#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:51 GMT TreeBASE (cc) 1994-2008 Study reference: Hattori Y., Ando Y., & Nakashima C. 2020. Taxonomical re-examination of genus Neofusicoccum in Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S27074] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=60; TAXLABELS Botryosphaeria_dothidea_CBS100564 Neofusicoccum_algeriense_ALG1 Neofusicoccum_andinum_CBS117453 Neofusicoccum_arbuti_CBS116131 Neofusicoccum_australe_CBS139662 Neofusicoccum_batangarum_CBS124924 Neofusicoccum_brasiliense_CMM1285 Neofusicoccum_buxi_CBS11675 Neofusicoccum_cordaticola_CBS123634 Neofusicoccum_corticosae_CBS120081 Neofusicoccum_cryptoaustrale_CBS122813 Neofusicoccum_eucalypticola_CBS115679 Neofusicoccum_eucalyptorum_CBS115791 Neofusicoccum_grevilleae_CPC16999 Neofusicoccum_hellenicum_CERC1947 Neofusicoccum_hongkongense_CERC2973 Neofusicoccum_illicii_BJFU2037 Neofusicoccum_italicum_150900 Neofusicoccum_kwambonambiense_CBS123639 Neofusicoccum_lumnitzerae_CMW41469 Neofusicoccum_luteum_CBS56292 Neofusicoccum_macroclavatum_CBS118223 Neofusicoccum_mangiferae_CMW7024 Neofusicoccum_mangroviorum_CMW41365 Neofusicoccum_mediterraneum_CBS121718 Neofusicoccum_microconidium_CERC3497 Neofusicoccum_nonquaestitum_CBS126655 Neofusicoccum_occulatum_CBS128008 Neofusicoccum_pandanicola_KUMCC170184 Neofusicoccum_parvum_CBS138823 Neofusicoccum_pennatisporum_MUCC510 Neofusicoccum_pistaciae_CBS59576 Neofusicoccum_pistaciarum_CBS113083 Neofusicoccum_pistaciicola_CBS113089 Neofusicoccum_protearum_CBS114176 Neofusicoccum_pruni_CBS121112 Neofusicoccum_ribis_CBS115475 Neofusicoccum_sinense_CGMCC318315 Neofusicoccum_sinoeucalypti_CERC2005 Neofusicoccum_sp._MUCC2585 Neofusicoccum_sp._MUCC392 Neofusicoccum_sp.MUCC241 Neofusicoccum_sp.MUCC2509 Neofusicoccum_sp.MUCC2511 Neofusicoccum_sp.MUCC2586 Neofusicoccum_sp.MUCC2660 Neofusicoccum_sp.MUCC2662 Neofusicoccum_sp.MUCC2663 Neofusicoccum_sp.MUCC2666 Neofusicoccum_sp.MUCC2669 Neofusicoccum_sp.MUCC650 Neofusicoccum_sp.MUCC789 Neofusicoccum_stellenboschiana_CBS110864 Neofusicoccum_terminaliae_CBS125263 Neofusicoccum_umdonicola_CBS123645 Neofusicoccum_ursorum_CBS122811 Neofusicoccum_variabile_CMW37739 Neofusicoccum_versiforme_CBS118101 Neofusicoccum_viticlavatum_CBS112878 Neofusicoccum_vitifusiforme_CBS110887 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M56573] TITLE Neofusicoccum_in_Japan; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1829; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_dothidea_CBS100564 GCACACATTTTCTGTGCCTGCACGT--------------------------GTGCTGGGTTCCTGCGCCGAATTTGCCTTATCACTCTGGTGAGGGGCAATTTCTTGGTGGGGCTGGCCCGCGCTAAGCCTCGTTTGGTCTTCGGCAAAATCTCCGCATCTGGATTTTTTGTGACCGGCGTGCGACCGAC--GCGAACACCCCTCACCAACGCTTCCAGCCACTCACGTTCGTCTATGCGACCATATGCTAACCACCGCCACAACAGGAAGCCGCTGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGGGCTCCG-GCCCGATCCTCCCACCCTTTGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCGGCCGCCCCCC-TCCCCGGGGGGGTGGCCAGCGCCCGCCAGAGGACCATCAAA--CTCCAGTCAGTAAACGATGCAGTCTG--AAAAAC-ATTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTT-GGTATTGGGCACCGTCCTTTGC-------------GGGCGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAACATACATCTCGCTTCGGAGCGCAGGGCGTCGCCCGCCGGACGAACCTTCTGA----ACTTT-----TCTCAAGGTTGACCTCGGATGACACAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCAAGCGTATCACCGCACGCCACGAAGATTTTCGTCAACGGTGTCTGGGTTGGTATTCACCGTGATCCCACCCAACTCGTCTCCGTCGTCAAGAAGCTGCGTCGTGACGGCACTCTCTCCCCGGAGATGAGTCTTGTTCGCGATGTTCGTGACAGGGAGTTCAAGATCTTCACCGATGCCGGGCGCGTCTGTAGGCCTCTTTTCATCATCGACGACGATCCTACAAGCGCGAACAAGGGTAACTTGGTTTTGTCCCGTGAACACATCGACAGGCTTGAGGA-AGATCAACAAATTGACGTCTCTGGCCTGTCCGATGAAGAGAGGGAAGAGAAGAGGTATGGCTGGAAGGGTTTACTTACCAGTGGTGTGGTTGAGTACATGGACGCAGAAGAAGAGGAAGCTGCCATGATTGTCATGACTCCCGATGATTTGCGTGCCCACCACAGGGCTCGTCAGGGCATCATTGACGAGGAAGACGAAGAGACGAAGCTCAACAGAGATCCTCATGAGCGTGTTGTTCCTCCCCCGAACCCCAGCGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CA--CCCGCTCCCGCGCCCCCGCTAACGCGAATCGACACCACAGGCAGACCAT-CTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCATCATTCTCAGCGTGGGAGAACATCAATGACTAAACTGTAGCAGCTACAATGGCACCTCGGACCTTCAGCTCGAGCGCATGAACGTCTATTTCAACGAGGTACTCTCTCACTAATTAGACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACGATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTTTTCCGCC- Neofusicoccum_algeriense_ALG1 ?????????????????????????--------------??????????????GCTGGGTTCCCGCGCTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCCTC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACATCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTTCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_andinum_CBS117453 GAAAGTTTTTCCTTCCGCTACACGC---------------------GCTGGGTTCTGGGTTCCCGCACTCAATTTGCCTTATCGCTCCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCTGCGCTAAGCCTTGTTTGGGC-TCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAATGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCT-TC----GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCTCGGCCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGCCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCTGTCGTTAAGAAGCTTCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGATATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCAGATGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAATAGGGACCCTCACGAGCGTGTCGTCCCGGCTCCCAATCCGAGTGTTAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----AAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTATCTCACTAATGGCACAAACACGTGAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_arbuti_CBS116131 GAAAGTTTTTCCTTCCGCTACACGC---------------------GCTGGGTTCTGGGTTCCCGCACTCAATTTGCCTTATCGCTCCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCTGCGCTAAGCCTTGTTTGGGC-TCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAATGGCCATC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTCGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCT-TC----GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCTCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCTGTCGTTAAGAAGCTTCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGATATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCAGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAATAGGGACCCTCACGAGCGTGTCGTCCCGGCTCCCAATCCGAGTGTTAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----AAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTATCTCACTAATGGCACAAACACGTGAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_australe_CBS139662 