Stemphylium vesicarium CBS_138089', 333 'Stemphylium vesicarium CBS_138090', 334 'Stemphylium vesicarium CBS_138138', 335 'Stemphylium vesicarium CBS_138333', 336 'Stemphylium vesicarium CBS_138421', 337 'Stemphylium vesicarium CBS_138484', 338 'Stemphylium vesicarium CBS_138520', 339 'Stemphylium vesicarium CBS_138765', 340 'Stemphylium vesicarium CBS_155.24', 341 'Stemphylium vesicarium CBS_156.45', 342 'Stemphylium vesicarium CBS_157.24', 343 'Stemphylium vesicarium CBS_184.25', 344 'Stemphylium vesicarium CBS_191.86', 345 'Stemphylium vesicarium CBS_192.86', 346 'Stemphylium vesicarium CBS_205.82', 347 'Stemphylium vesicarium CBS_273.31', 348 'Stemphylium vesicarium CBS_274.31', 349 'Stemphylium vesicarium CBS_307.36', 350 'Stemphylium vesicarium CBS_311.92', 351 'Stemphylium vesicarium CBS_322.49', 352 'Stemphylium vesicarium CBS_368.59', 353 'Stemphylium vesicarium CBS_370.51', 354 'Stemphylium vesicarium CBS_406.76', 355 'Stemphylium vesicarium CBS_486.92', 356 'Stemphylium vesicarium CBS_715.68', 357 Stemphylium_vesicarium_GV11.355.a1.2; TREE Fig._1_MLT = [&R] ((12:1.5125214043527E-6,((10:1.5125214043527E-6,(7:1.5125214043527E-6,((6:1.5125214043527E-6,(5:1.5125214043527E-6,(((((4:1.5125214043527E-6,(56:1.5125214043527E-6,(55:0.0019958478525116735,((162:1.5125214043527E-6,((93:1.5125214043527E-6,94:1.5125214043527E-6):0.005389631043430604,((160:1.5125214043527E-6,161:1.5125214043527E-6):0.021583180843350484,((112:1.5125214043527E-6,110:1.5125214043527E-6):1.5125214043527E-6,((114:1.5125214043527E-6,113:1.5125214043527E-6):1.5125214043527E-6,(115:1.5125214043527E-6,(111:1.5125214043527E-6,(109:1.5125214043527E-6,108:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.001988729879359368):0.002658110456262409):1.5125214043527E-6,((((((57:0.003791211417071021,((((105:1.5125214043527E-6,101:1.5125214043527E-6):1.5125214043527E-6,(((102:1.5125214043527E-6,104:1.5125214043527E-6):1.5125214043527E-6,103:1.5125214043527E-6):1.5125214043527E-6,100:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,106:1.5125214043527E-6):0.028858299906917358,((((171:1.5125214043527E-6,((173:1.5125214043527E-6,170:1.5125214043527E-6):1.5125214043527E-6,(174:1.5125214043527E-6,(176:1.5125214043527E-6,175:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,164:1.5125214043527E-6):1.5125214043527E-6,(((163:1.5125214043527E-6,166:1.5125214043527E-6):1.5125214043527E-6,168:1.5125214043527E-6):1.5125214043527E-6,((165:1.5125214043527E-6,172:1.5125214043527E-6):1.5125214043527E-6,167:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,169:0.0019971626095164267):0.010923409842490956):0.0061317169006417475):0.002260253558487027,(((184:1.5125214043527E-6,180:1.5125214043527E-6):1.5125214043527E-6,(((182:1.5125214043527E-6,181:1.5125214043527E-6):1.5125214043527E-6,(178:1.5125214043527E-6,(177:1.5125214043527E-6,183:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,179:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,((((33:1.5125214043527E-6,30:1.5125214043527E-6):1.5125214043527E-6,(21:1.5125214043527E-6,23:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(40:1.5125214043527E-6,(31:1.5125214043527E-6,(((41:1.5125214043527E-6,39:1.5125214043527E-6):1.5125214043527E-6,37:1.5125214043527E-6):1.5125214043527E-6,35:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(32:1.5125214043527E-6,((28:1.5125214043527E-6,36:1.5125214043527E-6):1.5125214043527E-6,(((34:1.5125214043527E-6,((27:1.5125214043527E-6,19:1.5125214043527E-6):1.5125214043527E-6,(20:1.5125214043527E-6,(((29:1.5125214043527E-6,24:1.5125214043527E-6):1.5125214043527E-6,18:1.5125214043527E-6):1.5125214043527E-6,38:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(26:1.5125214043527E-6,22:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(25:1.5125214043527E-6,17:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.006011892227224604,((95:1.5125214043527E-6,96:1.5125214043527E-6):0.014936644970711623,(((227:1.5125214043527E-6,229:1.5125214043527E-6):1.5125214043527E-6,(228:1.5125214043527E-6,230:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(226:1.5125214043527E-6,231:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.002013375083691682,(((58:1.5125214043527E-6,60:1.5125214043527E-6):1.5125214043527E-6,59:1.5125214043527E-6):1.5125214043527E-6,61:1.5125214043527E-6):0.0041567858510663915):0.0019787186886570805,(((((((125:1.5125214043527E-6,126:1.5125214043527E-6):1.5125214043527E-6,(130:0.0020464303835481864,155:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(((((148:1.5125214043527E-6,152:1.5125214043527E-6):1.5125214043527E-6,(((139:1.5125214043527E-6,((144:1.5125214043527E-6,146:1.5125214043527E-6):1.5125214043527E-6,143:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,((((122:1.5125214043527E-6,134:1.5125214043527E-6):1.5125214043527E-6,123:1.5125214043527E-6):1.5125214043527E-6,138:1.5125214043527E-6):1.5125214043527E-6,(145:1.5125214043527E-6,(((137:1.5125214043527E-6,121:1.5125214043527E-6):1.5125214043527E-6,142:1.5125214043527E-6):1.5125214043527E-6,156:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,129:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,118:1.5125214043527E-6):1.5125214043527E-6,(((117:1.5125214043527E-6,(153:1.5125214043527E-6,(141:1.5125214043527E-6,(120:1.5125214043527E-6,127:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(135:1.5125214043527E-6,(128:1.5125214043527E-6,(124:1.5125214043527E-6,116:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(((154:1.5125214043527E-6,149:1.5125214043527E-6):1.5125214043527E-6,119:1.5125214043527E-6):1.5125214043527E-6,151:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,147:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(((132:1.5125214043527E-6,140:1.5125214043527E-6):1.5125214043527E-6,150:1.5125214043527E-6):1.5125214043527E-6,((133:1.5125214043527E-6,136:1.5125214043527E-6):1.5125214043527E-6,131:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,157:0.002022939578480956):0.008291518696027017,((54:0.004081980016764523,((219:1.5125214043527E-6,(224:1.5125214043527E-6,((((221:1.5125214043527E-6,220:1.5125214043527E-6):1.5125214043527E-6,225:1.5125214043527E-6):1.5125214043527E-6,218:1.5125214043527E-6):1.5125214043527E-6,(217:1.5125214043527E-6,216:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.0020313183420779045,(223:1.5125214043527E-6,222:1.5125214043527E-6):1.5125214043527E-6):0.0020330188224434065):1.5125214043527E-6,((98:1.5125214043527E-6,(99:1.5125214043527E-6,((213:1.5125214043527E-6,212:1.5125214043527E-6):1.5125214043527E-6,97:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,((((((215:1.5125214043527E-6,207:1.5125214043527E-6):1.5125214043527E-6,(187:1.5125214043527E-6,(186:1.5125214043527E-6,208:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,188:1.5125214043527E-6):1.5125214043527E-6,(211:1.5125214043527E-6,210:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(214:1.5125214043527E-6,209:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,185:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.002072522787661913):0.0019602826316489387,((((((306:1.5125214043527E-6,293:1.5125214043527E-6):1.5125214043527E-6,243:1.5125214043527E-6):1.5125214043527E-6,271:1.5125214043527E-6):1.5125214043527E-6,270:1.5125214043527E-6):1.5125214043527E-6,((298:1.5125214043527E-6,(349:1.5125214043527E-6,((307:1.5125214043527E-6,(287:1.5125214043527E-6,((((313:1.