#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:26 GMT TreeBASE (cc) 1994-2008 Study reference: Marin-felix Y., Gramaje D., Halleen F., Mostert L., & Spies C.F. 2021. Genera of phytopathogenic fungi: GOPHY 4. Studies in Mycology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S27583] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=26; TAXLABELS 'Aequabiliella effusa CBS_120883' 'Celerioriella dura CBS_120882' 'Celerioriella petrophiles CPC_29256' 'Celerioriella prunicola CBS_120876' 'Dolabra nepheliae CBS_123297' 'Minutiella tardicola CBS_121757' Moristroma_japonicum_BN1674 Moristroma_quercinum_BN1678 'Neophaeomoniella corymbiae CBS_145092' 'Neophaeomoniella eucalypti CPC_25161' 'Neophaeomoniella eucalyptigena CBS_145093' 'Neophaeomoniella niveniae CBS_131316' 'Neophaeomoniella zymoides CBS_114904' 'Neophaeomoniella zymoides CBS_121168' 'Paraphaeoisaria alabamensis CBS_101.77A' 'Paraphaeoisaria alabamensis CBS_101.77B' 'Paraphaeomoniella capensis CBS_123535' 'Phaeomoniella chlamydospora CBS_117179' 'Phaeomoniella chlamydospora CBS_229.95' 'Phaeomoniella pinifoliorum CBS_114903' 'Pseudophaeomoniella oleae CBS_139191' 'Pseudophaeomoniella oleicola CBS_139192' 'Rhynchostoma proteae CBS_112051' 'Strelitziana cliviae CPC_19822' 'Strelitziana malaysiana CPC_24874' 'Xenocylindrosporium kirstenboschense CBS_125545' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=38; TAXLABELS 'Aequabiliella effusa CBS_120883' 'Aequabiliella palatina JKI_Ap36' 'Celerioriella dura CBS_120882' 'Celerioriella petrophiles CPC_29256' 'Celerioriella prunicola CBS_120876' Celerioriella_umnquma_CSN1091 'Celothelium cinchonarum F_17105_f' 'Dolabra nepheliae CBS_123297' 'Heterophaeomoniella pinifoliorum CBS_114903' 'Minutiella pruni-avium CBS_145513' 'Minutiella simplex JKI_Jn27' 'Minutiella tardicola CBS_121757' 'Moristroma germanicum JKI_Feb06' Moristroma_japonicum_BN1674 'Moristroma palatinum JKI_Au02' Moristroma_quercinum_BN1678 'Neophaeomoniella constricta JKI_Mz35' 'Neophaeomoniella corymbiae CBS_145092' 'Neophaeomoniella eucalypti CPC_25161' 'Neophaeomoniella eucalyptigena CBS_145093' 'Neophaeomoniella niveniae CBS_131316' 'Neophaeomoniella ossiformis JKI_May03' 'Neophaeomoniella zymoides CBS_114904' 'Neophaeomoniella zymoides CBS_121168' 'Paraphaeoisaria alabamensis CBS_101.77A' 'Paraphaeoisaria alabamensis CBS_101.77B' 'Paraphaeomoniella capensis CBS_123535' 'Phaeomoniella chlamydospora CBS_117179' 'Phaeomoniella chlamydospora CBS_229.95' Pseudophaeomoniella_globosa_CSN185 'Pseudophaeomoniella oleae CBS_139191' 'Pseudophaeomoniella oleicola CBS_139192' 'Rhynchostoma proteae CBS_112051' 'Strelitziana cliviae CPC_19822' 'Strelitziana malaysiana CPC_24874' Vredendaliella_oleae_PMM1193 'Xenocylindrosporium kirstenboschense CBS_125545' Xenocylindrosporium_margaritarum_CSN1179 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M57834] TITLE 'Phaeomoniellales ITS-28S-TEF-TUB2'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=2226; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Aequabiliella effusa CBS_120883' CTGAG-TAAGGGTGT------TCTACGCCCG-ATCTCCAACCCTATGTTAA-AAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTTT-------------------CGGGACCGCCGGAGGC---ATTC--CAG-------CCTCTGGTCAG--TGCTTGCCAGTAGCCAATT-CA-----AATTC---TTTATTAAA-AAT-GAAGTCTGAATC--TTTAATT------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGCC-CT--TA----------TCGTT-----AAGGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-CGAAA-----GGT-TTTGTTGTCCCGGCCTT-TTTTGCTT------CGGCAAA------------------GATTTTTCAAAG-GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTCTGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGGTTGCAACCAGACTTGTGTGTAACAGTTCAACCTTGGTTTTCCAAGGCCTATTCTGTTA-TACCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCATCGGGAATGTATCTACCCCTC--GGGGTCGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-AT--TTGCTCGGATGCTGGCGTAATGGTTGTAACCGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCGAGAAGTTCGAGAAGGTAAGAATACATACCCAG----CTCAT-CACATTTTGCTGCCTTATCGCGCTTT----GTGAAAAATTTGGTGGGGGCGGGGCAGACTTCCA------AACGCCC----CCCTTGTGTCAGGCAGGAATTGCACAGACCACAAT------CATCACTTTTGC-----------------------------------AAACCACCTCACAATCACACGGACCAGATAGCTAACA--ATTCCTAACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAATGGTAAGCTGACATCCTC--GTTTCCGC-----GCTCTCAGACGCGACGTTTACCT-CGAATCCGAAACTCACATAC-TCGCAGGCAAACCATCTCCGGCGAACACGGTCTTGACGGATCTGGCGTGTAAGTGGACACTGGTT----GGAAGGC------TTCTGGACAATGTCTGAT-TTTGCACAGCTACAATGGTACCTCCGACCTTCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTAATACAACTCCCTGTACAT--CGAACTGCAT--CACGATGCTGAT-----CTTCTCCAGGCTTCCAACAACAAGTATGTTCCACGTGCCGTCCTTGTCGATCTCGAACCAGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAACTCTTCCGTCCAGACAACTTCGTCTTTGG 'Aequabiliella palatina JKI_Ap36' CTGAG-TAAGGGTGT------TTTACGCCCG-ATCTCCAACCCTATGTTAA-AAC-AC----TTTGTTGCTTTGGTAGGCCCGTCTTT-------------------CGGGACCGCCGGGGGC---ATTC--CAG-------CCTCTGGTCAG--TGCTTACCAGTAGCCAATT-CA-----AATTC---TTTCTTAAT-AAT-GAAGTCTGAATC--TTAATTA-------AA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-CGAAA-----GGT-TTTGTTGCTCCGGCCTTATTTTGCTT------CGGCAAA------------------TATTTTTC-------------------------------------------CGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTCTGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGGTTGCAACCAGACTTGTGTGTAACAGTTCAACCTTGGTTTTCCAAGGCCTATTCTGTTA-TACCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCATCGGGAATGTATCTACCCCTC--GGGGTCGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-AT--TTGCTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCAGACGCGACGTCTACCT-CGAATACGAAACTCACATAC-TCGCAGGCAAACCATCTCCGGTGAACACGGTCTTGATGGATCTGGCGTGTAAGTCGGCACTGGTC----GAAAGGC------TTCTGGACAATGTCTGAC-TTTGTACAGCTACAATGGTACCTCCGACCTTCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTAATACAACTCCTTGTACAT--CGATGTGGAT--CACGATGCTGAT-----TATCTCCAGGCATCCAACAACAAGTATGTTCCACGTGCCGTCCTCGTCGATCTCGAACCCGGTACAATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAACTCTTCCGTCCA----------------- 'Celerioriella dura CBS_120882' ATGAG-TTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTTTAAACC-AC----TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGGCCGCCGGGGAT---ATTCAGTTA-------TCTCTGGTCCG--CGCTTGCCAATAGCCAAACATA-----AATTC---TTTTATAACGAAT-GCAGTCTGATAA--TCAATTA-----TTAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----ACAGATAGGCCCGAAAGATAATGGCGGC-GTCAATACATGACCCCAGGTGCAGCGAGC-TTAT-------AGCATACAC-TTGACG----GTT-TGGATTGGCCCGGCCTT-TGTTCTCTAGTTA-AAGCAAT--TTAACGAACAGATCATTTTTTTTTAAAG-GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAAGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTAGGGCCCTATGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCGCAGTGGCCCATTCCGTTA-GTTCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACACCTTCGGGAGTAGACTTATAGCCCTTGGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-TT--CGGCTCGGATGCTGGCGTAATGGTTGTAAGCGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCGAGAAGTTCGAGAAGGTATGATCACAATTTCCATCATCCCCT-CACATTTTGCTGTCTTATCAGTGCTGG---GTGAAAATTTTGGTGGGGGCGGGGCATATTTCAA------AACAA-------CCCTGCCTCACCGCAAATGGACGCCTGCACCAACAAATTGGATATTTT-------GTCACCTCATGAGATA--------------GCATTATGAAATTG-TCGAGCGTGAATATGTTACTAAC---TATCCTAATAGGAAGCTGCCGAACTTGGTAAGGGTTCCTTCAA-----------------------------------------------------------------ATACTCATATTA-TCATAGGCAAACTATCTCTGGCGAGCATGGTCTCGATGGCTCTGGCATGTGAGTGTGGCATAAAAC-TCGAGACTA------AGACAAGTTTTCTAACGG-TTACAACAGCTACAATGGTACCTCAGACCTCCAACTCGAGCGTATGAACGTCTACTTCAACGAGGTACGATCACTTCAACCTCTG--CAAATAAAAA--AGCGATGCTGAT-----TCAAAATAGGCATCCGGCAACAAATATGTCCCACGTGCAGTCCTCATCGATCTTGAACCTGGTACCATGGATGCTGTCCGTGCTGGTCCATTCGGTCAACTTTTCCGCCCAGATAACTTCGTTTTCGG 'Celerioriella petrophiles CPC_29256' CTGAG-TTAGGGTCC------TCTGGGCCCGAACCTCTCACCCTTTGTTTA-AAC-AC----TTTGTTGCTTTGGCAGGCCCGACCTC-------------------CGGGACCGCCGGGGGC---GTTCAATCG-------CCTCTGGCCAG--TGCCTGCCAATAGCCTATCGTA-----AATTC---TTCTTTAAC-TAT-GAAGTCTGAACT--ATAATTA------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCTC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-AC---------------------------------------------------------------------------------------------------------------------------------------------------------------ACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAAGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCTGCGTCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCCAACGGTTCAACCACTGTTTTCAGTGGCCTATTCCGTTG-GTCCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGACTTGGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTTTGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-TT--CTGCTCGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Celerioriella prunicola CBS_120876' CTGAG-TTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTTAA-AAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTCT-------------------CGGGACCGCCGGGGGC---TTTT--CTG-------CCTCTGGTCAG--TGCTTGCCAATAGCCAATATTA-----AATTC---TTCTTTAAC-GAT-GAAGTCTGATAACTATAATTA------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-ATGACCCCAGGTGCAGCGAGC-TTAT-------AGCATACACTTGTGGT----GGT-CTTGTTGGCCTGGCCCC-TTTAGTTA------AAACTAT--TTTAAC------------TTACTTAAAG-GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAAGCTTAGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTAGGGCTTTATGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCTCAGTGGCCCATTCCGTTA-GTTCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACAGCTTCGGTTGTAGACTTATAGCCCTCGGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAAGCCACAAATCCTCTAAACTTTCCGAAAAAAAAAAGACGCGACAACGATAT-CGAACACGATGCTCATACAA-CCACAGGCAAACTATCTCCGGCGAACATGGTCTTGATGGCTCTGGCGTGTAAGTGTGGCATAATTC--TGAAGCTG------GAGCAACACTGCTGACGC-CTGAAAAAGCTACAATGGCACCTCAGACCTCCAACTTGAGCGCATGAACGTCTACTTCAACGAGGTACATACATTTCGAGCCCTG--CAATACCACA--AGCGATGCTGAC-----TAGGAAAAGGCTTCTGGCAACAAGTATGTCCCACGTGCCGTCCTCGTCGATCTTGAACCTGGTACCATGGATGCTGTCCGTGCCGGTCCATTCGGTCAACTCTTCCGCCCAGATAACTTGG------- Celerioriella_umnquma_CSN1091 CTGAG-TTAGGGTCC------TCTGGGCCCGAACCTCCAACCCTTTGTTTATACC-AC----TTTGTTGCTTTGGCAGGCCCGACCTT-------------------CGGGACCGCCGGGGGC---GTTCGATCG-------CCTCTGGCCAG--CGCTTGCCAATAGCCTATT-CA-----AATTC---TTCTTTAAC-CAT-GAAGTCTGAACA--ATAATTA------TAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCTC-------GGCTTGTTATTGGGTC-CTC-TA----------TCGTT-----ACAGATAGACCCGAAAGATAATGGCGGT-GTCAACA-ATGACCCCAGGTGCAGCGAGC-TTAT-------AGCATACAC-TGTGGT----GGT-TTTGTTGGCCTTGCCTT-TGTAGTTA------GGATTTC--TTAACT---------ATTCTTTTTTAAA-GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTAAAGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGCCCTATGCTGCATCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCTCAGTGGCCTATTCCGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGGCATCGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTTTGTGTAATGTGGCCTACCTAGACTGAGGAACGCGCTTT--TTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--TAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAACATCGAGAAGTTCGAGAAGGTAAGAATCCTCTACT------CTCTT-CGCTTCTTGCAGCCTTATCAGCGCTTGG--ATGAAAATTTTGGTGGGGGCGGGGCGGATCTCAA------AACAG------CCCTTGTTTCACCGCAAGAACCGACCCCTCCACAT------CATCATCTCAAGCCTGCCATTCCTGGCGCCTCGCAGCAGTG------CAAGACAATACAAACATAACAGCAACAATAACTAAC---GAGCACAATAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Celothelium cinchonarum