#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:18 GMT TreeBASE (cc) 1994-2008 Study reference: Cmara M., Palm M., Van berkum P., & O'neill N. 2002. Molecular phylogeny of Leptosphaeria and Phaeosphaeria. Mycologia, 94(4): 630-640. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S822] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=59; TAXLABELS Leptosphaeria_bicolor Leptosphaeria_conferta Leptosphaeria_congesta Leptosphaeria_doliolum Leptosphaeria_dryadis Leptosphaeria_maculans Leptosphaeria_sp._fm._Bouganvillea Leptosphaeria_sp._fm._Miscanthus Leptosphaeria_taiwanensis_a Leptosphaeria_taiwanensis_b Leptosphaeria_taiwanensis_c Leptosphaeria_typharum Leptosphaeria_weimeri Paraphaeosphaeria_michotii Phaeoseptoria_musae Phaeoseptoria_sp. Phaeosphaeria_alpina Phaeosphaeria_avenaria Phaeosphaeria_bellynckii Phaeosphaeria_berlesei Phaeosphaeria_caricicola Phaeosphaeria_caricinella Phaeosphaeria_caricis Phaeosphaeria_culmorum Phaeosphaeria_dennisiana Phaeosphaeria_eustoma_a Phaeosphaeria_eustoma_b Phaeosphaeria_fuckelii Phaeosphaeria_halima Phaeosphaeria_herpotrichoides_a Phaeosphaeria_herpotrichoides_b Phaeosphaeria_insignis Phaeosphaeria_juncicola Phaeosphaeria_juncina Phaeosphaeria_juncophila Phaeosphaeria_lindii Phaeosphaeria_luctuosa Phaeosphaeria_lycopodina Phaeosphaeria_microscopica Phaeosphaeria_nigrans Phaeosphaeria_nodorum Phaeosphaeria_oreochloae Phaeosphaeria_oryzae Phaeosphaeria_padellana Phaeosphaeria_phragmiticola Phaeosphaeria_phragmitis Phaeosphaeria_pleurospora Phaeosphaeria_pontiformis Phaeosphaeria_setosa 'Phaeosphaeria silenes-acaulis' Phaeosphaeria_silvatica Phaeosphaeria_sp._fm._Iolium Phaeosphaeria_sp._fm._Phlox Phaeosphaeria_spartinae_a Phaeosphaeria_spartinae_b Phaeosphaeria_triglochinicola Phaeosphaeria_vagans Phaeosphaeria_volkartiana Stogonospora_foliicola ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M241] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=502; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Leptosphaeria_bicolor CATTAATTA--CGCAAGC-TATAGC-TTTGTCTACTT--GTACCTCTTGTTGTTTCCTC-GGCAGGC-TTGCCTGCCGCTAGGGAACCCCACAAACCCTTGTTTAAAGTATCAA--AATC-TCTGATAACTATTTAAAT-TATTACAAC-TTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CG-CTTTCTGCGT-----GGACTCGCCCCAAAGTCATTGGCAGC----GGTCGTGCCAGCTTCTCACGCAGCACA-TTTGCGTTTCTTGA--AGTTTGGTGGATCAGCAT-CCAGTAAGCTC-TTTTAT-GAC--TTGACCTCGGATCAGG Leptosphaeria_conferta CATTACCCTTTCATCAGGGGATTGG--ATGTC-TTTTGCGTACTATTTG-T--TTCCTT-GGTAGGC-TTGCCTGCCAATAGGAC-AAACT-ACAACC--ACTTGTAATTGCAGT-CAGCGTCAGT-AACAA-TGTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTTCTCTGCGCT-TGCGTGGAATGGACTCGCCTTAAAACAATTGGCAGCCGGCATGTTTGGCCT--GGA-GCGCAGCACATTTTGCGCCTCTTGTCA---ATGCTGT-TG-GCAT-CCATCAAGA-TCTTTTTT-AGCTCTTGACCTCGGATCAGG Leptosphaeria_congesta CATTACCCTTTGATCAGGGGATGGG--ATGTC-CTTTGCGTACTATTTG-T--TTCCTT-GGTGGGC-TTGCCCGCCTATAGGAC-TCACA-AAACCC--ACTTGTAATTGCAGT-CAGCGTCAGTAAACAA-TGTAAT-TATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTATGTCTGCTGCCCT-TGGGCACGCCAGACTCGCCTTAAAGCAATTGGCAGCCGGCAT-ATCAGCCT--GGA-GCGCAGCACATTTTGCGTCCCTTGCTG---ACCGTGT-TG-GCAT-CCATCAAGACGATTTTATCAGCTCTTGACCTCGGATCAGG