#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:03 GMT TreeBASE (cc) 1994-2008 Study reference: Uzuhashi S., & Tojo M. 2020. Globisporangium cryptosplendens sp. nov., a new species separated from G. splendens. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S26955] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Elongisporangium_anandrum_CBS28531 Elongisporangium_helicandrum_CBS39354 Globisporangium_heterothallicum_CBS45067 Globisporangium_splendens_CBS46248 Globisporangium_splendens_MAFF240030 Globisporangium_splendens_MAFF241982 Globisporangium_splendens_MAFF241983 Globisporangium_splendens_MAFF241986 Globisporangium_splendens_MAFF243778 Globisporangium_splendens_MAFF243781 Globisporangium_splendens_MAFF243782 Globisporangium_splendens_MAFF243783 Globisporangium_splendens_MAFF305867 Globisporangium_splendens_MAFF425469 Globisporangium_splendens_MAFF425508 Globisporangium_ultimum_CBS398.51 'Globisporangium ultimum sporangiiferum CBS_111.65' 'Globisporangium ultimum sporangiiferum CBS_122650' 'Globisporangium ultimum sporangiiferum CBS_219.65' 'Globisporangium ultimum sporangiiferum DAOM_240290' 'Globisporangium ultimum ultimum CBS_291.31' 'Globisporangium ultimum ultimum CBS_296.37' 'Globisporangium ultimum ultimum DAOM_BR144' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=26; TAXLABELS 'Elongisporangium anandrum CBS_285.31_AY598650' 'Elongisporangium helicandrum CBS_393.54_AY598653' 'Globisporangium heterothallicum CBS45067_HQ643553' 'Globisporangium heterothallicum CBS_451.67_AB507409' 'Globisporangium splendens CBS46248_HQ643795' 'Globisporangium splendens MAFF240030_AB796286' 'Globisporangium splendens MAFF241982_AB780602' 'Globisporangium splendens MAFF241983_AB780607' 'Globisporangium splendens MAFF241986_AB780573' 'Globisporangium splendens MAFF243778_AB780616' 'Globisporangium splendens MAFF243781_AB780619' 'Globisporangium splendens MAFF243782_AB780628' 'Globisporangium splendens MAFF243783_AB780644' 'Globisporangium splendens MAFF305867_AB796293' 'Globisporangium splendens MAFF425469_AB796297' 'Globisporangium splendens MAFF425508_AB796304' 'Globisporangium splendens PPRI8415_FJ415953' 'Globisporangium ultimum sporangiiferum CBS_111.65_KJ639275' 'Globisporangium ultimum sporangiiferum CBS_219.65_AY598656' 'Globisporangium ultimum sporangiiferum DAOM_240290_KJ639276' 'Globisporangium ultimum ultimum ATCC_58811_KJ639272' 'Globisporangium ultimum ultimum BR144_HQ643943' 'Globisporangium ultimum ultimum CBS39851_HQ643865' 'Globisporangium ultimum ultimum CBS_291.31_KJ639270' 'Globisporangium ultimum ultimum Lev2075_KJ639271' 'Pythium splendens CBS118747_DQ381808' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M59390] TITLE Globisporangium_ITS_0928; LINK TAXA = Taxa2; DIMENSIONS NCHAR=865; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Elongisporangium anandrum CBS_285.31_AY598650' CCACACCAAAAAA--CTTTCCACGTGAACTGT--------CTTAGCAT--------GTTTTG-TGCCTTT-------------------------TATTAGGCTAAACGAAGGTCGG-----AGTAA-------------AATCTGGCTGATCTATC----TTTTTAAACCCA----TTACTTTATTACTGATTTATACTGTGAGGACGAAAGTCTTTGCTTTTAACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACAATAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGTGAGAGAGA-TG-GCCGATGTGAAGTGTCTCG-ATCTGTGCATATTTA----TTT--ATGACACATTGATCGAGTCCTTTTAAATGTACACTGTTTTTTCTCTTGTTTCTATGAGGTAC--TGCTCGAACGG-AGTGATCTTTGGATTGCTTGCATGTTTGGTGGCAACTTCGGTTTAGACGCTAGGAGAAAATGCTCGATTCGCGGTATGTTAGGCTTCGGCTCGACAATGTTGCTT-ATTAGGCGTTGACTCTGTTTTTACCTTGAGGTACCATTATTTGTGTGAGATGTGTCTAATAATTGCTTGCAAGTAAGGTGTTGCTTGATAGTTACGCTTTGATACTGCTTTTCGGAGTGGTGTTGAGGTTGAGGATAGCACAATTTGGGAAAATTTTGTA-CACTGTTATGTATGTAACTGT-----GTATCT-CAA 'Elongisporangium helicandrum