F_17105_f' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGCAA-GTTGTGGTTC-AGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTCGAACCGTATGCCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCA?TTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTGGCAACCAGACTTGTGTACGGCGGTTCCGCCATCGTTCGCGATGGTTCATTCCACCGTGTCCAGGCCAGCATCGGTTGCGGCGGTGAGTTAAAGGCTTGGGGAAGGTATCAACCTCC----GGGTTGACTTATAGCCCCAGGTGTCATGCCACCTGTCACGACCGAGGCACGCGC-TC--CGGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTGCGCGTAATGAAAGTGAACGGAGGTAGGAACCC---TT-GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dolabra nepheliae CBS_123297' TCGAG-TTTGGGTCC-----TTCGGGGCCCC-ATCTCCAACCCTTTGTTTACATC-AC----TTTGTTGCTTTGGCAGGCCCGTCCCCTGGGTTCCA----------GGGGACCGCCGGGAGC---GTCTG-ACG-------CCTCTGGCCAG--CGCCTGCCGATAGCCAATTTAA-----AATTC---TTTTAGTGA-AAT-GCTGTCTGAATT--GAAAACA-------TA---AATTCATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCTTCAAGCCC-------GGCTTGTCATTGGACC-CGATCC----------ATCTC-----ATGGATCCATCTGAAAAATAATGGCGGTGGACGCAA-ATAGCCCCTGGCAGAGTGAGC-TTTA-------CGCATCAGT-CACGGC----GGT-CGTTGCAGCCC-------------------------------------CCG---------------------------------------------------------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-------GGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAATGCGGGGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCCTTTGCAGCGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCTC--TGGTGTATTCCGTGT-CCACAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGGGAATGTACCTACGCC----GGGGTAGACTTATAGCCCCGGGTGCAATGTGACCCGCCGAGACTGAGGTACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGT?????????????????????????????????????????????????????????????????????????????GGAGGTAGGATCCCG--C-AGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Heterophaeomoniella pinifoliorum CBS_114903' -------TAGGGTCT------TCTGGGCCCGAACCTCCAACCCTATGTTTA-ACT-AC----TTTGTTGCTTTGGCAGGCCCGCCTTT-------------------CGGGGCCGCCGGAGGG---GTTAAGTCA-------CCTCTGGTCAG--TGCTTGTCAGTAGCCAATC-TA-----AATTC----TTTATAAT-TAT-GAAGTCTGAATC--TTTAATT------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTATTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CCT-TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCATGA-ATGACCCCAGGGGCAGCGAGC-TTAT-------AGCATACAC-TGAGGT----GGTCTTTGTGGGCGCGGCCCCTTTTCGTTA------AAGCAAT--TTAAC-------------TAAACTCAAA-GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAACGTTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTATACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCATCACTGTTCTCAGTGGTCTATTCCGTTATATCCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCTTGGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTAAGAACCCG--CAAGGGTGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAACATCGAGAAGTTCGAGAAGGTAAGATGATATCTTGCATT--CCATT-TTCTTTTTACCGCCTTATCAACGCTGAG-TGCGAAAATTTTGGTGGGGGCGGGGACAGTCTCA-------AACAG------CCCTTGATTCATCAACG------CCTCTCCCCCAC------CATCACTTCTGA-----------------------------------AGCCCAGCGTAACGTATCAAGGACAACTTTACTGACT--ACGTGTAATAGGAAGCCGCTGAACTCGGTAAGGGTTCCTTCAATGGTAAGCCAAGATTTCCTTCGC---------GCTGATTAGACGCGACGTCCACCT-CGAATTGAAAACTCATACTT-TGATAGGCAAACCGTCTCTGGCGAACACGGTCTTGATGGATCTGGCGTGTAAGTTGGGACAACAT----GAACAACC-----ACACAACAATTTTCTGAT-CTTGAATAGCTACAATGGTACCTCCGATCTTCAACTAGAGCGCTTGAACGTCTACTTCAACGAGGTAAAGAGAAACAGAAGTATC--TCATACCATG--CATCAAGCTAAC-----ACTTACCAGGCATCTGGAAACAAATATGTCCCGCGTGCTGTCCTTGTCGATCTTGAACCAGGTACCATGGATGCAGTCCGCGCCGGTCCTTTCGGCCAACTTTTCCGACCCGACAACTTCGTCTTCG- 'Minutiella pruni-avium CBS_145513' CCGAG-TAAGGGTGC-------TTGCGCCCG-ATCTCCAACCCTGTGTTTAAACTACC----ATTGTTGCTTTGGCAGGCCCGTCCTT-------------------TGGGGCCGCTGGGGGG---GTTCAGTCA-------CCCCTGGCCAG--TGCTTGCCAGTAGCCTATC-AA-----AAATC---TTTTATAAC-TAT-GTCGTCTGAATC--ATAATTA------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCCC-------GGCTTGTCATTGGGCC-CT--TA----------TCGTT-----ACAGATAGGCCTGAAAGATAATGGCGGT-GTCGAGA-ACGACCCCAGGTGCAGCGAGC-TTAT-------AGCACACAC-TGAAA-----GGT-CCTCTTGTCCCGGCCTA-TGACTTCTTCCCCCCGGGGAC--------------AGAAATTCACTTCAAAG---------------------GATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCTTCGGTTTAAATCCCTTGGAACAGGGTGTCACAGAGGGTGAGAGTCCCGTCTTGAACCGTATGCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGTAACCAGACTTGAGTTGGGCGGTTCTACCGCGGTTCGCCGTGGCCTATTCCGTCCGATCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGACCTCGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCGGGGTGCAATGTGACCTACCTGGACCGAGGAACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTATAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAAGCTGAGACTTTCACCTCTCGCG-----ACATCCAGACGCGACAGATAATT-CGAACTCCGAGCTCATACAA-TTTCAGGCAAACAATCTCTGGTGAGCATGGTCTTGACGGCTCCGGCGTGTAAGTTGGCACAGAC-----TTGATGG------TATTGGGCAGCTTCTAAT-CCATCACAGCTACAATGGCAACTCCGATCTTCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTAATTACAAGACAGGATTTC--TGAAATTACGAATACTTCATTGAC-----CAATTCAAGGCGTCAAACAACAAATATGTCCCCCGTGCCGTCCTTGTCGACCTTGAGCCCGGTACCATGGATGCCGTTCGCGCTGGTCCATTTGGTCAACTCTTCCGCCCAGACAACTTCGTTTTCGG 'Minutiella simplex JKI_Jn27' CCGAG-TAAGGGTGC-------TTGCGCCCG-ATCTCCAACCCTGTGTTTAAACTACC----TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGGCCGCTGGGGGG---GTTCAGTCA-------CCCCTGGCCAG--TGCTTGCCAGTAGCCTATC-AA-----AAATC---TTTTATAAC-CAT-GTCGTCTGAATC--ATAATTA------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCCC-------GGCTTGTCATTGGGTC-CT--TA----------TCGTT-----ACAGATAGGCCTGAAAGATAATGGCGGT-GTCGAGA-ACGACCCCAGGTGCAGCGAGC-TTAT-------AGCACACAC-TGAAA-----GGT-CTTCTCGTCCCGGCCTA-TGACTTCTTCCCCCCGGGGAC--------------AGAAATTTACTTAAAAG----------------------------------ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCTTCGGTTTAAATCCCTTGGAACAGGGTGTCACAGAGGGTGAGAGTCCCGTCTTGAACCGTCTGCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGTAACCAGACTTGAGTTGGGCGGTTCTACCGCGGTTCGCCGTGGCCTATTCCGTCCGATCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGACCTCGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCGGGGTGCAATGTGACCTACCTGGACCGAGGAACGCGC-AT--CTGCTCGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGACGCGACATACATTT-CGAACTCTGAGCTCATACAA-TTTCAGGCAAACAATCTCTGGCGAGCATGGTCTTGACGGCTCCGGCGTGTAAGTC-GCCCAGAT-----TTGATGG------CGTTGGGCAGCTTCTAAT-CCATCGCAGCTACAATGGCAACTCCGACCTTCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTACTTACAAGACAAGATATC--TGAGGCTATGAATTCTGTATTGAC-----CAGTTCAAGGCATCAAACAACAAATATGTTCCCCGTGCCGTCCTTGTCGACCTTGAGCCCGGTACCATGGACGCCGTTCGCGCTGGTCCATTCGGTCAACTCTTCCGACCAGACAACTTCG------- 'Minutiella tardicola CBS_121757' CCGAG-TAAGGGTGC-------TTGCGCCCG-ATCTCCAACCCTGTGTTGAAACTACC----TTTGTTGCTTTGGCAGGCCCGTCTTT-------------------CGGGGCCGCCGGGGGG---GTTCAGTCA-------CCCCTGGCCAG--TGCTTGCCAGTAGCCTATC-AA-----AAATC---TTTTATAAC-CAT-GTCGTCTGAATC--ATAATTA------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCCC-------GGCTTGTCATTGGGCC-CT--TA----------TCGTT-----ACAGATAGGCCTGAAAGATAATGGCGGT-GTCGAGA-ACGACCCCAGGTGCAGCGAGC-TTAT-------AGCACACAC-TGAAA-----GGT-TTTCTTGTCCCGGCCTA-TGACTTCTTCCCCCCGGGGAC--------------AGAAATTTACTTAAAAGGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCTTCGGTTTAAATCCCTTGGAACAGGGTGTCACAGAGGGTGAGAGTCCCGTCTTGAACCGTATGCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGTAACCAGACTTGAGCTGGGCGGTTCTACCGCGGTTCGCCGTGGCCTATTCCGTCCGGTCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGACCTCGGGAATGTATCTACTCTTC--GGGGTCGACTTATAGCCCGGGGTGCAATGTGACCTACCTGGACCGAGGAACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTATAAGCGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCGAGAAGTTCGAGAAGGTATGTGATACATTCTCTCACATCATG-CAATTTTAGTTGCCTTATCGCCCCTT----GAGAAATATTTGGTGGGGGCGGGGCAACACATCA------AACAGCCCTGATACTCGATCCTGCCGCA------TCTCACTTCCGC------TATCCT--------------------------------------------GCCACCAACGTTCAGATTGATCAAATCGCTAACAA-TTGCCCAACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAATGGTAAGCTGAAGTCTTCACCTCTCGCG-----ACATCCAGACGCGACATACATTT-CGAACTCTGAGCTCATACAA-TTTCAGGCAAACAATCTCTGGCGAGCATGGTCTTGACGGCTCCGGCGTGTAAGTC-GCCCAGAT-----TTGATGG------CGTTGGGCAGCTTCTAAT-CCATCGCAGCTACAATGGCAACTCCGACCTTCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTACTTACAAGACAAGATATC--TGAGGCTATGAATTCTGTATTGAC-----CACTTCAAGGCATCAAACAACAAATATGTTCCCCGTGCCGTCCTTGTCGACCTTGAGCCCGGTACCATGGACGCCGTTCGCGCTGGTCCATTCGGTCAACTCTTCCGACCAGACAACTTCGTCTTCGG 'Moristroma germanicum JKI_Feb06' CAGAGTGAAAGGTAT-----TCAATTGCCTG-ACCTCCAACCCTATGTTTAACTA-CC----TTTGTTGCTTTGGCAAGTCATTTTCTTCACT--------------GAAAATGATTGGCAGT---GTTTATTCA-------CTGTTGATCTG--TACTTGCCAATAGCCTATT-TA-----AATAC---TATTTTAAC-TAT-GATGTCTGAATA--TTAAATC-------AA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATT-TAT-TGTG-AAG---AAATTT-----AACAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGACCCCAGATGCAGCGAGCTTTTT-------TGCATACAT-TTGAA-----GTCATTTTTAACCCTATGCCT-TATGTTTTTTCGTTAAGCTTC-GGTTTAATTAG-AAAACAATTTTTTCAAG---------------------------------------------------TAATAGCTCAAATTTGAAATCTGACTC---TTCGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTCCAATTTCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCGTCTATTGTACCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATTCCCCTATTGTTTTCAATAGGTCATTTTGTTAAATTCAGGCCAGCATCAGTTTGAGTGGTTAGTTAAAGACCTTAGGAATGTATCTACTCTC----GGGTAGACTTATAGCCTAGGGTGAAATGTGACCTACTTGGACTGAGGAACGCGC-T---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCTACGCGACACAACC---ACGAATAGTCACTCATATAT-CTTCAGGCAAACCATCTCAGGCGAACATGGACTTGACGGATCTGGTGTGTAAGTGCAAGATACAT----TCGAGTCCCTCCTGTCGAGACAGGATCTGATATCACAATAGATACAATGGCACCTCAGACCTCCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTATGAAAGATGCAAAAGATT--GTACG-------AGTCAAGCTAATTGAGAAAAAAAAAGGCATCTTCCAACAAGTATGTTCCACGTGCCGTCCTCGTCGATCTTGAACCTGGTACTATGGATGCCGTCCGCGCTGGTCCATTCGGTCAA----------------------------- Moristroma_japonicum_BN1674 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AC---TATTTTAAC-T?T-GATGTCTGAATA--TTAAATC-------AA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATT-TAT-TGTT--AA---TTTCTT-----ACCAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGA-CCCAGATGCAGCGAGCTTTTT-------TGCATACAT-TTGAA-----GTCAATTTTAACCCTATGCCT-TATG-TTTTTGGTTAAGCTAC-GGTTTAACTGA-AACTA---TTTTTCAAG-GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGACTC---TTCGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTCCAATTTCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCGTCTATTGTCCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATACCCCTATGGTTTTCAATGGGTCATTTTGTTAAATG{CT}AGGCCAGCATCAGT{AT}AGAGTGGTTAGTTAAAGACCTTAGGAATGTATCTACTCTC----GGGTAGACTTATCGCCTAAGGTGAAATGTGACCTACTTGGACTGA{AG}GAGCGCGC-TAT-ATGCTCGGATGCTGGCGTAATGGATGTAAGCGACCCGT-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTACGGGTGTCGAACCCCTACGCGTAATGAAAGTGAACGGAGGTAAGAACCTTT---TAGGTGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Moristroma palatinum