5125214043527E-6,(((((((((((245:1.5125214043527E-6,(316:1.5125214043527E-6,(253:1.5125214043527E-6,(326:1.5125214043527E-6,(257:1.5125214043527E-6,(255:1.5125214043527E-6,(263:1.5125214043527E-6,(310:1.5125214043527E-6,(314:1.5125214043527E-6,(321:1.5125214043527E-6,(320:1.5125214043527E-6,((262:1.5125214043527E-6,(289:1.5125214043527E-6,(327:1.5125214043527E-6,(274:1.5125214043527E-6,(256:1.5125214043527E-6,(((332:1.5125214043527E-6,(244:1.5125214043527E-6,(311:1.5125214043527E-6,(267:1.5125214043527E-6,(290:1.5125214043527E-6,(351:1.5125214043527E-6,(261:1.5125214043527E-6,(329:1.5125214043527E-6,(((305:1.5125214043527E-6,(336:1.5125214043527E-6,((((331:1.5125214043527E-6,(308:1.5125214043527E-6,(266:1.5125214043527E-6,((((302:1.5125214043527E-6,((((((295:1.5125214043527E-6,((352:1.5125214043527E-6,((((254:1.5125214043527E-6,(241:1.5125214043527E-6,((273:1.5125214043527E-6,((280:1.5125214043527E-6,(272:1.5125214043527E-6,(((((330:1.5125214043527E-6,(((((276:1.5125214043527E-6,(334:1.5125214043527E-6,(355:1.5125214043527E-6,(350:1.5125214043527E-6,(347:1.5125214043527E-6,(346:1.5125214043527E-6,(342:1.5125214043527E-6,(340:1.5125214043527E-6,(339:1.5125214043527E-6,(337:1.5125214043527E-6,(335:1.5125214043527E-6,(328:1.5125214043527E-6,(333:1.5125214043527E-6,(322:1.5125214043527E-6,(344:1.5125214043527E-6,(354:1.5125214043527E-6,(((275:1.5125214043527E-6,(292:1.5125214043527E-6,(((246:1.5125214043527E-6,((248:1.5125214043527E-6,(((((204:1.5125214043527E-6,(190:1.5125214043527E-6,(((((((((((((90:1.5125214043527E-6,((92:1.5125214043527E-6,(((199:1.5125214043527E-6,(197:1.5125214043527E-6,((159:1.5125214043527E-6,(107:1.5125214043527E-6,193:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,158:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,201:1.5125214043527E-6):1.5125214043527E-6,202:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,91:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,206:1.5125214043527E-6):1.5125214043527E-6,205:1.5125214043527E-6):1.5125214043527E-6,203:1.5125214043527E-6):1.5125214043527E-6,200:1.5125214043527E-6):1.5125214043527E-6,198:1.5125214043527E-6):1.5125214043527E-6,196:1.5125214043527E-6):1.5125214043527E-6,195:1.5125214043527E-6):1.5125214043527E-6,194:1.5125214043527E-6):1.5125214043527E-6,189:1.5125214043527E-6):1.5125214043527E-6,16:1.5125214043527E-6):1.5125214043527E-6,88:1.5125214043527E-6):1.5125214043527E-6,191:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,87:1.5125214043527E-6):1.5125214043527E-6,192:1.5125214043527E-6):1.5125214043527E-6,89:0.002045693242839848):1.5125214043527E-6,15:0.004056839800218121):0.003924360087146775):1.5125214043527E-6,250:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,297:1.5125214043527E-6):1.5125214043527E-6,303:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,278:1.5125214043527E-6):1.5125214043527E-6,341:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,291:1.5125214043527E-6):1.5125214043527E-6,264:1.5125214043527E-6):1.5125214043527E-6,259:1.5125214043527E-6):1.5125214043527E-6,317:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,319:1.5125214043527E-6):1.5125214043527E-6,277:1.5125214043527E-6):1.5125214043527E-6,252:1.5125214043527E-6):1.5125214043527E-6,282:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,356:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,304:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,269:1.5125214043527E-6):1.5125214043527E-6,258:1.5125214043527E-6):1.5125214043527E-6,353:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,318:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,357:1.5125214043527E-6):1.5125214043527E-6,315:1.5125214043527E-6):1.5125214043527E-6,240:1.5125214043527E-6):1.5125214043527E-6,242:1.5125214043527E-6):1.5125214043527E-6,288:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,285:1.5125214043527E-6):1.5125214043527E-6,279:1.5125214043527E-6):1.5125214043527E-6,283:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,323:1.5125214043527E-6):1.5125214043527E-6,268:1.5125214043527E-6):1.5125214043527E-6,251:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,312:1.5125214043527E-6):1.5125214043527E-6,324:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,260:1.5125214043527E-6):1.5125214043527E-6,345:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,249:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,247:1.5125214043527E-6):1.5125214043527E-6,281:1.5125214043527E-6):1.5125214043527E-6,286:1.5125214043527E-6):1.5125214043527E-6,299:1.5125214043527E-6):1.5125214043527E-6,300:1.5125214043527E-6):1.5125214043527E-6,301:1.5125214043527E-6):1.5125214043527E-6,309:1.5125214043527E-6):1.5125214043527E-6,325:1.5125214043527E-6):1.5125214043527E-6,338:1.5125214043527E-6):1.5125214043527E-6,343:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,284:1.5125214043527E-6):1.5125214043527E-6,296:1.5125214043527E-6):1.5125214043527E-6,265:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,348:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,294:1.5125214043527E-6):1.5125214043527E-6):0.004007910974928924,(((68:1.5125214043527E-6,85:1.5125214043527E-6):1.5125214043527E-6,((47:1.5125214043527E-6,(52:1.5125214043527E-6,((51:1.5125214043527E-6,48:1.5125214043527E-6):1.5125214043527E-6,((44:1.5125214043527E-6,43:1.5125214043527E-6):1.5125214043527E-6,((49:1.5125214043527E-6,50:1.5125214043527E-6):1.5125214043527E-6,53:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,((46:1.5125214043527E-6,45:1.5125214043527E-6):1.5125214043527E-6,42:1.5125214043527E-6):1.5125214043527E-6):0.004106299111860062):0.0020458067182476036,((76:1.5125214043527E-6,(86:1.5125214043527E-6,(82:1.5125214043527E-6,((63:1.5125214043527E-6,77:1.5125214043527E-6):1.5125214043527E-6,(67:1.5125214043527E-6,64:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(((70:1.5125214043527E-6,81:1.5125214043527E-6):1.5125214043527E-6,(((73:1.5125214043527E-6,72:1.5125214043527E-6):1.5125214043527E-6,((((71:1.5125214043527E-6,66:1.5125214043527E-6):1.5125214043527E-6,62:1.5125214043527E-6):1.5125214043527E-6,84:1.5125214043527E-6):1.5125214043527E-6,(75:1.5125214043527E-6,65:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(83:1.5125214043527E-6,((79:1.5125214043527E-6,80:1.5125214043527E-6):1.5125214043527E-6,(74:1.5125214043527E-6,69:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,78:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):0.002011625165140646):0.00198520820357471,(((232:1.5125214043527E-6,233:1.5125214043527E-6):1.5125214043527E-6,((237:1.5125214043527E-6,(235:1.5125214043527E-6,234:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,238:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(239:1.5125214043527E-6,236:1.5125214043527E-6):1.5125214043527E-6):0.004054371937329456):0.002027649047981284):0.002020275197977186):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,3:1.5125214043527E-6):1.5125214043527E-6,11:1.5125214043527E-6):1.5125214043527E-6,8:1.5125214043527E-6):1.5125214043527E-6,14:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,13:1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6):1.5125214043527E-6,(9:1.5125214043527E-6,2:1.5125214043527E-6):1.5125214043527E-6):0.002032584915910731):0.07442065619951409,1:0.07442065619951409); END; BEGIN TREES; TITLE Stemphylium_ITS_GAPDH_CALD_ML; LINK TAXA = Taxa1; TRANSLATE 1 Alternaria_alternata_GV14.634a1, 