GAAGATTTTTCGTTCCGCTGCCCGC--------------GC-----GAT-GGTGCTGGGATGCTGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGATCGGACGCTAACGACCGTC---TTAGGAAGCCGCCGAGCTCGGTAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--C-GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCATGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAATATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAAAGGTATGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGG-TGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGT?????????????????????????????????????CTTCTGGTTTGTTGCC-AAAA-------CACCGCCGCTCCCGCGCTCCCGCTGACGCGAATCGACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_batangarum_CBS124924 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC--GGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAGCCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTATGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACTCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCTGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAGGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTTGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_brasiliense_CMM1285 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--TTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTACACAAACACGTAAAGAATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCCCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_buxi_CBS11675 GA-----CTTTTTGCTGCTGCACGC--------------GCACG-----------CCGGGCCCCTCACCCAATTTGCCTCATCACTTCGATGAGGGGCATTTTGGTGGTGGGGCTCGCCCGCGCTAAACCCCGTTTGCGCTTCGGCAAAATGTCCGCGTTTGGTCGCTTCGCGACCGGCGTGCTACCGAA--GCG--CGCCCCTCGCCACACA-----GCCA--------CTCATGTACGACCAGGCGCTAACAACCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCGCGCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCCCTC--CCGGGGGCTGGCCAGCGCCCGCCAGAGGACCACCAAA--CTCCAGTCAGTAAACGTCGCGGTCTG--AAAAGCAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCCCCCTCTCAGGGGGGCGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTCGGAGCGCTTGGCGTCGCCCGCCGGACGAACCTTTGTGA---ATCAC-----TTCCAAGGTGGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCAAACGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTCCATCGTGACCCGACTCAGCTTGTCTCTGTCGTCAAGAAGCTGCGTCGAGACGGTACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAATTCAAGATTTTCACGGATGCAGGCCGAGTGTGCAGGCCTCTATTCATCATTGACGACGATCCGTTCAGCCCGAACAAGGGAAACCTGGTCCTGTCCAGGGAACACATCGACAAGCTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAACGATGACGAAAGGGATGAGAGGAGATACGGTTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAAGAGGTTGCGATGATTGTCATGACCCCCGACGATCTGAGGGCGCACCACAGGGCTCGCCAGGGCATCGTCGATGAAGAAGACGAAGAGACCAAGCGTAACAGAGACCCTCACGAGCGCGTCGTCCCGGCCCCCAACCCGAGCGTC????????????????????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_cordaticola_CBS123634 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGCTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACACC---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTGTTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGCGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TC??????????????????????????????CATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAACTTGTCTCCGTTGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGAAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGACGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCTCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCTTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTGGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_corticosae_CBS120081 GAAAGTTTTT----CCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCGCTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCAGCCCGCGCTAAGCCTCGTTTGCGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGGCCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--C-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTATGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTTTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGTGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCCCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACGCACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_cryptoaustrale_CBS122813 GAAGATTTTTCGTTCCGCTGCCCGC--------------GC-----GAT-GGTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGATCGGACGCTAACGACTGTC---TCAGGAAGCTGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--C-GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_eucalypticola_CBS115679 GAAAATTTTTCCTTCCGCTGCACGC--------------TT-----CCTGGGTGCTGGGTTCCCGCACTCAATTTACCTCATCGCTTCAGTGAGGGGCATTT---TGGTGGGGTCGGCCCGCGCTAATCCTGGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCAACCGGCGTGCGACCGAA--ATG--CGCCCCTC-------------GCCA--------TGTATGCGCGGCCAGACGCTAACGCCCATC---CCAGGAAGCTGCCGAACTCGGTAAGGGTTC????????AAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCT-TT----GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTTGCAGTCTG--AAAACCAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGT-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AATCACCTCGCTTTGGAGCGCATGGCGTCGCCTGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCTCGCTCCTGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAACACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCTC----GAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAATACGTTCCTCGTGCCGTCCTCGTTGACCTCGAGCCTGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_eucalyptorum_CBS115791 GAAAATTTTTCCTTCCGCTGCACGC--------------TT-----CCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCAGTGAGGGGCATTT---TGGTGGGGTCGGCCCGCGCTAATCCTGGTTTGTGCTTCGGCAAAATCTCCGTATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--ATG--CGCCCCTC-------------GCCA--------TGCATGCGCGGCCAGACGCTAATGCCCATC---CCAGGAAGCCGCCGAACTCGGTAAGGGTTC??????????GGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCT-TT----GGGGGCTGGCCAGCGTCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTTGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTTGCTT-GGTATTGGGCCCCGTCCTCTGT-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AATCACCTCGCTTTGGAGCGCATGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCAC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCTCGCTCCTGCGCCCCCGCTGACGCGAATCGACACCATAGGCAGACCAT-TTCTGGTGAACACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCTC----GAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACATAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTTGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_grevilleae_CPC16999 ?????????????????????????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????????--???--????????????????-------??--------????????????????????????---???