CBS_393.54_AY598653' CCACACCAAAAAA--CTTTCCACGTGAACTGT--------CTTAACAT--------GTTTTG-TGCCTTT-------------------------AATTAGGCTAAACGAAGGTCGG-----AGTAA-------------AATCTGGCTGATCTATC----TTTTTAAACCCC----TTACTTAATTACTGATTTATACTGTGAGGACGAAAGTCTTTGCTTTTAACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACAATAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGTGAGAGAGA-TG-GCCGATGTGAAGTGTCTCG-ATCTGTGCATATTTT----TTTTTATGACACATTGATCGAGTCCTTTTAAATGTACACTGTTTTTTCTCTTGTTTCTATGAGGTAC--TGCTCGAACGG-AGTGATCTTGTGATTGCTTGCATGTTTGGTGGCAACTTCGGTTTAGACGCTAGGGGTTAATGCTCGATTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCTT-ATTAGGCGTTGACTCTGTTTTTACCTTGAGGTACCATTATTTGTGTGAGATGTTTCTATGGATTGCTTGCAAGTAAGGTGTTGCTTGATAGTTACGCTTTGATGCTGCTTTTCGGAGTGGTATGAAGGTTGAGGATAGCACAATTTGGGAAAATTTTGTA-CACTGTTATGTATGTAACTGT-----GTATCT-CAA 'Globisporangium heterothallicum CBS45067_HQ643553' CCACACCTAAAAA-ACTTTCCACGTGAACTGTCAAACCTGTTCTGTGCTTGTGCTGGGTCTG-CGTTTTC---------GGACGCGGAC{AG}---CGGCGGAGGCTGAACGAAGGCTGGTTT--CATTT-G-----TATG--AGATCAGCTGATATATT----TTTTCAAACCCCTTTTTTACAAAATGACTGATCAATACTGTGAGAACGAAAGTTCTTGCTTTAAACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTAGACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTTTT-CTGTGTAGTCAGGATTGGAGA-CGTGCAGATGTGAAGTGTCTCGCGCACTTGCGTC--------TTCGGACGACA-AGCTGTCGAGTCCTTTTAAA{AG}CGACACGATCTTT-CTATTGTTTCTGTGAAGCGTATTGCTCG-AACGCGGTGATTTTCGGATCGCTCGCAGTCGT--CGGCGACTTCGGTGAGAACATAAAGGAGGAAACCTCAATTCGCGGTATGTTCGGCTTCGGCTCGACAATGTTGCTT-ATTGTGTGTGGAATCTGTTTTCGCCTTGAGGTGTACTGATGGTTGTGTGCTTGAACTGGGAGTTGGTGTGTAGTAGAGTGGT-GCAGC-ATGCATGGT--TACGC--CTTTT---A--TATAGAGAG---------ATGTCTATTTGGGAAAGTTGTAC-TGTTTGGCAAGCATC---TTGCCGACTGTATCT-CAA 'Globisporangium heterothallicum CBS_451.67_AB507409' CCACACCTAAAAA-ACTTTCCACGTGAACTGTCAAACCTGTTCTGTGCTTGTGCTGGGTCTG-CGTTTTC---------GGACGCGGACA---CGGCGGAGGCTGAACGAAGGCTGGTTT--CATTTTG-----TATG--AGATCAGCTGATATATT----TTT-CAAACCCCTTTTTTACAAAATGACTGATCAATACTGTGAGAACGAAAGTTCTTGCTTTAAACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTAGACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTTTT-CTGTGTAGTCAGGATTGGAGA-CGTGCAGATGTGAAGTGTCTCGCGCACTTGCGTC--------TTCGGACGACA-AGCTGTCGAGTCCTTTTAAAACGACACGATCTTT-CTATTGTTTCTGTGAAGCGTATTGCTCG-AACGCGGTGATTTTCGGATCGCTCGCAGTCGT--CGGCGACTTCGGTGAGAACATAAAGGAGGAAACCTCAATTCGCGGTATGTTCGGCTTCGGCTCGACAATGTTGCTT-ATTGTGTGTGGAATCTGTTTTCGCCTTGAGGTGTACTGATGGTTGTGTGCTTGAACTGGGAGTTGGTGTGTAGTAGAGTGGT-GCAGC-ATGCATGGT--TACGC--CTTTT---A--TATAGAGAG---------ATGTCTATTTGGGAAAGTTGTAC-TGTTTGGCAAGCATC---TTGCCGACTGTATCT-CAA 'Globisporangium splendens CBS46248_HQ643795' CCACACTTTAAA---CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTT{CT}---------GGATA{CG}TGGAT--CGGGAGT{CG}AGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCGTTTTTCAAACCC-----TTACATAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACC{AG}{GT}AGGTTGTCGG{CT}TTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF240030_AB796286' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTATATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF241982_AB780602' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTTGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF241983_AB780607' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF241986_AB780573' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTACTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF243778_AB780616' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTAAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTTGGATTGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACATTGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF243781_AB780619' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTTTCAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCATTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGGTTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCTTAGGTTGTCGGCTTGAACTGTGTATCATTGTTGAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF243782_AB780628' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTT-CAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAATTTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGGTTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCATAGGTTGTCGGCTTGAACTGTGTATCATTGTTGAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF243783_AB780644' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAGCTGTGGATCGTTGTTTAGTAGGGTATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF305867_AB796293' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTTTCAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGGTTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCATAGGTTGTCGGCTTGAACTGTGTATCATTGTTGAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAGA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF425469_AB796297' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTT---------GGATACTGGAT--CGGGAGTGAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTC-GTTTTTCAAACCC-----TTACCTAAATACTGATTGATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAACAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGAGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACTGGAGGTTGTCGGTTTGAACTGTGGATCGTTGTTTAGTAGGGCATT-TTCGCGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens MAFF425508_AB796304' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTTTCAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGTACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTTGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGGTTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCATAGGTTGTCGGCTTGAACTGTGTATCATTGTTGAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTAATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium splendens PPRI8415_FJ415953' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTTTCAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGATTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTGATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCATAGGTTGTCGGCTTGAACTGTGTATCATTGTTGAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGATTGTCGGTGGTATCT-CAA 'Globisporangium ultimum sporangiiferum CBS_111.65_KJ639275' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTAACTGATCTAG-TGTTTTCCTATTTTTGGGACACTGGAATACAGGATTCAGCAGGACGAAGGTTAGTCTCTCGTAATGCAAATTAGGA-GGACTAGCTGATGAACTTTTCTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTTTTCTGTGTAGTCAGAGATGGAAAATGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTTCGTTTTCGATCGACA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTT-CTATGGTTTCTATGAAGTGTGATGTTCGGAAGGCAGTGATTTTCGGATCACTGGCGGCTTT--TGGCGACTTCGGTATAAACGTAT-GGAGATTACCTCAATTCGCGGTATGTTAGGCTTTGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACTGTAAATGATTGTTTAGTAGGACATT-TTCGCGATGTATGGA--GACGTTGCATTT---GGTTGCGTAGAG---------AGATTGATTTGGGAAAATTCTGTACTTTTGGCAATTGT----TTGCTAAATGTATCT-CAA 'Globisporangium ultimum sporangiiferum CBS_219.65_AY598656' CCACACTTTAAAA-ACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTAACTGATCTAG-TGTTTTCCTATTTTTGGGACACTGGAATACAGGATTCAGCAGGACGAAGGTTAGTCTCTCGTAATGCAAATTAGGA-GGACTAGCTGATGAACTTTTCTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTG?GAACTGCGATACGT?ATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTTT-CTGTGTAGTCAGAGATGGAAAATGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTTCGTTTTCGATCGACA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTT-CTATGGTTTCTATGAAGTGTGATGTTCGGAAGGCAGTGATTTTCGGATCACTGGCGGCTTT--TGGCGACTTCGGTATAAACGTAT-GGAGATTACCTCAATTCGCGGTATGTTAGGCTTTGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACTGTAAATGATTGTTTAGTAGGACATT-TTCGCGATGTATGGA--GACGTTGCATTT---GGTTGCGTAGAG---------AGATTGATTTGGGAAAATTCTGTACTTTTGGCAATTGT----CTGCTAAATGTATCT-CAA 'Globisporangium ultimum sporangiiferum DAOM_240290_KJ639276' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTAACTGATCTAGCTGTTTTCCTATTTTTGGGACACTGGAATACAGGATTCAGCAGGACGAAGGTTAGTCTCTCGTAATGCAAATTAGGA-GGACTAGCTGATGAACTTTTCTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTTTTCTGTGTAGTCAGAGATGGAAAATGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTTCGTTTTCGATCGACA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTT-CTATGGTTTCTATGAAGTGTGATGTTCGGAAGGCAGTGATTTTCGGATCATTGGCGGCTTT--TGGCGACTTCGGTATAAACGTAT-GGAGATTACCTCAATTCGCGGTATGTTAGGCTTTGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACTGTAAATGATTGTTTAGTAGGACATT-TTCGCGATGTATGGA--GACGTTGCATTT---GGTTGCGTAGAG---------AGATTGATTTGGGAAAATTCTGTACTTTTGGCAATTGT----TTGCTAAATGTATCT-CAA 