#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 20, 2022; 21:30 GMT TreeBASE (cc) 1994-2008 Study reference: Gams W., & Meyer W. 1998. What exactly is Trichoderma harzianum?. Mycologia, 90(5): 904-915. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S320] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=8; TAXLABELS Trichoderma_harzianum_CBS185.69 Trichoderma_harzianum_CBS354.33 Trichoderma_harzianum_Th1_CBS688.94 Trichoderma_harzianum_Th2_CBS689.94 Trichoderma_harzianum_Th3_CBS693.94 Trichoderma_inhamatum_CBS273.78 Trichoderma_longibrachiatum_CBS816.68 Trichoderma_viride_CBS240.63 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1251] TITLE ITS1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=275; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=. GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Trichoderma_harzianum_CBS185.69 CCGAGTTTACAACTCCCAAACCC.AATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCAC..GCCCCGGGTGCGTCGCAGCCCCGGAACC.A.GGCGCCCGCCGGAGGGACCAACC..AAACTCTT.TCTGTA.GTCCCC...........TCGCGG.AC.GTTATTTCTTACAGCTCTGAGCAAAAA...................T.TCCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_harzianum_CBS354.33 CCGAGTTTACAACTCCCAAACCC.AATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCT.GCCCCGGGTGCGTCGCAGCCCCGGA.CCAA.GGCGCCCGCCGGAGG.ACCAACC.AAAACTCTTTT.TGTATACCCCC...........TCGCGG....GTT.TTT.T.ATAA.TCTGAGCCTT.CTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_harzianum_Th1_CBS688.94 CCGAGTTTACAACTCCCAAACCC.AATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCT.GCCCCGGGTGCGTCGCAGCCCCGGA.CCAA.GGCGCCCGCCGGAGG.ACCAACCTAAAACTCTTAT.TGTATACCCCC...........TCGCGG....GTTTTTT.T.ATAA.TCTGAGCCTTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_harzianum_Th2_CBS689.94 CCGAGTTTACAACTCCCAAACCC.AATGTGAACGCTACCAAACTGTTGCCTCGGCGGGATCTCT.GCCCCGGGCGCGTCGCAGCCCCGGA.CCAA.GGCGCCCGCCGGAGG.ACCAACCCAAAACTCTTAT.TGTATACCCCC...........TCGCGG....GTTATTT.TTACTA.TCTGAGCCTT.CTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_harzianum_Th3_CBS693.94 CCGAGTTTACAACTCCCAAACCC.AATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCAC..GCCCCGGGTGCGTCGCAGCCCCGGAACC.A.GGCGCCCGCCGGAGGGACCAACC..AAACTCTTTTCTGTA.GTCCCC...........TCGCGG.AC.GTTATTTCTTACAGCTCTGAGCAAAAA...................T.TC.AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_inhamatum_CBS273.78 CCGAGTTTACAACTCCCAAACCC.AATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCT.GCCCCGGGTGCGTCGCAGCCCCGGA.CCAA.GGCGCCCGCCGGAGG.ACCAACC.AAAACTCTTAT.TGTATACCCCC...........TCGCGG....GTTTTTT.TTATAA.TCTGAGCCTT.CTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_longibrachiatum_CBS816.68 CCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGTTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGG.ACCAACTCCAAACTCTTTTTT.TCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTAT.TTT.TGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG Trichoderma_viride_CBS240.63 CCGAGTTTACAACTCCCAAACCC.AATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCAC..GCCCCGGGTGCGTCGCAGCCCCGGAACC.A.GGCGCCCGCCGGAGGGACCAACC..AAACTCTT.TCTGTA.GTCCCC...........TCGCGG.AC.GTTATTT.TTACAGCTCTGAGCAAAAA...................T.TC.AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG ; END; BEGIN TREES; TITLE Tb5086; LINK TAXA = Taxa1; TRANSLATE 1 Trichoderma_longibrachiatum_CBS816.68, 2 Trichoderma_harzianum_Th2_CBS689.94, 3 Trichoderma_inhamatum_CBS273.78, 4 Trichoderma_harzianum_CBS354.33, 5 Trichoderma_harzianum_Th1_CBS688.94, 6 Trichoderma_viride_CBS240.63, 7 Trichoderma_harzianum_CBS185.69, 8 Trichoderma_harzianum_Th3_CBS693.94; TREE Fig._4 = [&R] (1,((2,(3,4,5)),(6,7,8)))Trichoderma; END;