JKI_Au02' CTGAGTGAAAGGTAT-----TCAATTACCTG-ACCTCCAACCCTATGTTTAATTA-CC----TTTGTTGCTTTGGCATGTCATTTTCTTAATT--------------GAAAATGATTGGAAGT---GTTTGTTCA-------CCTCTGATCTG--TACTTGCCAATAGCCTATT-TA-----AATAC---TACTTTAAC-TAT-GATGTCTGAATA--TTAAATC-------AA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATT-TTA-T-----------TGTTT-----AACAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGACCCCAGATGCAGCGAGC--TTT-------TGCATACAT-TTGAA-----GTCATTTTTAACCCTATGCCT-TATG--TTTTGGTTAAGCTTCCAGTTTAATCAG-AACAATTTTTTTTCAAG-------------------------------------GGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGACTC-TTTTCGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTACAATTTTGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCATCTATTGTGCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATTCCCCTATTGTTTTCAATGGGTCATTTTGTTAAATTCAGGCCAGCATCAGTTTGAGTGGTTAGTTAAAGACCTTGGGAATGTATCTACTCTC----GAGTAGACTTATAGCCTTTGGTGAAATGTGACCTACTTGGACTGAGGAACGCGC-TTT-A------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACGACCTCTACGCGACACAACC---ACGAATAGCCACTCATATAT-CTTCAGGCAAACCATCTCAGGCGAACATGGACTTGACGGATCTGGTGTGTAAGTGCAGGATACAT----TCGAGTC---CCTGTCGAGACAGGATCTGACATCACAATAGATACAATGGCACCTCAGACCTCCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTATGAAAGATGC-AGAGATT--GCACG-------AGTCAAGCTAATCG---AGAAACAAGGCATCTTCCAACAAGTATGTTCCACGTGCCGTCCTCGTCGATCTTGAACCTGGTACTATGGATGCCGTCCGTGCTGGTCCATTCGGTCAACTCTTCCGTCCCGACAAC----------- Moristroma_quercinum_BN1678 CAGAGTGAAAGGGTA-----TTCATTGCCTG-ACCTCCAACCCTATGTTTAACTA-CC----TTTGTTGCTTTGGCAAGTCATTTTCTTCACT--------------GAAAATGGTTGGCAGT---GTTCATTCA-------CTGTTGATCTG--TACTTGCCAATAGCCTATT-TA-----AATAC---TATTTTAAC-TAT-GATGTCTGAATA--TTAAATC-------AA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATT-TAT-TGTTTAAG---AAATTT-----AACAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGACCCCAGATGCAGCGAGCTTTTT-------TGCATACAT-TTGAA-----GTCATTTTTAACCCTATGCCT-TATGTTTTTTCGTTAAGCTTC-GGTTTAATTAGAAAAACAATTTTTTCAAG-GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGACTC---TTCGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTCCAATTTCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCGTCTATTGTACCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATACCCCTATGGTTTTCAATAGGTCAT?TTGTTAAATTCAGGCCAGCATCAGTTTGAGTGGTTAGTTAAAGACCTTAGGAATGTATCTACTCTC----GGGTAGACTTATAGCCTAGGGTGAAATGTGACCTACTTGGACTGAGGAACGCGC-TTT-ATGCTCGGATGCTGGCGTAATGGATGTAGGCGACCCGT-CTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTAAGAACCTTT---TAGGTGCATTATCGACCGATCCTGATGTC-TCGGATGGATTTGAGTAGAGCATAGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeomoniella constricta JKI_Mz35' CTGAGTTTAGGGTCT---C-TTCGGAGCCCAAATCTCCAACCCTTTGTTAAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTTA--TCCTTTAA---CCGGGAGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTAAA-----AATTC---TTTATTA---AAT-AATGTCTGAAAA--ATTATAA-----CTAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT-----ACAGCATACAT-TGAAA-----GGT-TTTTGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTTTCAAAG----------------------------------------GAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTTTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGTTA-ATCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGAACGCGC-TTTATTGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTACATTTATGAAGAGGAAGCTCACGATC-ACGAAGGCAAACTATCTCTGGCGAGCATGGTCTTGATGGCTCCGGCATGTGAGTTGAAAATAGGA----TCAACAC------ATCGAGACAACTACTGAC-TCGTCGCAGCTACAATGGTACCTCGGATCTTCAACTCGAGCGCATGAACGTCTATTTCAATGAGGTAAGCCAACCAAGCTATGAT--CGGTATTGTG--GGCTCCGCTGAC-----AGGTCACAGGCTTCCGGTAACAAATATGTGCCACGTGCCGTCCTGGTCGATCTTGAGCCAGGTACTATGGACGCCGTTAGAGCCGGTCCATTCGGTCAACTCTTCCGCCCGGACAACTTCGTCTTCGG 'Neophaeomoniella corymbiae CBS_145092' CTGAG-TTAGGGTTC-----TTTTGAGCCCGAACCTCCAACCCTTTGTTAAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTTTGAATCCCTTCAC---GGGGAGGACGACCGCCGGGGAT---TCTT--TTA-------TCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AATAAATGTCTGAAAA--ATTATAA-----TTAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----ACAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-CGAAA-----GGT-TTTTGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTTTCAAAG------------------CAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAGCAGTTCTACCGCAGTTCTCTGTGGCCTATTCTGCTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACGCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC-TTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--TAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeomoniella eucalypti CPC_25161' CTGAG-TTAGGGTTC-----TTTTGAGCCCGAACCTCCAACCCTTTGTATA-AAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTGAAATTCCTTCG---GGATTTGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGAAAA--ATTATAA-----CTAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-TGAAA-----GGT-TTTTGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTTTTAAAG-----------------------------------ACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC-TTTATTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neophaeomoniella eucalyptigena CBS_145093' CTGAG-TTAGGGTCT---C-TTCGGAGCCCGAACCTCCAACCCTTTGTTAAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCCTA--TCCTTTCA---CCGGGAGACGACCGCCGGGGGC---GTTCAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGAAAA--ATTATAA-----TTAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCTCT--TA----------TCGTG-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCATCA-ATGACCCCAGATGCAGCGAGC-TTAT-----ACAGCATACAT-CGAAA-----GGT-TTTGGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------ATTTTCACAAG------------ACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAGCAGTTCTACCGCAGTTCTCTGTGGCCTATTCTGCTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACGCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC-TTTATTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA---CGAGAAGTTCGAGAAGGTACGTTGCTTTCTTTTCATATTGCTT-GCAATTTTGCTGCTTCACTGCTCTGGGT--GTGAAAATTTTGGTGGGGGCGGGGCTATTCTGAACCCTGAAGCAA-C----CCCTTGCCTCACCCACA------TCACTGCACAAC------CTC-----------------------------------------------ATGCATATC-TTGGTCAAAACATCTTAACTAACA--CATATCAACAGGAAGCCGCTGAACTCGGAAAGGGTTCCTTCAATGGTAAGCGAAAATACCCACGTCGCGAG-----GCGACTAGACGCGACCGACACTTATGAAAATGAAACTCACAATC-ACGAAGGCAAACTATCTCTGGCGAACATGGCCTTGATGGATCCGGCATGTGAGTTGGAAGCAAAA----TCAACGA------CCCGAGGCAACTACTGAT-TCGTTGCAGCTACAATGGTACCTCGGACCTTCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTAAGCCAGAGAGCATATTGT--TATTGTTGTA--CGCTTTGCTGAC-----CGGTTCCAGGCTTCCGGTAATAAGTATGTGCCACGTGCCGTCCTCGTCGATCTCGAGCCAGGTACCATGGATGCCGTTAGAGCCGGTCCATTCGGTCAACTTTTCCGCCCAGACAACTTCGTCTTCGG 'Neophaeomoniella niveniae CBS_131316' CTGAG-TTAGGGTCT---CATCTCGAGCCCGAACCTCCAACCCTTTGTTTAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTGACACTCCTTTAACCGGGATCGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGACAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGAAAA--ATTATAA-----TTAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-TGAAA-----GGT-TTTTGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTTTTAAAA-GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC-TTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAACATCGAGAAGTTCGAGAAGGTAAGATTCTTCCTCTTCATCATCACT-CCATTCTTGATGCCTCATTGCTCCGGGT--GTGAAAATTTTGGTGGGGGCGGGGCTCATCTGA-------AGCAA-C----CCCTTGCCTCACCCACAA--TGATCACACCACATC------C-------------------------------------------------ATGCAAATCATTAATGAAAGAAACATGACTAACAC-ATCAACAACAGGAAGCCGCTGAACTCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Neophaeomoniella ossiformis JKI_May03' CTGAGTTTAGGGTCT---CTTTTAGAGCCCGAACCTCCAACCCTTTGTTAAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTTA--TCCTTTAA---CGGGGAGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTAAA-----AATTC---TTTATTA---AAT-AATGTCTGAAAA--ATTATAA-----TTAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-TGAAA-----GGT-TTTTGTGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTTTCAAAG------------------------------------CGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCCTATTCTGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACGCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------G-----GCGACTAGACGCGACCTACATTTATGAAGAGGAAACTCACGGTT-ACGAAGGCAAACAATCTCTGGCGAGCATGGCCTTGATGGCTCCGGCATGTGAGTTGGCAGCAGGA----TCAACAC------ATCGAGACAAATACTGAC-TCGTTGCAGCTACAATGGTACCTCGGACCTTCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTAAGCAAGACAAGCTATGAT--CGGTATTGTG--GGTTCCACTGAC-----AGGTCATAGGCTTCCGGCAACAAGTATGTGCCACGTGCCGTCCTGGTCGATCTTGAGCCAGGTACCATGGATGCCGTTAGAGCCGGTCCATTCGGTCAACTCTTCCGCCCGGACAACTT--------- 'Neophaeomoniella zymoides CBS_114904' CTGAG-TTAGGGTCT---CATCTCGAGCCCGAACCTCCAACCCTTTGTATAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTGAAAATCCTTTAACGGGGATCGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGCCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTCATTA---AAT-CATGTCTGAAAA--ATTATAA-----CTAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCTC-------GGCTTGTTATTGGGCC-CT--TA----------TCGTT-----AAAGATAGGCTCGAAAGATAATGGCGGC-GTTATAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-CGAAA-----GGT-TTATATGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTCATTAAAG----------------------------------------------------AATAGCTCAAATTTGAAATCTGGCTC--TA--GGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC----ATTGCTCGGATGCTGGCGTAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACACCTACGTCGCGCG-----GCGACTAGACGCGACCTACA---ATGAAGAAGAAACTCACAACCAACGAAGGCAAACTATCTCCGGCGAGCATGGCCTCGATGGCTCCGGCATGTGAGTTGGAAGCAAGAT--CTCAACAA------ACCGAGTCAAACACTGAT-TCGTTACAGCTACAATGGTACCTCGGACCTCCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTAAGCCAGACCAACTCTCGT--TGGCGTTGTG--GCCTCTATTGAC-----ACCACCCAGGCTTCCGGTAACAAGTATGTGCCACGTGCCGTTCTCGTCGATCTCGAGCCAGGTACCATGGATGCTGTTAGAGCCGGTCCATTCGGTCAGCTCTTCCGCCCAGACA------------- 'Neophaeomoniella zymoides CBS_121168' CTGAG-TTAGGGTCT---CATCTCGAGCCCGAACCTCCAACCCTTTGTATAAAAC-AC----TTTGTTGCTTTGGCAGGCCCGTCTGAACATCCTTTAACCGGGATCGACGACCGCCGGGGGC---GTTCAGTCA-------CCTCTGGCCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-CATGTCTGAAAA--ATTATAA-----CTAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCTC-------GGCTTGTTATTGGGCC-CT--TA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCATAA-ATGACCCCAGATGCAGCGAGC-TTAT-------AGCATACAT-CGAAA-----GGT-TTTTATGGCCCGGCCTT-AACGAG--------AAGCAAT--TCTCAA------------TTTATTTAAA-GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC--TA--GGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAAGTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGTTA-GTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC----ATTGCTCGGATGCTGGCGTAATGGTTGTAAACGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCGAGAAGTTCGAGAAGGTAAGATTCTTCCTGTTCATCTTCACC-CCATT-TTGCTGCCTCATTGCTCTGGGT--GTGAAAATTTTGGTGGGGGCGGGGCTCATCTGA-------AGCAACC----CCCTTGCCTCACCCACAA--TGATTACACCACATT------C-------------------------------------------------ATGCAATTCATTGACAAAAGTATCATGACTAACAC-ATCAACAATAGGAAGCCGCTGAACTCGGTAAGGGTTCCTTCAA---------------------------------------------------------TGAAGGAGAAACTCACAATCAACGAAGGCAAACTATCTCCGGCGAGCATGGCCTCGATGGCTCCGGCATGTGAGTTGGAAGCAAGAT--CTCAACAC------ACCGAGTCAAACACTGAT-TCGTTACAGCTACAATGGTACCTCGGACCTCCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTAAGCCAGACCAACTCTCGT--TGGCGTTGTG--GCCTCTATTGAC-----ACCACCCAGGCTTCCGGTAACAAGTATGTGCCACGTGCCGTTCTCGTCGATCTCGAGCCAGGTACCATGGATGCCGTTAGAGCCGGTCCATTCGGTCAGCTCTTCCGCCCAGACAACTTCGTCTTCGG 'Paraphaeoisaria alabamensis