Leptosphaeria_doliolum CATTACCATTACCTCAACGGGGGGG--ATGTCTTTTTGCGTACAGTTTGTT--TTCCCAGCAGGGACTTTGTGCCCCTACGGGA----TAT-CAATCCACCCTTGAATTTGCAGTCCATAGTCTGAAAAATA--ATAAT-AATTACAAC-TTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCG-CTTTTTGCG-----CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCCT--GGA-GCGCAGCACATTTTGCGCACCTTGCTGG---CGGTGT-TG-GCCC-CCATCAAGTCCATATATT-GGCTCTTGACCTCGGATCAGG Leptosphaeria_dryadis CATTAACCTTCATCGGGGGGCTGGA--ATGTC-TTTTGCGTACTATTTG-T--TTCCTT-GGTGGGC-TTGCCTGCCGATAGGAC-ATTAT-TAAACC--TTTTGTAATTGCAGT-CAGCGTCAG--AAAAA-CATAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTG-TCCCGTTTCT-CGCGT-----GGACTCACCTTAAAGCAATTGGCAGCCGGCAT-ATTGGCTT--GGA-GCGCAGCACATTTTGCGCCTCTTGTCA---TGATTGT-TG-GCAT-CCATCAAGACTATTTTTT--GCTCTTGACCTCGGATCAGG Leptosphaeria_maculans CATTACTCATTTTCAAAGCACTGCC--ATGTT-TTTTGCGTACTATTTG-T--TTCCTT-GGTGGGC-TTGCCCACCAATTGGAT-CCCCT-AAAACC--ACTTGCAATTGCAGT-CAGCGTCAGT-AACAA-TGTAATAAATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTTC----CACT-TG--------GGACTCGCCTTGAAACAATTGGCAGCCGGCA-CATTGGCCT--GGA-GCGCAGCACATTTTGCGCCTCTTGTCA---TGGTTGT-TG-GCAT-CCATCAAGACACTTTTTA-AGCTCTTGACCTCGGATCAGG Leptosphaeria_sp._fm._Bouganvillea CATTAAACGTTATATCACGGGGGGC--ATGTC-CTTTGCGTACAACATGTT--TTCCTTGGGGGGGC-TTGCTCCCCACTCGGACAAATCT-ACCACCTTTTTTGTAATTGCAGT-CTGCGTCAGATAATCA-TATAAT-TATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTG-TCTCGCGGTTCTGCG-----CAGACTCGCCTTAAAACAATTGGCAGCCGGCTTG-TTAGCCT--GGA-GCGCAGCACATATTGCGCCTCTTGCTAG--CGACTGC-TCGGCAC-CCATCAAGCCCATTTATT-TGCTCTTGACCTCGGATCAGG Leptosphaeria_sp._fm._Miscanthus CATTAATTA--CGCAAGC-TATAGC-TTTGTCTACGT--GTACCTCTTGTTGTTTCCTC-GGCAGGC-TTGCCTGCCGCTGGGACCCCTTA--AACCCTTGTTTACAGTATGAA--AATC-TCTGATAACCATTTAAAT-TATTACAAC-TTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CG-TTTTATGCGC-----GGACTCGCCCCAAAGTCATTGGCAGC----GGTCGTGCCAGCTTCTCGCGCAGCACA-TTTGCGTTTCTTGA--AGTTTGGTGGATCAGCGT-CCAGTAAGCTA-TTTTAT-GAC--TTGACCTCGGATCAGG Leptosphaeria_taiwanensis_a CATTAATTA--CGCAAGC-TATAGC-TTTGTCTACGT--GTACCTCTTGTTGTTTCCTC-GGCAGGC-TTGCCTGCCGCTGGGACCCCTTA--AACCCTTGTTTACAGTATGAA--AATC-TCTGATAACCATTTAAAT-TATTACAAC-TTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CG-TTTTATGCGC-----GGACTCGCCCCAAAGTCATTGGCAGC----GGTCGTGCCAGCTTCTCGCGCAGCACA-TTTGCGTTTCTTGA--AGTTTGGTGGATCAGCGT-CCAGTAAGCTA-TTTTAT-GAC--TTGACCTCGGATCAGG Leptosphaeria_taiwanensis_b CATTAATTA--CGCAAGC-TATAGC-TTTGTCTACGT--GTACCTCTTGTTGTTTCCTC-GGCAGGC-TTGCCTGCCGCTGGGACCCCTTA--AACCCTTGTTTACAGTATGAA--AATC-TCTGATAACCATTTAAAT-TATTACAAC-TTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CG-TTTTATGCGC-----GGACTCGCCCCAAAGTCATTGGCAGC----GGTCGTGCCAGCTTCTCGCGCAGCACA-TTTGCGTTTCTTGA--AGTTTGGTGGATCAGCGT-CCAGTAAGCTA-TTTTAT-GAC--TTGACCTCGGATCAGG Leptosphaeria_taiwanensis_c