2 'Stemphylium canadense CBS_116602', 3 'Stemphylium canadense CBS_118081', 4 'Stemphylium paludiscirpi CBS_109842', 5 'Stemphylium triglochinicola CBS_718.68', 6 'Stemphylium halophilum CBS_337.73', 7 'Stemphylium halophilum CBS_410.73', 8 'Stemphylium lycii CBS_115192', 9 'Stemphylium lycii CBS_116582', 10 'Stemphylium lycii CBS_124982', 11 'Stemphylium lycii CBS_125240', 12 'Stemphylium lycii CBS_125241', 13 'Stemphylium amaranthi CBS_124650', 14 'Stemphylium amaranthi CBS_124651', 15 'Stemphylium amaranthi CBS_124984', 16 'Stemphylium amaranthi CBS_124985', 17 'Stemphylium amaranthi CBS_136589', 18 'Stemphylium amaranthi CBS_124746', 19 'Stemphylium amaranthi CBS_124750', 20 'Stemphylium amaranthi CBS_124753', 21 'Stemphylium trifolii CBS_116580', 22 'Stemphylium chrysanthemicola CBS_117255', 23 'Stemphylium loti CBS_407.54', 24 'Stemphylium sarciniforme CBS_110049', 25 'Stemphylium sarciniforme CBS_116581', 26 'Stemphylium sarciniforme CBS_136810', 27 'Stemphylium sarciniforme CBS_116579', 28 'Stemphylium sarciniforme CBS_133723', 29 'Stemphylium sarciniforme CBS_138345', 30 'Stemphylium sarciniforme CBS_335.33', 31 'Stemphylium sarciniforme CBS_364.49', 32 'Stemphylium simmonsii CBS_116598', 33 'Stemphylium simmonsii CBS_133894', 34 'Stemphylium simmonsii CBS_116603', 35 'Stemphylium simmonsii CBS_116604', 36 'Stemphylium simmonsii CBS_133515', 37 'Stemphylium simmonsii CBS_133518', 38 'Stemphylium simmonsii CBS_134496', 39 'Stemphylium simmonsii CBS_716.68', 40 'Stemphylium beticola CBS_136590', 41 'Stemphylium beticola CBS_141024', 42 'Stemphylium beticola CBS_141026', 43 Stemphylium_beticola_GV12.287a1, 44 Stemphylium_beticola_GV12.336a1, 45 Stemphylium_beticola_GV12.356a1, 46 Stemphylium_beticola_GV12.368a1, 47 Stemphylium_beticola_GV12.403a1, 48 Stemphylium_beticola_IFZ2013.035, 49 Stemphylium_beticola_IFZ2014.020, 50 'Stemphylium beticola CBS_141025', 51 Stemphylium_beticola_IFZ2013.024, 52 'Stemphylium beticola CBS_133892', 53 'Stemphylium beticola CBS_137492', 54 'Stemphylium beticola CBS_378.54', 55 Stemphylium_beticola_GV13.425a1, 56 'Stemphylium beticola CBS_116599', 57 'Stemphylium beticola CBS_133512', 58 'Stemphylium beticola CBS_136699', 59 Stemphylium_beticola_GV11.196a1.3, 60 Stemphylium_beticola_GV12.275a1, 61 Stemphylium_beticola_GV12.276a1, 62 Stemphylium_beticola_GV12.367a1, 63 Stemphylium_beticola_GV13.436c2, 64 Stemphylium_beticola_GV14.693a1, 65 'Stemphylium drummondii CBS_346.83', 66 'Stemphylium novae-zelandiae CBS_138157', 67 'Stemphylium novae-zelandiae CBS_138295', 68 'Stemphylium lancipes CBS_133314', 69 'Stemphylium lancipes CBS_101217', 70 'Stemphylium lancipes CBS_116584', 71 'Stemphylium callistephi CBS_527.50', 72 'Stemphylium solani CBS_116586', 73 'Stemphylium solani CBS_118082', 74 'Stemphylium solani CBS_408.54', 75 'Stemphylium ixeridis CBS_124748', 76 'Stemphylium symphyti CBS_115268', 77 'Stemphylium symphyti CBS_118796', 78 'Stemphylium symphyti CBS_138069', 79 'Stemphylium symphyti CBS_138070', 80 'Stemphylium lycopersici CBS_124983', 81 'Stemphylium lycopersici CBS_135778', 82 'Stemphylium lycopersici CBS_333.73', 83 'Stemphylium lycopersici CBS_120325', 84 'Stemphylium lycopersici CBS_120326', 85 'Stemphylium lycopersici CBS_123008', 86 'Stemphylium lycopersici CBS_116585', 87 'Stemphylium lycopersici CBS_124981', 88 'Stemphylium lycopersici CBS_463.78', 89 'Stemphylium lycopersici CBS_116587', 90 'Stemphylium lycopersici CBS_122803', 91 'Stemphylium lycopersici CBS_124980', 92 'Stemphylium lycopersici CBS_436.76', 93 'Stemphylium lycopersici CBS_122639', 94 'Stemphylium lycopersici CBS_321.87', 95 'Stemphylium botryosum CBS_116596', 96 'Stemphylium botryosum CBS_714.68', 97 'Stemphylium eturmium CBS_122124', 98 'Stemphylium eturmium CBS_133528', 99 'Stemphylium eturmium CBS_138495', 100 'Stemphylium eturmium CBS_109845', 101 'Stemphylium eturmium CBS_668.80', 102 'Stemphylium eturmium CBS_122641', 103 'Stemphylium eturmium CBS_124652', 104 'Stemphylium astragali CBS_116583', 105 'Stemphylium lucomagnoense CBS_116601', 106 'Stemphylium majusculum CBS_133424', 107 'Stemphylium majusculum CBS_717.68', 108 'Stemphylium gracilariae CBS_115179', 109 'Stemphylium gracilariae CBS_115180', 110 'Stemphylium gracilariae CBS_125060', 111 'Stemphylium gracilariae CBS_273.55', 112 'Stemphylium gracilariae CBS_308.36', 113 'Stemphylium gracilariae CBS_482.90', 114 'Stemphylium armeriae CBS_338.73', 115 'Stemphylium vesicarium CBS_124749', 116 'Stemphylium vesicarium CBS_133905', 117 'Stemphylium vesicarium CBS_322.49', 118 'Stemphylium vesicarium CBS_123005', 119 'Stemphylium vesicarium CBS_123803', 120 'Stemphylium vesicarium CBS_125242', 121 'Stemphylium vesicarium CBS_191.86', 122 'Stemphylium vesicarium CBS_109843', 123 'Stemphylium vesicarium CBS_109844', 124 'Stemphylium vesicarium CBS_115182', 125 'Stemphylium vesicarium CBS_115204', 126 'Stemphylium vesicarium CBS_122640', 127 'Stemphylium vesicarium CBS_124279', 128 'Stemphylium vesicarium CBS_124747', 129 'Stemphylium vesicarium CBS_124751', 130 'Stemphylium vesicarium CBS_124752', 131 'Stemphylium vesicarium CBS_133474', 132 'Stemphylium vesicarium CBS_133737', 133 'Stemphylium vesicarium CBS_133914', 134 'Stemphylium vesicarium CBS_138138', 135 'Stemphylium vesicarium CBS_155.24', 136 'Stemphylium vesicarium CBS_156.45', 137 'Stemphylium vesicarium CBS_157.24', 138 'Stemphylium vesicarium CBS_184.25', 139 'Stemphylium vesicarium CBS_192.86', 140 'Stemphylium vesicarium CBS_205.82', 141 'Stemphylium vesicarium CBS_273.31', 142 'Stemphylium vesicarium CBS_274.31', 143 'Stemphylium vesicarium CBS_307.36', 144 'Stemphylium vesicarium CBS_311.92', 145 'Stemphylium vesicarium CBS_368.59', 146 'Stemphylium vesicarium CBS_370.51', 147 'Stemphylium vesicarium CBS_406.76', 148 'Stemphylium vesicarium CBS_486.92', 149 'Stemphylium vesicarium CBS_715.68', 150 Stemphylium_vesicarium_GV11.355a1.2; TREE Fig._2_MLT = [&R] ((((65:0.02017706044195706,(67:1.83062790600875E-6,66:1.83062790600875E-6):0.029871263072519288):0.005066169487298691,(((95:1.83062790600875E-6,96:1.83062790600875E-6):0.011269846891861574,((((103:5.813257537094106E-4,102:5.792048538975943E-4):0.001160513547840002,(101:5.794610630265257E-4,100:1.83062790600875E-6):1.83062790600875E-6):0.0011586765619478019,((99:1.83062790600875E-6,98:1.83062790600875E-6):5.797195718127196E-4,97:5.798897235737768E-4):1.83062790600875E-6):0.004698047442540914,(104:0.00529144831872481,(((114:0.002927151494088263,((((118:1.83062790600875E-6,((((((((139:1.83062790600875E-6,(129:1.83062790600875E-6,((143:1.83062790600875E-6,((((123:1.83062790600875E-6,((124:1.83062790600875E-6,(122:1.83062790600875E-6,(138:1.83062790600875E-6,(131:1.83062790600875E-6,(147:5.804802680049508E-4,((141:1.83062790600875E-6,((135:1.83062790600875E-6,(150:1.83062790600875E-6,(145:1.83062790600875E-6,125:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,148:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,136:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,128:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,127:1.83062790600875E-6):1.83062790600875E-6,144:1.83062790600875E-6):1.83062790600875E-6,142:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,140:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,134:1.83062790600875E-6):1.83062790600875E-6,130:1.83062790600875E-6):1.83062790600875E-6,146:1.83062790600