---??????????????????????????????????????AAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCGATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCC-TC--GGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTTGCAGCCTGAAAAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTT-GGCGTTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCATAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TCATT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_hellenicum_CERC1947 GAAAGTTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACCCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTAGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCC--------CACGTGTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGTAAGGGT??????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT---CGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCCTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCC- Neofusicoccum_hongkongense_CERC2973 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCCAGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGT??????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCCGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTGTTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_illicii_BJFU2037 ?????????????????????????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????????--???--????????????????-------??--------????????????????????????---???---???????????????????????????????????????????????????????????TCGAG-CTCG-GCTCGACTCTCCCACCCAATGTGTACC-CACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCTTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_italicum_150900 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCCAGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTA?????????---??????????????????????????????????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTTCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT------CTCAAGG-TGACCTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_kwambonambiense_CBS123639 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATGAAA--CTCCAGTCAGTGAACTTTGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACGAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTACAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAAGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGACCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACTTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTACACAAACACGTAAAGAATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_lumnitzerae_CMW41469 GAAGATTTTTCGTTCCGCTGCCCCC--------------GC-----GAT-GGTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCAGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGATT-CGCAGCCA--------CACATGTGCGATCGGACGCTAACAATCGTC---TCAGGAAGCCGCCGAGCTCGGCAAGGGTTC?????????????TCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--T-GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGC-------------GGACGCGCCTCGAAGACCTCGGCGGCGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGA??????ATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAACCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCGACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGACCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCAGCCCCCAACCCAAGTGTC????????????????????????????-????-------????????????????????????????????????????????GCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTACGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_luteum_CBS56292 GAAGATTTTTCGTTCCGCTGCCCGC--------------GC-----GAT-GGTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAC--GCG--CACCCCTCGCCAGACT-CGCAGCCA--------CAC--GTGCGATCGGACGCTAACGACCGTC---TCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--CGGGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGT-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGCCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCACGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGATTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAGGAAGACGAAGAGAGCAAGCGTAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACGAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_macroclavatum_CBS118223 GAAAGTTTTTCCTTCCGCTGCACGC---------------------GCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCGTC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCT-TC----GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGCCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGGGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCAGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAATCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_mangiferae_CMW7024 GAAAGTTTTTCCTTCCGCTGCACGC-------------------TTGCTGGGTGCTGGGTT-CCGTACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTGGTTTGTGCTTCGGCAAAATCTCCGCATTTGG-TTTTTTGCGACCGGCGTGCGACCGAAGCGCG--CGCCCCTCGCCAGACG-C---GCCA--------CGCATGTGCAA-CAGACGCTAACGCACATC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACCTTACCTCCGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCC-TC--GAGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTTGCAGCCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAATA--TTTTT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACTAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTTTGCGCCGTTTTCCGCGC----GAATGGCAATGGCTGACCTGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCTGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_mangroviorum_CMW41365 GAAGATTTTTCGTTCCGCTGCCCGC--------------GC-----GAT-GGTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCTTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAC--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CAC--GTGCGATCGGACGCTAACGACCATC---TCAGGAAGCCGCCGAGCTCGGCAAGGGTTC?????????????TCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--CGGGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGT-------------GGACGCGCCTTGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGA??????ATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAATGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGCCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCACGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGATTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTC????????????????????????????-????-------????????????????????????????????????????????GCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGTCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACGAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_mediterraneum_CBS121718 GAAAGCTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTTGTTTGTGCTTCGGCAAAATCTCCACATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CACAGCCG--------CAC--GTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--CGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGCAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCACACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAACGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCATTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_microconidium_CERC3497 GAAAGTTTTTCCTTCCGCTGCACGC--------------TT-----GCTGGGTGCTGGGTT-CCGTACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTGGTTTGTGCTTCGGCAAAATCTCCGCATTTGG-TTTTTTGCGACCGGCGTGCGACCGAAGCGCG--CGCCCCTCGCCAGACG-C---GCCA--------CGCATGTGCAA-CAGACGCTAACGCACATC---CCAGGAAGCCGCCGAACTCGGCAAGGGT??????