#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 21:25 GMT TreeBASE (cc) 1994-2008 Study reference: Peintner U., Bougher N., Castellano M., Moncalvo J., Moser M., Trappe J., & Vilgalys R. 2001. Multiple origins of sequestrate fungi related to Cortinarius (Cortinariaceae). American Journal of Botany, 88(12): 2168-2179. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S858] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=29; TAXLABELS Cortinarius_anomalus Cortinarius_collinitus Cortinarius_odorifer Cortinarius_violaceus Gymnopilus_penetrans Gymnopilus_sapineus Gymnopilus_spectabilis Hebeloma_circinans Hebeloma_crustuliniforme Hebeloma_fastibile Hebeloma_helodes Hebeloma_mesophaeum Hebeloma_radicosum Hebeloma_velutipes Hymenogaster_alnicola Hymenogaster_bulliardii Hymenogaster_gardneri Hymenogaster_glacialis Hymenogaster_griseus Hymenogaster_olivaceus Hymenogaster_parksii Hymenogaster_populetorum Hymenogaster_sp._nov._Trappe20345 Hymenogaster_subalpinus Hymenogaster_tener Naucoria_bohemica_AF124712 Naucoria_bohemica_IB19940290 Naucoria_escharoides Naucoria_scolecina ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=106; TAXLABELS Cortinarius_acutus Cortinarius_alboviolaceus_IB19740181 Cortinarius_alboviolaceus_IB19950329 Cortinarius_allutus Cortinarius_anomalus_AJ236071 Cortinarius_anomalus_IB19950138 Cortinarius_armeniacus_AJ236074 Cortinarius_armeniacus_IB19960124 Cortinarius_armillatus Cortinarius_bigelowii Cortinarius_brunneus_AJ236076 Cortinarius_brunneus_IB19950084 Cortinarius_callochrous Cortinarius_caninus Cortinarius_cinereobrunneus Cortinarius_citriolens Cortinarius_collinitus Cortinarius_corrosus Cortinarius_corrugatus Cortinarius_delibutus_AJ236065 Cortinarius_delibutus_IB19860263 Cortinarius_elegantior Cortinarius_evernius Cortinarius_favrei Cortinarius_flavaurora Cortinarius_fraudulosus Cortinarius_gentilis_IB19960825 Cortinarius_gentilis_U56026 Cortinarius_glaucopus Cortinarius_globuliformis Cortinarius_hercynicus Cortinarius_humicola Cortinarius_laniger_IB19740251 Cortinarius_laniger_IB19990511 Cortinarius_leucopus Cortinarius_limonius_IB19740328 Cortinarius_limonius_U56028 Cortinarius_lividoochrascens Cortinarius_magnivelatus_hypog Cortinarius_mucifluus Cortinarius_mucosus Cortinarius_muscigenus Cortinarius_obtusus Cortinarius_odorifer Cortinarius_paragaudis Cortinarius_pholideus Cortinarius_porphyropus_AJ236069 Cortinarius_porphyropus_IB19990515 Cortinarius_pseudosalor Cortinarius_saginus Cortinarius_salor Cortinarius_scaurus_AJ236070 Cortinarius_scaurus_IB19940243 Cortinarius_scaurus_IB19980175 Cortinarius_sp._Trappe8178 Cortinarius_sp._nov._Trappe18741 Cortinarius_subfoetidus Cortinarius_talus Cortinarius_traganus_AF037224 Cortinarius_traganus_IB19960060 Cortinarius_trivialis Cortinarius_umbilicatus Cortinarius_vanduzerensis Cortinarius_variecolor Cortinarius_vernicosus Cortinarius_verrucisporus Cortinarius_vibratilis_AJ238032 Cortinarius_vibratilis_IB19970078 Cortinarius_violaceus_AJ236059 Cortinarius_violaceus_IB19980181 Cuphocybe_melliolens Dermocybe_austroveneta Dermocybe_cinnamomea Dermocybe_crocea Dermocybe_malicoria Dermocybe_olivaceopicta_U56049 Dermocybe_olivaceopicta_U56050 Dermocybe_phoenicea Dermocybe_splendida Hebeloma_circinans Hebeloma_fastibile Hebeloma_mesophaeum Hymenogaster_remyi Hymenogaster_sublilacinus Protoglossum_luteus Protoglossum_sp._Trappe15856 Protoglossum_sp.1_Beever_996_OK Quadrispora_oblongispora Quadrispora_sp._nov.Trappe20012 Rozites_caperatus_AJ238033 Rozites_caperatus_IB19990888 Thaxterogaster_albocanus Thaxterogaster_campbellae_2_Trappe19821 Thaxterogaster_campbellae_3 Thaxterogaster_campbellae_Trappe19821_OK Thaxterogaster_fragilis Thaxterogaster_paveleckii_Typus