CBS_101.77A' TCGAG-TTAGGGTCC------TCTGGGCCCC-ATCTCCAACCCTTTGTTTATCAA-ACCT--TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGACCGCCGGAGGC----TTTTGTCG-------CCTCTGGTCCG--TGCCTGCCAGTAGCCCAAT-CA-----AATTC---TTTCTAAAC-CAT-GAAGTCTGAATG--TTTAAAA---TCAAAA---ATTAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CCT-TATCGACC-TTTTTTGT-----GAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGAAATGACCCCTGGTGCAGCGAGCAATCA-------AGCATACAC-TGAGGC----GGTCTTTTTTGTCCCGGCCCT-TTTGTTAATTCATTTAACTCC-------------------------TAAAG----------------------GATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACCGTCTGTCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCTCAGTGGCCCATTCCGTTA-GTCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTGACCTACCTGGACCGAGGTACGCGCTTT--TTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGG-AACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATA-GGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paraphaeoisaria alabamensis CBS_101.77B' TCGAG-TTAGGGTCC------TCTGGGCCCC-ATCTCCAACCCTTTGTTTATCAA-ACCT--TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGACCGCCGGAGGC----TTTTGTCG-------CCTCTGGTCCG--TGCCTGCCAGTAGCCCAAT-CA-----AATTC---TTTCTAAAC-CAT-GAAGTCTGAATG--TTTAAAA---TCAAAA---ATTAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CCT-TATCGACCTTTTTTTGT-----GAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGAAATGACCCCTGGTGCAGCGAGCAATCA-------AGCATACAC-TGAGGC----GGTCTTTTTTGTCCCGGCCCT-TTTGTTAATTCATTTAACTCC-------------------------TAAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paraphaeomoniella capensis CBS_123535' CTGAG-TTAGGGTTC-----TTTCGAGCCCG-ATCTCCAACCCTTTGTTCAACTA-CC----TTCGTTGCTTTGGCAGGCCCGTTCTTTA-----------------CGGGACCGCCGGAGGT---GTTAGGTCA-------CCTCTGGCCCG--TGCCTGCCAGTAGCCCACA-CA-----AATTC---TTCTACA---AAT-TTTGTCTAAGCA--TTAAATA------TAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTATTCGAGCGTCATTATCAC-CACTCAAGCCC-------GGCTTGTTATTGGGTC-TTC-TG----------TCGTT-----AAGGACAGACCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGC-TCAT-----ACAGCATACAC-TGAGGT----GGT-TGTCTTGTCCCGGCCTT-AGTCTTGGTTAAACAAGACAT--------------------TTTTTTCAAG-----GAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGC-TT---GCGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGTTGTGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAGTCCCGTCTAGAACCGTATACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCACCACTGTTCTCAGTGGTTTATTCCGTTATTTCCAGGCCAGCATCGGTTTGGGTGGTTAGTTAAAGACATTGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCTTTGTGTAATGTGACCTACCCGGACCGAGGCACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGTTAAACGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGCGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATCTACGCATAGGGGCGAAACATCGAGAAGTTCGAGAAGGTACGAATTCATCCTTTTTT--TCCAT-TTCATTTGCGTCTCACATCTGGCCTTATCTCAACGACTTTTGGTGGGGGCGGGGCAATGCGAATTATCGCAACAC------CGCCACACCAAAGAAAAAATTTGATCATCCACGAG------AACAATTT-------------------------------------TCCGCCCAATGTTTACTACTTGGAAACAAAACACTAAC---GTCATCGATAGGAAGCCGCTGAACTTGGTAAGGGTTCCTTCAATGGTAAGCCCGGATACCCCTCCATCTGC-----GCATGTCGACGCGACAGGGGTCT-GAAATTTCATACTCATCTAT-CAATAGGCAAACCATCTCTGGTGAACACGGTCTTGATGGATCTGGAGTGTAAGCTCATCCTTCTTCCTCCCGAGTC------TTCCTGTCCGTCGCTGAC-GCCGAACAGCTACAATGGTACCTCCGACCTCCAACTCGAGCGAATGAATGTCTACTTCAACGAGGTGAGCACGAAACACGATCAC--AAACTCTGCA----TGATGCTGAT----ATAGGGAAAGGCTTCGAGCAACAAATATGTCCCCCGTGCTGTCCTCGTCGATCTCGAGCCTGGTACCATGGATGCCGTCCGTGCGGGTCCATTCGGTCAACTCTTCCGTCCCGACAACTTCGTCTTCGG 'Phaeomoniella chlamydospora CBS_117179' TCGAG-TCAGGGTCC------TCTGGGCCCG-ATCTCCAACCCTTTGTTTATCATACC----TTTGTTGCTTTGGCAGACCCGTCCTT-------------------CGGGACCGTCGGGGGC---GTTCAGTCG-------CCTCTGGCCAG--CGTCTGCCAGTAGCCCAACCAA-----AATTC---TTTGTTACA-TGT-GACGTCTGAACG--GTTCCAT-----CAAA---ATCAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGATATTGGGTC-CA--TATCAACT---TTCATA-----GAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGCAATCA-------AGCATACAC-TGAGGT----GGT-CCTCTTGGCCTGGCCCT-ATTGTTTTGTT---GCAGAAC--TCTCAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGAAGGTATGACTTCCACCCTCATT-----AT-CACATTTTGCTGCCTTATCGCCGCCTGT--GTGAAAATTTTGGTGGGGGCGGGGC---TCTCAA------AACGA------CCCTTGCTTCACCGCAA----TGCTCTCCACCAAC------CATATTTC-------ATCACTGCG--------------------------ATAAGCTTGTCATTCAAAAAGCTCATCACTGACT--GTTCTCAATAGGAAGCTGCTGAACTCGGAAAGG----------TGGTAAGCCATAACCCCTCTAAACCTCGA---CGACTACAGACGCGCCAGA------CAAGAACGATGCTCACATCG-CATTAGGCAAACAATCTCTGGTGAACACGGCCTTGATGGCTCTGGTGTGTAAGTTCAATCGACTCT--CATACTGA------TAACATGGTTCACTGATC-TTGGAACAGCTACAATGGAACCTCCGACCTCCAACTTGAGCGCATGAACGTCTACTTCAACGAGGTACTTGAGAAC-AGTCTTTC--CACTACGATACATACAATACTAAT-----CTCCATTAGGCGTCTGGCAACAAGTATGTCCCACGTGCCGTCCTCGTCGATCTTGAGCCTGGTACCATGGACGCTGTCCGTGCAGGTCCATTCGGTCAACTTTTCCGACCAGACAACTTTGTTTT--- 'Phaeomoniella chlamydospora CBS_229.95' TCGAG-TCAGGGTCC------TCTGGGCCCG-ATCTCCAACCCTTTGTTTATCATACC----TTTGTTGCTTTGGCAGACCCGTCCTT-------------------CGGGACCGTCGGGGGC---GTTCAGTCG-------CCTCTGGCCAG--CGTCTGCCAGTAGCCCAACCAA-----AATTC---TTTGTTACA-TGT-GACGTCTGAACG--GTTCCAT-----CAAA---ATCAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGATATTGGGTC-CA--TATCAACT---TTCATA-----GAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGCAATCA-------AGCATACAC-TGAGGT----GGT-CCTCTTGGCCTGGCCCT-ATTGTTTTGTT---GCAGAAC--TCTCAG-----------------------GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACCGTCTGTCGCGTCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCCAACGGTTCAACCGCTGTTTTCAGTGGCCTATTCCGTTG-GTTCAGGCCAGCATCGGTTCGAGTGGTTAGTTAAAGACTTTGGGAATGTATCTACCCCTCCGGGGGTAGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGGACGCGCTTT--TTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAAGCCATAACCCCTCTAAACCTCGA---CGACTACAGACGCGCCAGA------CAAGAACGATGCTCACATCG-CATTAGGCAAACAATCTCTGGTGAACACGGCCTTGATGGCTCTGGTGTGTAAGTTCAATCGACTCT--CATACTGA------TAACATGGTTCACTGATC-TTGGAACAGCTACAATGGAACCTCCGACCTCCAACTTGAGCGCATGAACGTCTACTTCAACGAGGTTCTTGAGAACAAGTCTTTC--CACTACGATACATACAATACTAAT-----CTCCATTAGGCGTCTGGCAACAAGTAT----------------------------------------------------------------------------------------------------- Pseudophaeomoniella_globosa_CSN185 CTGAG-TTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTTTATCAA-CC----TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGACCGCCGGGGGG---GTTCAGTCA-------CCTCTGGCCCG--CGCTTGCCAATAGCCTATTCAA-----AATCC---TTTTTTAAC-CAT-GAAGTCTGAGAA--TTAATTA------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCATCAAGCCC-------GGCTTGTTATTGGGTT-CCCGTA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACGA-ATGACCCCAGATGCAGCGAGC-TTTA-------AGCATACAT-CGAGGT----GGT-GTTCGTGGCCTGGCCTT-TTGAAATT--------CTCAT--TCTCATGGG--ATTTCATTTTTTCTAAG-GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTTAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCGAACGGTTCCACCACTGTTTTCAGTGGCCCATTCCGTTC-GTTCAGGCCAGCATCAGTTTGGGTGGGTAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTGCCCTACCTAGACTGAGGTACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCG--TGAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----GAGAAGTTCGAGAAGGTAAGCTCATCCTGACAA----TTCTC-TGACTCTTGATGCCTTATCAGCCGCTTG-GGTGAAAATTTTGGTGGGGGCGGGGCAGGGCCATAATCTCAAACAA------CCCTTGCCTCAATCATA------CCCCCCTTCAAT------ACG-------------GAACACCCAAATACTTGCAGCGATGGGCCTCTTGAGTGAATTAACGATGAAGAAACAGACAACTAACTGTTTCTTTGATAGGAAGCTGCCGAACTTGGTAAGGGTTCCTTCAA---------------------------------------------------------GGAATTGGATGCTCATACGA-TCATAGGCAAACCATCTCTGGCGAGCACGGCCTCGATGGCTCCGGCATGTAGGTTGAAGTTGCTA----GAGACTT------CATCAACACGTGGCTAAT-ATGCTATAGCTACAATGGCACGTCCGATCTCCAACTCGAGCGTATGAACGTCTACTTCAACGAGGTAAACAAGCACTGTTGTACCTGCAATACAATA--TTCACAGCTGAC----GCTTTCAAAGGCATCCGGCAACAAGTATGTCCCACGTGCTGTCCTCGTCGATCTTGAGCCAGGTACCATGGATGCAGTTCGTGCTGGTCCATTCGGTCAACTCTTCCGCCCAGATAACTTTGTCTTCGG 'Pseudophaeomoniella oleae CBS_139191' CTGAG-TTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTCTATAAA-CC----TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGACCGCCGGGGGT---GTTCAGTCA-------CCTCTGGCCCG--TGCTTGCCAATAGCCTATTCAA-----AATCCT--TTTTTTAAC-CAT-GAAGTCTGAGAA--TTAATTA------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCATCAAGCCC-------GGCTTGTTATTGGGTC-CCCATA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCACGA-ATGACCCCAGATGCAGCGAGC-TTTA-------AGCATACAT-CGAGGT----GGT-GTTCTTGGCCTGGCCTT-TTGAAATT---------TCAT--TCTTATGG---ATTTCATTTTTT-TAAG--------------------------------GTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGATAAGGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCCGCATCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCGAACGGTTCAACCACTGTTTTCAGTGGCCCATTCCGTTC-GTCCAGGCCAGCATCAGTTTGGGTGGGTAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTACCCTACCTAGACTGAGGTACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCG--TTAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTAT-----------------------GAGAAGGTAAGCTCATCCTCATTG----CCCTTGGGATTCTTGATGCCTTATCAGCCGCTTG-GGTGAAAATTTTGGTGGGGGCGGGGCAGGGCTATAATCTCAAACAG------CCCTCGCCTCAATCATA------CCCCCCTTCAAC------ACC-------------GAACATCGAAGCACTTGCAGCGATGGGCCTCTTGAGTAGATTGACCATGAAGAACCAGATAGCTAACTG-TTTCCCAATAGGAAGCTGCTGAACTTGGCAAGGGTTCCTTCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pseudophaeomoniella oleicola CBS_139192' CTGAG-TTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTCTATAAA-CC----TTTGTTGCTTTGGCAGGCCCGTCCTT-------------------CGGGACCGCCGGGGGT---GTTCAGTCA-------CCTCTGGCCCG--CGCTTGCCAATAGCCTATTCAA-----AATCC---TTTTTTAAC-CAT-GAAGTCTGAGAA--TTAATTA------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCATCAAGCCC-------GGCTTGTTATTGGGTT-CCCGTA----------TCGTT-----AAAGATAGGCCCGAAAGATAATGGCGGC-GTCCAGA-ATGACCCCAGATGCAGCGAGC-TTTA-------AGCATACAT-CGAGGT----GGT-GTTCTTGGCCTGGCCTT-TTGAAATT---------TCAT--TCTTATGG---ATTTCATTTTTTCTAAG-------------------------TGCCTTAGTACGGCGTAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTTAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCGAACGGTTCAACCACTGTTTTCAGTGGCCCATTCCGTTC-GTCCAGGCCAGCATCAGTTTGGGTGGGTAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTGCCCTACCTAGACTGAGGTACGCGC-AT--CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCG--TGAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATA-GGGCGAAA-----------------AGGTAAGCTCATCCTCATTG----CCCTT-GGATTCTTGATGCCTTATCAGCCGCTTG-GGTGAAAATTTTGGTGGGGGCGGGGCAGGGCTATAATCTCAAACAG------CCCTCGCCTCAATCATA------CCCCCTTTCAAC------ACC-------------GAACATCGAAGCACTTGCAGCGATGGGCCTCTTGAGTAGATTGACCATGAAGAACCAGATAGCTAACTG-TTTCCCAATAGGAAGCTGCCGAACTTGGCAAGGGTTCCTTCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Rhynchostoma proteae CBS_112051' TCAGG-ATAGGGTCT--------TTGGCCCA-ACTCCCAACCCTTTGTTTACTGT-AC----CTTGTTGCTTTGGCAGGGCCGCCGTAT---------------------GGCCGCCAGGCCTCTAGTTCAATTGTTCTAGAGGTTGGGCCTG--TACCTGCCAATAGCCTACACCA-----AACTC---TTGTGTAAT-CAT-GATATCTGAGTC--TAAATTT-------------AATAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAA-TTCCGTGAGTCATCGAATCTTTGAACGCACATTGCACCTTTTGGTATTCCG-AAAGGTATGCCTGTTCGAGCGTCATTATCAC-CTCTCAAGCTA-------GGCTTGTTATTGGGCC-TC--TA----------CCGTT-----TATGGTTGGCCTTGAAGATAACGACTGT-TCTACGG-TATTGGCCGGATGCAACGAGC-TTTAA----CCAGCACGCAT-TCGGCC----CGC-GCCGTAGATACAGGTCT-CCATATTTATTTCTAG------------------------------------GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTGCGGTTTAAATCCCTTGGAACAGGGTGTCATAGAGGGTGAGAGTCCCGTCTTTAACCGTCTGTTGCGTCCATGTGAAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGGGCAGCGATTCAGCCGTTCTTCTGAACGGTGTACTTTGCTGTTTCCAGGCCAGCATCGGTTTGGGTGGCCAGTTAAAGGCTTCGGGAATGTATCTACCCTCC--GGGGTAGACTTATAGCCCGAGGTGACATCTGGTCTACCTGGACCGAGGCAAGCGT--T--CTACACGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCTT--C--GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Strelitziana cliviae