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACCTTACCTCCGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCC-TC--GAGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTTGCAGCCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTGAATATTTT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAATACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTTTGGGTTGGTGTTCATCGTGACCCGACCCAGCTCGTCTCTGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAGATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATCTTCACCGATGCAGGCCGAGTGTGCAGGCCTCTCTTCATCATTGACGATGATCCGTTCAGCCCGAACAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAGATTGATGTTTCTGGGATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCCGACGATCTGAGAGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAACGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACTAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTTTGCGCCGTTTTCCGCGC----GAATGGCAATGGCTGACCTGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_nonquaestitum_CBS126655 GAAAGTTTTTCCTTCCGCTACACGC---------------------GCTGGGTTCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCTGCGCTAAGCCTTGTTTGGGC-TCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCAACCAGACGCTAATGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCCCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCT-CC----GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGCGAACGTCTCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTCGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTTCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAAGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGATATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGGATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAATAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATGGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_occulatum_CBS128008 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTAGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC--GGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGAAACATGGAGCTTCTCGAAGAGTATGAGCCAAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACTCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGCTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_pandanicola_KUMCC170184 ?????????????????????????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????????--???--????????????????-------??--------????????????????????????---???---????????????????????????????????????????????CATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_parvum_CBS138823 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCCAGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACAGCCATC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGG??????????????CATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_pennatisporum_MUCC510 GAAAGTTTTTCGCT-CGCTGCGCGC--------------------------GCGCTGGGTTCCCGCACTCAATTTGCCTTGTCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCACATCTGG---TTTTGCGACCGGTGTGCGACCGCC--GCG--CCCCCCTCGCCAGACC-CGCAGCCA--------CTCATGTGCGATCGGACGCTAACGACGCTC---CCAGGAAGCCGCCGAACTCGGCAAGGGCTC????????AAGGATCATTACCGAGTTGATTCGAGCTTCG-GCTCGACTCTCCCACCCCATGTGTACC-AACCTCTGTTGCTTTGGCAGGCCGCGGTCGCCCGCACCGGCTCCCT-TC---GCGGGGCTGGCCAGCGCCTGCCAGAGGACCACAAAACTCTCCAGTCAGTGAACGTCGCAGTCTG--AAAAGCAAAGC-TAATTTGAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTGTTGGGCCCCGCCCTCTAC-------------GGGCGCGCCTCGAAGACCTCGGCGGTGGCGTCTCGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCGCGGCGCCGCTCGCCGGACGAACCTTTGGAT------TT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CAATCCCGCTGCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCACTGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCTCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTATGTTCCTCGTGCTGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTTTTCCGCC- Neofusicoccum_pistaciae_CBS59576 GAAAGTTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACCCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCC--------CACGTGTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--C-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATCTTCATCAACGGTGTCTGGGTTGGTGTCCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACTATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTGCCGCGCCCCCGCTGACGCCAATCGACACCACAGGCAGACTAT-CTCTGGCGAGCACGGCCTGGACGGCTCCGGCGTGTAAGTTTGCGCTGTCTTTGCCGC----GCTCTGCAATCGCTGACCCTTGGCAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAGTTAGACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCATCCAACAATAAGTACGTTCCTCGTGCTGTCCTCGTTGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGTC- Neofusicoccum_pistaciarum_CBS113083 GAAAGCTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTTGTTTGTGCTTCGGCAAAATCTCCACATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CACAGCCG--------CAC--GTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--CGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTACCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGGA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCACACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAACGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCATTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGTCAGCTCTTCCGCC- Neofusicoccum_pistaciicola_CBS113089 GAAAGCTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTTGTTTGTGCTTCGGCAAAATCTCCACATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CACAGCCG--------CAC--GTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--CGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAGAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCACACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAACGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCATTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGTCAGCTCTTCCGCC- Neofusicoccum_protearum_CBS114176 GAAAGCTTTTTCTTCCGCTGCACGC--------------AC-----GCAGGGTGCCGGGTTGCCGCACTCAATTTGTCTGATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG--TTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGC--------------------------CGCTAACGACCATC---TCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCTCCC-TT--A-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCGCAGCCTG--AAAATCAAGTT-AA---TGAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTATTGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGGA----TC-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGCAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCAGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGAAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTCTCTGGAATGAACGATGACGAAAGAGACGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTGTCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCATGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTTTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTACTGTCTCACTAGTCGCACAAGCACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAATAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_pruni_CBS121112 GAAAGTTTTT----CCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCGCTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGGCCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTC???????????????