875E-6):1.83062790600875E-6,133:1.83062790600875E-6):1.83062790600875E-6,149:1.83062790600875E-6):1.83062790600875E-6,137:1.83062790600875E-6):1.83062790600875E-6,(126:1.83062790600875E-6,132:1.83062790600875E-6):1.83062790600875E-6):5.823946806894654E-4):1.83062790600875E-6,119:1.83062790600875E-6):1.83062790600875E-6,(120:1.83062790600875E-6,121:1.83062790600875E-6):5.803676373017358E-4):5.817704036651656E-4,(115:1.83062790600875E-6,(117:1.83062790600875E-6,116:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):0.004119271154023305):5.659212989411951E-4,(((((111:1.83062790600875E-6,112:1.83062790600875E-6):1.83062790600875E-6,108:1.83062790600875E-6):1.83062790600875E-6,(109:0.0017431445582722675,110:0.0011591227179817735):1.83062790600875E-6):1.83062790600875E-6,113:5.837735574873036E-4):0.005309649786021593,(106:1.83062790600875E-6,107:5.791091844201996E-4):0.004705731228000933):5.453370480874034E-4):5.731059093128984E-4,105:0.002311900252901124):0.0011587185726620733):0.002926206922009837):0.0018310387535019714):0.00532781663021411,((75:0.027841557918643473,(((79:1.83062790600875E-6,78:1.83062790600875E-6):5.819412962233622E-4,(76:1.83062790600875E-6,77:1.83062790600875E-6):6.143815592610846E-4):0.013855396953551057,(((81:5.780883223306098E-4,82:5.777872597549726E-4):1.83062790600875E-6,(((((93:1.83062790600875E-6,94:1.83062790600875E-6):1.83062790600875E-6,((90:1.83062790600875E-6,(91:1.83062790600875E-6,92:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,89:1.83062790600875E-6):5.768609151813361E-4):5.779717195407422E-4,(88:5.765579898783094E-4,87:1.83062790600875E-6):5.763173135669717E-4):1.83062790600875E-6,86:1.83062790600875E-6):0.0011541344486900044,80:0.001156351116555393):1.83062790600875E-6):1.83062790600875E-6,(84:5.782896423085158E-4,(83:1.83062790600875E-6,85:1.83062790600875E-6):1.83062790600875E-6):5.773837858659929E-4):0.03422209669229426):0.002227840212215193):0.003291806118266307,((71:0.013365472206545699,(72:1.83062790600875E-6,(73:1.83062790600875E-6,74:1.83062790600875E-6):5.705142407969029E-4):0.009922114003969983):0.01865814499507249,((70:1.83062790600875E-6,69:1.83062790600875E-6):0.002350896220804859,68:1.83062790600875E-6):0.010806109556652817):0.005406659920088237):0.004261290918636935):0.010899661613635762):0.01524374103355435,(((((20:1.83062790600875E-6,19:1.83062790600875E-6):1.83062790600875E-6,((17:5.765689149295721E-4,((15:1.83062790600875E-6,16:1.83062790600875E-6):1.83062790600875E-6,(14:1.83062790600875E-6,13:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6):5.764975909440526E-4,18:1.83062790600875E-6):5.768957294031699E-4):0.007464812038231978,((6:1.83062790600875E-6,7:1.83062790600875E-6):0.005889695731966771,(9:0.0023119232466781436,(8:0.0011542007707790103,(11:5.759843100761826E-4,(10:1.83062790600875E-6,12:1.83062790600875E-6):1.83062790600875E-6):5.764593513286121E-4):1.83062790600875E-6):0.0011264791700428185):0.005720694305494837):0.003072130581181615,((3:1.83062790600875E-6,2:5.765799964708384E-4):0.012837597255208737,(5:0.020624072937384844,4:0.013311108695854884):0.0038859690737239306):5.798511961581098E-4):0.00793629821101174,(21:0.019692680273533835,(((33:0.004072184783871359,(32:0.0016717485905383325,(((38:1.83062790600875E-6,(37:1.83062790600875E-6,39:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,36:1.83062790600875E-6):0.0017629242273620885,(34:1.83062790600875E-6,35:1.83062790600875E-6):0.0010993104156149282):5.749183767225743E-4):1.83062790600875E-6):0.004683536430148939,(((((42:1.83062790600875E-6,(47:1.83062790600875E-6,44:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,(((49:1.83062790600875E-6,48:1.83062790600875E-6):1.83062790600875E-6,43:1.83062790600875E-6):1.83062790600875E-6,45:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,(46:1.83062790600875E-6,41:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,40:1.83062790600875E-6):1.83062790600875E-6,((((53:1.83062790600875E-6,54:0.0011441776933557362):1.83062790600875E-6,55:1.83062790600875E-6):1.83062790600875E-6,52:5.716129672407505E-4):1.83062790600875E-6,((51:1.83062790600875E-6,50:1.83062790600875E-6):5.716617441719499E-4,((58:1.83062790600875E-6,(((64:1.83062790600875E-6,61:1.83062790600875E-6):1.83062790600875E-6,(((59:1.83062790600875E-6,57:1.83062790600875E-6):1.83062790600875E-6,63:1.83062790600875E-6):1.83062790600875E-6,60:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,62:1.83062790600875E-6):1.83062790600875E-6):1.83062790600875E-6,56:1.83062790600875E-6):1.83062790600875E-6):5.716134431788286E-4):5.716476366691596E-4):0.004670719907942277):0.016109941792257054,((((24:1.83062790600875E-6,(25:1.83062790600875E-6,26:1.83062790600875E-6):1.83062790600875E-6):0.0032469209162409936,((((31:1.83062790600875E-6,29:1.83062790600875E-6):1.83062790600875E-6,27:1.83062790600875E-6):1.83062790600875E-6,28:5.671234590246576E-4):1.83062790600875E-6,30:1.83062790600875E-6):0.003067523204252571):0.026009757696635258,23:0.032199456659592895):0.003934888957061077,22:0.02695108430444323):0.0066645025855620295):0.006135553262684358):0.0014969199114598806):0.007052953865295645):0.14831644585879,1:0.14831644585879); END; BEGIN TREES; TITLE Stemphylium_ITS_BI; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_alternata_GV14.634a1, 2 'Stemphylium amaranthi CBS_124650', 3 'Stemphylium amaranthi CBS_124651', 4 'Stemphylium amaranthi CBS_124746', 5 'Stemphylium amaranthi CBS_124750', 6 'Stemphylium amaranthi CBS_124753', 7 'Stemphylium amaranthi CBS_124984', 8 'Stemphylium amaranthi CBS_124985', 9 'Stemphylium amaranthi CBS_133539', 10 'Stemphylium amaranthi CBS_134164', 11 'Stemphylium amaranthi CBS_134500', 12 'Stemphylium amaranthi CBS_136589', 13 'Stemphylium amaranthi CBS_138299', 14 'Stemphylium amaranthi CBS_138519', 15 'Stemphylium armeriae CBS_338.73', 16 'Stemphylium astragali CBS_116583', 17 'Stemphylium beticola CBS_116599', 18 'Stemphylium beticola CBS_133512', 19 'Stemphylium beticola CBS_133892', 20 'Stemphylium beticola CBS_136590', 21 'Stemphylium beticola CBS_136699', 22 'Stemphylium beticola CBS_137492', 23 'Stemphylium beticola CBS_141024', 24 'Stemphylium beticola CBS_141025', 25 'Stemphylium beticola CBS_141026', 26 'Stemphylium beticola CBS_378.54', 27 Stemphylium_beticola_GV11.196.a1.3, 28 Stemphylium_beticola_GV12.275a1, 29 Stemphylium_beticola_GV12.276a1, 30 Stemphylium_beticola_GV12.287a1, 31 Stemphylium_beticola_GV12.336a1, 32 Stemphylium_beticola_GV12.356a1, 33 Stemphylium_beticola_GV12.367a1, 34 Stemphylium_beticola_GV12.368a1, 35 Stemphylium_beticola_GV12.403a1, 36 Stemphylium_beticola_GV13.425a1, 37 Stemphylium_beticola_GV13.436c2, 38 Stemphylium_beticola_GV14.693a1, 39 Stemphylium_beticola_IFZ22013.024, 40 Stemphylium_beticola_IFZ22013.035, 41 Stemphylium_beticola_IFZ22014.020, 42 'Stemphylium botryosum CBS_116596', 43 'Stemphylium botryosum CBS_133292', 44 'Stemphylium botryosum CBS_133293', 45 'Stemphylium botryosum CBS_133738', 46 'Stemphylium botryosum CBS_134149', 47 'Stemphylium botryosum CBS_136587', 48 'Stemphylium botryosum CBS_136805', 49 'Stemphylium botryosum CBS_136822', 50 'Stemphylium botryosum CBS_136933', 51 'Stemphylium botryosum CBS_137037', 52 'Stemphylium botryosum CBS_138762', 53 'Stemphylium botryosum CBS_714.68', 54 'Stemphylium callistephi CBS_527.50', 55 'Stemphylium canadense CBS_116602', 56 'Stemphylium canadense CBS_118081', 57 'Stemphylium