CPC_19822' CCGAG-TTAGGGTTCGCTTTCGAGCAGCCCGACCTCCCAACCCTTTGTTTACCTT-ACCTAAATTGTTGCTTCGGCGAGCCGGTCCTC-------------------ACGGGCCGCCTGGTCC---ACCTG-----------GACCGGGACAGTTCGCCCGCCGATGGCCCCAAACCAAACAAATTCTTGATACCAAAA-CAT-GTCGTCTGAAAC-ATTTCTTGATATTAAAAAATCAAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCATTGGTATTCCG-ATGGGCATGCCTGTTCGAGCGTCATTATCCT-CTCTCACAACCTTTATTGGTGGTGGTGTTGGACC-CAGGTCGCCCGGAGTCACATC-----CGCGACCGGTCTCAAAGACAATGACGGC-GTCCGTG-GGGACCCTCTTCGCAACGAGT-TTTCTTCTGGAGACACGCGT-CGAGTTTCAAGGA-CCCAGCGGGCCGGTCTT-ACCTAAATGAATTTTTCTCAG-------------------------------GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCG----TAAGGTCCGAGTTGTAATTTGTAGAGGATGTTTTGGGCACCGTCGCGGTGTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTGAAACCG-CGATAGGACCCGTGTAAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCAGGCAATCAGACTCGTGCGCGGG-GTTCCCCCTTGCTTCTGCTTGGGTTACTTCCCCGCGACCGGGCCATCATCAGTTTGGGGGGCCGGTTAAAGGCCTCGGGAATGTACCCACTCCTCCGGGGGTGGACTTATAGCCCGGGGTGTCATGCGGCCTCTCCGGACTGAGGAACGCGC-TT--CGGCGAGGATGATGGCGTAATGGTTGTCTGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCTTGCGCGGAATGAAAGTGAACGGAGGTAGGAAGGCC--TGAGCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Strelitziana malaysiana CPC_24874' CCGAG-TTAGGGTTGCTCTTCTGAGTGCCCGACCTCCCAACCCTTTGTCTATGAT-ACC---ACAGTTGCTTCGGCGGACCGAGGAGTCA-----------------CACCCTCGCCTGGTTT-----------------ACGGCCGGGAGAG--CGTCCGTCGATGGCCCCAAATT-----AACACTTGAACCCAAAA-CCT-GTCGTCTGAAAA--CTATTTGATATCATAA---TCAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCATTGGTATTCCG-ATGGGCATGCCTGTTCGAGCGTCATTATCCT-CTCTCAAACCTCCT----GGTTTGGCGTTGGATC-GAGTTGTG-------GGCAAC-----CGCAACTGGTCTCAAAGACAATGACGGC-GTCCGTG--GGACCCTCTTCGCAACGAGT-CTTTTAC--GAGGCACGCGG-GGAGTTGCAAGGT-CTCGTCGGGTCGGTCTA-ACCCTTTTATTTTTAAG-----------------------------------GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC----TCGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCACCGTCGCGGTGTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTTTGAAACCG-CGATAGGACCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCAGGCAATCAGACTCGAGCGCGGG-GTTCCCCCTGGCTTCTGCCAGGGTTACTTCCCCGTGACCGGGCCAACATCAGTTTGAGGGGCCGGTTAAAGGCCTTGGGAATGTACTCACTCCTTCGGGGGTGAACTTATAGCCCAGGGTGTCATGCGGCCTCCCCGGACTGAGGAACGCGC-TT--CGGCGAGGATGTTGGCGTAATGGTTGTCTGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTGGCGCGGAATGAAAGTGAACGGAGGTAGGAAGGCT--TAAGCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Vredendaliella_oleae_PMM1193 CTGAG-TTAGGGTCT------TCTAGGCCTG-ATCTCCAACCCTATGTTTAACCA-TC----CTTGTTGCTTTGGCAGGTCCGTCTTT-------------------CGGGACCGCTGGAGGT---TTT---ATA-------CCTCTGGCCCG--TGCCTGCCAGTAGCCAATC-TA-----AATAC----TTTATAAT-CAT-GAAGTCTGAATC--ATTAA--------TTA---AATTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-CT--TT----------TTATCTGTTAAAAGATAGGCCTGAAAGATAATGGCGGTAGTCGTAA-GTGACCCCAAGTGCAGCGAGC-TTAT-------AGCATACAC-TGAGGT----GGT-TCTTATGGCCTGGCCCT-TTTTGTTA------AAACAAT--TTTTAACCAA-------------------GGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTT-C-----AGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTAAGGCTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTAAAACCATCTGCCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCATTTGCAACCAGACTTGTGTGTAACGGTTCAACCACCATTCTTGGTGGCCCATTCCGTTATATCCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCTTTGGGAATGTATCAACCCTC----GGGTTGACTTATAGCCCTTGGTGTAATGTGACCTATCCGGACCGAGGTACGCGC-TT--CGGCTCGGATGCTGGCGTAATGGTTGTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTAGGAACC-G--CAA-GGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----GAGAAGTTCGAGAAGGTATGGCTACCCTCTCGTTGG-AAAAT-CACAATTTGCTGCTTCTTATCGCTGT----TTGAAAATTTTGGTGGGGGCGGGGC---------------TGCAA------CCCTTGCTTCATCCATC------ACCAACATCACC------AAC-------ATCCTGTCTTACTTCGATACTTGTTC--------------CTGCACAAGTTCATCAACAAACATGTTGCTAACA--GCCCTCA---------------------------------TAG------------------------------------------------ATATATATGCGACCTTGATGCTTATACAA-TCTCAGGCAAACCATCTCCGGCGAACATGGTCTTGATGGATCTGGTGTGTAAGTAAACAAATACTT--GAAAAGAC------GTATGGCTTCAATCTGAT-TTCGATTAGCTACAATGGTACCTCCGACCTCCAACTCGAGCGCATGAACGTCTACTTCAACGAGGTAAGATTTACGGTTTTGGTA--GCATATGGCG-----CATACTGAT-----TGGATGAAGGCATCTGGCAACAAATATGTCCCCCGTGCCGTCCTTGTCGACCTTGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAACTTTTCCGTCCAGACAACTTCGTCTTTGG 'Xenocylindrosporium kirstenboschense CBS_125545' TTGAG-TAAGGGTTC------TCCGAGCCCG-ACCTCCAACCCTTTGTCTATACT-AC----CTTGTTGCTTTGGCAGGCCCGTCCCTTCAC---------------CGGGACCGCTGGAGAT---GCGTAGCCG-------TCTCTGGCCAG--TGCCTGTCAATAGCCCATC-TC-----AACTC----TTTTTAAC-CAT-GTCGTCTGACGA--AACAATC------------AATAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTTTCAA-CCATCAAGCAC-------GGCTTGTTATTGGGTC-TCATCG----------TTAAG-----AACGATGGACCTGAAAGTCAATGGCGGC-GTTCAGT-TTGACCCCAGATGCAGCGAGC-TTTC-----TTAGCATACAT-CGCGGT----GGT-CGGCTGGACCTGGCCCC-TAAATACT---------------TCTTAAG--------------------------GAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCCC-TTTTAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCCTCGGTTTAAATTCCTTGGAACAGGATATCAGAGAGGGTGAGAGTCCCGTCTTGAACCGTCGGTCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTTTAACGGTTCCACCACGGTTCTCCGTGGTCTATTCCGTTA-TCGCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCTTTGGGAATGTATCAACGCTTC--GGGGTTGACTTATAGCCCATCGTGTAATGTGACCTACCCGGACCGAGGTACGCGT-TC--ATTCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTTAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACC-G--CAA-GGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Xenocylindrosporium_margaritarum_CSN1179 CTGAG-TTAGGGTTC-----TTCTGAGCCCG-ATCTCCAACCATTTGTTTATACT-AC----CTTGTTGCTTTGGCAGGCCCGGCCTTTC-----------------GGGGGCCGCCGGGGGG---GTTCAATCA-------CCTCTGGTCCG--TGCTTGCCAGTAGCCAACT-TC-----AATTC----TTTATAAT-TAT-GTCGTCTGATAT--TTAATTA------CAA---AATTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTC-TTT-TTTTTATCGGTGTGAAA-----ATCGATAGGCCTGAAAGATAATGGCGGT-GTCATGATTAGACCCCAGGTGCAGCGAGC-TATA-------AGCATCCAC-TGAGGT----GGT-CGTCGTGTCCCGGCCTT-AACGATATTTTTT----------TTCTAA-----------------------GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTC-TTTTAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGTTACGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGCCCCGTCTTGAACCGCCAACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTCATAACAGTTCCACTTCGGTTTTCCGGAGCTTATTCTGTTT-TGACAGGCCAGCATCGGTTTGGGTGGTTAGTTAAAGGCTTTGGGAATGTATCAACACCTTCGGGGGTTGACTTATAGCCCAGAGTGTAATGTGACCTACCCGGACCGAGGTACGCGA-TT--TATCACGGATGCTGGCATAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCG--CAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAACATCGAGAAGTTCGAGAAGGTAACCCTCACTTTTTCT----------ATCTTTTTACAATTTTGCTCTTGCTTCT-GTGAAAAATGGTGGTGGGGGCGGGGCATCTTCAAAACCCGACACAG------CCCCTCAAAAAAGAGCA------CCCCTTGTT-----------------------------------------------------------ACGAGATATACCAATTCGAACATGACAGCTAAC---AACAACATCAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M57794] TITLE 'Phytopathogenic fungi ITS-28S-TEF1a'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1797; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Aequabiliella effusa CBS_120883' ?????????????????AAGGATCATTACTGAGTAAGGGTGT------TCTACGCCCG-ATCTCCAACCCTATGTTAA-AAC----ACTTTGTTGCTTTGGCAGGCCCGTCT-------------------TTCGGGACCGCCGGAGGC---ATTC--CAG-------CCTCTGGTCAG--TGCTTGCCAGTAGCCAATTCAA-----ATTC----TTTATTAAA-AAT-GAAGTCTGA--ATCTTTAATT-------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGCCCT------------TATCGTTAAGGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATCGAAA-----GGTTTTGTT-GTCCCGGCCTTTTTTGCTTCGGCAA-----------------------AGATTTTTCAAAGG?GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTCTGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGGTTGCAACCAGACTTGTGTGTAACAGTTCAACCTTGGTTTTCCAAGGCCTATTCTGT-TATACCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCATCGGGAATGTATCTACCCCTC--GGGGTCGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-AT-TTGCTCGGATGCTGGCGTAATGGTTGTAACCGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAGTTCGAGAAGGTAAGAATACATACCCAGCTCAT----CACATTTTGCTGCCTTATCGCGCTT---TGTGAAAAATTTGGTGGGGGCGGGGCAGAC------TTCCAAACGCCCCCCTTGTGTCAGGCAGGAA------TTGCACAGACCACAA-------TCATCACTTTTGCAAAC-CACCTCACAATCA----------CACGGACCAGATAGCTAAC-AATTCCTAACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAA 'Celerioriella dura CBS_120882' ?????????????????AAGGATCATTAATGAGTTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTTTAAACC----ACTTTGTTGCTTTGGCAGGCCCGTCC-------------------TTCGGGGCCGCCGGGGAT---ATTCAGTTA-------TCTCTGGTCCG--CGCTTGCCAATAGCCAAACATA-----AATTC---TTTTATAACGAAT-GCAGTCTGA--TAATCAATTAT------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCT------------TATCGTTACAGATAGGCCCGAAAGATAATGGCGGC-GTCAATACATGACCCCAGGTGCAGCGAGC-TTAT------AGCATACACTTGACG----GTTTGGATT-GGCCCGGCCTTTGTTCTCTAGTTAAAGCAATTTAACGAACAGATCA--TTTTTTTTTAAAGG?GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAAGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTAGGGCCCTATGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCGCAGTGGCCCATTCCGT-TAGTTCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACACCTTCGGGAGTAGACTTATAGCCCTTGGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-TT-CGGCTCGGATGCTGGCGTAATGGTTGTAAGCGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAGTTCGAGAAGGTATGATCACAATTTCCATCATCCCCTCACATTTTGCTGTCTTATCAGTGCT--GGGTGAAAATTTTGGTGGGGGCGGGGCATAT------TTCAAAACAA---CCCTGCCTCACCGCAAATGGACGCCTGCACCAACAAATTGGATATTTTGTCACCTCATGAGAT-AGCATTATGAAATTG----TCGAGCGTGAATATGTTACTAAC--TATCCTAATAGGAAGCTGCCGAACTTGGTAAGGGTTCCTTCAA 'Celerioriella petrophiles CPC_29256' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTCC------TCTGGGCCCGAACCTCTCACCCTTTGTTTA-AAC----ACTTTGTTGCTTTGGCAGGCCCGACC-------------------TCCGGGACCGCCGGGGGC---GTTCAATCG-------CCTCTGGCCAG--TGCCTGCCAATAGCCTATCGTA-----AATTC---TTCTTTAAC-TAT-GAAGTCTGA--ACTATAATTA-------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCTC-------GGCTTGTTATTGGGTCCT------------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-AC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAAGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCTGCGTCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCCAACGGTTCAACCACTGTTTTCAGTGGCCTATTCCGT-TGGTCCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGACTTGGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTTTGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-TT-CTGCTCGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAA--------------------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Celerioriella prunicola CBS_120876' ?????????????????AAGGATCATTACTGAGTTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTTAA-AAC----ACTTTGTTGCTTTGGCAGGCCCGTCT-------------------CTCGGGACCGCCGGGGGC---TTTT--CTG-------CCTCTGGTCAG--TGCTTGCCAATAGCCAATATTA-----AATTC---TTCTTTAAC-GAT-GAAGTCTGATAACTATAATTA-------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCT------------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCAACA-ATGACCCCAGGTGCAGCGAGC-TTAT------AGCATACACTTGTGGT---GGTCTTGTT-GGCCTGGCCCCTTTAGTTA-----------------AAACTATTTT--AACTTACTTAAAGG?GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAAGCTTAGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTAGGGCTTTATGCTGCGTCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCTCAGTGGCCCATTCCGT-TAGTTCAGGCCAGCATCAGTTTGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACAGCTTCGGTTGTAGACTTATAGCCCTCGGTGTAATGTGACCTACCTAGACTGAGGAACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGAC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Dolabra