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCT-CT--C-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTATGAGCCGAATGTGTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGTGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCCCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA--CTCTCACTAATTGCACGCACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_ribis_CBS115475 GAAAGTTTTTCCTTCCGCTGCACGCGCTGGGTGCTGGGTGCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CACCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC--GGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTATGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACTCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCTGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTTGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTC?????????????????????????????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGTAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sinense_CGMCC318315 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTAGGTTCCTGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTC?????????????????????????????TCGAGCTTCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCT-TTG-GGGGGGGCTGGCCAGCGCCCGCTAGAGGACCACAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTTAAA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGTACAGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCTGGTTTGTTGCCAAAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGAATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sinoeucalypti_CERC2005 GAATGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGT??????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC---GGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTATGAGCCAAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACTCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGCTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp._MUCC2585 GAAAGTTTTTCCTTCCGCTGCACGC--------------------------GTGCTGGGTTCC-GTACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTGGTTTGTGCTTCGGCAAAAACTCCGCATTTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACGGC---------------CACGCGTGCAA-CAGACGCTAACGCTC------CCAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAA?????????????????????????????????-???????????????????????????-??????????????????????????????????????????????-------???????????????????????????????????--??????????????????????????--???????????-??---????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????-------------???????????????????????????????????????????????????--????????????????????????????????????????-------------------------?????????????????GATGACCCAGCGGAACATGGAGCTTCTGGAAGAATACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTTTGGGTTGGTGTTCATCGTGACCCGACCCAGCTCGTCTCTGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAGATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATCTTCACCGATGCAGGCCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCGTTCAGCCCGAACAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAGATTGATGTTTCTGGGATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCCGACGATCTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAACGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACTAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTTTGCGCCGTTTTCCGCGC----GAATGGCAATGGCTGACCTGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp._MUCC392 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCCAGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACAGCCATC---CCAGGAAGCCGCCGAGCTCGG?AAGGG???????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-AATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCGCCCT-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGACCCAGCGGAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGA?CCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACCCCC???????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_sp.MUCC241 GAAAGTTTTTCCTTCCGCTGCACGC--------------------------GTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGCGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-------GC--------CACGCGTGCGACCAGACGCTAACG---GCC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-AATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCGCCCT-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGACCCAGCGGAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2509 GAAAGTTTTTCCTTCCGCTGCACGC--------------------------GTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-------GC--------CACGCGTGCGACCAGACGCTAACG---GCC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-AATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCGCCCT-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGACCCAGCGGAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACC??????????????????-????-------????????????????CCC??GCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGA?CCCGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCA?CAG?TACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGA?CGTCTA?TTCAACGAGGTACTCT??CACTAATT?CACAAAC?CGTAAAGTATGGCAATCTT??GAACG?GCAGCA?GCGTCC?ACAACAA??ACGTTCCT?G?GCCG?CCT?GTCGACCTCGA?CCCGGCACCA?GGATGCCGTCCGCGCCGG?CCCTTCGGCCAG?T?TTCCGCC- Neofusicoccum_sp.MUCC2511 ?????????????????????????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????????--???--????????????????-------??--------????????????????????????---???---??????????????????????????????????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-AATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCGCCCT-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGA?CCAGC?GAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACCCCC???????????????-????