CATTAATTA--CGCAAGC-TATAGC-TTTGTCTACGT--GTACCTCTTGTTGTTTCCTC-GGCAGGC-TTGCCTGCCGCTGGGACCCCTTA--AACCCTTGTTTACAGTATGAA--AATC-TCTGATAACCATTTAAAT-TATTACAAC-TTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CG-TTTTATGCGC-----GGACTCGCCCCAAAGTCATTGGCAGC----GGTCGTGCCAGCTTCTCGCGCAGCACA-TTTGCGTTTCTTGA--AGTTTGGTGGATCAGCGT-CCAGTAAGCTA-TTTTAT-GAC--TTGACCTCGGATCAGG Leptosphaeria_typharum CATTAAATATGAAAGCGGTTTGGGG--ATGTC-TTTTGCGTAC-CTTTG-T--TTCCT-GGGTGGGC-TTGCCCACCAACAGGAC-AGTAT-TAAACC--ATTTGTAATTGCAAT-CAGCGTCAGT--ACAA-CAAAAT-AGTTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTG-TCT--------TGTG------AGACTCGCCTTAAAATAATTGGCAGCCAGCATACTGGTATT--GGA-GCGCAGCACAAG-T-CGCGCTTTGTATC--TGAATG-CGGGCAT--CCAG-AAGCCTCTTTTTC-AACTTTTGACCTCGGATCAGG Leptosphaeria_weimeri CATTACCCTTCGTCAGAGGGTGGGA--ATGTC-TTTTGCGTACTATTTG-T--TTCCTT-GGTGGGC-TCGCCCGCCAACAGGAC-ACTAT-AACACC---TTTGTAATTGCAGT-CAGCGTCAG--AAAAA-CGTAAT-TATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTG-TCTCGCCTTG-TGCGC-----AGACTCGCCTTAAAGCAATTGGCAGCCGGCAT-ATTGGCCT--GGA-GCGCAGCACATTTTGCGTCCCGGGCCA---TGATTGT-TG-GCGT-CCATCAAGACCACTTTTT--GCTCTTGACCTCGGATCAGG Paraphaeosphaeria_michotii CATTATCCATCTAAAACCAGGTGCG-TTTTTTTACGA--GCACCT-TTGTT-CTCCTTC-GGCGGGG-CAACCTGCCGCT--GGAACTTAATAAAACCTTTTATCTAGCATTAC--CTGT-TCTGAT-ACAAAT--AAT-CGTTACAAC-TTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCC-CGCCTCTGCGCGC-----GGACTCGCCCCAAATTCATTGGCAGC----GGTCTTTGCCTCCTCTCGCGCAGCACA-ATTGCGTCT-GCGA--GGGGGCGTGG-CCCGCAT-CCACGAAGCAA-CATTACCGTC-TTTGACCTCGGATCAGG Phaeoseptoria_musae CATTAC-ATTCAGT-------------TTGTCTTTTTGCGTACT-TATCGT--TTCCTC-GGCGGGC-TTGCCTGCCGGTTGGACAACTTT-ACAACCTTTTTA-AATCTTCAAT-CAGCGTCTG-AATAATATACAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGCTTGTCTT------T----TT-GTTAAGACTCACCTCAAAGTCATTGGCAGCCAG-TGTTTTGGTAGT--AA-GCGCAGCACATTTTGCG--TCTTGGTCCCT-CAACAG-CA-GCAT-CCATCAAGCCA-TTTTCT-CACTTTTGACCTCGGATCAGG Phaeoseptoria_sp. CATTAC-ATTCAGT-------------TTGTTTTTTTGCGTACT-TATCGT--TTCCTC-GGCGGG-CTTGCCTGCCGGTTGGACAACTTT-ATAACCTTTTTA-AATCTTCAAT-CAGCGTCTG-AATAATATACAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGCTTGTCTT------T----TT-GTTAAGACTCACCTCAAAGTCATTGGCAGCCAG-TGTTTTGGTAGT--AA-GCGCAGCACATTTTGCG--TCTTGGTCCCT-CAACAG-CA-GCAT-CCATCAAGCCA-TTTTCT-CACTTTTGACCTCGGATCAGG Phaeosphaeria_alpina CATTAA-TTTCGGTGGTTTTCCACT--TTGTCT-TTTGAGTACC-CAAG-T--TTCTTT-GGTAGGC-TTGCCTGCCA-TT-GAC-AACCT-ATAACC-TATTT-AATTTTAATT-CAGCGTCTG--AAAACTT-TAAT-AATTACAAC-TTTCATCAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTATTCTTT----GC-AATAAGACTCGCCTTAAAACAATTGGCAGCCA-G-GTTTTGGCATT-GAA-GCGCAGCACATTTTGCAATTCAAGCCCT----AATGC-TT-GCGT-CCAT-AAGCGT-ATTTTA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_avenaria CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-CACG-T--TTCCTC-GGCAGGC-TTGCCTGCCGATTGGACAAACCT-ACAACC-TTTTT-AATTTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACGACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTA----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACAAGTCGCGATTCTT----ATCA-AATAC-TT-GCGT-CCAC-AAGCCC-TTTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_bellynckii