'Globisporangium ultimum ultimum ATCC_58811_KJ639272' CCACACTTTAAAAAACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGAGCTGG-TGTTTTC--ATTTTTGG-ACACTGGAA--CGGGAGTCAGCAGGACGAAGGTTGGTCTGTTGTAATGCAAGTTATGATGGACTAGCTGATGAACTTTTGTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGGGATGGAA--TGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTT--TTTTCGATCGAGA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTTTCTATGGTTTCTATGAAGTGTAATGGTTGGAAGGCAGTGATTTTCGGATTGCTGGCGGCTTT--TGGCGACTTCGGTATGAACGTAT-GGAGACTAGCTCAATTCGTGGTATGTTAGGCTTCGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACCGTAAGTGATTGTTTAGTAGAGCATT-TTCACGATGTATGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTGATTTGGGAAA-TTTTGTATCATTGTCAATTGCAAGATTGTGTATGGTATCT-CAA 'Globisporangium ultimum ultimum BR144_HQ643943' CCACACTTTAAAAAACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGAGCTGG-TGTTTTC--ATTTTTGG-ACACTGGAA--CGGGAGTCAGCAGGACGAAGGTTGGTCTGTTGTAATGCAAGTTATGATGGACTAGCTGATGAACTTTTGTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGGGATGGAA--TGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTT--TTTTCGATCGAGA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTTTCTATGGTTTCTATGAAGTGTAATGGTTGGAAGGCAGTGATTTTCGGATTGCTGGCGGCTTT--TGGCGACTTCGGTATGAACGTAT-GGAGACTAGCTCAATTCGTGGTATGTTAGGCTTCGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACCGTAAGTGATTGTTTAGTAGAGCATT-TTCACGATGTATGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTGATTTGGGAAA-TTTTGTATCATTGTCAATTGCAAGATTGTGTATGGTATCT-CAA 'Globisporangium ultimum ultimum CBS39851_HQ643865' CCACACTTTAAAAAACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGAGCTGG-TGTTTTC--ATTTTTGG-ACACTGGAA--CGGGAGTCAGCAGGACGAAGGTTGGTCTGTTGTAATGCAAGTTATGATGGACTAGCTGATGAACTTTTGTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGGGATGGAA--TGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTT--TTTTCGATCGAGA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTTTCTATGGTTTCTATGAAGTGTAATGGTTGGAAGGCAGTGATTTTCGGATTGCTGGCGGCTTT--TGGCGACTTCGGTATGAACGTAT-GGAGACTAGCTCAATTCGTGGTATGTTAGGCTTCGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACCGTAAGTGATTGTTTAGTAGAGCATT-TTCACGATGTATGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTGATTTGGGAAA-TTTTGTATCATTGTCAATTGCAAGATTGTGTATGGTATCTACAA 'Globisporangium ultimum ultimum CBS_291.31_KJ639270' CCACACTTTAAA--ACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGAGCTGG-{CT}GTTTTC--ATTTTTGG-ACACTGGAA--CGGGAGTCAGCAGGACGAAGGTTGGTCTGTTGTAATGCAAGTTATGATGGACTAGCTGATGAACTTTTGTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGGGATGGAA--TGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTT--TTTTCGATCGAGA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTTTCTATGGTTTCTATGAAGTGTAATGGTTGGAAGGCAGTGATTTTCGGATTGCTGGCGGCTTT--TGGCGACTTCGGTATGAACGTAT-GGAGACTAGCTCAATTCGTGGTATGTTAGGCTTCGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACCGTAAGTGATTGTTTAGTAGAGCATT-TTCACGATGTATGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTGATTTGGGAAA-TTTTGTATCATTGTCAATTGCAAGATTGTGTATGGTATCT-CAA 'Globisporangium ultimum ultimum Lev2075_KJ639271' CCACACTTTAAA--ACTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGAGCTGG-TGTTTTC--ATTTTTGG-ACACTGGAA--CGGGAGTCAGCAGGACGAAGGTTGGTCTGTTGTAATGCAAGTTATGATGGACTAGCTGATGAACTTTTGTTTTTAAACCC-----TTACCTAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT--CTGTGTAGTCAGGGATGGAA--TGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTTCGTT--TTTTCGATCGAGA-ATCTGTCGAGTCCTTTTAAATGGACACGGTCTTTTCTATGGTTTCTATGAAGTGTAATGGTTGGAAGGCAGTGATTTTCGGATTGCTGGCGGCTTT--TGGCGACTTCGGTATGAACGTAT-GGAGACTAGCTCAATTCGTGGTATGTTAGGCTTCGGCTCGACAATGTTGCGTAATTGTGTGTGGTCTTTGTTTGTGCCTTGAGGTGTACTAGAGGTTGTCGGTTTGAACCGTAAGTGATTGTTTAGTAGAGCATT-TTCACGATGTATGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTGATTTGGGAAA-TTTTGTATCATTGTCAATTGCAAGATTGTGTATGGTATCT-CAA 'Pythium splendens