nepheliae CBS_123297' CGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTGGGTCCT-----TCGGGGCCCC-ATCTCCAACCCTTTGTTTACATC----ACTTTGTTGCTTTGGCAGGCCCGTCCCC---TGGGTTC-------CAGGGGACCGCCGGGAGC---GTCTGA-CG-------CCTCTGGCCAG--CGCCTGCCGATAGCCAATTTAA-----AATTC---TTTTAGTGA-AAT-GCTGTCTGA--ATTGAAAAC--------ATA---AATTCATTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCTTCAAGCCC-------GGCTTGTCATTGGACCCG----------ATCCATCTCATGGATCCATCTGAAAAATAATGGCGGTGGACGCAA-ATAGCCCCTGGCAGAGTGAGC-TTTA------CGCATCAGTCACGGC----GGTCGTTGCAGCCCCCGTTGAACC----------CGA---------AATTTATTT??????????????????????????????????????????????????????????????AAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-------GGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAATGCGGGGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCCTTTGCAGCGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCTC--TGGTGTATTCCGT-GTCCACAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGGGAATGTACCTACGCC----GGGGTAGACTTATAGCCCCGGGTGCAATGTGACCCGCCGAGACTGAGGTACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGT?????????????????????????????????????????????????????????????????????????????GGAGGTAGGATCCCGC---AGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Minutiella tardicola CBS_121757' ?????????????????AAGGATCATTACCGAGTAAGGGTGC-------TTGCGCCCG-ATCTCCAACCCTGTGTTGAAACTA---CCTTTGTTGCTTTGGCAGGCCCGTCT-------------------TTCGGGGCCGCCGGGGGG---GTTCAGTCA-------CCCCTGGCCAG--TGCTTGCCAGTAGCCTATCAAA-----AATC----TTTTATAAC-CAT-GTCGTCTGA--ATCATAATTA-------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAC-CCCTCAAGCCC-------GGCTTGTCATTGGGCCCT------------TATCGTTACAGATAGGCCTGAAAGATAATGGCGGT-GTCGAGA-ACGACCCCAGGTGCAGCGAGC-TTAT------AGCACACACTGAAA-----GGTTTTCTT-GTCCCGGCCTATGACTTCTTCCCCC-----------CGGGGACAGA--AATTTACTTAAAAGGGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCTTCGGTTTAAATCCCTTGGAACAGGGTGTCACAGAGGGTGAGAGTCCCGTCTTGAACCGTATGCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGTAACCAGACTTGAGCTGGGCGGTTCTACCGCGGTTCGCCGTGGCCTATTCCGTCCGGTCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGACCTCGGGAATGTATCTACTCTTC--GGGGTCGACTTATAGCCCGGGGTGCAATGTGACCTACCTGGACCGAGGAACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTATAAGCGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAGTTCGAGAAGGTATGTGATACATTCTCTCACATCATGCAATTTTAGTTGCCTTATCGCCCCT---TGAGAAATATTTGGTGGGGGCGGGGCAACA------CATCAAACAGCCCTGATACTCGATCCTGCCG----CATCTCACTTCCGCT------ATCCTGCCACCA---------------ACGTTCA----------GATTGATCAAATCGCTAACAATTGCCCAACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAA Moristroma_japonicum_BN1674 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AC---TATTTTAAC-T?T-GATGTCTGA--ATATTAAAT--------CAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATTTATTGTT------AATTTCTTACCAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGA-CCCAGATGCAGCGAGCTTTTT------TGCATACATTTGAA-----GTCAATTTTAACCCTATGCCTTATGTTTTTGGT????????????????????????????????????????GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGACTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTCCAATTTCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCGTCTATTGTCCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATACCCCTATGGTTTTCAATGGGTCATTTTGTTAAATG{CT}AGGCCAGCATCAGT{AT}AGAGTGGTTAGTTAAAGACCTTAGGAATGTATCTACTCTC----GGGTAGACTTATCGCCTAAGGTGAAATGTGACCTACTTGGACTGA{AG}GAGCGCGCTAT-ATGCTCGGATGCTGGCGTAATGGATGTAAGCGACCCGT-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTACGGGTGTCGAACCCCTACGCGTAATGAAAGTGAACGGAGGTAAGAACCTTT---TAGGTGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Moristroma_quercinum_BN1678 ??????????????????????????CAGAGTGAAAGGGTAT------TCATTGCCTG-ACCTCCAACCCTATGTTTAACTA----CCTTTGTTGCTTTGGCAAGTCATTTT--------CTTCA------CTGAAAATGGTTGGCAGT---GTTCATTCA-------CTGTTGATCTG--TACTTGCCAATAGCCTATT-TA-----AATAC---TATTTTAAC-TAT-GATGTCTGA--ATATTAAAT--------CAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAACCCCTCAAGCTT-------GGCTTGTTATTGGATTTATTGTTT----AAGAAATTTAACAATTGATCTCAAAGATAATGGCGGT-GTCAAAA-TTGACCCCAGATGCAGCGAGCTTTTT------TGCATACATTTGAA-----GTCATTTTTAACCCTATGCCTTATGTTTTTTCGT???????????????????????????????????????GGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGACTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTCCAATTTCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTATAACCGTCTATTGTACCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCATTTAAC-ATACCCCTATGGTTTTCAATAGGTCAT?TTGTTAAATTCAGGCCAGCATCAGTTTGAGTGGTTAGTTAAAGACCTTAGGAATGTATCTACTCTC----GGGTAGACTTATAGCCTAGGGTGAAATGTGACCTACTTGGACTGAGGAACGCGCTTT-ATGCTCGGATGCTGGCGTAATGGATGTAGGCGACCCGT-CTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTAAGAACCTTT---TAGGTGCATTATCGACCGATCCTGATGTC-TCGGATGGATTTGAGTAGAGCATAGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGGAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Neophaeomoniella corymbiae CBS_145092' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTTC-----TTTTGAGCCCGAACCTCCAACCCTTTGTTAAAAAC----ACTTTGTTGCTTTGGCAGGCCCGTTTGAATCCCTTCAC---GGGGAGGACGACCGCCGGGGAT---TCTT--TTA-------TCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AATAAATGTCTGA--AAAATTATAAT------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCT------------TATCGTTACAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATCGAAA-----GGTTTTTGT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAATTTTTCAAAGG??????????????????CAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAGCAGTTCTACCGCAGTTCTCTGTGGCCTATTCTGC-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACGCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGTACGCGCTTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGT--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Neophaeomoniella eucalypti CPC_25161' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTTC-----TTTTGAGCCCGAACCTCCAACCCTTTGTATA-AAC----ACTTTGTTGCTTTGGCAGGCCCGTCTGAAATTCCTTCG---GGATTTGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGA--AAAATTATAAC------TAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCT-----------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATTGAAA-----GGTTTTTGT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAATTTTTTAAAGG???????????????????????????????????ACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGT-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGCTTTATTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Neophaeomoniella eucalyptigena CBS_145093' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTCTC----TTCGGAGCCCGAACCTCCAACCCTTTGTTAAAAAC----ACTTTGTTGCTTTGGCAGGCCCGTCCTA---TCCTTTCACCGG--GAGACGACCGCCGGGGGC---GTTCAGTCA-------CCTCTGGTCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGA--AAAATTATAAT------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCTCT-----------TATCGTGAAAGATAGGCCCGAAAGATAATGGCGGC-GTCATCA-ATGACCCCAGATGCAGCGAGC-TTATA----CAGCATACATCGAAA-----GGTTTTGGT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAAATTTTCACAAGG????????????ACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAGCAGTTCTACCGCAGTTCTCTGTGGCCTATTCTGC-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGGCCTTGGGAATGTATCTACGCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATAGGGTCTACCTGGACTGAGGTACGCGCTTTATTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG???CGAGAAGTTCGAGAAGGTACGTTGCTTTCTTTTCATATTGCTTGCAATTTTGCTGCTTCACT-GCTCTGGGTGTGAAAATTTTGGTGGGGGCGGGGCTATTCTGAACCCTGAAGCAA-CCCCTTGCCTCACCCACATC-------------------------ACTGCACAACCTC--------------ATGCATATC----TTGGTCAAAACATCTTAACTAAC-ACATATCAACAGGAAGCCGCTGAACTCGGAAAGGGTTCCTTCAA 'Neophaeomoniella niveniae CBS_131316' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTCTCA---TCTCGAGCCCGAACCTCCAACCCTTTGTTTAAAAC----ACTTTGTTGCTTTGGCAGGCCCGTCTGACACTCCTTTAACCGGGATCGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGTCAG--TGCTTGCCGACAGCCTATTCAA-----AATTC---TTTATTA---AAT-AATGTCTGA--AAAATTATAAT------TAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCT-----------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCACAA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATTGAAA-----GGTTTTTGT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAATTTTTTAAAAGGGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC-TTC--GAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGT-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGCTTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGCATCGAGAAGTTCGAGAAGGTAAGATTCTTCCTCTTCATCATCACTCCATTCTTGATGCCTCATT-GCTCCGGGTGTGAAAATTTTGGTGGGGGCGGGGCTCA-------TCTGAAGCAA-CCCCTTGCCTCACCCACAATG------------------------ATCACACCACATCC-------------ATGCAAATC---ATTAATGAAAGAAACATGACTAACACATCAACAACAGGAAGCCGCTGAACTCGG??????????????? 'Neophaeomoniella zymoides CBS_114904' CGTAGGGGTGACTGCGGAAGGATCATTACTGAGTTAGGGTCTCA---TCTCGAGCCCGAACCTCCAACCCTTTGTATAAAAC----ACTTTGTTGCTTTGGCAGGCCCGTCTGAAAATCCTTTAACGGGGATCGACGACCGCCGGGGGC---GTTTAGTCA-------CCTCTGGCCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTCATTA---AAT-CATGTCTGA--AAAATTATAAC------TAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCTC-------GGCTTGTTATTGGGCCCT------------TATCGTTAAAGATAGGCTCGAAAGATAATGGCGGC-GTTATAA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATCGAAA-----GGTTTATAT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAATTCATTAAAGG????????????????????????????????????????????????????AATAGCTCAAATTTGAAATCTGGCTC--TA--GGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGT-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC---ATTGCTCGGATGCTGGCGTAAT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Neophaeomoniella zymoides CBS_121168' ?????????????????AAGGATCATTACTGAGTTAGGGTCTCA---TCTCGAGCCCGAACCTCCAACCCTTTGTATAAAAC----ACTTTGTTGCTTTGGCAGGCCCGTCTGAACATCCTTTAACCGGGATCGACGACCGCCGGGGGC---GTTCAGTCA-------CCTCTGGCCAG--TGCTTGCCGATAGCCTATTCAA-----AATTC---TTTATTA---AAT-CATGTCTGA--AAAATTATAAC------TAA---ATATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCTC-------GGCTTGTTATTGGGCCCT------------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCATAA-ATGACCCCAGATGCAGCGAGC-TTAT------AGCATACATCGAAA-----GGTTTTTAT-GGCCCGGCCTTAACGAG-------------------AAGCAATTCT--CAATTTATTTAAAGGGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTC--TA--GGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGCGCCCGCAGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAAGTGTACGGCAAGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAAGCGTTTGCAACCAGACTTGTTTCTAACAGTTCTACCGCAGTTCTCTGTGGCTTATTCTGT-TAGTCCAGGCCAGCATCAGTTTGGGTGGCTCGTTAAAGACTTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCATTGTGTAATAGGGTCTACCTGGACTGAGGTACGCGC---ATTGCTCGGATGCTGGCGTAATGGTTGTAAACGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAGTTCGAGAAGGTAAGATTCTTCCTGTTCATCTTCACCCCA-TTTTGCTGCCTCATT-GCTCTGGGTGTGAAAATTTTGGTGGGGGCGGGGCTCA-------TCTGAAGCAACCCCCTTGCCTCACCCACAATG------------------------ATTACACCACATTC-------------ATGCAATTC---ATTGACAAAAGTATCATGACTAACACATCAACAATAGGAAGCCGCTGAACTCGGTAAGGGTTCCTTCAA 'Paraphaeoisaria alabamensis