chrysanthemicola CBS_117255', 58 'Stemphylium drummondii CBS_133521', 59 'Stemphylium drummondii CBS_136821', 60 'Stemphylium drummondii CBS_137084', 61 'Stemphylium drummondii CBS_346.83', 62 'Stemphylium eturmiunum CBS_109845', 63 'Stemphylium eturmiunum CBS_122124', 64 'Stemphylium eturmiunum CBS_122641', 65 'Stemphylium eturmiunum CBS_124652', 66 'Stemphylium eturmiunum CBS_133461', 67 'Stemphylium eturmiunum CBS_133526', 68 'Stemphylium eturmiunum CBS_133528', 69 'Stemphylium eturmiunum CBS_133543', 70 'Stemphylium eturmiunum CBS_134165', 71 'Stemphylium eturmiunum CBS_134473', 72 'Stemphylium eturmiunum CBS_136569', 73 'Stemphylium eturmiunum CBS_136572', 74 'Stemphylium eturmiunum CBS_136593', 75 'Stemphylium eturmiunum CBS_136594', 76 'Stemphylium eturmiunum CBS_136614', 77 'Stemphylium eturmiunum CBS_136616', 78 'Stemphylium eturmiunum CBS_136798', 79 'Stemphylium eturmiunum CBS_136806', 80 'Stemphylium eturmiunum CBS_136809', 81 'Stemphylium eturmiunum CBS_136811', 82 'Stemphylium eturmiunum CBS_136815', 83 'Stemphylium eturmiunum CBS_136942', 84 'Stemphylium eturmiunum CBS_137493', 85 'Stemphylium eturmiunum CBS_138495', 86 'Stemphylium eturmiunum CBS_668.80', 87 'Stemphylium gracilariae CBS_115179', 88 'Stemphylium gracilariae CBS_115180', 89 'Stemphylium gracilariae CBS_125060', 90 'Stemphylium gracilariae CBS_273.55', 91 'Stemphylium gracilariae CBS_308.36', 92 'Stemphylium gracilariae CBS_482.90', 93 'Stemphylium halophilum CBS_337.73', 94 'Stemphylium halophilum CBS_410.73', 95 'Stemphylium ixeridis CBS_124748', 96 'Stemphylium ixeridis CBS_138522', 97 'Stemphylium lancipes CBS_101217', 98 'Stemphylium lancipes CBS_116584', 99 'Stemphylium lancipes CBS_133314', 100 'Stemphylium loti CBS_136565', 101 'Stemphylium loti CBS_136574', 102 'Stemphylium loti CBS_136575', 103 'Stemphylium loti CBS_136581', 104 'Stemphylium loti CBS_136584', 105 'Stemphylium loti CBS_136585', 106 'Stemphylium loti CBS_407.54', 107 'Stemphylium lucomagnoense CBS_116601', 108 'Stemphylium lycii CBS_115192', 109 'Stemphylium lycii CBS_116582', 110 'Stemphylium lycii CBS_124982', 111 'Stemphylium lycii CBS_125240', 112 'Stemphylium lycii CBS_125241', 113 'Stemphylium lycii CBS_136592', 114 'Stemphylium lycii CBS_136941', 115 'Stemphylium lycii CBS_137135', 116 'Stemphylium lycopersici CBS_116585', 117 'Stemphylium lycopersici CBS_116587', 118 'Stemphylium lycopersici CBS_120325', 119 'Stemphylium lycopersici CBS_120326', 120 'Stemphylium lycopersici CBS_122639', 121 'Stemphylium lycopersici CBS_122803', 122 'Stemphylium lycopersici CBS_123008', 123 'Stemphylium lycopersici CBS_124980', 124 'Stemphylium lycopersici CBS_124981', 125 'Stemphylium lycopersici CBS_124983', 126 'Stemphylium lycopersici CBS_133468', 127 'Stemphylium lycopersici CBS_133728', 128 'Stemphylium lycopersici CBS_133919', 129 'Stemphylium lycopersici CBS_134314', 130 'Stemphylium lycopersici CBS_135159', 131 'Stemphylium lycopersici CBS_135168', 132 'Stemphylium lycopersici CBS_135169', 133 'Stemphylium lycopersici CBS_135172', 134 'Stemphylium lycopersici CBS_135178', 135 'Stemphylium lycopersici CBS_135179', 136 'Stemphylium lycopersici CBS_135180', 137 'Stemphylium lycopersici CBS_135181', 138 'Stemphylium lycopersici CBS_135184', 139 'Stemphylium lycopersici CBS_135185', 140 'Stemphylium lycopersici CBS_135193', 141 'Stemphylium lycopersici CBS_135194', 142 'Stemphylium lycopersici CBS_135195', 143 'Stemphylium lycopersici CBS_135778', 144 'Stemphylium lycopersici CBS_136342', 145 'Stemphylium lycopersici CBS_136577', 146 'Stemphylium lycopersici CBS_136818', 147 'Stemphylium lycopersici CBS_138073', 148 'Stemphylium lycopersici CBS_138083', 149 'Stemphylium lycopersici CBS_138320', 150 'Stemphylium lycopersici CBS_138493', 151 'Stemphylium lycopersici CBS_138494', 152 'Stemphylium lycopersici CBS_138504', 153 'Stemphylium lycopersici CBS_138505', 154 'Stemphylium lycopersici CBS_321.87', 155 'Stemphylium lycopersici CBS_333.73', 156 'Stemphylium lycopersici CBS_436.76', 157 'Stemphylium lycopersici CBS_463.78', 158 'Stemphylium majusculum CBS_133424', 159 'Stemphylium majusculum CBS_717.68', 160 'Stemphylium novae-zelandiae CBS_138157', 161 'Stemphylium novae-zelandiae CBS_138295', 162 'Stemphylium paludiscirpi CBS_109842', 163 'Stemphylium sarciniforme CBS_110049', 164 'Stemphylium sarciniforme CBS_116579', 165 'Stemphylium sarciniforme CBS_116581', 166 'Stemphylium sarciniforme CBS_133513', 167 'Stemphylium sarciniforme CBS_133523', 168 'Stemphylium sarciniforme CBS_133525', 169 'Stemphylium sarciniforme CBS_133723', 170 'Stemphylium sarciniforme CBS_136566', 171 'Stemphylium sarciniforme CBS_136803', 172 'Stemphylium sarciniforme CBS_136810', 173 'Stemphylium sarciniforme CBS_136823', 174 'Stemphylium sarciniforme CBS_138345', 175 'Stemphylium sarciniforme CBS_335.33', 176 'Stemphylium sarciniforme CBS_364.49', 177 'Stemphylium simmonsii CBS_116598', 178 'Stemphylium simmonsii CBS_116603', 179 'Stemphylium simmonsii CBS_116604', 180 'Stemphylium simmonsii CBS_133515', 181 'Stemphylium simmonsii CBS_133518', 182 'Stemphylium simmonsii CBS_133894', 183 'Stemphylium simmonsii CBS_134496', 184 'Stemphylium simmonsii CBS_716.68', 185 'Stemphylium solani CBS_116586', 186 'Stemphylium solani CBS_118082', 187 'Stemphylium solani CBS_134293', 188 'Stemphylium solani CBS_408.54', 189 Stemphylium_sp._Fig._1_Clade_1_CBS_133406, 190 Stemphylium_sp._Fig._1_Clade_1_CBS_133463, 191 Stemphylium_sp._Fig._1_Clade_1_CBS_133472, 192 Stemphylium_sp._Fig._1_Clade_1_CBS_133479, 193 Stemphylium_sp._Fig._1_Clade_1_CBS_133835, 194 Stemphylium_sp._Fig._1_Clade_1_CBS_136570, 195 Stemphylium_sp._Fig._1_Clade_1_CBS_136726, 196 Stemphylium_sp._Fig._1_Clade_1_CBS_136796, 197 Stemphylium_sp._Fig._1_Clade_1_CBS_136799, 198 Stemphylium_sp._Fig._1_Clade_1_CBS_136808, 199 Stemphylium_sp._Fig._1_Clade_1_CBS_136943, 200 Stemphylium_sp._Fig._1_Clade_1_CBS_137045, 201 Stemphylium_sp._Fig._1_Clade_1_CBS_137081, 202 Stemphylium_sp._Fig._1_Clade_1_CBS_137085, 203 Stemphylium_sp._Fig._1_Clade_1_CBS_137479, 204 Stemphylium_sp._Fig._1_Clade_1_CBS_137480, 205 Stemphylium_sp._Fig._1_Clade_1_CBS_138502, 206 Stemphylium_sp._Fig._1_Clade_1_CBS_138503, 207 Stemphylium_sp._Fig._1_Clade_7_CBS_133532, 208 Stemphylium_sp._Fig._1_Clade_7_CBS_134178, 209 Stemphylium_sp._Fig._1_Clade_7_CBS_134949, 210 Stemphylium_sp._Fig._1_Clade_7_CBS_136340, 211 Stemphylium_sp._Fig._1_Clade_7_CBS_136351, 212 Stemphylium_sp._Fig._1_Clade_7_CBS_136939, 213 Stemphylium_sp._Fig._1_Clade_7_CBS_137055, 214 Stemphylium_sp._Fig._1_Clade_7_CBS_137418, 215 Stemphylium_sp._Fig._1_Clade_7_CBS_137419, 216 'Stemphylium symphyti CBS_115268', 217 'Stemphylium symphyti CBS_118796', 218 'Stemphylium symphyti CBS_133300', 219 'Stemphylium symphyti CBS_133301', 220 'Stemphylium symphyti CBS_133302', 221 'Stemphylium symphyti CBS_136568', 222 'Stemphylium symphyti CBS_138069', 223 'Stemphylium symphyti CBS_138070', 224 'Stemphylium symphyti CBS_138075', 225 'Stemphylium symphyti CBS_138891', 226 'Stemphylium trifolii CBS_116580', 227 'Stemphylium trifolii CBS_133466', 228 'Stemphylium trifolii CBS_136700', 229 'Stemphylium trifolii CBS_136723', 230 'Stemphylium trifolii CBS_136724', 231 'Stemphylium trifolii CBS_136725', 232 'Stemphylium triglochinicola CBS_133731', 233 'Stemphylium triglochinicola CBS_133732', 234 'Stemphylium triglochinicola CBS_133739', 235 'Stemphylium triglochinicola