CBS118747_DQ381808' CCACACTTTAAAA--CTGTCCACGTGAACTGT-AAGCAAGTCTAGCGCTGTGACTGATCTGG-TGTTTTC---------GGATAGTGGAT--CGGGAGTCAGCAGGACGAAGGTTGGTCT--CGTAATGTAAATTATG--GGACTAGCTGATGCATTCCTTTTTTCAAACCC-----TTACATAAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTA-CTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTT--CTGTGTAGTCAGGGAGAGAGA-CGTGCAGATGTGAAGTGTCTCGCATGGTTGCGTT--------TTCGGACGACG-ATCTGTCGAGTCCTTTTAAATGGACAGGGTCTTT-CTATGGTCTGTGTGAAGTGTGGTGCTCGAAAGGCAGTGGTTTTCGGATCGCTGGCGGCTTT--TGGCGACTTCGGCATGAACATAT-GGAGACTACCTCGGTTCGCGGTATGTTAGGCTTCGGCTGAACAATGTTGCGTAATTGAGTGTGGAATCCGTTTGTGCCTTGAGGTGTACCATAGGTTGTCGGCTTGAACTGTGTATCATTGTTTAGTAGGGTATT-TTCACGATGTACGGA--GACGCTGCATTT---AGTTGCGTAGAG---------AGATTTATTTGGGAAA-TTCTGTATCGTTGATGATCGAATGAT-GTCGGTGGTATCT-CAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M59391] TITLE Globisporangium_cox1_cox2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1233; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Elongisporangium_anandrum_CBS28531 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTAGTAATTACTGCACATGCTTTTATTATGATTTTCTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCTAGTGTTCAAGCACACTCTGGACCTTCAGTTGATTTAGCTATTTTTAGTTTACATTTATCTGGTATTTCATCTTTATTAGGTGCTATAAACTTTCTTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTTATTACTGCTTTCTTATTATTATTAACATTACCTGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAACTTAAATACATCATTTTATGATCCATCAGGAGGAGGTGATCCTGTATTATACCAACATTTATTTTATAAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTATAGTACATGGTGCTACTATTGAAATTATTTGGACTACTATCCCAGCTTTAATTTTATTAACAGTAGCTGTACCTTCATTCGCTTTATTATATTCTATGGATGAAGTAATTGATCCAATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGATGATTTAACTATAGGTCAATTTAGACTTTTAGAAGTAGATAATAGAGTAGTAGTTCCTACAAATAGTCATATTAGAGTATTAATTACTGCTTCAGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATAAAATTAGATGCATGTCCAGGCCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Elongisporangium_helicandrum_CBS39354 AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCTGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTAATTACTGCACATGCTTTTATTATGATTTTCTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTCTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCTTTATCAAGTGTTCAAGCACATTCCGGACCTTCAGTTGACTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCGTCTTTATTAGGTGCTATAAACTTTCTTTCAACTATTTATAATATGAGAGCTCCTAGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTTATTACAGCTTTTTTATTATTATTAACATTACCAGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCAGGAGGAGGTGATCCTGTATTATACCAACATCTATTTTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTGCTACTATAGTACATGGTGCTACTATTGAAATTATCTGGACTACTATTCCAGCTTTAATTTTATTAACTGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTAATTGACCCAATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGACGATTTAACTATAGGTCAATTTAGACTTTTAGAAGTAGATAATAGAGTAGTTGTTCCTACAAATAGTCATATTAGGGTATTAATTACTGCTTCTGATGTTTTACATTCATGGACTATTCCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_heterothallicum_CBS45067 AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTAGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCACCATTTATATAATGTTGTAGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCATTAATGATAGGTGCACCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCAATTAATTTTTTATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTGCCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTCTTATTATTATTAACTTTACCTGTATTAGCTGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGTGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTGGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATAGCTTCTACCATTGTACATGGTGCTACTATTGAAATTATTTGGACCACAATACCTGCTTTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCTATAATTACTTTAAAAGTTATAGGTAGCCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCTGATGAGCCTTTAATTTTTGATAGTTACATGGTACAAGAAAATGATTTAGAATTAGGTCAATTTAGACTTTTAGAAGTAGATAACCGTGTAGTAGTTCCTACTAATAGTCATATTAGAGTGTTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_CBS46248 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACACGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCTTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF240030 