CATTAAATATCGGTAGTTTACTACC--TTGACGTTTTGCGTACT-CATG-T--TTCCTC-GGTAGGC-TTGCCTGCCGGTTGGACAATTTA-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG--AATTATCTTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCTATGCTTGGTGTTGGGTGTTTGTC-TCTGCTCT----GC---CTAGACTCGCCTTAAATATATTGGCAGCCG-GTATACTGGCTT--GAA-GCGCAGCAC-AATTGCATTTCAGGC--TTGTTATTAT-TA-GCGT-CCA-CAAGAAT--ATTAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_berlesei CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CCTG-T--TTCCTC-GGCGGGC-TTGCCCGCCGGTTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-ATTTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTGTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGTCCCATCAAGCCT-CTTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_caricicola CATTAAATACCGGTAGTTTACTACC--TTGACTTTTTGAGCACT-TGTG-T--TTCCTC-GGCAGGC-TTGCCTGCCGTATGGACAAATCA-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG--AATTAT-TTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTC-TTTGCTTT----GC---TTAGACTCGCCTTAAATATATTGGCAGCCG-GTATACTGGTTT--GAA-GCGCAGCAC-AATTGCATTTCTAGC--TTGTTATTAC-TG-GTAC-CCATTAAGAAA--ATTAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_caricinella CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GT-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_caricis CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATGC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGT Phaeosphaeria_culmorum CATTACATT-CAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGACTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_dennisiana CATTAA-TTTCGGTGGATTTCCACT--TTGTCT-TTTGAGTACC-CAAG-T--TTCCTT-GGCAGGC-TTGCCTGCCAACTGGAC-AACCT-ATAACC-CTTTT-AATTTTAAAT-CAGCGTCTG--AAAATTT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCTATTCATT----GC-AATAGGACTCGCCTTAAAACAATTGGCAGCCA-GTGTTTTGGCATT-GAA-GCGCAGCACATTTTGCAATTCAAGCCCT----AATAC-TT-GCGT-CCATAAAGCGT-ATGTTA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_eustoma_a CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-TACG-T--TTCCTC-GGTAGGC-TTGCCTGCCGATTGGACAAACCT-ATAACC--TTTT-AAATTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTT----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTAAT-GAA-GCGCAGCACAAGTCGCGATTCTT----ATTA-AATAC-TT-GCGT-CCAC-AAGCC---TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_eustoma_b CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-TACG-T--TTCCTC-GGTAGGC-TTGCCTGCCGATTGGACAAACCT-ATAACC--TTTT-AAATTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTT----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTAAT-GAA-GCGCAGCACAAGTCGCGATTCTT----ATTA-AATAC-TT-GCGT-CCAC-AAGCC---TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_fuckelii CATTAA-ATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGTGGGC-TTGCCTGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GT-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTC-AAC--TA-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_halima