CBS_133740', 236 'Stemphylium triglochinicola CBS_133744', 237 'Stemphylium triglochinicola CBS_133747', 238 'Stemphylium triglochinicola CBS_133748', 239 'Stemphylium triglochinicola CBS_718.68', 240 'Stemphylium vesicarium CBS_109843', 241 'Stemphylium vesicarium CBS_109844', 242 'Stemphylium vesicarium CBS_115182', 243 'Stemphylium vesicarium CBS_115204', 244 'Stemphylium vesicarium CBS_122640', 245 'Stemphylium vesicarium CBS_123005', 246 'Stemphylium vesicarium CBS_123803', 247 'Stemphylium vesicarium CBS_124279', 248 'Stemphylium vesicarium CBS_124747', 249 'Stemphylium vesicarium CBS_124749', 250 'Stemphylium vesicarium CBS_124751', 251 'Stemphylium vesicarium CBS_124752', 252 'Stemphylium vesicarium CBS_125242', 253 'Stemphylium vesicarium CBS_133459', 254 'Stemphylium vesicarium CBS_133467', 255 'Stemphylium vesicarium CBS_133473', 256 'Stemphylium vesicarium CBS_133474', 257 'Stemphylium vesicarium CBS_133475', 258 'Stemphylium vesicarium CBS_133477', 259 'Stemphylium vesicarium CBS_133478', 260 'Stemphylium vesicarium CBS_133481', 261 'Stemphylium vesicarium CBS_133519', 262 'Stemphylium vesicarium CBS_133533', 263 'Stemphylium vesicarium CBS_133540', 264 'Stemphylium vesicarium CBS_133541', 265 'Stemphylium vesicarium CBS_133652', 266 'Stemphylium vesicarium CBS_133659', 267 'Stemphylium vesicarium CBS_133663', 268 'Stemphylium vesicarium CBS_133668', 269 'Stemphylium vesicarium CBS_133672', 270 'Stemphylium vesicarium CBS_133673', 271 'Stemphylium vesicarium CBS_133676', 272 'Stemphylium vesicarium CBS_133677', 273 'Stemphylium vesicarium CBS_133737', 274 'Stemphylium vesicarium CBS_133742', 275 'Stemphylium vesicarium CBS_133821', 276 'Stemphylium vesicarium CBS_133825', 277 'Stemphylium vesicarium CBS_133834', 278 'Stemphylium vesicarium CBS_133893', 279 'Stemphylium vesicarium CBS_133905', 280 'Stemphylium vesicarium CBS_133914', 281 'Stemphylium vesicarium CBS_134156', 282 'Stemphylium vesicarium CBS_134977', 283 'Stemphylium vesicarium CBS_136306', 284 'Stemphylium vesicarium CBS_136353', 285 'Stemphylium vesicarium CBS_136567', 286 'Stemphylium vesicarium CBS_136571', 287 'Stemphylium vesicarium CBS_136586', 288 'Stemphylium vesicarium CBS_136588', 289 'Stemphylium vesicarium CBS_136591', 290 'Stemphylium vesicarium CBS_136610', 291 'Stemphylium vesicarium CBS_136615', 292 'Stemphylium vesicarium CBS_136732', 293 'Stemphylium vesicarium CBS_136733', 294 'Stemphylium vesicarium CBS_136736', 295 'Stemphylium vesicarium CBS_136741', 296 'Stemphylium vesicarium CBS_136742', 297 'Stemphylium vesicarium CBS_136743', 298 'Stemphylium vesicarium CBS_136744', 299 'Stemphylium vesicarium CBS_136745', 300 'Stemphylium vesicarium CBS_136759', 301 'Stemphylium vesicarium CBS_136760', 302 'Stemphylium vesicarium CBS_136797', 303 'Stemphylium vesicarium CBS_136800', 304 'Stemphylium vesicarium CBS_136802', 305 'Stemphylium vesicarium CBS_136804', 306 'Stemphylium vesicarium CBS_136807', 307 'Stemphylium vesicarium CBS_136812', 308 'Stemphylium vesicarium CBS_136813', 309 'Stemphylium vesicarium CBS_136814', 310 'Stemphylium vesicarium CBS_136816', 311 'Stemphylium vesicarium CBS_136817', 312 'Stemphylium vesicarium CBS_136824', 313 'Stemphylium vesicarium CBS_136825', 314 'Stemphylium vesicarium CBS_136934', 315 'Stemphylium vesicarium CBS_136935', 316 'Stemphylium vesicarium CBS_136950', 317 'Stemphylium vesicarium CBS_136951', 318 'Stemphylium vesicarium CBS_136953', 319 'Stemphylium vesicarium CBS_136955', 320 'Stemphylium vesicarium CBS_136957', 321 'Stemphylium vesicarium CBS_136958', 322 'Stemphylium vesicarium CBS_136960', 323 'Stemphylium vesicarium CBS_137082', 324 'Stemphylium vesicarium CBS_137139', 325 'Stemphylium vesicarium CBS_137146', 326 'Stemphylium vesicarium CBS_137155', 327 'Stemphylium vesicarium CBS_137490', 328 'Stemphylium vesicarium CBS_137491', 329 'Stemphylium vesicarium CBS_137922', 330 'Stemphylium vesicarium CBS_138087', 331 'Stemphylium vesicarium CBS_138088', 332 'Stemphylium vesicarium CBS_138089', 333 'Stemphylium vesicarium CBS_138090', 334 'Stemphylium vesicarium CBS_138138', 335 'Stemphylium vesicarium CBS_138333', 336 'Stemphylium vesicarium CBS_138421', 337 'Stemphylium vesicarium CBS_138484', 338 'Stemphylium vesicarium CBS_138520', 339 'Stemphylium vesicarium CBS_138765', 340 'Stemphylium vesicarium CBS_155.24', 341 'Stemphylium vesicarium CBS_156.45', 342 'Stemphylium vesicarium CBS_157.24', 343 'Stemphylium vesicarium CBS_184.25', 344 'Stemphylium vesicarium CBS_191.86', 345 'Stemphylium vesicarium CBS_192.86', 346 'Stemphylium vesicarium CBS_205.82', 347 'Stemphylium vesicarium CBS_273.31', 348 'Stemphylium vesicarium CBS_274.31', 349 'Stemphylium vesicarium CBS_307.36', 350 'Stemphylium vesicarium CBS_311.92', 351 'Stemphylium vesicarium CBS_322.49', 352 'Stemphylium vesicarium CBS_368.59', 353 'Stemphylium vesicarium CBS_370.51', 354 'Stemphylium vesicarium CBS_406.76', 355 'Stemphylium vesicarium CBS_486.92', 356 'Stemphylium vesicarium CBS_715.68', 357 Stemphylium_vesicarium_GV11.355.a1.2; TREE Fig._1_BI = [&R] (1:0.01481252,240:2.215784E-4,241:2.22041E-4,242:2.198057E-4,244:2.215717E-4,245:2.303552E-4,246:2.435184E-4,247:2.21348E-4,248:2.117254E-4,249:2.211136E-4,250:2.169848E-4,251:2.05365E-4,252:2.115601E-4,253:2.290477E-4,254:2.070626E-4,255:2.274619E-4,256:2.070287E-4,257:2.143431E-4,258:2.261448E-4,259:2.107422E-4,260:2.241055E-4,261:2.228821E-4,262:2.044651E-4,263:2.061879E-4,264:2.168134E-4,265:2.227621E-4,266:2.062223E-4,267:2.103194E-4,268:2.118484E-4,269:2.151823E-4,272:2.248683E-4,273:2.274088E-4,274:2.215993E-4,275:2.119838E-4,276:2.149551E-4,277:2.151448E-4,278:1.962334E-4,279:2.115693E-4,280:1.954359E-4,281:1.998935E-4,282:2.033556E-4,283:2.292898E-4,284:2.314236E-4,285:2.226456E-4,286:2.108804E-4,287:2.37988E-4,288:2.130178E-4,289:2.046963E-4,290:2.094173E-4,291:2.20223E-4,292:2.195621E-4,294:2.032091E-4,295:2.127905E-4,296:2.290893E-4,297:2.132479E-4,298:2.075404E-4,299:2.03634E-4,300:2.213867E-4,301:2.086214E-4,302:2.132706E-4,303:2.089242E-4,304:2.224076E-4,305:2.271498E-4,307:2.16938E-4,308:2.035724E-4,309:2.088824E-4,310:2.188446E-4,311:2.128635E-4,312:2.126949E-4,313:2.193471E-4,314:2.305296E-4,315:2.130992E-4,316:2.154562E-4,317:2.285573E-4,318:2.29966E-4,319:2.227414E-4,320:2.057162E-4,321:2.038035E-4,322:2.142272E-4,323:2.13566E-4,324:2.18727E-4,325:2.300185E-4,326:2.142911E-4,327:2.089538E-4,328:2.140453E-4,329:2.061046E-4,330:2.230755E-4,331:2.026469E-4,332:2.238581E-4,333:2.106239E-4,334:2.177963E-4,335:2.178844E-4,336:2.084699E-4,337:2.155483E-4,338:2.108613E-4,339:2.24099E-4,340:2.204854E-4,341:1.966778E-4,342:1.979239E-4,343:2.11541E-4,344:2.173993E-4,345:2.142385E-4,346:1.922766E-4,347:2.249217E-4,348:2.21816E-4,349:2.365941E-4,350:2.150236E-4,351:2.03252E-4,352:2.114756E-4,353:2.175618E-4,354:2.225845E-4,355:2.249211E-4,356:2.102841E-4,357:2.256946E-4,243:2.075477E-4,270:1.930816E-4,271:2.166641E-4,293:2.28152E-4,306:2.005649E-4,((((97:2.118468E-4,98:2.157257E-4,99:2.101375E-4,212:2.251668E-4,213:2.163816E-4,((216:2.126055E-4,217:2.402264E-4,218:2.031051E-4,219:2.35261E-4,220:2.190347E-4,221:2.280563E-4,224:2.192699E-4,225:2.121641E-4):5.275845E-4,222:2.191048E-4,223:2.237001E-4):5.223421E-4,185:2.103952E-4,186:2.251029E-4,207:2.088103E-4,208:2.142966E-4,187:2.206845E-4,209:2.200078E-4,210:2.296925E-4,211:2.20704E-4,214:2.27698E-4,215:2.056492E-4,188:2.165297E-4,54:8.617683E-4):5.90514E-4,(116:2.192819E-4,117:2.126255E-4,118:2.144481E-4,119:2.131142E-4,120:2.316536E-4,121:2.111044E-4,122:2.139211E-4,123:2.243654E-4,124:2.256205E-4,127:2.187259E-4,128:2.182389E-4,129:2.122692E-4,134:2.267596E-4,135:2.35599E-4,137:2.151192E-4,138:2.000054E-4,139:2.116865E-4,141:2.15034E-4,142:2.18853E-4,143:2.168955E-4,144:2.174476E-4,145:2.182669E-4,146:2.232823E-4,147:2.268037E-4,148:2.112864E-4,149:1.929219E-4,151:2.179392E-4,152:2.174024E-4,153:2.099421E-4,154:2.337341E-4,156:2.078557E-4,125:2.388039E-4,126:2.134101E-4,131:2.19756E-4,132:2.036973E-4,133:2.239744E-4,136:2.340247E-4,140:2.10093E-4,150:2.083396E-4,130:5.169171E-4,155:2.145353E-4,157:5.313235E-4):0.001482474):5.313304E-4,62:2.175252E-4,63:2.209203E-4,64:2.14125E-4,65:2.059009E-4,66:2.293577E-4,67:2.097864E-4,69:2.106399E-4,70:2.200404E-4,71:1.990008E-4,72:2.036931E-4,73:2.082972E-4,74:2.074974E-4,75:2.261836E-4,76:2.230705E-4,77:2.111939E-4,78:2.184483E-4,79:2.077494E-4,80:2.013994E-4,81:2.189089E-4,82:2.224843E-4,83:2.290861E-4,84:2.405192E-4,86:2.127079E-4,(68:2.294075E-4,85:2.141572E-4,(42:2.269849E-4,43:2.059519E-4,44:2.318109E-4,45:2.077107E-4,46:2.425785E-4,47:2.332398E-4,48:2.235043E-4,49:2.291589E-4,50:2.129504E-4,51:2.121342E-4,52:2.122027E-4,53:2.169856E-4):8.600243E-4):5.184491E-4,(((58:2.211737E-4,59:2.12943E-4,60:2.222172E-4,61:2.295967E-4):8.562367E-4,(226:2.094413E-4,227:1.968314E-4,228:2.058286E-4,229:2.209739E-4,230:2.019727E-4,231:2.21341E-4,(177:2.188481E-4,178:1.94548E-4,179:2.230331E-4,180:2.199556E-4,181:2.060677E-4,182:2.08842E-4,183:2.07866E-4,184:2.191341E-4,(57:9.322069E-4,((163:2.075526E-4,166:2.12229E-4,168:2.074157E-4,165:2.16423E-4,167:2.263099E-4,172:2.053321E-4,164:2.340406E-4,170:2.037398E-4,173:2.093581E-4,174:2.230702E-4,175:2.263172E-4,176:2.140925E-4,169:5.23635E-4,171:2.164373E-4):0.00183673,(100:2.11997E-4,101:2.216741E-4,102:2.187246E-4,103:2.147607E-4,104:2.192765E-4,105:2.24502E-4,106:2.157047E-4):0.004255848):0.001269282):5.886534E-4,17:2.133274E-4,18:2.076315E-4,19:2.29865E-4,20:1.996465E-4,21:2.272181E-4,22:2.232088E-4,26:2.296735E-4,27:2.201985E-4,36:2.101589E-4,32:2.036025E-4,23:2.268096E-4,31:2.192684E-4,37:2.155244E-4,34:2.28594E-4,38:2.038389E-4,35:2.290008E-4,24:2.078477E-4,30:2.193604E-4,33:2.199054E-4,29:2.125833E-4,28:2.227623E-4,39:2.156702E-4,40:1.989592E-4,41:2.084816E-4,25:2.070082E-4):9.926959E-4,(95:2.21724E-4,96:2.164597E-4):0.002341553):5.531119E-4):6.720236E-4,((162:2.08023E-4,(108:2.134554E-4,109:2.242188E-4,110:2.27918E-4,111:2.322956E-4,112:2.077894E-4,113:2.104452E-4,114:2.333058E-4,115:2.256563E-4,(93:2.111334E-4,94:1.997667E-4):0.00110185,(160:2.032572E-4,161:2.170166E-4):0.003287805):6.170312E-4,(2:2.111173E-4,3:2.168096E-4,4:2.023658E-4,5:2.093642E-4,6:2.168999E-4,7:2.089916E-4,8:2.108773E-4,9:2.321734E-4,10:2.090603E-4,11:1.952191E-4,13:2.178581E-4,14:2.262289E-4,12:5.574115E-4,55:5.390497E-4,56:2.027208E-4):4.960856E-4):5.171859E-4,(232:2.007031E-4,233:2.126183E-4,234:2.206529E-4,235:2.08061E-4,236:2.220731E-4,237:2.146358E-4,238:2.023115E-4,239:2.343103E-4):8.761838E-4):5.590009E-4):5.328375E-4):5.127179E-4,199:2.132116E-4,201:2.199303E-4,158:2.082382E-4,197:2.209435E-4,159:2.189929E-4,107:2.166318E-4,193:2.15322E-4,87:2.113979E-4,88:2.212797E-4,16:2.333293E-4,189:2.137592E-4,190:2.197077E-4,191:2.260933E-4,192:2.307998E-4,194:2.057131E-4,195:2.126212E-4,196:2.101749E-4,198:2.261828E-4,200:2.124392E-4,203:2.186956E-4,204:2.087244E-4,205:2.020593E-4,206:1.987689E-4,90:2.163684E-4,91:2.103018E-4,92:2.154838E-4,89:5.382433E-4,202:2.172869E-4,15:8.098574E-4):5.354064E-4); END; BEGIN TREES; TITLE Stemphylium_ITS_GAPDH_CALD_BI; LINK TAXA = Taxa1; TRANSLATE 1 Alternaria_alternata_GV14.634a1, 2 'Stemphylium canadense CBS_116602', 3 'Stemphylium canadense CBS_118081', 4 'Stemphylium paludiscirpi CBS_109842', 5 'Stemphylium triglochinicola CBS_718.68', 6 'Stemphylium halophilum CBS_337.73', 7 'Stemphylium halophilum CBS_410.73', 8 'Stemphylium lycii CBS_115192', 9 'Stemphylium lycii CBS_116582', 10 'Stemphylium lycii CBS_124982', 11 'Stemphylium lycii CBS_125240', 12 'Stemphylium lycii CBS_125241', 13 'Stemphylium amaranthi CBS_124650', 14 'Stemphylium amaranthi CBS_124651', 15 'Stemphylium amaranthi CBS_124984', 16 'Stemphylium amaranthi CBS_124985', 17 'Stemphylium amaranthi CBS_136589', 18 'Stemphylium amaranthi CBS_124746', 19 'Stemphylium amaranthi CBS_124750', 20 'Stemphylium amaranthi CBS_124753', 21 'Stemphylium trifolii CBS_116580', 22 'Stemphylium chrysanthemicola CBS_117255', 23 'Stemphylium loti CBS_407.54', 24 'Stemphylium sarciniforme CBS_110049', 25 'Stemphylium sarciniforme CBS_116581', 26 'Stemphylium sarciniforme CBS_136810', 27 'Stemphylium sarciniforme CBS_116579', 28 'Stemphylium sarciniforme CBS_133723', 29 'Stemphylium sarciniforme CBS_138345', 30 'Stemphylium sarciniforme CBS_335.33', 31 'Stemphylium sarciniforme CBS_364.49', 32 'Stemphylium simmonsii CBS_116598', 33 'Stemphylium simmonsii CBS_133894', 34 'Stemphylium simmonsii CBS_116603', 35 'Stemphylium simmonsii CBS_116604', 36 'Stemphylium simmonsii CBS_133515', 37 'Stemphylium simmonsii CBS_133518', 38 'Stemphylium simmonsii CBS_134496', 39 'Stemphylium simmonsii CBS_716.68', 40 'Stemphylium beticola CBS_136590', 41 'Stemphylium beticola CBS_141024', 42 'Stemphylium beticola CBS_141026', 43 Stemphylium_beticola_GV12.287a1, 44 Stemphylium_beticola_GV12.336a1, 45 Stemphylium_beticola_GV12.356a1, 46 Stemphylium_beticola_GV12.368a1, 47 Stemphylium_beticola_GV12.403a1, 48 Stemphylium_beticola_IFZ2013.035, 49 Stemphylium_beticola_IFZ2014.020, 50 'Stemphylium beticola CBS_141025', 51 Stemphylium_beticola_IFZ2013.024, 52 'Stemphylium beticola CBS_133892', 53 'Stemphylium beticola CBS_137492', 54 'Stemphylium beticola CBS_378.54', 55 Stemphylium_beticola_GV13.425a1, 56 'Stemphylium beticola CBS_116599', 57 'Stemphylium beticola CBS_133512', 58 'Stemphylium beticola CBS_136699', 59 Stemphylium_beticola_GV11.196a1.3, 60 Stemphylium_beticola_GV12.275a1, 61 Stemphylium_beticola_GV12.276a1, 62 Stemphylium_beticola_GV12.367a1, 63 Stemphylium_beticola_GV13.436c2, 64 Stemphylium_beticola_GV14.693a1, 65 'Stemphylium drummondii CBS_346.83', 66 'Stemphylium novae-zelandiae CBS_138157', 67 'Stemphylium novae-zelandiae CBS_138295', 68 'Stemphylium lancipes CBS_133314', 69 'Stemphylium lancipes CBS_101217', 70 'Stemphylium lancipes CBS_116584', 71 'Stemphylium callistephi CBS_527.50', 72 'Stemphylium solani CBS_116586', 73 'Stemphylium solani CBS_118082', 74 'Stemphylium solani CBS_408.54', 75 'Stemphylium ixeridis CBS_124748', 76 'Stemphylium symphyti CBS_115268', 77 'Stemphylium symphyti CBS_118796', 78 'Stemphylium symphyti CBS_138069', 79 'Stemphylium symphyti CBS_138070', 80 'Stemphylium lycopersici CBS_124983', 81 'Stemphylium lycopersici CBS_135778', 82 'Stemphylium lycopersici CBS_333.73', 83 'Stemphylium lycopersici CBS_120325', 84 'Stemphylium lycopersici CBS_120326', 85 'Stemphylium lycopersici CBS_123008', 86 'Stemphylium lycopersici CBS_116585', 87 'Stemphylium lycopersici CBS_124981', 88 'Stemphylium lycopersici CBS_463.78', 89 'Stemphylium lycopersici CBS_116587', 90 'Stemphylium lycopersici CBS_122803', 91 'Stemphylium lycopersici CBS_124980', 92 'Stemphylium lycopersici CBS_436.76', 93 'Stemphylium lycopersici CBS_122639', 94 'Stemphylium lycopersici CBS_321.87', 95 'Stemphylium botryosum CBS_116596', 96 'Stemphylium botryosum