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF241982 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF241983 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACACGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCTTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF241986 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF243778 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF243781 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACACGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCAATCTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGACCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACAGTAGCTGTTCCATCATTTGCTTTGTTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAACTTAGACTTTTAGAAGTAGATAATCGCGTTATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTCGCTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGGGTATTTTATGG Globisporangium_splendens_MAFF243782 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACACGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCAATCTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGACCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACAGTAGCTGTTCCATCATTTGCTTTGTTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAACTTAGACTTTTAGAAGTAGATAATCGCGTTATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTCGCTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF243783 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAAAAGGTGTATTTTATGG Globisporangium_splendens_MAFF305867 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACACGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCAATCTTTAGTTTACATTTATCAGGTATTTCGTCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTCCACAGATTACCCTTATTTGTTTGGGCTATATTTATTACAGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGACCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTGTTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAACTTAGACTTTTAGAAGTAGATAATCGTGTTATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTCGCTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF425469 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAAGCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCGCATTCAGGTCCTTCAGTAGATTTAGCTATATTTAGTTTACATTTATCTGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_splendens_MAFF425508 AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACACGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCAATCTTTAGTTTACATTTATCAGGTATTTCGTCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTCCACAGATTACCCTTATTTGTTTGGGCTATATTTATTACAGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGACCCTGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTGTTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGATGAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAACTTAGACTTTTAGAAGTAGATAATCGTGTTATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTCGCTTAAATCAAACTTCTATGTTTATTAAAAGAAAAGGTGTATTTTATGG Globisporangium_ultimum_CBS398.51 AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTCATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATCGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCAGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACTGTATATCCACCTTTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACACGGTGCTACTATTGAAATTATTTGGACTACAATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAGTTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGCCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCGATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG 'Globisporangium ultimum sporangiiferum