-------????????????????????????????????????????????GCAGACCAT-TTCCGGCGAGCACGGCCT-GACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCC?AC?TGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATT?CACAAACACGTAAAGTATGGCAAT?TT?TGAACG?GCAGCA?GCGTCCAACAA?AA?TACGTTCCTCG?GCCG?CCT?GTCGACCTCGAGCCCGGCACCA?GGA?G??G?CCGCGCCGG?CCCTTCGG?CAGCTCTTCCG?C- Neofusicoccum_sp.MUCC2586 GAAAGTTTTTCCTTCCGCTGCACGC-------------------------GGTGCTGGG-TTCCGTACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTGGTTTGTGCTTCGGCAAAAACTCCGCATTTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACG-------GC--------CACGCGTGCAA-CAGACGCTAACG---CTC---CCAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCA???AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-TATGTGTACCTTACCTCCGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCTCCCC-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTTGCAGCCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACA-----------------TT-----TCTCAAGG??????????ATGACCCAGCGGAACATGGAGCTTCTGGAAGAATACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTTTGGGTTGGTGTTCATCGTGACCCGACCCAGCTCGTCTCTGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAGATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATCTTCACCGATGCAGGCCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCGTTCAGCCCGAACAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAGATTGATGTTTCTGGGATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCCGACGATCTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAACGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACTAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTTTGCGCCGTTTTCCGCGC----GAATGGCAATGGCTGACCTGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2660 GAAGATTTT-CGTTCTGCTGCCCGC--------------------------GTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-------GC--------CACACGTGCGATCGGACGCTAACG---ACC---TCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-CATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGACCCCCG-------GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGACCCAGCGAAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTACGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGTTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2662 GAAGATTTT-CGTTCTGCTGCCCGC--------------------------GTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-------GC--------CACACGTGCGATCGGACGCTAACG---ACC---TCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-CATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGACCCCCG-------GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACG-----------------TT-----TCTCAAGG??????????ATGACCCAGCGAAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTACGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGTTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2663 GAAGATTTT-CGTTCTGCTGCCCGC--------------------------GTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-------GC--------CACACGTGCGATCGGACGCTAACG---ACC---TCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-CATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGACCCCCG-------GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACG-----------------TT-----TCTCAAGG??????????ATGACCCAGCGAAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTACGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGTTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2666 GAAGATTTT-CGTTCTGCTGCCCGC--------------------------GTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-------GC--------CACACGTGCGATCGGACGCTAACG---ACC---TCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-CATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGACCCCCG-------GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC------------------TT-----TCTCAAGG??????????ATGACCCAGCGAAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTACGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCGCAGGCAGACCATCTTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGTTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC2669 GAAGATTTT-CGTTCTGCTGCCCGC--------------------------GTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGACCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-------GC--------CACACGTGCGATCGGACGCTAACG---ACC---TCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-CATGTGTAC--TACCTCTGTTGCTTC-GCGGGCCGCGGTCCTCCGCACCGACCCCCG-------GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACG-----------------TT-----TCTCAAGG??????????ATGACCCAGCGAAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTACGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACCCCCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCAACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGTTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_sp.MUCC650 GAAAGTTTTTCCTTCCGCTGCACGC--------------------------GTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTTGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-------GC--------CACGCGTGCGACCAGACGCTAACA---GCC---CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACC-AATGTGTAC--TACCTCTGTTGCTTT-GCGGGCCGCGGTCCTCCGCACCGGCGCCCT-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGTCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCCCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGAC-------------------------??????????????????ATGACCCAGCGGAACATGGAGCTCCTCGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCCGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGATGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGACGAAGAAGACGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACCCCC???????????????-????-------?????????????????????????????????????????????????????-?????????????????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Neofusicoccum_sp.MUCC789 GAAAGTTTTTCCTTCCGCTGCACGC--------------------------GTGCTGGG-TTCCGTACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTGGTTTGTGCTTCGGCAAAATCTCCGCATTTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACG-------GC--------CACGCGTGCAA-CAGACGCTAACG---CAC---CCAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACCTTACCTCCGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCCC-------GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTTGCAGCCTG--AAAAACAAGTT--A---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACA-----------------TT-----TCTCAAGG??????????ATGACCCAGCGGAACATGGAGCTTCTGGAAGAATACGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTTTGGGTTGGTGTTCATCGTGACCCGACCCAGCTCGTCTCTGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAGATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATCTTCACCGATGCAGGCCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCGTTCAGCCCGAACAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAGATTGATGTTTCTGGGATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCCGACGATCTGAGAGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAACGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACTAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTTTGCGCCGTTTTCCGCGC----GAATGGCAATGGCTGACCTGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_stellenboschiana_CBS110864 