CATTACTATAAGGCATGAATATTTA--TTGATTTTTTGCGTA-T-CCTG-T--TTCCTT-GGTAGGC-TTGCCTGCCAATTGGACAAAATC-ATAACCCT-TTT-AATATTTAAT-CAGCGTCTG--AATCATTTTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTAATCTCAAGCTATGCTTGGCGTTGGGTACTTGTCTTA-GCTGA----GC-CTAAAGACTTGCCTTAAATATATTGGCAGCCA-GTATTTTGGTTT--GAATGTGCAGCACA----GCGCCTCAAGC--TGTTAAACAC-GG-GCA-ACCATGAGAAAT-TATCACT--CTTTTGACCTCGGATCAGG Phaeosphaeria_herpotrichoides_a CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CTTG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CT-TTAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_herpotrichoides_b CATTACAATTCAGTAGCTTGCT-CT--TTGTCT-TTTGCGCACT-CTTG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CT-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_insignis CATTACATT-CAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_juncicola CATTAAACA-CAGTAGTTTTCTATT--TTGTCTTTTTGCGTACT-CATG-T--TTCCTC-GGCAGGC-CTGCCTGCCGATTGGAC-TCCCT-ATAACC-TTATT-AATTGTAAAT-CAGCGTCTC--AATAAT-ATAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGAGTTTGT--TCT-------------TTTGGACTCTCCCTAAATTCATTGGCAGCAG-ATATATTGTTTT--GAA-GCGCAGCACAATTTGCAATTCAAGC--CT--TTCTAT-CA-GCCC-CCAT-AAGTAT-TTT----CACTTTTGACCTCGGATCAGG Phaeosphaeria_juncina CATTAC-ATTCAGTATTGTATGTAC--TTGTCT-TTTGAGTACT-TATG-T--TTCCTT-GGTAGGC-TTGCCTGCCAGTTGGACAACACTTATAACCTTTTTA--ATTTTCAAT-CAGCGTCTGAAATAATTT--AAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGCTTGTCCTCTCC-CT----GT-GTTTGGACTCACCTTAAAGAAATTGGCAGCCA-GTGTATTGGTTTT-GAA-GCGCAGCACAATTTGCGATTCAAGCTTATATCATCAG-CT---TT-CCAGTAAGCCT-TTTTAT-CACTTTTGACCTCGGATCAGG Phaeosphaeria_juncophila CATTAATTATCGGTAGTTTACTACC--TTGACTTTTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGAATGGACAAATCA-ATAACC-TATTT-AATATTTAAT-CAGCGTCTG--AATTATTTTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCCTTGCTTGGTGTTGGGTGTTTGTC-TCTGCTCT----GC---TTAGACTCGCCTTAAATATATTGGCAGCCG-GTATACTGGTTT--GAA-GCGCAGCAC-ATTTGCAATTCAAGC--CTGCTATTAT-TG-GTAT-CCACAAAGAAT--ATCAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_lindii CATTACAATTCAGTAGCTCGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGACTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_luctuosa CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACCTTTTTT-AATTTTCAAT-CAGCGTCTGAAAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_lycopodina CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_microscopica CATTACAATTCAGTAGCTTGCTACT--TTGTCT-CCTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TATTC-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTCAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTGGC--CT-ATAATAC-TT-GCGT-CCAT-AAGCCT-ATTTTC-AACTTTTGACCTCGGATCAGG Phaeosphaeria_nigrans CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-CACG-T--TTCCTC-GGCAGGC-TTGCCTGCCGATTGGACAAACCT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTA----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACAAGTCGCGATTCTT----ATCA-AATAC-TT-GCGT-CCAC-AAGCCC-TTTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_nodorum CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-CACG-T--TTCCTC-GGCAGGC-TTGCCTGCCGATTGGACAAACCT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTA----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACAAGTCGCGATTCTT----ATCA-AATAC-TT-GCGT-CCAC-AAGCCC-TTTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_oreochloae CATTAA-TTTCGGTGGTTTTCCTCT--TTGTCT-TTTGAGTACC-CAAG-T--TTCTTT-GGTAGGC-TTGCCTGCCA-TT-GAC-AACCT-ATAACC-TTTTT-AATTTTAAAT-CAGCGTCTG--AAAACTT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTATTCTTT----GT-AATAAGACTCGCCTTAAAACAATTGGCAGCCA-GTGTTTTGGCATT-GAA-GCGCAGCACATTTTGCAATTCAAGCCCT----AATAC-TT-GCGT-CCAG-AAGCGT-ATTTTA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_oryzae CATTAC-ATTCAGT-------------TTGTTTTTTTGCGTACC-TATCGT--TTCCTC-GGCGGGC-TTGCCTGCCGGTTGGACAACTTT-ATAACCTTTTTA-AATCTTCAAT-CAGCGTCTG-AACAATATACAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGCTTGTCTT------T----TT-GTTAAGACTCACCTCAAAGTCATTGGCAGCCA-GTGTTTTGGTAGT--AA-GCGCAGCACATTTTGCG--TCTTGGTCCCT-CAACAG-CG-GCAT-CCATCAAGCCA-TTTTCT-CACTTTTGACCTCGGATCAGG Phaeosphaeria_padellana CATTAA-TTTCGGTGGTTTTCCACT--TTGTCT-TTTGAGTACC-CAAG-T--TTCTTT-GGTAGGC-TTGCCTGCCA-TT-GAC-AACCT-ATAACC-TTTTT-AATTTTAAAT-CAGCGTCTG--AAAAATT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTATTCTTT----GC-AATAAGACTCGCCTTAAAACAATTGGCAGCCA-GTGTTTTGGCATT-GAA-GCGCAGCACATTTTGCAATTCAAGCCCA----AATAC-TT-GCGT-CCAT-AAGCGT-ATTTTA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_phragmiticola CATTACAATTCAGTAGCTTGCTACT--TTGTCT-ATTGCGCACC-CATGTT--TTCCTC-GGCGGGC-TTGCCCGCCGGTTGGACAAACCT-ATAACC-TTTTT-CATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAGTGCAGTGTGAATTCAGCAGATATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCAG-TGTTTTGGTATT-GAA-GCGCAGCACAATTTGCGATTCTAGC--CG-ACAGCAC-TT-GCGT-CCAT-AAGCC---TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_phragmitis CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGGTTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTGAAAAAAA-T-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTATC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-CACTTTTGACCTCGGATCAGG Phaeosphaeria_pleurospora CATTACTTT-CAGTAGTTTACTACT--TTGTCTTTTTGCGCACT-CATG-T--TTCCTC-GGTAGGC-TTGCCTGCCGGTCGGAC-ATTTA-ATAACC-TTTTT-AATCTTCAAT-CAGCGTCTG--AACAATTATAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCTATGCTTGGTGTTGGGTGTTTGTC-TGTGCTTT----AT-GCTTAGACTCGCCTTAAATATATTGGCAGCCG-ATATATTGGTTT--GAA-GCGCAGCACAATTTGCGAATCTTGC--CT-TTAATAT-TA-GCCC-CCATAAAGTAT-AATTAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_pontiformis CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGTACC-CATG-T--TTCCTC-GGCAGGC-TTGCCTGCCGATTGGAC-AATCT-ATAACC-TTTTT-AATTTTTAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GT-GTTTGGACTCGCCTTAAAACAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACAATTTGCGATTCTGGC--CTTAAAACAC-TA-GTGT-CCAT-AAG-TA-TTTTCT-CACTTTTGACCTCGGATCAGG Phaeosphaeria_setosa CATTATCAATT-AT-AGGCG------TTTGTC-TTTTGCGTACTGTATG-T--TTCCTC-GGTGGGC-TCGCCCGCCGATAGGAC-ACTTT-AAAACC--TTTTGTAATGGAAAT-CAGCGTCAGAAATAAC-TATAAT-AGTTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTG-TCTCGCCG-T-TGCGCG---CAGACTCGCCTTAAAGCAATTGGCAGCCGGCAAAA---GCCT-GGGA-GCGCAGCACA---TGCGTTGCTT-TCAGACTGCTTGT-CGAGCGT-CCAGCAAGCCTATTATTCTTGCGTTTGACCTCGGATCAGG 'Phaeosphaeria silenes-acaulis' ACAT??