#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 7:58 GMT TreeBASE (cc) 1994-2008 Study reference: Crous P.W., Decock C., & Schoch C.L. 2001. Xenocylindrocladium guianense and X. subverticillatum, two new species of hyphomycetes from plant debris in the tropics. Mycoscience, 42: 559-566. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S718] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=11; TAXLABELS Curvicladium_cigneum_STEU_1595 Cylindrocladiella_infestans_ATCC_44816 Cylindrocladiella_microcylindrica_ATCC_38571 Cylindrocladium_floridanum_ATCC_18882 Cylindrocladium_scoparium_ATCC_46300 Fusarium_subglutinans_NRRL_22016 Gliocladiopsis_tenuis_IMI_300597 Xenocylindrocladium_guianense_STEU_3396 Xenocylindrocladium_guianense_STEU_3397 Xenocylindrocladium_serpens_STEU_1144 Xenocylindrocladium_subverticillatum_STEU_3397 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2287] TITLE beta_tubulin_gene_fragment; LINK TAXA = Taxa1; DIMENSIONS NCHAR=571; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Curvicladium_cigneum_STEU_1595 ???????????GTTGCTACCCCTGATTCTACCCCGCCGACCCGGCTCTCAC----CACCTCGACGACAACAAGGCTCGCCG-CTT-GC-AA-------TATGTTGTGATGCTGGA--TCCTGATGGCTAACCGC-GTGTTTCTTTCTCAATTATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTGCT--TCCT---CCTCGATCCTCTGCT--ATGACGG-GATTCACTGACATTCG--TGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGT{AG}CCT{AC}TGAGCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTATGTGGTGAAATCACGT{CT}ACTAATGATGCCCTCGACAAGCGGTAAACAAAA-ACTCACACCACCTAGGCTTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocladiella_infestans_ATCC_44816 ??????????????GCTGCCCCT{CG}ATTCTATCC{AC}GCCGAATCGTTTCCCACCCACCGCCTCGACAACAACAAAGCTCGCGA-TGCC-CACC-------CACATCGTGATATCT--GAAGACAATGGCTAATTTT-GTGTGTTTCTGCGAA-TATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTA-CATTCCT-CACCTCGACAAGCTTCG-----TCAACGGCTG-CTAACGGT-GTCTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGT?TACAACGGCAGCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA--CTATGGCAC--TCACAT-TTGCTACACTGTGAAATCAGAATGTA-CTCACGCTCCGTAGGCTTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTTCGTCCCGACAACTT????????????????????? Cylindrocladiella_microcylindrica_ATCC_38571 ???????????????????????????????????????????ACCATTTTCCACCGC{CT}TCGGCAACAACAAAGCTCGCGA-TAAT--GCC-------CACGTCGTGATATCTT-GAATGAGATTGCTAATC---ATGTGTTTCTG-AAC-TATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTT-TACACCT-CACCTTCACGAGTCTCT-----GCGGCGTTTG-CTCACGAT-?CAT-AACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGCAGCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA--CTGAAG-AT--CTA-AT-TTGCCACA--G-AGAATCACAGTG-A-CTTACGCCTATTAGGCTTCTGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCT{CT}GAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTT???????????????????????????????????????????????? Cylindrocladium_floridanum_ATCC_18882 ?GCGTGCCTTTGTTGCTGCCCCTGAGCGTACCCCGCCGACCCGGTTTCCAC----CGCTTCGACAACAACAAAGCTCGATG-GCTT-CAAG-------CACAATGCGATATTGGAGGACAAGGTTGCTAACTATCGTTTTTCTCTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATAGTTCCCAACTTCAAAAAAAAAATCTACCGTGAAGATTGACTGACACTTA--TGGCTAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTTTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGTATGTGGTCAAATTGC------AACATCGCTTTGGCGAGAATATAGAGCCAGCACTCACACCATCTAGGCTTCCGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGAT?TTGAGCCCGGT?CCATGGATGCCGTCCGTGCCGGCCCTTT?GGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocladium_scoparium_ATCC_46300 ?GCGTGCCTTGGTTGCTGCCCCTGATTCTACCCCGCCGCCCCGGTTTCCAC----CACATCGACGAAAACAAAGC-CGCAG-CCTCACGAA-------CATGATGTGATATCAGA--ACAAGATTGCTAACCGT-GTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCT---CTTCAACTCCAACAAAATTCTC-ACGACCG-GATTCACTGACAGTTA--TCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCCACGAGGTATGTGA--AAACCACGCGG-TGTT--CTCACACGCCGAGAGGCACAAGCAA-ACTGACAC?ATGTAGGCTTCTGGCAACAAGTTCCGTCCTTGTGCTGTCGTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Fusarium_subglutinans_NRRL_22016 CGCGTTGAGTTTATGGTGCCCCTGATTCTACCCCGCTGGG--------CGGTGGCAGCT----CAACGACAATGCACGATAGCTA-GCAGCTTTA-AATACCTTCTG----TCAAGATGAAGA-AGCTAATCAGATCTTTTCTCTGCG----ATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTGCTCATCGCTT-CCTCGAC-----GTCGCATGTGGGGGAT--GCTCACGAT-GTTT-ATCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAACGAGGTATGCTTTAACA-------GTCA---------ATGCCAAGAATTC---CCA-AGCTCACACAAC-TAGGCCTCTGGCAACAAGTATGTTCCCCGAGCCGTCCTCGTCGATCTTGAGCCTGGTACCATGGACGCCGTCCGAGCTGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Gliocladiopsis_tenuis_IMI_300597 ???????????GTCGCTGCCCCTGATTCTACCCCGCCGGGCCATT-----CCCACCGCCACGACAACAACAAAGCTCGGGA-C-CT-CGAT-------CACGACGTGATAA-TG-GAACACGATGGCTGACAAT-GTCT-TTTTTGCAAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTAACTCCCCTACATCTCAACAGTTCATTATCGCGCGGGGATTGACTGACGATTGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATACAATGATTC--TTGCCCCTTGCTCCCCCGAGAAGACGAGCCAAAGCTCACACCACCAAGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTTCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGCCCCTTTGGTCAGCTTTTCCGCCCCGACAACTT????????????????????? Xenocylindrocladium_guianense_STEU_3396 CGCGGTGCTTTGTTGCTGCCCCTGATTCTACCCCGCCGTCC??GAT---GGTTGCCGTCTTGACAACAGCAAAGCCCGTGGGCTTCGCCATGATGCGGGATTCTGTGATATTTG-GGATAAGATGGCTGACCAG--TGCTTCTTCTTCAACTATAGGTTCACCTCCAGACCGG?CAGTGCGTAAG?--ACTCCCTCCGATTCGACTGTTTATCAT---GAGGGGATTCACTGACA-TGA---GACCAGGGTAACCAAATTGGTGCCGCCTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGCAGTTCCGAGCTTTAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTATG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Xenocylindrocladium_guianense_STEU_3397 CGCGGTGCTTTGTTACTGCCCCTGATTCTACCCC?CCGTCCCCGAT---G?CTGCCGTCTCGTCAACAGCAAAGTCCGTGGGCTTCGTCATGATGCGGGATTCTGTGATATTTG-GGATAAGATGCCTGACCAG--TGCTTCTTCTTCAACTATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGT--ACTCCCTCCGATTCGACTGTTTATCAT---GAGGGGATTCACTGACA-TGA---GACCAGGGTAACCAAATTGGTGCCGCCTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGCAGCTCCGAGCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTATGTTGTG-CATCATCGCCCCTGG--CAAACATGGCAGCAATCAAACTCACAC------CACTGTAGGCTTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTT-CGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Xenocylindrocladium_serpens_STEU_1144 ?GCGCTGCTTGGCTGCTGCCCCTGATTCTACCCCGCTGCCTCTGCT---GCCCG---TCTCGACAACATCGATGCGAGTG-GCTCC-CGA-GCCGTGTAATGGTGCGATA?T-G-GAACAAGATGGCTGACCAGC-GATTTCTTCATCGAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCTTTCCCCCTCGATCCCAATGTTGACCTC---GAGGGGATTTGCTAACA-CTG---G-GTAGGGTAACCAAATTGGTGCCGCCTTCTGGCAGACCATCTCCGGCGAGCACGGCCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTATGTTGTG-AATCACGGTCCCTCGC-CAGGCGAGACGACAAACCAGCTCACGCCAC------TGCAGGCTTCTGGCAACAAGTATGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Xenocylindrocladium_subverticillatum_STEU_3397 ???????????GTTGCTGCCCCTGATTCTACCCCGCT?CCGCCGTT---GGCAGCCCTCTCGACAACAACAATGCTCGCGAGCCGC-CGGCGCGATATCATAGTCTGGTATT-G-GGACAAGATGGCTGACTGTG-TGTTTCTTCATCGAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAG--TTCTCCCTTCGACCCAGCTCACCTCCAT---GAGCGGATTCACTAACA-TTG---GAGCAGGGTAACCAAATTGGTGCCGCCTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTATGTTGTG-AATCACGCCCCCCCCTTCAAGCCGCACAGCACGCAGGCTCACACCACCCTCACTGCAGGCTTCCGGTAACAAGTATGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = beta_tubulin_gene_fragment) = N: 1-571; CODONPOSSET CodonPositions (CHARACTERS = beta_tubulin_gene_fragment) = N: 1-571; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2286] TITLE ITS1_5.8S_ITS2_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=538; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Curvicladium_cigneum_STEU_1595 ??CATTACCGAGTTTACAACTCCCAAACCCCATGTGAAC-ATACCTCAAACGTTCCCTCGGCGG-T--GTCCCGCGC---TCCGGCA--AGGGCCCGCCAGAGGACCCAACAAACTCTTTGTATTTCAATCTAGTATCTTCTGAGTGAAAACAAACAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGC-CTCTTCTGG-CTTGGTGTTGGGGATCGGCACGGGCGCCCTCAGGGG-CGCTGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCCAACTCTGCGTAGTAATACA--CCTCGCACTGGAAGCTCGGCGCGGCCAAGCCGTTAAACCCCCAACTTTTTTT????????????????????????????????????????? Cylindrocladiella_infestans_ATCC_44816 ??CATTACAGAGTTTACAACTCCCAAACCCC-TGTGAACA-TACC-A-GTCGTTGCCTCGGCGG-T--GT--CTTGC---TTCGGCG--A--GCCCGCCAGAGGACCCAACAAACTCTT---GTTTT--TTTAGTATTATCTGAGTGACAA-GTTTAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAACCCCC----GGGTTTGGTGTTGGAGATCGGCATGA-GTCCTTCGGGGCG--ACGCCGTCTCCCAAATATAGTGGCGGTCTCGCTGTAGCTTCCTATGCGTAGTAGCACA--CCTCGCACTGGAAA-GCAGCGCGGCCACGCCGTTAAACCCCCAACTTTT--CTGAGTTTGACCTCGAATCAGGTAGGATTACCCGCTGAACTT Cylindrocladiella_microcylindrica_ATCC_38571 ??CATTACAGAGTTTACAACTCCCAAACCCC-TGTGAACT-TACC-ATGTCGTTGCCTCGGCGG-T--GT--CTTGC---TTCGGCG--A--GCCCGCCAGAGGACCCAACAAACTCTT---GTTTT--TTTAGTATTATCTGAGTGACAA-GTTTAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAACCCCC----GGGTTTGGTGTTGGAGATCGACATGAAGCCCTTCTGGGTGTGAAGTCGTCTCCCAAATATAGTGGCGGTCTCGCTGTAGCTTCCTATGCGTAGTAGCACA--CCTCGCACTGGAAA-GCAGCAAGCCCACGCCGTTAAACCCCCCACTTT---CTGAGTTTGACCTCGAATCAGGTAGGATTACCCGCTG????? Cylindrocladium_floridanum_ATCC_18882 ??CATTACCGAGTTTACAACTCCCAAACCCCATGTGAAC-ATACCTGTTTCGTTCCCTCGGCGG-T--GTCCG-----------GCA--ACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTT--TTCAGTATCTTCTGAGTGAAAAAAA-CAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGTTGGGGATCGGCA-GGGCGTCCTTCGGGT-CGC-GCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAGTCTCGGTGCGACCACGCCGTAAAACCCCCAACTTTTTCT--GGTTGACCTCGAATCAGGTAGGACTACCCGCT??????? Cylindrocladium_scoparium_ATCC_46300 ???????CCGAGTTTACAACTCCCAAACCCCATGTGAAC-ATACCTGTTTCGTTCCCTCGGCGG-T--GTCCG-----------GCA--ACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTT--TTCAGTATCTTCTGAGTAAAAAAAAACAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCT-------GCTTGGTGTTGGGGATCGGCA-AGGCGTCCTCCGGGT-CGC-GCCGTCCCCCAAATATAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTAAAACCCCCAACTTTTTTCTG??????????????????????????????????????? Fusarium_subglutinans_NRRL_22016 ATCATTACCGAGTTTACAACTCCCAAACCCC-TGTGAAC-ATACCAATT--GTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCC-TAAACTCTGTT---TCTA--TATGTAACTTCTGAGTAAAACCATA-AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC-------AGCTTGGTGTTGGGACTCG---CGAG-----TCAAATCGCG------TTCCCCAAATTGATTGGCGGTCACGTCG-AGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCC-AACTTCTGAATG---TTGACCTCGGATCAGGTAGGAATACCCGCTGAAC?? Gliocladiopsis_tenuis_IMI_300597 ?????TACCGAGTTTACAACTCCCAAACCCC-TGTGAACT-TACC-TTTATGTTGCCTCGGCGG-C--GTCC---GC---TTCGGCG-----GCCCGCCAGAGGACCCAA-ACTCTTGT---ATTTGAATTGAGTATTCTCTGAGTGATAC-AAGCAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCC----GGGCTTGGTGTTGGAGATCGGCAACCGCCCCCTCGTGGGGTG-CGCCGCCTCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATTCA--CCTCGCTCTGGAAC-GCGGCGCGGCCAAGCCGTTAAACCCCCCACTTCTGAA---GGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTT Xenocylindrocladium_guianense_STEU_3396 ???ATTACCGAGTTTACAACTCCCAAACCCAATGTGAACTATACCTGTT-CGTTCCCTCGGCGG-T--GTCCGGCGC---TTCGGCG--AAGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTT--TT-AGTATCTTCTGAGTGAAAAAAA-CAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAATTCCTCTTTTGGAATTGGTGTTGGGGATCGGCA-AGGCGTCCTTCGGGC-CGC-GCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAAACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTTTTTTT--GTTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT Xenocylindrocladium_guianense_STEU_3397 ??CATTACCGAGTTTACAACTCCCAAACCCAATGTGAACTATACCTGTT-CGTTCCCTCGGCGG-T--GTCCGGCGC---TTCGGCG--AAGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTT--TT-AGTATCTTCTGAGTGAAAAAAA-CAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAATTCCTCTTTTGGAATTGGTGTTGGGGATCGGCA-AGGCGTCCTTCGGGC-CGC-GCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAAACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTTTTTTT--GTTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT Xenocylindrocladium_serpens_STEU_1144 ??CATTACCGAGTTTACAACTCCCAAACCCAATGTGAACTATACCTGTT-CGTTCCCTCGGCGG-T--GTTCGCTGC---TTCGGCA--GAGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATCT--TT-AGTATCTTCTGAGTGAAAAAAA-CAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGACGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAATTCCTCTTTTGGGATTGGTGTTGGGGATCGGCA-AGGCGACCTTCGGGC-CGC-GCCGTCCCCTAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAAACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTTTTTTTT-GTTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT Xenocylindrocladium_subverticillatum_STEU_3397 ??CATTACCGAGTTTACAACTCCCAAACCCCATGTGAACTATACCTGTT-CGTTCCCTCGGCGG-C--GTTT-CTCC---CGAAAGG--GAGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTT--TT-AGTATCTTCTGAGTGAAAAAAA-CAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAATTCCTCTTTTGGGATTGGTGTTGGGGATCGGCA-AGGCGACCTTCGGGC-CGC-GCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACA--CCTCGCTCTGGAGTCTTGGCGCGGCCACGCCGTTAAACCCCCAACTTTTTTTTT-GTTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS1_5.8S_ITS2_rDNA) = N: 1-538; CODONPOSSET CodonPositions (CHARACTERS = ITS1_5.8S_ITS2_rDNA) = N: 1-538; END; BEGIN TREES; TITLE Tb5889; LINK TAXA = Taxa1; TRANSLATE 1 Xenocylindrocladium_guianense_STEU_3397, 2 Xenocylindrocladium_guianense_STEU_3396, 3 Xenocylindrocladium_subverticillatum_STEU_3397, 4 Xenocylindrocladium_serpens_STEU_1144, 5 Gliocladiopsis_tenuis_IMI_300597, 6 Cylindrocladium_scoparium_ATCC_46300, 7 Cylindrocladium_floridanum_ATCC_18882, 8 Curvicladium_cigneum_STEU_1595, 9 Cylindrocladiella_microcylindrica_ATCC_38571, 10 Cylindrocladiella_infestans_ATCC_44816, 11 Fusarium_subglutinans_NRRL_22016; TREE Fig._1 = [&R] (11,((10,9),5),(8,((7,6),((4,3),(2,1))))); END;