CBS_714.68', 97 'Stemphylium eturmium CBS_122124', 98 'Stemphylium eturmium CBS_133528', 99 'Stemphylium eturmium CBS_138495', 100 'Stemphylium eturmium CBS_109845', 101 'Stemphylium eturmium CBS_668.80', 102 'Stemphylium eturmium CBS_122641', 103 'Stemphylium eturmium CBS_124652', 104 'Stemphylium astragali CBS_116583', 105 'Stemphylium lucomagnoense CBS_116601', 106 'Stemphylium majusculum CBS_133424', 107 'Stemphylium majusculum CBS_717.68', 108 'Stemphylium gracilariae CBS_115179', 109 'Stemphylium gracilariae CBS_115180', 110 'Stemphylium gracilariae CBS_125060', 111 'Stemphylium gracilariae CBS_273.55', 112 'Stemphylium gracilariae CBS_308.36', 113 'Stemphylium gracilariae CBS_482.90', 114 'Stemphylium armeriae CBS_338.73', 115 'Stemphylium vesicarium CBS_124749', 116 'Stemphylium vesicarium CBS_133905', 117 'Stemphylium vesicarium CBS_322.49', 118 'Stemphylium vesicarium CBS_123005', 119 'Stemphylium vesicarium CBS_123803', 120 'Stemphylium vesicarium CBS_125242', 121 'Stemphylium vesicarium CBS_191.86', 122 'Stemphylium vesicarium CBS_109843', 123 'Stemphylium vesicarium CBS_109844', 124 'Stemphylium vesicarium CBS_115182', 125 'Stemphylium vesicarium CBS_115204', 126 'Stemphylium vesicarium CBS_122640', 127 'Stemphylium vesicarium CBS_124279', 128 'Stemphylium vesicarium CBS_124747', 129 'Stemphylium vesicarium CBS_124751', 130 'Stemphylium vesicarium CBS_124752', 131 'Stemphylium vesicarium CBS_133474', 132 'Stemphylium vesicarium CBS_133737', 133 'Stemphylium vesicarium CBS_133914', 134 'Stemphylium vesicarium CBS_138138', 135 'Stemphylium vesicarium CBS_155.24', 136 'Stemphylium vesicarium CBS_156.45', 137 'Stemphylium vesicarium CBS_157.24', 138 'Stemphylium vesicarium CBS_184.25', 139 'Stemphylium vesicarium CBS_192.86', 140 'Stemphylium vesicarium CBS_205.82', 141 'Stemphylium vesicarium CBS_273.31', 142 'Stemphylium vesicarium CBS_274.31', 143 'Stemphylium vesicarium CBS_307.36', 144 'Stemphylium vesicarium CBS_311.92', 145 'Stemphylium vesicarium CBS_368.59', 146 'Stemphylium vesicarium CBS_370.51', 147 'Stemphylium vesicarium CBS_406.76', 148 'Stemphylium vesicarium CBS_486.92', 149 'Stemphylium vesicarium CBS_715.68', 150 Stemphylium_vesicarium_GV11.355a1.2; TREE Fig._2_BI = [&R] (1:0.5603167663450391,((((2:0.001594294693392118,3:6.473104067005175E-4):0.0217550558885132,(4:0.02312037952938915,5:0.03569805014472916):0.007563501010517042):0.001891447815002726,(((6:6.85708772999705E-4,7:6.552534387374704E-4):0.010905402577006,(8:0.002492936186476949,9:0.004404617462085623,(10:6.621546249599473E-4,11:0.001538645376997348,12:6.774227626057348E-4):0.001618739335441387):0.002439523681322594):0.01018972459434144,(13:6.442964003584513E-4,14:6.879791057208953E-4,15:6.687030008394624E-4,16:6.272872868591518E-4,17:0.001621990781770751,(18:7.424777345100842E-4,(19:6.765240568311398E-4,20:6.602429236877012E-4):0.0015060580842554):0.001555722098970033):0.0130347903345159):0.006009451547237411):0.01401793007752687,(21:0.03314753112487831,((22:0.04591219041187155,(23:0.05617962448829792,((24:6.33836698326614E-4,25:6.486581085281393E-4,26:6.836114561389565E-4):0.006343359527341642,(27:6.486590882638985E-4,28:0.001618153468684165,29:6.512407939163888E-4,30:6.768938019099088E-4,31:6.4205776877307E-4):0.005433613350195283):0.04476650067603026):0.007000751858311834):0.01165358611278459,((32:0.002969919175880644,33:0.007498115637410573,((34:6.655654726545317E-4,35:6.322017574871145E-4):0.002153920357972893,(36:6.535151341225472E-4,37:6.360822931688265E-4,38:6.608097302507972E-4,39:6.34569444092041E-4):0.003876437368280609):0.001561421294678998):0.00842340625873743,(40:6.939716564006925E-4,41:6.793414656274696E-4,42:6.704502817760033E-4,43:6.857476444408662E-4,44:6.671574425385888E-4,45:6.245786227302035E-4,46:6.668868462311212E-4,47:6.457697109132796E-4,48:6.937740620877561E-4,49:6.264030749593842E-4,(50:7.267488408498893E-4,51:6.926381343590244E-4):0.00145527715017723,(52:0.001577025160746441,53:6.721659245455096E-4,54:0.002591845340838923,55:6.483403850540832E-4,(56:6.332277630257473E-4,57:6.330251675309165E-4,58:6.415821692119802E-4,59:6.872536353941236E-4,60:6.5042331226799E-4,61:6.420216421239143E-4,62:6.67302925014376E-4,63:7.115811300796609E-4,64:6.830900071411322E-4):0.001484352148625104):0.00156970454440806):0.008601097898018316):0.0282989924402385):0.01082208200771282):0.003419784495319285):0.01608279698467958,((65:0.03528130076268933,(66:6.748369650294969E-4,67:6.472941244589069E-4):0.05199432214013738):0.009092083721194064,((((68:8.463022722384457E-4,(69:9.693527747736805E-4,70:6.697307673196581E-4):0.003843728119063071):0.01903085491738058,(71:0.02325282965639936,(72:7.736388827922021E-4,(73:6.238392909548188E-4,74:6.238866928412568E-4):0.00152810051351182):0.01747295280305289):0.0325743840356377):0.009933634101468738,(75:0.04788868558885535,(((76:6.886918082608744E-4,77:6.924599952659005E-4):0.001819968949035904,(78:6.74964971420133E-4,79:7.394781994117539E-4):0.001709111610408861):0.02592314214343736,(80:0.002563191237805264,81:0.001658879885833313,82:0.001523665238978197,(83:6.5585665860449E-4,84:0.001579247644274336,85:6.536939882382217E-4,(86:0.001394022888875506,87:7.025852617134564E-4,88:0.001648933752128461,(89:6.685222504294461E-4,90:6.548538877669986E-4,91:6.587405144901534E-4,92:6.952405371229864E-4,(93:6.319731752789681E-4,94:6.80143287925322E-4):0.001511146679835756):0.001570534159998413):0.002360744478981572):0.001510741046943452):0.06006975776593289):0.004317067859363061):0.005768506001498625):0.007300555292102271,((95:6.435735012770753E-4,96:6.685959015896751E-4):0.01925405754390559,((97:0.001704316837173266,(98:6.895802415080589E-4,99:7.115761677913151E-4):0.001610571493937541,(100:6.792965797149908E-4,101:0.001614869138701816,(102:0.001551463431234584,103:0.001596394235281165):0.002550708929049996):0.002475628946816984):0.008446301245358976,(104:0.009436169905650948,(105:0.004379618428040177,(((106:9.075364996763384E-4,107:0.001268487431418772):0.008907402582640911,(108:6.491606555020971E-4,109:0.003513853109087225,110:0.002495821107318119,111:6.801686847455273E-4,112:6.34442499704062E-4,113:0.001645668855126788):0.01005950317657594):0.001513981527553307,(114:0.005576821942571374,(115:6.630153477636898E-4,116:6.48374563520914E-4,117:6.431081023257277E-4,(118:6.638865362296853E-4,119:6.699639717350255E-4,(120:6.743684905128182E-4,121:6.873536186947407E-4):0.001574572767033386,(122:6.953574119108107E-4,123:6.540835383864052E-4,124:6.570187039446024E-4,125:6.884442207199847E-4,126:6.794468796960203E-4,127:6.75623650254138E-4,128:6.497951078809354E-4,129:6.822768878862313E-4,130:6.585246799169089E-4,131:6.683808781826868E-4,132:6.899566928037022E-4,133:6.773360147281937E-4,134:6.454896496838768E-4,135:6.701065792899574E-4,136:6.727047922378706E-4,137:6.880459825552292E-4,138:6.421639263505959E-4,139:6.641535901329837E-4,140:6.843459263903101E-4,141:6.540433887434142E-4,142:6.480520741292327E-4,143:6.662768368253792E-4,144:6.764348323865073E-4,145:7.085202833203853E-4,146:6.761646691650164E-4,147:0.001609103852099131,148:6.573603326950362E-4,149:6.722913711537476E-4,150:6.190244128427699E-4):0.001651636704430157):0.001599054594485694):0.007649091251105836):0.00146583606694816):0.001647034871814092):0.002675046615407942):0.005588647557167052):0.003567349221799045):0.01033549414017361):0.01874847149027303):0.02720967539778651); END;