CBS_101.77A' ?????????????????????ATCATTATCGAGTTAGGGTCC------TCTGGGCCCC-ATCTCCAACCCTTTGTTTATCAAAC--CTTTTGTTGCTTTGGCAGGCCCGTCC-------------------TTCGGGACCGCCGGAGGC----TTTTGTCG-------CCTCTGGTCCG--TGCCTGCCAGTAGCCCAATCAA-----ATTC----TTTCTAAAC-CAT-GAAGTCTGA--ATGTTTAAAAT----CAAAA---ATTAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCTTATCGACC--TTTTTTGTGAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGAAATGACCCCTGGTGCAGCGAGCAATCA------AGCATACACTGAGGC----GGTCTTTTTTGTCCCGGCCCTTTTGTT-------------------AATTCATTTA-----ACTCCTAAAGG??????????????????????GATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTC-TTTCAGAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACCGTCTGTCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCTAACGGTTCAACCACTGTTCTCAGTGGCCCATTCCGT-TAGTCCAGGCCAGCATCGGTTCGGGTGGTCAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTGACCTACCTGGACCGAGGTACGCGCTTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGG-AACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGCGAAAG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Paraphaeoisaria alabamensis CBS_101.77B' ?????????????????????ATCATTATCGAGTTAGGGTCC------TCTGGGCCCC-ATCTCCAACCCTTTGTTTATCAAAC--CTTTTGTTGCTTTGGCAGGCCCGTCC-------------------TTCGGGACCGCCGGAGGC----TTTTGTCG-------CCTCTGGTCCG--TGCCTGCCAGTAGCCCAATCAA-----ATTC----TTTCTAAAC-CAT-GAAGTCTGA--ATGTTTAAAAT----CAAAA---ATTAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCTTATCGACC-TTTTTTTGTGAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGAAATGACCCCTGGTGCAGCGAGCAATCA------AGCATACACTGAGGC----GGTCTTTTTTGTCCCGGCCCTTTTGTT-------------------AATTCATTTA-----ACTCCTAAAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Paraphaeomoniella capensis CBS_123535' CGTAGGTGAACCTGCGGAAGGATCATTACTGAGTTAGGGTTC-----TTTCGAGCCCG-ATCTCCAACCCTTTGTTCAACTA----CCTTCGTTGCTTTGGCAGGCCCGTTCTT-----------------TACGGGACCGCCGGAGGT---GTTAGGTCA-------CCTCTGGCCCG--TGCCTGCCAGTAGCCCACACAA-----ATTC----TTCTACA---AAT-TTTGTCTAA--GCATTAAATA-------TAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTATTCGAGCGTCATTATCAC-CACTCAAGCCC-------GGCTTGTTATTGGGTCTTC-----------TGTCGTTAAGGACAGACCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGC-TCATA----CAGCATACACTGAGGT----GGTTGTCTT-GTCCCGGCCTTAGTCTT-------------------GGTTAAACAAGACATTTTTTTCAAGG?????GAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGC-TT---GCGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGTTGTGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAGTCCCGTCTAGAACCGTATACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCACCACTGTTCTCAGTGGTTTATTCCGTTATTTCCAGGCCAGCATCGGTTTGGGTGGTTAGTTAAAGACATTGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCTTTGTGTAATGTGACCTACCCGGACCGAGGCACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGTTAAACGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGCGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATCTACGCATAGGGGCGAAAGCATCGAGAAGTTCGAGAAGGTACGAATTCATCCTTTTTTTCC-ATTTCATTTGCGTCTCACATCTGGCCTTATCTCAACGACTTTTGGTGGGGGCGGGGCAATGCGA---ATTATCGCAACACCGCCACACCAAAGAAAAAA-----TTTGATCATCCACGAGAACAATTTTCCGCCCA--------------ATGTTTA------CTACTTGGAAACAAAACACTAAC--GTCATCGATAGGAAGCCGCTGAACTTGGTAAGGGTTCCTTCAA 'Phaeomoniella chlamydospora CBS_117179' ???AGGTGAACCTGCGGAAGGATCATTATCGAGTCAGGGTCC------TCTGGGCCCG-ATCTCCAACCCTTTGTTTATCATA---CCTTTGTTGCTTTGGCAGACCCGTCC-------------------TTCGGGACCGTCGGGGGC---GTTCAGTCG-------CCTCTGGCCAG--CGTCTGCCAGTAGCCCAACCAA-----AATTC---TTTGTTACA-TGT-GACGTCTGA--ACGGTTCCATC------AAA---ATCAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGATATTGGGTCCATATCA-----ACTTTCATAGAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGCAATCA------AGCATACACTGAGGT----GGTCCTCTT-GGCCTGGCCCTATTGTTTTGTTGC------------------------AGAACTCTCAGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGAAGGTATGACTTCCACCCTCATTAT-----CACATTTTGCTGCCTTATC-GCCGCCTGTGTGAAAATTTTGGTGGGGGCGGGGCT---------CTCAAAACGA--CCCTTGCTTCACCGCAATG----CTCTCCACCAACCAT------ATTTCATCACTGCG-------------ATAAGCTTG---TCATTCAAAAAGCTCATCACTGAC-TGTTCTCAATAGGAAGCTGCTGAACTCGGAAAGG?????????? 'Phaeomoniella chlamydospora CBS_229.95' ?????????????GCGGAAGGATCATTATCGAGTCAGGGTCC------TCTGGGCCCG-ATCTCCAACCCTTTGTTTATCATA---CCTTTGTTGCTTTGGCAGACCCGTCC-------------------TTCGGGACCGTCGGGGGC---GTTCAGTCG-------CCTCTGGCCAG--CGTCTGCCAGTAGCCCAACCAA-----AATTC---TTTGTTACA-TGT-GACGTCTGA--ACGGTTCCATC------AAA---ATCAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGATATTGGGTCCATATCA-----ACTTTCATAGAAGATAGGCCCGAAAGATAATGGCGGC-GTCAAGA-ATGACCCCAGGTGCAGCGAGCAATCA------AGCATACACTGAGGT----GGTCCTCTT-GGCCTGGCCCTATTGTTTTGTTGC------------------------AGAACTCTCAGG???GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACCGTCTGTCGCGTCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCCAACGGTTCAACCGCTGTTTTCAGTGGCCTATTCCGT-TGGTTCAGGCCAGCATCGGTTCGAGTGGTTAGTTAAAGACTTTGGGAATGTATCTACCCCTCCGGGGGTAGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGGACGCGCTTT-TTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGC--AAGGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Phaeomoniella pinifoliorum CBS_114903' ??????????????????????????????????TAGGGTCT------TCTGGGCCCGAACCTCCAACCCTATGTTTA-ACT----ACTTTGTTGCTTTGGCAGGCCCGCCT-------------------TTCGGGGCCGCCGGAGGG---GTTAAGTCA-------CCTCTGGTCAG--TGCTTGTCAGTAGCCAATCTAA-----ATT-----CTTTATAAT-TAT-GAAGTCTGA--ATCTTTAATT-------AAA---ATTTAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTATTCGAGCGTCATTATCAA-CCCTCAAGCCC-------GGCTTGTTATTGGGTCCCT-----------TATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCATGA-ATGACCCCAGGGGCAGCGAGC-TTAT------AGCATACACTGAGGT----GGTCTTTGTGGGCGCGGCCCCTTTTCGTTA----------------AAGCAATTTA--ACTAAACTCAAAGG????????????????????????????????????????????????????AATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAACGTTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTATACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCATCACTGTTCTCAGTGGTCTATTCCGTTATATCCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACCCTTC--GGGGTCGACTTATAGCCCTTGGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-AT-CTGCTCGGATGCTGGCGTAAT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAGTTCGAGAAGGTAAGATGATATCTTGCATTCC--ATTTTCTTTTTACCGCCTTATCAACGCTGAGTGCGAAAATTTTGGTGGGGGCGGGGACAG-------TCTCAAACAG--CCCTTGATTCATCAACGCC------TCTCCCCCACCAT-------------CACTTCTGAAG-------CCCAGCGTAAC----GTATCAAGGACAACTTTACTGAC-TACGTGTAATAGGAAGCCGCTGAACTCGGTAAGGGTTCCTTCAA 'Pseudophaeomoniella oleae CBS_139191' CGTAGGTGAACCTTCGGAAGGATCATTACTGAGTTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTCTATAAA----CCTTTGTTGCTTTGGCAGGCCCGTCC-------------------TTCGGGACCGCCGGGGGT---GTTCAGTCA-------CCTCTGGCCCG--TGCTTGCCAATAGCCTATTCAA-----AATCCT--TTTTTTAAC-CAT-GAAGTCTGA--GAATTAATTA-------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCATCAAGCCC-------GGCTTGTTATTGGGTCCCC----------ATATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCACGA-ATGACCCCAGATGCAGCGAGC-TTTA------AGCATACATCGAGGT----GGTGTTCTT-GGCCTGGCCTTTTGAAATTTCATTC-----------TTATGGATTT--CATTTTTTTAAGG?????????????????????????????????GTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGATAAGGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCCGCATCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCGAACGGTTCAACCACTGTTTTCAGTGGCCCATTCCGT-TCGTCCAGGCCAGCATCAGTTTGGGTGGGTAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTACCCTACCTAGACTGAGGTACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGT--TAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTAT????????????????????????GAGAAGGTAAGCTCATCCTCATTGCCCTT---GGGATTCTTGATGCCTTATCAGCCGCTTGGGTGAAAATTTTGGTGGGGGCGGGGCAGGGCTATAATCTCAAACAG--CCCTCGCCTCAATCATACC------CCCCTTCAACACCGA--ACATCGAAGCACTTGCAGCGATGGGCCTCTTGAGTAGATTGACCATGAAGAACCAGATAGCTAACTGTTTCCCAATAGGAAGCTGCTGAACTTGGCAAGGGTTCCTTCAA 'Pseudophaeomoniella oleicola CBS_139192' CGTAGGTGAACCTTCGGAAGGATCATTACTGAGTTAGGGTCC------TCTGGGCCCG-ACCTCCAACCCTTTGTCTATAAA----CCTTTGTTGCTTTGGCAGGCCCGTCC-------------------TTCGGGACCGCCGGGGGT---GTTCAGTCA-------CCTCTGGCCCG--CGCTTGCCAATAGCCTATTCAA-----AATCC---TTTTTTAAC-CAT-GAAGTCTGA--GAATTAATTA-------TAA---ATATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTATCAA-CCATCAAGCCC-------GGCTTGTTATTGGGTTCCC----------GTATCGTTAAAGATAGGCCCGAAAGATAATGGCGGC-GTCCAGA-ATGACCCCAGATGCAGCGAGC-TTTA------AGCATACATCGAGGT----GGTGTTCTT-GGCCTGGCCTTTTGAAATTTCATTC-----------TTATGGATTT--CATTTTTTCTAAGG?????????????????????????TGCCTTAGTACGGCGTAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC-TTTTAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGACAAGGCTTGGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGTCCCTATGCCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTTCGAACGGTTCAACCACTGTTTTCAGTGGCCCATTCCGT-TCGTCCAGGCCAGCATCAGTTTGGGTGGGTAGTTAAAGGCCTTGGGAATGTATCTACTCCTTCGGGTGTAGACTTATAGCCCTCGGTGTAATGTGCCCTACCTAGACTGAGGTACGCGC-AT-CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCCGT--GAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGCGAAAG??????????????????AGGTAAGCTCATCCTCATTGCCCTT----GGATTCTTGATGCCTTATCAGCCGCTTGGGTGAAAATTTTGGTGGGGGCGGGGCAGGGCTATAATCTCAAACAG--CCCTCGCCTCAATCATACC------CCCTTTCAACACCGA--ACATCGAAGCACTTGCAGCGATGGGCCTCTTGAGTAGATTGACCATGAAGAACCAGATAGCTAACTGTTTCCCAATAGGAAGCTGCCGAACTTGGCAAGGGTTCCTTCAA 'Rhynchostoma proteae CBS_112051' CGTAGGTGAACCTGCGGAAGGATCATTATCAGGATAGGGTCT------TT--GGCCCA-ACTCCCAACCCTTTGTTTACTGT----ACCTTGTTGCTTTGGCAGGGCCGCCG-------------------TATGG--CCGCCAGGCCTCTAGTTCAATTGTTCTAGAGGTTGGGCCTG--TACCTGCCAATAGCCTACACCA-----AACTC---TTGTGTAAT-CAT-GATATCTGA--GTCTAAATTTA--------------ATAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAA-TTCCGTGAGTCATCGAATCTTTGAACGCACATTGCACCTTTTGGTATTCCG-AAAGGTATGCCTGTTCGAGCGTCATTATCAC-CTCTCAAGCTA-------GGCTTGTTATTGGGCCTC------------TACCGTTTATGGTTGGCCTTGAAGATAACGACTGT-TCTACGG-TATTGGCCGGATGCAACGAGC-TTTAAC---CAGCACGCATTCGGCC----CGCGCCGTAGATACAGGTCTCCATATTTA---------------------------------TTTCTAGA???GGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC-TTTCAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTGCGGTTTAAATCCCTTGGAACAGGGTGTCATAGAGGGTGAGAGTCCCGTCTTTAACCGTCTGTTGCGTCCATGTGAAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGGGCAGCGATTCAGCCGTTCTTCTGAACGGTGTACTTTGCTGTTTCCAGGCCAGCATCGGTTTGGGTGGCCAGTTAAAGGCTTCGGGAATGTATCTACCCTCC--GGGGTAGACTTATAGCCCGAGGTGACATCTGGTCTACCTGGACCGAGGCAAGCGT--T-CTACACGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGGAATGAAAGTGAACGGAGGTAGGAACCTTC----GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Strelitziana cliviae CPC_19822' CGTAGGTGAACCTGCGGAAGGATCATTACCGAGTTAGGGTTCGCTTTCGAGCAGCCCGACCTCCCAACCCTTTGTTTACCTTACCTAAATTGTTGCTTCGGCGAGCCGGTCC-------------------TCACGGGCCGCCTGGTCC---ACCTG-----------GACCGGGACAGTTCGCCCGCCGATGGCCCCAAACCAAACAAATTCTTGATACCAAAA-CAT-GTCGTCTGA--AACATTTCTTGATATTAAAAAATCAAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCATTGGTATTCCG-ATGGGCATGCCTGTTCGAGCGTCATTATCCT-CTCTCACAACCTTTATTGGTGGTGGTGTTGGACCCAGGTCGCCCGGAGTCACATCCGCGACCGGTCTCAAAGACAATGACGGC-GTCCGTG-GGGACCCTCTTCGCAACGAGTTTTCTTCTGGAGACACGCGTCGAGTTTCAAGGACCCAGC-GGGCCGGTCTTACCTAAATG----------------------------AATTTTTCTCAGG??GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCG-TA---AGGTCCGAGTTGTAATTTGTAGAGGATGTTTTGGGCACCGTCGCGGTGTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTGAAACCG-CGATAGGACCCGTGTAAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCAGGCAATCAGACTCGTGCGCGGG-GTTCCCCCTTGCTTCTGCTTGGGTTACTTCCCCGCGACCGGGCCATCATCAGTTTGGGGGGCCGGTTAAAGGCCTCGGGAATGTACCCACTCCTCCGGGGGTGGACTTATAGCCCGGGGTGTCATGCGGCCTCTCCGGACTGAGGAACGCGC-TT-CGGCGAGGATGATGGCGTAATGGTTGTCTGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCTTGCGCGGAATGAAAGTGAACGGAGGTAGGAAGGCCT--GAGCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Strelitziana