CBS_111.65' AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCTGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAGTTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTCTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGAGCAGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTCTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTCTTATTATTATTAACTTTACCGGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCTGTATTATATCAACATTTATTTTATTAACTTTCACCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGCTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCGACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCTGCTTTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATCGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAACTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGCCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCTTGGGCTGTACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG 'Globisporangium ultimum sporangiiferum CBS_122650' AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCTGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTCTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCTGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACCGTATATCCACCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTCTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTTTTATTATTATTAACTTTACCCGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCTGTATTATATCAACATTTATTTTATTAACTTTCACCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCGGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTGTATTCAATGGATGAAGTAATCGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCTTGGGCTATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGCTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG 'Globisporangium ultimum sporangiiferum CBS_219.65' AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTGGTTGTAACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTATCTTCTGCTATTGTTGAATCTGGTGCAGGTACAGGTTGGACAGTATACCCACCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGGCAATTTTTATTACTGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTGATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGATGAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCTTGGGCTATACCTTCATTAGGAGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG 'Globisporangium ultimum sporangiiferum DAOM_240290' AATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCATTTATATAATGTGGTTGTAACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATTGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTATCTTCTGCTATTGTTGAATCTGGTGCAGGTACAGGTTGGACAGTATACCCACCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGGCAATTTTTATTACTGCTTTCTTATTATTATTAACTTTACCAGTATTAGCAGGTGCTATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTGATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGATGAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCTTGGGCTATACCTTCATTAGGGGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG 'Globisporangium ultimum ultimum CBS_291.31' AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTCATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATCGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCAGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACTGTATATCCACCTTTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACAATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAGTTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGCCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCGATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG 'Globisporangium ultimum ultimum CBS_296.37' AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTCATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATCGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCAGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACTGTATATCCACCTTTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACAATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAGTTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGCCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCGATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG 'Globisporangium ultimum ultimum