{CG}CATTACATATCGGTAGTTTACTACC--TTGACTTTTTGCGCACACAT??{CG}T--TTCCTT-GGCGGGC-TTGCCCGCCAACAGGATCATTCA-AACAT??{CG}CTTT-AATTTTCAAT-CAGCGTCTG--AATTATTTTAAT-AATACAT??{CG}TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCACAT??{CG}TGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAACAT??{CG}AATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCAACAT??{CG}TCGAGCGTCATTTGTACTCTCAAGCCTTGCTTGGTGTTGGGTGACAT??{CG}TCTGCTCT----GC---TTAGACTCGCCTTAAATAGATTGGCAACAT??{CG}ATACTGGTTT--GAA-GCGCAGCAC-ATTTGCAATTCAAGC--ACAT??{CG}TAT-TG-GTAT-CCACAAAGAAT--ATCAA-CACTTTTGACCTAC Phaeosphaeria_silvatica CATTACAATTCAGTAGCTTGCTACT--TTGTCT-ATTGCGCACT-CCTG-T--TTCCTC-GGTGGGC-TTGCCCGCCGATTGGACAAAACT-ATACTC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCT-T----GC-GTTTGGACTCGCCTTAAAGTAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-GTAATAC-TC-GCGT-CCAT-AAGTCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_sp._fm._Iolium CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAACTTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGCATCAGG Phaeosphaeria_sp._fm._Phlox CATTATGAATAAGTAGTTTGCTACTT-TTGTCT-TTTGAGTACT-TATG-T--TTCCTT-GGTAGGC-TTGCTTACCAATTGGACAATTTA-CAAACCTTTATT---TCTTAAAT-CAGCGTCTG--AATAAAT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTTTGTTTT----ATAGCTTGGACTCGCCTCAAAGTAATTGGCAGCCAAATGTTTTGGTAG--AAA-GCGCAGCACATTTTGCAATTTCCT---CCAAGAGTAT-TA-GCG-ACCAATAAGCCT-TTCTAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_spartinae_a CATTAAATTTCTTTGGCGTGCCACT--TTGTCT-TTTGTGCACT---TG-T--TTCCTC-GGCGGGT-CTGCCCGTCTTTAGGACCAAACT-ATAACCCTTTTT--ATTTTTAAT-CTGCGTCTGAAAACAATA-TAAT-CATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTATA-GAA-GCGCAGCACATTTTGCGATTCTGGC--TG-ATAATAC-TT-GCGT-CCAT-AAGCCT-TTTTATTAACGCTTGACCTCGGATCAGG Phaeosphaeria_spartinae_b CATTAAATTTCTTTGGCGTGCCACT--TTGTCT-TTTGTGCACT---TG-T--TTCCTC-GGCGGGT-CTGCCCGTCTTTAGGACCAAACT-ATAACCCTTTTT--ATTTTTAAT-CTGCGTCTGAAAACAATA-TAAT-CATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GT-GTTTGGACTCGCCTTAAAATAATTGGCAGCCA-GTGTTTTGGTATA-GAA-GCGCAGCACATTTTGCGATTCTGGC--TG-ATAATAC-TT-GCTT-CCAT-AAGCCT-TTTTATTAACGCTTGACCTCGGATCAGG Phaeosphaeria_triglochinicola CATTAAATATCGGTAGTTTACTACC--TTGACTTTTTGCGCACT-CATG-T--TTCCTT-GGTGGGC-TTGCCCGCCAAAAGGATAATTTA-ATAACC-TCTTT-AATTTTCAAT-CAGCGTCTG--AATTATTTTAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCCTTGCTTGGTGTTGGGTGTTTGTC-TCTGCTCT----GC---TTAGACTCGCCTTAAATATATTGGCAGCCG-GTATACTGGTTT--GAA-GCGCAGCAC-ATTTGCAATTCAAGC--CTGCTATTAT-TG-GTAC-CCACAAAGAAT--ATCAA-CACTTTTGACCTCGGATCAGG Phaeosphaeria_vagans CATTACA-TTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CATG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCTTT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CG-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Phaeosphaeria_volkartiana