GAAGATTTTTCGTTCCGCTGCCCGC--------------GC-----GAT-GGTGCTGGGATGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGATCGGACGCTAACGACCGTC---TCAGGAAGCTGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGTGGGCCGCGGTCCTCCGCACCGACCCCCG-TT--C-GGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCCAATGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGCGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCCCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAACGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTACTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGAGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCCCCCAACCCAAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCGCAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_terminaliae_CBS125263 GAAAGTTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACCCAATTTGTCTTATCGCGTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACGTGTGCGACCGGACGCTAACGGCCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCC-TT--CGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAGGACGAAGAGAGCAAACGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCATTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_umdonicola_CBS123645 GAAAGTTTTTCCTTCCGCTGCACGC--------------GCTGGGTGCTGGGTGCTGGGTTCCTGCACTCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCCGCGCTAAGCCTCGTTCGGGC-TCGGCAAAATGTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACA-C---GCCA--------CGCATGTGCGACCAGACGCTAACGGCCATC---CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCT-TC--GGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAA--CTCCAGTCAGTGAACTTCGCAGCCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TTATT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTCGAAGAGTATGAGCCGAATGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACTCAGCTTGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCTGGTCGGGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCTCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTTGAGTACATGGATGCGGAAGAAGAGGAGGTGGCGATGATTACCATGACTCCTGACGATTTGAGGGCGCACCACCGGGCCCGTCAAGGCATTATCGACGAAGAAGATGAAGAGAGCAAGCGGAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAATACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCACGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCTGCGCCGTTTCCCGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_ursorum_CBS122811 GAAAGTTTTTCCTTCCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACGTGTGCGACCGGACGCTAACGGCCA-----CCAGGAAGCCGCCGAGCTCGGCAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGACTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCTCCC-TT--CGGGGGGCTGGCCAGCGCCCGCCGGAGGACCATAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAATACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACCCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGACAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACCTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCAGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGACGATTTGAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAAAGCAAACGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCTTGCGC----GAACGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCATTAATTGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_variabile_CMW37739 ?????????????????????????--------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????????????--???--????????????????-------??--------????????????????????????---???---????????????????????????????????????????????????????????GATTCGAGCTCCG-GCTCGACTCTCCCACCCCATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCG-TT---TGGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AGAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGC-------------GGACGCGCCTCGAAGACCTCGGCGGCGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----T---------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????-------????????????????????????????????????????????GCAGACCAT-TTCTGGCGAGCATGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_versiforme_CBS118101 GAAAGTTTTTCCTTCCGCTGCGCGC--------------GT-----GCTGGGTGCTGGGTTCCCGCACCCAATTTGCCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGGTTTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CTCATGTGCGACCGGACGCTAACGATCATC---ATAGGAAGCCGCCGAGCTCGGCAAGGGTTC????????AAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCTCCC--TC--C-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCTGC-------------GGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGAA----TT-TTTTTTCTTTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAACGTCTCGCCAAACGCCACCAAGATTTTCATCAACGGTGTCTGGGTTGGTGTCCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGTACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGACGATCCGTTCAGCCCGAACAAGGGTAACTTGGTCTTGGCCCGAGAGCACATCGACAAATTGGAGGC-AGATCAAGAAATTGACGTTTCTGGAATGAACGATGACGAAAGAGACGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACTCCCGATGATCTGAGGGCGCACCACCGGGCTCGCCAAGGCATTATCGATGAGGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTC?????????????TTCTGGTTTGTTGCC-AAAAACACTCCCGCTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCCCCGTTCCCCGCGC----GAATGGCAATGGCTGACCCGCAACAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTACTCTCTCACTAATTACACAAACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGTCAGCTCTTCCGCC- Neofusicoccum_viticlavatum_CBS112878 GAAAGTTTTTCCTTCCGCTGCACGC--------------AC-----GCCGGGTACTGGGTTGCCGCACTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTAGGCCCGCGCTAAGCCTCGTTTGTGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGACCGAA--GCG--CGCCCCTCGCCAGATT-CGCAGCCA--------CACGTGTGCGACCGGACGCTGACGACCA-----CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCCTTT--CGGGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTAAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCATGGCGCCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTCTTCATCATTGACGATGATCCATTCAGCCCGAATAAAGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGGGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGCGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCAATGATTACCATGACTCCCGACGATTTAAGGGCGCACCACCGGGCTCGTCAAGGCATTATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCTCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTCCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCATTTCGTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACAAACCACTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- Neofusicoccum_vitifusiforme_CBS110887 