DAOM_BR144' AATCATAAAGACATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGGTGTAGTTGGTACTACATTATCTATTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTCATGGGTAATCATCATTTATATAATGTTGTTGTTACTGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATCGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTATTATTAGTATCTTCAGCTATAGTTGAATCTGGAGCAGGTACAGGTTGGACTGTATATCCACCTTTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATTTTTATTACAGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCTGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACAATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAGTTTTCAGATGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGCCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCGATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG ; END; BEGIN TREES; TITLE Globisporangium_cox1_cox2; LINK TAXA = Taxa1; TRANSLATE 1 Elongisporangium_helicandrum_CBS39354, 2 Elongisporangium_anandrum_CBS28531, 3 'Globisporangium ultimum sporangiiferum CBS_219.65', 4 'Globisporangium ultimum sporangiiferum CBS_122650', 5 'Globisporangium ultimum sporangiiferum CBS_111.65', 6 'Globisporangium ultimum sporangiiferum DAOM_240290', 7 'Globisporangium ultimum ultimum CBS_291.31', 8 'Globisporangium ultimum ultimum DAOM_BR144', 9 'Globisporangium ultimum ultimum CBS_296.37', 10 Globisporangium_ultimum_CBS398.51, 11 Globisporangium_heterothallicum_CBS45067, 12 Globisporangium_splendens_CBS46248, 13 Globisporangium_splendens_MAFF425508, 14 Globisporangium_splendens_MAFF425469, 15 Globisporangium_splendens_MAFF305867, 16 Globisporangium_splendens_MAFF240030, 17 Globisporangium_splendens_MAFF243783, 18 Globisporangium_splendens_MAFF243782, 19 Globisporangium_splendens_MAFF243781, 20 Globisporangium_splendens_MAFF243778, 21 Globisporangium_splendens_MAFF241983, 22 Globisporangium_splendens_MAFF241982, 23 Globisporangium_splendens_MAFF241986; TREE PAUP_1 = [&R] ((1:0.023825,2:0.016775):0.0510025,(((11:0.05046,(3:1.51E-4,6:7.78E-4):0.014009):0.007503,((4:0.00576,5:0.013665):0.00965,(10:7.74E-4,(9:0.0,(7:0.0,8:0.0):0.0):0.001106):0.020842):0.002531):0.012099,(((13:9.04E-4,15:0.0):0.005257,(18:0.0,19:9.1E-4):2.81E-4):0.016396,((12:8.84E-4,21:9.95E-4):6.81E-4,(17:9.33E-4,(14:0.0,(22:0.0,(23:0.0,(16:0.0,20:0.0):0.0):0.0):0.0):0.0):0.002204):0.022536):0.001939):0.0510025); END; BEGIN TREES; TITLE Globisporangium_ITS; LINK TAXA = Taxa2; TRANSLATE 1 'Pythium splendens CBS118747_DQ381808', 2 'Globisporangium splendens PPRI8415_FJ415953', 3 'Globisporangium ultimum sporangiiferum CBS_111.65_KJ639275', 4 'Globisporangium ultimum sporangiiferum CBS_219.65_AY598656', 5 'Globisporangium ultimum sporangiiferum DAOM_240290_KJ639276', 6 'Globisporangium ultimum ultimum ATCC_58811_KJ639272', 7 'Globisporangium ultimum ultimum Lev2075_KJ639271', 8 'Globisporangium ultimum ultimum CBS_291.31_KJ639270', 9 'Globisporangium ultimum ultimum BR144_HQ643943', 10 'Globisporangium ultimum ultimum CBS39851_HQ643865', 11 'Globisporangium heterothallicum CBS45067_HQ643553', 12 'Globisporangium heterothallicum CBS_451.67_AB507409', 13 'Globisporangium splendens CBS46248_HQ643795', 14 'Globisporangium splendens MAFF425508_AB796304', 15 'Globisporangium splendens MAFF425469_AB796297', 16 'Globisporangium splendens MAFF305867_AB796293', 17 'Globisporangium splendens MAFF240030_AB796286', 18 'Globisporangium splendens MAFF243783_AB780644', 19 'Globisporangium splendens MAFF243782_AB780628', 20 'Globisporangium splendens MAFF243781_AB780619', 21 'Globisporangium splendens MAFF243778_AB780616', 22 'Globisporangium splendens MAFF241983_AB780607', 23 'Globisporangium splendens MAFF241982_AB780602', 24 'Globisporangium splendens MAFF241986_AB780573', 25 'Elongisporangium anandrum CBS_285.31_AY598650', 26 'Elongisporangium helicandrum CBS_393.54_AY598653'; TREE PAUP_1 = [&R] ((25:0.014079,26:0.014906):0.133168,((11:0.0,12:0.0):0.171359,(((3:0.0,(4:0.001221,5:0.00122):0.0):0.030047,(9:0.0,(6:0.0,(10:0.0,(7:0.0,8:0.0):0.0):0.0):0.0):0.02735):0.033299,((2:0.001243,(1:0.001249,(19:0.001249,(20:0.002503,(14:0.003752,16:0.001246):0.0):0.0):2.82992E-7):0.001252):0.009209,(13:0.0,(15:0.003767,((21:0.003787,23:0.0):0.001254,(18:0.0,(22:0.0,(17:0.001253,24:0.001253):0.0):0.0):0.0):0.0):0.003642):0.00905):0.040422):0.083409):0.133168); END;