CATTACAATTCAGTAGCTTGCTACT--TTGTCT-TTTGCGCACT-CTTG-T--TTCCTC-GGCGGGC-TTGCCCGCCGATTGGACAAAACT-ATAACC-TTTTT-AATTTTCAAT-CAGCGTCTG-AAAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCTCT----GC-GTTTGGACTCGCCTTAAAGCAATTGGCAGCCA-GTGTTTTGGTATT-GAA-GCGCAGCACATTTTGCGATTCTAGC--CT-ATAATAC-TT-GCGT-CCAT-AAGCCT--TTTTT-AACTTTTGACCTCGGATCAGG Stogonospora_foliicola CATTAC-ACTCAGTAGTTTACTACT--TTGTCT-TTTGCGCACC-CATG-T--TTCCTC-GGCAGGC-TTGCCTGTCGACTGGACAAAATT-ATAACC-TTTTT-AATGTTCAAT-CAGCGTCTG--AAAAACT-TAAT-AATTACAAC-TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT------AGTGTGAATT--GCAGA-ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTT----GT-GTTTGGACTCGCCTTAAAACAATTGGCAGCCA-GTGTTTTGGTATA-GAA-GCGCAGCACAAGTCGCGATTCTGGC--CTCATAGCAC-TT-GCAT-CCAC-AAG--T-TTTTTT-AACTTTTGACCTCGGATCAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-502; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-502; END; BEGIN TREES; TITLE Tb6107; LINK TAXA = Taxa1; TRANSLATE 1 Stogonospora_foliicola, 2 Phaeosphaeria_volkartiana, 3 Phaeosphaeria_vagans, 4 Phaeosphaeria_triglochinicola, 5 Phaeosphaeria_spartinae_b, 6 Phaeosphaeria_spartinae_a, 7 Phaeosphaeria_sp._fm._Phlox, 8 Phaeosphaeria_sp._fm._Iolium, 9 Phaeosphaeria_silvatica, 10 'Phaeosphaeria silenes-acaulis', 11 Phaeosphaeria_setosa, 12 Phaeosphaeria_pontiformis, 13 Phaeosphaeria_pleurospora, 14 Phaeosphaeria_phragmitis, 15 Phaeosphaeria_phragmiticola, 16 Phaeosphaeria_padellana, 17 Phaeosphaeria_oryzae, 18 Phaeosphaeria_oreochloae, 19 Phaeosphaeria_nodorum, 20 Phaeosphaeria_nigrans, 21 Phaeosphaeria_microscopica, 22 Phaeosphaeria_lycopodina, 23 Phaeosphaeria_luctuosa, 24 Phaeosphaeria_lindii, 25 Phaeosphaeria_juncophila, 26 Phaeosphaeria_juncina, 27 Phaeosphaeria_juncicola, 28 Phaeosphaeria_insignis, 29 Phaeosphaeria_herpotrichoides_b, 30 Phaeosphaeria_herpotrichoides_a, 31 Phaeosphaeria_halima, 32 Phaeosphaeria_fuckelii, 33 Phaeosphaeria_eustoma_b, 34 Phaeosphaeria_eustoma_a, 35 Phaeosphaeria_dennisiana, 36 Phaeosphaeria_culmorum, 37 Phaeosphaeria_caricis, 38 Phaeosphaeria_caricinella, 39 Phaeosphaeria_caricicola, 40 Phaeosphaeria_berlesei, 41 Phaeosphaeria_bellynckii, 42 Phaeosphaeria_avenaria, 43 Phaeosphaeria_alpina, 44 Phaeoseptoria_sp., 45 Phaeoseptoria_musae, 46 Paraphaeosphaeria_michotii, 47 Leptosphaeria_weimeri, 48 Leptosphaeria_typharum, 49 Leptosphaeria_taiwanensis_c, 50 Leptosphaeria_taiwanensis_b, 51 Leptosphaeria_taiwanensis_a, 52 Leptosphaeria_sp._fm._Miscanthus, 53 Leptosphaeria_sp._fm._Bouganvillea, 54 Leptosphaeria_maculans, 55 Leptosphaeria_dryadis, 56 Leptosphaeria_doliolum, 57 Leptosphaeria_congesta, 58 Leptosphaeria_conferta, 59 Leptosphaeria_bicolor; TREE Fig._1 = [&R] ((((((((58,54),57),(55,47)),(53,56)),48),11),(((((45,(17,44)),26),(((((18,43),16),35),((6,5),(((((30,(29,2)),21),((36,28),22,(40,14),(9,15),(37,23,8,3,24))),38),32))),((((34,33),(42,19,20)),1),12))),(((((((10,4),25),39),41),31),13),27)),7)Phaeosphaeria),((52,51,50,49),59),46); END;