malaysiana CPC_24874' CGTAGGTGAACCTGCGGAAGGATCATTACCGAGTTAGGGTTGCTCTTCTGAGTGCCCGACCTCCCAACCCTTTGTCTATGATA---CCACAGTTGCTTCGGCGGACCGAGGAGT-----------------CACACCCTCGCCTGGTTT-----------------ACGGCCGGGAGAG--CGTCCGTCGATGGCCCCAAATT-----AACACTTGAACCCAAAA-CCT-GTCGTCTGA--AAACTATTTGA-TATCATAA---TCAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTTCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCATTGGTATTCCG-ATGGGCATGCCTGTTCGAGCGTCATTATCCT-CTCTCAAACCTCCT----GGTTTGGCGTTGGATCGAGTT-------GTGGGCAACCGCAACTGGTCTCAAAGACAATGACGGC-GTCCGTG--GGACCCTCTTCGCAACGAGTCTTTTAC--GAGGCACGCGGGGAGTTGCAAGGTCTCGTC-GGGTCGGTCTAACCCTTTTA--------------------------------TTTTTAAGG??GGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC-TC---GGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCACCGTCGCGGTGTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTTTGAAACCG-CGATAGGACCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCAGGCAATCAGACTCGAGCGCGGG-GTTCCCCCTGGCTTCTGCCAGGGTTACTTCCCCGTGACCGGGCCAACATCAGTTTGAGGGGCCGGTTAAAGGCCTTGGGAATGTACTCACTCCTTCGGGGGTGAACTTATAGCCCAGGGTGTCATGCGGCCTCCCCGGACTGAGGAACGCGC-TT-CGGCGAGGATGTTGGCGTAATGGTTGTCTGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTGGCGCGGAATGAAAGTGAACGGAGGTAGGAAGGCTT--AAGCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Xenocylindrosporium kirstenboschense CBS_125545' CGTAGGTGAACCTGCGGAAGGATCATTATTGAGTAAGGGTTC------TCCGAGCCCG-ACCTCCAACCCTTTGTCTATACT----ACCTTGTTGCTTTGGCAGGCCCGTCC--------CTTC-------ACCGGGACCGCTGGAGAT---GCGTAGCCG-------TCTCTGGCCAG--TGCCTGTCAATAGCCCATCTCA-----ACT-----CTTTTTAAC-CAT-GTCGTCTGA--CGAAACAATC-------------AATAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA-TTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCG-AAGGGCATGCCTGTTCGAGCGTCATTTTCAA-CCATCAAGCAC-------GGCTTGTTATTGGGTCTC----------ATCGTTAAGAACGATGGACCTGAAAGTCAATGGCGGC-GTTCAGT-TTGACCCCAGATGCAGCGAGCTTTCT-----TAGCATACATCGCGGT----GGTCGGCTG-GACCTGGCCCCTAAATACTTCTTAAGG????????????????????????????????????????GAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCCC-TTTTAGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGGCCTCGGTTTAAATTCCTTGGAACAGGATATCAGAGAGGGTGAGAGTCCCGTCTTGAACCGTCGGTCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGTTTTTAACGGTTCCACCACGGTTCTCCGTGGTCTATTCCGT-TATCGCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCTTTGGGAATGTATCAACGCTTC--GGGGTTGACTTATAGCCCATCGTGTAATGTGACCTACCCGGACCGAGGTACGCGT-TC-ATTCTCGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTTAAACCCTTACGCGTAATGAAAGTGAACGGAGGTAGGAACC--G--CAAGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END; BEGIN TREES; TITLE 'Phytopathogenic fungi ITS-28S-TEF1a MLT'; LINK TAXA = Taxa1; TRANSLATE 1 'Aequabiliella effusa CBS_120883', 2 'Celerioriella dura CBS_120882', 3 'Celerioriella petrophiles CPC_29256', 4 'Celerioriella prunicola CBS_120876', 5 'Dolabra nepheliae CBS_123297', 6 'Minutiella tardicola CBS_121757', 7 Moristroma_japonicum_BN1674, 8 Moristroma_quercinum_BN1678, 9 'Neophaeomoniella corymbiae CBS_145092', 10 'Neophaeomoniella eucalypti CPC_25161', 11 'Neophaeomoniella eucalyptigena CBS_145093', 12 'Neophaeomoniella niveniae CBS_131316', 13 'Neophaeomoniella zymoides CBS_114904', 14 'Neophaeomoniella zymoides CBS_121168', 15 'Paraphaeoisaria alabamensis CBS_101.77A', 16 'Paraphaeoisaria alabamensis CBS_101.77B', 17 'Paraphaeomoniella capensis CBS_123535', 18 'Phaeomoniella chlamydospora CBS_117179', 19 'Phaeomoniella chlamydospora CBS_229.95', 20 'Phaeomoniella pinifoliorum CBS_114903', 21 'Pseudophaeomoniella oleae CBS_139191', 22 'Pseudophaeomoniella oleicola CBS_139192', 23 'Rhynchostoma proteae CBS_112051', 24 'Strelitziana cliviae CPC_19822', 25 'Strelitziana malaysiana CPC_24874', 26 'Xenocylindrosporium kirstenboschense CBS_125545'; TREE MLT = [&R] ((24:0.07997863,25:0.10638995):0.210265405,(23:0.20864322,(((17:0.17154269,20:0.07308469):0.01111777,((6:0.13467132,1:0.09014103):0.01296756,(26:0.16549848,(7:0.01262671,8:0.03755257):0.30218899):0.01354211):0.01182464):0.00804465,(((18:0.0,19:0.0):0.06407868,(15:0.0,16:0.0):0.04388527):0.04503774,(((11:0.02475229,9:0.02068193):0.01375776,(10:0.00831143,(12:0.0074573,(14:0.00431607,13:0.00918712):0.01618159):0.00544053):0.01352407):0.09837919,((22:0.01007301,21:0.00335369):0.08637859,(5:0.28571475,(3:0.0350781,(4:0.02969135,2:0.0777865):0.02649058):0.01217717):0.0):0.0165506):0.01442178):0.01535938):0.15197211):0.210265405); END; BEGIN TREES; TITLE 'Phaeomoniellales ITS-28S-TEF-TUB2 MLT'; LINK TAXA = Taxa2; TRANSLATE 1 'Pseudophaeomoniella oleicola CBS_139192', 2 'Pseudophaeomoniella oleae CBS_139191', 3 Pseudophaeomoniella_globosa_CSN185, 4 'Celerioriella prunicola CBS_120876', 5 Celerioriella_umnquma_CSN1091, 6 'Celerioriella petrophiles CPC_29256', 7 'Aequabiliella effusa CBS_120883', 8 'Aequabiliella palatina JKI_Ap36', 9 'Celerioriella dura CBS_120882', 10 'Heterophaeomoniella pinifoliorum CBS_114903', 11 'Minutiella simplex JKI_Jn27', 12 'Minutiella tardicola CBS_121757', 13 'Minutiella pruni-avium CBS_145513', 14 Vredendaliella_oleae_PMM1193, 15 'Neophaeomoniella niveniae CBS_131316', 16 'Neophaeomoniella zymoides CBS_121168', 17 'Neophaeomoniella zymoides CBS_114904', 18 'Neophaeomoniella eucalypti CPC_25161', 19 'Neophaeomoniella constricta JKI_Mz35', 20 'Neophaeomoniella ossiformis JKI_May03', 21 'Neophaeomoniella eucalyptigena CBS_145093', 22 'Neophaeomoniella corymbiae CBS_145092', 23 'Paraphaeomoniella capensis CBS_123535', 24 'Phaeomoniella chlamydospora CBS_229.95', 25 'Phaeomoniella chlamydospora CBS_117179', 26 'Paraphaeoisaria alabamensis CBS_101.77A', 27 'Paraphaeoisaria alabamensis CBS_101.77B', 28 Xenocylindrosporium_margaritarum_CSN1179, 29 'Xenocylindrosporium kirstenboschense CBS_125545', 30 'Dolabra nepheliae CBS_123297', 31 'Moristroma germanicum JKI_Feb06', 32 Moristroma_quercinum_BN1678, 33 'Moristroma palatinum JKI_Au02', 34 Moristroma_japonicum_BN1674, 35 'Rhynchostoma proteae CBS_112051', 36 'Strelitziana cliviae CPC_19822', 37 'Strelitziana malaysiana CPC_24874', 38 'Celothelium cinchonarum F_17105_f'; TREE MLT = [&R] (((((((((((22:0.03156965,21:0.03634936):0.00780143,(20:0.00816379,19:0.0252232):0.01252395):0.00829484,(((17:0.00743483,16:0.00493838):0.01599525,18:0.01554759):0.00198768,15:0.00839532):0.02737111):0.18638142,((((6:0.04372029,5:0.05862842):0.02991774,30:0.46269993):2.0E-8,(9:0.10753912,4:0.04949078):0.04128335):0.0289122,((3:0.03647613,1:0.00690194):0.0043004,2:0.00350072):0.11791456):0.02617445):0.0131912,((27:1.0E-8,26:1.0E-8):0.04686841,(25:1.0E-8,24:9.2299E-4):0.1100772):0.06828075):0.0318247,(38:0.36941702,14:0.11001414):0.08235048):0.01435002,((((12:0.00733127,11:0.00260445):0.01129895,13:0.02077277):0.18277328,(8:0.01166964,7:0.02267731):0.11227728):0.04040189,10:0.12878013):0.01336295):0.04028582,((((32:0.02097636,31:4.5636E-4):0.01994427,34:0.04302127):0.01354436,33:0.00818959):0.36015741,23:0.17098428):0.03591651):0.01970651,(29:0.20797439,28:0.16749053):0.06772882):0.2468762,35:0.37585813):0.36217523,(37:0.18471949,36:0.10364967):0.36217523); END; BEGIN TREES; TITLE 'Phaeomoniellales ITS-28S-TEF-TUB2 BI'; LINK TAXA = Taxa2; TRANSLATE 1 'Pseudophaeomoniella oleicola CBS_139192', 2 'Pseudophaeomoniella oleae CBS_139191', 3 Pseudophaeomoniella_globosa_CSN185, 4 'Celerioriella prunicola CBS_120876', 5 Celerioriella_umnquma_CSN1091, 6 'Celerioriella petrophiles CPC_29256', 7 'Aequabiliella effusa CBS_120883', 8 'Aequabiliella palatina JKI_Ap36', 9 'Celerioriella dura CBS_120882', 10 'Heterophaeomoniella pinifoliorum CBS_114903', 11 'Minutiella simplex JKI_Jn27', 12 'Minutiella tardicola CBS_121757', 13 'Minutiella pruni-avium CBS_145513', 14 Vredendaliella_oleae_PMM1193, 15 'Neophaeomoniella niveniae CBS_131316', 16 'Neophaeomoniella zymoides CBS_121168', 17 'Neophaeomoniella zymoides CBS_114904', 18 'Neophaeomoniella eucalypti CPC_25161', 19 'Neophaeomoniella constricta JKI_Mz35', 20 'Neophaeomoniella ossiformis JKI_May03', 21 'Neophaeomoniella eucalyptigena CBS_145093', 22 'Neophaeomoniella corymbiae CBS_145092', 23 'Paraphaeomoniella capensis CBS_123535', 24 'Phaeomoniella chlamydospora CBS_229.95', 25 'Phaeomoniella chlamydospora CBS_117179', 26 'Paraphaeoisaria alabamensis CBS_101.77A', 27 'Paraphaeoisaria alabamensis CBS_101.77B', 28 Xenocylindrosporium_margaritarum_CSN1179, 29 'Xenocylindrosporium kirstenboschense CBS_125545', 30 'Dolabra nepheliae CBS_123297', 31 'Moristroma germanicum JKI_Feb06', 32 Moristroma_quercinum_BN1678, 33 'Moristroma palatinum JKI_Au02', 34 Moristroma_japonicum_BN1674, 35 'Rhynchostoma proteae CBS_112051', 36 'Strelitziana cliviae CPC_19822', 37 'Strelitziana malaysiana CPC_24874', 38 'Celothelium cinchonarum F_17105_f'; TREE BI = [&R] ((((((((((17:0.018833,16:0.011402):0.037793,15:0.020548):0.012528,18:0.035655):0.06896,(22:0.075025,21:0.086627):0.022858,(20:0.017309,19:0.054149):0.024184):0.560027,(((6:0.118845,5:0.099595):0.093668,(9:0.280549,4:0.10188):0.098854,30:1.29134):0.075877,((3:0.084288,1:0.017547):0.013851,2:0.007832):0.295865):0.094736):0.045672,((27:0.004716,26:0.004108):0.094044,(25:0.002336,24:0.003754):0.305829):0.203434):0.112447,(38:1.05556,14:0.229848):0.285943):0.05668,(((12:0.016673,11:0.007613):0.026935,13:0.0541):0.542632,(8:0.035586,7:0.044869):0.257535):0.125604,(((32:0.042694,31:0.003376):0.041903,34:0.110601):0.039922,33:0.017777):1.14409,(29:0.574168,28:0.454851):0.288468,23:0.526739,10:0.284178):1.00164,35:1.05183):1.551905,(37:0.467366,36:0.245124):1.551905); END; BEGIN TREES; TITLE 'Phytopathogenic fungi ITS-28S-TEF1a BI'; LINK TAXA = Taxa1; TRANSLATE 1 'Aequabiliella effusa CBS_120883', 2 'Celerioriella dura CBS_120882', 3 'Celerioriella petrophiles CPC_29256', 4 'Celerioriella prunicola CBS_120876', 5 'Dolabra nepheliae CBS_123297', 6 'Minutiella tardicola CBS_121757', 7 Moristroma_japonicum_BN1674, 8 Moristroma_quercinum_BN1678, 9 'Neophaeomoniella corymbiae CBS_145092', 10 'Neophaeomoniella eucalypti CPC_25161', 11 'Neophaeomoniella eucalyptigena CBS_145093', 12 'Neophaeomoniella niveniae CBS_131316', 13 'Neophaeomoniella zymoides CBS_114904', 14 'Neophaeomoniella zymoides CBS_121168', 15 'Paraphaeoisaria alabamensis CBS_101.77A', 16 'Paraphaeoisaria alabamensis CBS_101.77B', 17 'Paraphaeomoniella capensis CBS_123535', 18 'Phaeomoniella chlamydospora CBS_117179', 19 'Phaeomoniella chlamydospora CBS_229.95', 20 'Phaeomoniella pinifoliorum CBS_114903', 21 'Pseudophaeomoniella oleae CBS_139191', 22 'Pseudophaeomoniella oleicola CBS_139192', 23 'Rhynchostoma proteae CBS_112051', 24 'Strelitziana cliviae CPC_19822', 25 'Strelitziana malaysiana CPC_24874', 26 'Xenocylindrosporium kirstenboschense CBS_125545'; TREE BI = [&R] ((25:0.250654,24:0.249747):1.23759,(23:0.555365,(26:0.57418,17:0.493347,6:0.387793,1:0.20458,20:0.190629,(7:0.030122,8:0.098615):1.03732,(((19:0.003568,18:0.0038):0.20063,(16:0.003759,15:0.003307):0.086936):0.133993,(((22:0.026856,21:0.008846):0.209868,(5:0.964798,(3:0.104927,(2:0.20969,4:0.073925):0.057732):0.046483):0.040037):0.069789,((11:0.059153,9:0.056816):0.045981,(10:0.024951,(12:0.017836,(14:0.012488,13:0.026049):0.041752):0.015452):0.034125):0.306854):0.048425):0.070887):0.874318):1.23759); END;