GAAAGTTTTT----CCGCTGCACGC--------------AC-----GCTGGGTGCTGGGTTGCCGCGCTCAATTTGTCTTATCGCTTCGGTGAGGGGCATTTTGGTGGTGGGGTCAGCCCGCGCTAAGCCTCGTTTGCGCTTCGGCAAAATCTCCGCATCTGG-TTTTTTGCGACCGGCGTGCGGCCGAA--GCG--CGCCCCTCGCCAGACT-CGCAGCCA--------CACATGTGCGACCGGACGCTAACGACCA-----CCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTAAGGATCATTACCGAGTTGATTCGAGCTCCG-GCTCGACTCTCCCACCCTATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCCCCCCCTT--C-GGGGGCTGGCCAGCGCCCGCCAGAGGACCACAAAA--CTCCAGTCAGTGAACGTCGCAGTCTG--AAAAACAAGTT-AA---TAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTT-GGTATTGGGCTCCGTCCTCCAC-------------GGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGA--AAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTGAA----TT-TT-----TCTCAAGGTTGACCTCGGATGACCCAGCGGAACATGGAGCTTCTGGAAGAGTATGAGCCGAATGTCTCGCCAAACGCCACTAAGATTTTCATCAACGGTGTCTGGGTTGGTGTTCATCGTGACCCAACCCAGCTCGTCTCCGTCGTTAAGAAGCTGCGCCGAGACGGCACTCTGTCTGCGGAAATGAGTCTTATTCGTGATGTCCGTGATAGGGAGTTCAAGATTTTCACCGATGCAGGTCGAGTGTGCAGGCCTCTGTTCATCATTGACGACGATCCATTCAGCCCGAATAAGGGGAACTTGGTCTTGGCCCGAGAGCACATCGACAAACTGGAGGC-AGATCAAGAAATCGACGTTTCTGGAATGAATGATGACGAAAGAGATGAGAAGAGGTATGGCTGGAAGGGGTTGCTGCAGAGTGGTGTGGTCGAGTACATGGATGCGGAAGAAGAGGAGGTTGCGATGATTACCATGACCCCCGACGATTTGAGGGCGCATCACCGGGCTCGTCAAGGCATCATCGATGAAGAAGACGAAGAGAGCAAGCGCAACAGGGATCCCCACGAGCGTGTCGTCCCGGCTCCCAACCCGAGTGTCAAGCAGTACACGCTTCTGGTTTGTTGCC-AAAA-------CACTGCCGCTCCCGCGCCCCCGCTGACGCGAATCGACACCACAGGCAGACCAT-TTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGC----GAATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACTCTCTCACTAATTGCACGCACACGTAAAGTATGGCAATCTTCTGAACGCGCAGCAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTTGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC- ; END; BEGIN TREES; TITLE Neofusicoccum_in_Japan; LINK TAXA = Taxa1; TRANSLATE 1 Botryosphaeria_dothidea_CBS100564, 2 Neofusicoccum_parvum_CBS138823, 3 Neofusicoccum_algeriense_ALG1, 4 Neofusicoccum_hongkongense_CERC2973, 5 Neofusicoccum_sinoeucalypti_CERC2005, 6 Neofusicoccum_italicum_150900, 7 Neofusicoccum_ribis_CBS115475, 8 Neofusicoccum_kwambonambiense_CBS123639, 9 Neofusicoccum_batangarum_CBS124924, 10 Neofusicoccum_umdonicola_CBS123645, 11 Neofusicoccum_occulatum_CBS128008, 12 Neofusicoccum_cordaticola_CBS123634, 13 Neofusicoccum_andinum_CBS117453, 14 Neofusicoccum_arbuti_CBS116131, 15 Neofusicoccum_nonquaestitum_CBS126655, 16 Neofusicoccum_macroclavatum_CBS118223, 17 Neofusicoccum_grevilleae_CPC16999, 18 Neofusicoccum_brasiliense_CMM1285, 19 Neofusicoccum_hellenicum_CERC1947, 20 Neofusicoccum_variabile_CMW37739, 21 Neofusicoccum_illicii_BJFU2037, 22 Neofusicoccum_sinense_CGMCC318315, 23 Neofusicoccum_mangiferae_CMW7024, 24 Neofusicoccum_eucalypticola_CBS115679, 25 Neofusicoccum_eucalyptorum_CBS115791, 26 Neofusicoccum_sp._MUCC392, 27 Neofusicoccum_sp.MUCC650, 28 Neofusicoccum_sp.MUCC241, 29 Neofusicoccum_sp.MUCC2509, 30 Neofusicoccum_sp.MUCC2511, 31 Neofusicoccum_sp.MUCC2669, 32 Neofusicoccum_sp.MUCC2662, 33 Neofusicoccum_sp.MUCC2663, 34 Neofusicoccum_sp.MUCC2660, 35 Neofusicoccum_sp.MUCC2666, 36 Neofusicoccum_sp.MUCC2586, 37 Neofusicoccum_sp.MUCC789, 38 Neofusicoccum_stellenboschiana_CBS110864, 39 Neofusicoccum_luteum_CBS56292, 40 Neofusicoccum_cryptoaustrale_CBS122813, 41 Neofusicoccum_australe_CBS139662, 42 Neofusicoccum_lumnitzerae_CMW41469, 43 Neofusicoccum_mangroviorum_CMW41365, 44 Neofusicoccum_vitifusiforme_CBS110887, 45 Neofusicoccum_mediterraneum_CBS121718, 46 Neofusicoccum_pistaciarum_CBS113083, 47 Neofusicoccum_terminaliae_CBS125263, 48 Neofusicoccum_ursorum_CBS122811, 49 Neofusicoccum_viticlavatum_CBS112878, 50 Neofusicoccum_corticosae_CBS120081, 51 Neofusicoccum_pruni_CBS121112, 52 Neofusicoccum_pistaciicola_CBS113089, 53 Neofusicoccum_pistaciae_CBS59576, 54 Neofusicoccum_protearum_CBS114176, 55 Neofusicoccum_versiforme_CBS118101, 56 Neofusicoccum_microconidium_CERC3497, 57 Neofusicoccum_pandanicola_KUMCC170184, 58 Neofusicoccum_pennatisporum_MUCC510, 59 Neofusicoccum_buxi_CBS11675, 60 Neofusicoccum_sp._MUCC2585; TREE Imported_tree_1 = [&R] ((59:0.0901308674029746,(55:0.014297292446344331,(((25:0.010162301084769308,24:0.01159995605877157):0.025671738422812496,((37:7.173529918315201E-4,(36:1.00000050002909E-6,60:9.893839514872132E-4):0.0030690895652727844):0.0058617398150462964,(23:0.003322528424430006,56:0.0018750044879306137):1.00000050002909E-6):0.017746503558189734):0.010038844282707206,(((((15:0.005755749010595381,(14:0.0024732017274127754,13:0.0037063454990043853):0.00712928417444192):0.008703273290209609,(((22:0.010079008677894429,(18:0.0032840491443629693,8:0.0053730459712885825):0.0010458289230447773):0.0010929005717996273,((17:0.03373547012390326,12:0.0033748817269301395):0.003649644974645548,((9:0.002019868378550579,(10:0.0033770010458105794,7:0.0020762660509667926):1.00000050002909E-6):0.0013440728812226365,(11:0.00201926603919883,(5:6.081319036331227E-4,21:0.0066592352775598235):7.561464514045953E-5):0.0013561397684857279):0.002035466690331598):6.750748685935231E-4):0.001403904857316187,(((30:1.00000050002909E-6,(26:1.00000050002909E-6,((57:1.00000050002909E-6,2:1.00000050002909E-6):6.896823354553305E-4,(27:1.00000050002909E-6,(28:7.072973127004373E-4,29:7.370555199683518E-4):7.070329320764335E-4):0.004995001241794447):1.00000050002909E-6):9.50227566210652E-4):0.0034409832211832496,(3:0.004804287218764528,6:1.00000050002909E-6):0.002103483030633404):0.0013246213122140092,4:0.0013709293412939169):0.0017219506566659942):0.006883692535248824):0.0015578026801477069,16:0.008877625268625308):0.0066470093605742455,58:0.07063011150314884):0.002343575719389787,((40:0.015065643079993706,((20:0.0021341903677613034,42:0.002361594940131772):0.008931642496136398,((43:0.003577631952798255,39:0.00202747382064936):0.0055381788791404925,(38:0.0013494653254387053,(41:0.004979353732591157,(31:7.021880954733848E-4,((34:1.00000050002909E-6,35:1.00000050002909E-6):1.00000050002909E-6,(33:1.00000050002909E-6,32:1.00000050002909E-6):1.00000050002909E-6):1.00000050002909E-6):0.010135153906236065):6.914520639287963E-4):1.00000050002909E-6):0.0017227661609696765):0.008225342027673412):0.013559592670732633,((51:0.002451148347516562,(44:0.0031625478977491176,50:9.736059779024426E-4):0.0014087407111662027):0.007376031391337157,((49:0.012238347979621287,((52:7.372923492604003E-4,(46:0.001406123811314317,45:0.0012952584553223082):6.73040985725529E-4):0.005046072118883126,(47:0.0023628065240962437,48:0.005847420841496552):6.331311104150912E-4):0.004510088865245608):6.303065417746488E-4,(54:0.026053279457569786,(53:0.022724590320530418,19:0.005212424757971639):0.0025063585604708197):1.00000050002909E-6):0.001435255199622965):8.582791198762074E-4):0.0070387032878318784):0.006814010220048101):0.003727760811573518):0.02015715354165559):0.10021635430566025,1:0.10021635430566025); END;