Thaxterogaster_pingue_IB19760501 Thaxterogaster_pingue_IB19951102 Thaxterogaster_piriformis Thaxterogaster_porphyreum_HNBO36 Thaxterogaster_porphyreum_NZ8468 Thaxterogaster_redactus Thaxterogaster_sp._Trappe17869 Thaxterogaster_violaceum_DAO Thaxterogaster_violaceum_Hallin ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=31; TAXLABELS Cortinarius_anomalus Cortinarius_collinitus Cortinarius_odorifer Cortinarius_violaceus Descolea_antarctica_IB19630883 Descolea_antarctica_NZ5182 Descolea_gunnii_NZ2042 Descolea_gunnii_NZ752 Descolea_maculata Descolea_phlebophora_TAS_E4912 Descolea_phlebophora_TAS_E4946 Descolea_phlebophora_VIC_E5331 Descolea_recedens_NSW_E4591 Descolea_recedens_Qld_E4604 Descolea_recedens_TAS_E4459 Descolea_rheophylla Descolea_sp._PNG_E4527 Descolea_sp._TAS_E1181 Descomyces_albellus Descomyces_sp._nov._Trappe12624 Hebeloma_circinans Hebeloma_fastibile Hebeloma_radicosum Setch_australiensis_Claridge2580 Setch_australiensis_Claridge2606 Setch_australiensis_Claridge2621 Setch_australiensis_Claridge2679 Setchell_tenuipes_AF099362 Setchell_tenuipes_AF099363.1 Setchell_tenuipes_Trappe24524 Setchell_tenuipes_Trappe24776 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M837] TITLE 'Hymenogaster-Hebeloma-Naucoria clade'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=859; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cortinarius_anomalus ??????????????????????????????????CGGAAGGATCATTATTG-AAATAAACCTGATG-GGTTGCTGCTGGTTTTTT--AATG-AACA---TGTGCACA-CCT-GTTATCTTT--ATAT---TTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-T-AAG----TTTTCTTAA--TG--------CTAG-CA-----TTAAGGTTTTT-G-GG-A-CTGGCCT------T------TGTCTTT---TCCTTTCT-ATTATC---TGGTCTATGTT---TATTCA-TATA--CCCT-AATG-TAT-GT-TATAGAATGT--AATAA---TTGGGCCT--TG-TG-CC-TATAAA-----CTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTCA--GC----TTTTGCTTG-TT-GAGTG-TTGGA-TG--TGGGGGG------TCTTTTGCTGGCCTTTTTTT-------AGA-GGTCAGCTTCCCTAAAATT-TATTAGCGGA----ACAATTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACG----CTATTGA------C-GTG--AG----GC---AGTT---CA--G-CTT-CT-AA-CAGTCC-ATTG-ACTTGGACAG----TTTTCA----TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAAGTTAA Cortinarius_collinitus ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATG-AGTTGTTGCTGGTTCTCT--AAAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-T-CAC----TCT-CTGAAA-TG-CT-----AACCAGCAT---TTTAGGTTG---GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT--CT--AGGTCTATGTT---TTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA----CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTTA--AA----TTTTGA-------GAGTGTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTCTCC---------AA-GGTCAGCTCCCCTGAAATG-TATTAGCGGA----ACAATTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------T-GTA--AA----GC--AAGTT---CA--G-CTT-AT-AA-CAGTCC-ATTG-ACTTGGACAATT-CTCTATT-TA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_odorifer ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATA-AGTTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--GTAC---CTTCACC--TGTGCACCTTTTGTAGA-CTT-GAG-T-ATC----TCT-CTGAA--TG-CT----TTTGTA-------TTCAGGATT---GAGG-A-TTGACTT------TC-----TGTCTT----TTCTTATA-TTTT-C---AAGTCTATGTT---TCTTCA-TATA--CCCT-AATG-TAT-GT-TCAAGAATGT--AATTA---ATGGGCCTTTTG-TG-CC-TATAAAG---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACC-TTT---------------------------GG-TTGGA-TG--TGGG------------TTTGCTGGCCTCTT------------AAGGTCAGCTCCCCTTAAATG-CATTAGCGGACA--ATATATTGCCAA--CT---GTTCA-TTGGTGTGATAAT-TTATCTACA----CTATTAA------C-CTG--AC----GCAAT-GTT---CA--G-CTT-CT-AA-CGGTCC-ATTG-ACTTGGACAA---ATTTATTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_violaceus ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATA-AGTTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTTTGTCATCTTT--ATAT---CTTCACA--TGTGCACCTCTTGTAGA-CTTTGGA-T-ATC-----TTTCTGAA--TG---------TA---A-----TTCAGGTTTT--GAGG-A-TTGACTT------TTT----GGTCTC----TCCTTACA-TTT--CC--AAATCTATGTT---CCTTCA-TATA--C----ACT--TAT-GT-TATAGAATGT--AATAAA--ATAGGCCTTTTT-TG-CCTTACAAAAA--CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTCAA-GC----TTTTGCTTG-TC-GAGTGTTTGGA-TT--TGGGG----------TTGTGCTGGTCTTATTTTCT------GAAGGTCAGCTCCCCTGAAATG-TATTAGCAGA----ACAATTTGTTGA--CC---GTTCA-TTAATGTGATAAC--TATCTACA----TTATTGAT-----GTGTG--AG----GCAGTAGTT---CA--G-CTT-CTTAA-CAGTCC-ATTG-ACTTGGACAA---ATTTTCA----TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Gymnopilus_penetrans ???????????????????????????????????GGAAGGATCATTATTG--AATAAACCTGATGTGGTTGTAGCTGGCTCTCTT--GAG-AGTA---AGTGCTCG-CCC-GTCATCTTT--GTCT---TTCCACC--TGTGCACTTCTTGTAGA-TTT-GGA-TGTAA------------------CTGTC--CGAGGCAA-----CTC-GGTTGG-GAGGAA--TGTC---------ATT---CG-TG-GCTTTCCTTGTA-TGT-CC---AAGTCTATGTT-----TTCA-TATA--CTCC-AAAG-AAT-GT-AACAGAATGT---ATCA---CTAGGCCT--TG-TG-CC-TATAAA---CTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCC-TTGGTATTCCGAGGGGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTACTA--GC----TTTTGC-TA-TGTAATGGCTTGGA-TA--TGGGGG-------TCTTTTGCTGGTTT---------CGAAAGGAA-TCTGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG-TTAGACGT-----CTGC---TTT--AAAT-GGGTT--GTGCTG-CTT-CT-AATCG-TCCTCTTA-----GGACAATT-ATT-----GA-CCATT-TGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Gymnopilus_sapineus AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG--AATAAACTTGATGTGGTTGTAGCTGGCTCTCTT--GGG-GGTA---TGTGCTCG-CCC-GTCATCTTT--ATAT---TTCCACC--TGTGCACTTTTTGTAGA-TTT-AGA-TGTGA------------------CTTTC--TGTGGCGA-----CTCAGTTGG--GAGGAA--TGTC--------AATT---CGTTG-GCTTTCCTTGTA-TGT-CC---AAATCTATGTT----TTTTA-TATA--CTCC---AG-AAT-GT-AATAGAATGT---ATCA---ATAGGCCT--TG-TG-CC-TATAAA-----TAGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCC-TTGGTATTCCGAGGGGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTACTA--GCTTTTATGAGC-AA-TGTAATGGCTTGGA-TG--TGGGGG-------TTTTTTGCTGGCGG---------CGAAAGAAA-TCAGCTCCCCTAAAATC-TATTAGCTGG--TGCCCCCGTGTGGA--CT---ATCTA-CTGGTGTGATAAT--TATCTATGCCG-TTAGATGT-----C-----------AAATAGGGAT--GTGCTG-CTT-CT-AATTG-TCCACTTA-----GGACACTT-ATT-----GA-CTATT-TGACCTCAA???????????????????????????? Gymnopilus_spectabilis ???????????????????????????????CTGCGGAAGGATCATTATTG--AATAAACTTGATGTGGTTGTAGCTGACTTTCGCAAGAG-AGTA---TGTGCTCG-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACTTTTTGTAGA-TTT-GAATTGTAG------------------CTTTC--CGAGGTAA-----CTCGGTTGG--GAGGAA--TGTC---------ATT---CG-TG-GCTTTTCATGTAATACGTT--CAAGTCTATGTT-----TTCA-TATA--CTCC-AAA--AAT-GT-AACAGAATGT---ATCA---TTGGGCCT--TG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCC-TTGGTATTCCGAGGGGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAGCC-TTATTA--GC----TTTTGC-T--TCTAATGGTCTGGA-TG--TGGGGG-------TC-TTTGCTGGTTT---------CGCAAGAAA-TCTGCTCCCCTTAAATG-TATTAGCCGG---TGCCCTACGTGGA--CT---GTCTA-CTGGTGTGATAAT--TATCTACGCCG-TTAGATGT-----CTGC---TTT--AAAT-GGGAT--GCGCTG-CTT-CT-AATCG-TCCTTTCA-----GGACAATT-ATT-----GCACCATTTTGACCTCA????????????????????????????? Hebeloma_circinans ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTCGCTGGCCCTCTC--GGG-GGCA---TGTGCACA-CCC-GCCATCCTC--ATCT---CTCCACC--TGTGCACTTCTTGTAGA-CTT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAC--TG-CTT--------------A-TTGGCTTTCCTTGCA-TTT--CC--AGGCCTACGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCCT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TA--TGGGGG-----TATATTTTGCCGGCTTCTT------CACAGATGG-TCAGCTCCCCTTAAATG-CATTAGCCAG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGCAATTA---TA-T-GGGTTT-GCACTG-CTTCCT-AA-CCGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACCAT?????????????????????????????????????? Hebeloma_crustuliniforme ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTCGCTGGCCCTCTT--GGG-GGTA---TGTGCACA-CCT-ACCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-TTT-GGAAT-TGA----TTATCCGT---GG-C------AACTCGG-------TCGT------GAGGAC--TG-CTA-----GCACTT---AGCTGGCTTTCTTTGCA-ATT--CC--AGGTCTATGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCCT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCA{AG}AATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCATTATCA--AC----TTTTGC-TG-AT-ATTGGCTTGGA-TG--TGGGGG-----TTTATTTTGCTGGCTTCT---------CATATAG-TCAGCTCCCCTTAAAAG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCTA--TAGACAT-----CTGCAATCA---TA-T-GGGTTT-GCGCTG-CTT-CT-AA-CAGTCT-GTTG-ATTCAGACAAT--A----CA-TG-ACAAT?????????????????????????????????????? Hebeloma_fastibile ???????????????????????????????????????????CATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTTTC--GGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAC-TTG-CTG-----GCATT----AGCTGGCTTTCCTTGCA-TTT--CC--CAGTCTATGTT---TTTTCA-TATA--CCCC-ATTG-AAT-GT-AACAGAATGT---AACATA-TTGGGCCTT-TG-TG-CC-TATAAAAA--CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACTATTATCA--GC----TTTTGC-TG-AT-GATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTT---------CACAGAATG-TCAGCTCCCCTTAAATG-CATTAGCCGG---T?CCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTACAATCA---TA-T-GGGTTT-GCACTG-CTT-CC-AG-CCGTCT-GTTT-ACTCAGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hebeloma_helodes ????????????????????????????????????????????????????????????????????GTTGTCGCTGGCCCTCTT--GGG-GGTA---TGTGCACA-CCT-ACCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-TTT-GGAAT-TGA----TTATCCGA---GG-C------AACTCGG-------TCGT------GAGGAC--TG-CTA-----GCACTT---AGCTGGCTTTCTTTGCA-ATT--CC--AAGTCTATGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCCT-TG-TG-CC-TAT{AC}AA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCATTATCA--AC----TTTTGC-TG-AT-AATGGCTTGGA-TG--TGGGGG-----TCTATTTTGCTGGCTTCT---------CAGATAG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCTA--TAGACAT-----CTGCAATCA---TA-T-GGGTTT-GCGCTG-CTT-CT-AA-CAGTCT-GTTG-ATTCAGACAAT--A----CA-TG-ACAAT?????????????????????????????????????? Hebeloma_mesophaeum ?????????????????????????????????????????????????????????????????????TTGTTGCTGGCCCTTTC--GGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAC-TTG-CTG-----GCACT----AGCTGGCTTTCCTTGCA-TTT--CC--AAGTCTATGTT---TTTTCA-TATA--CCCC-ATTG-AAT-GT-AACAGAATGT---AACATA-TTGGGCCTT-TG-TG-CC-TATAAAAA--CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACTATTATCA--GC----TTTTGC-TG-AT-GATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTT---------CACAGAATG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTACAATCA---TA-T-GGGTTT-GCGCTG-CTT-CC-AA-CCGTCT-GTTT-ACTCAGACAAT--A----CA-TG-ACAA??????????????????????????????????????? Hebeloma_radicosum ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTTGCTGGCC{CT}TCTC--GGG-GGCA---TGTGCACA-CCC-ATCATTCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAT--TG-CTG-----GCACT----CGCTAGCTCTCCTTGCA-TTT--CC--AGGTCTATGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCC-T-TG-TG-CC-TATAAAA--CC-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATCA--GC----TTTTGT-TG-AT-ACTGGCTTGGA-TA--TGGGGG-----TCTATTTTGCTGGCTTCTTT------ACAGATGG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGCAATCA---TA-T-GGGTTT-GCACTG-CTT-CC-AA-CCGTCT-GTTC-ATTCGGACAAT--A----CT-TG-ACAAT?????????????????????????????????????? Hebeloma_velutipes ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTTGCTGGCTCTTTC--GAG-GGCA---TGTGCACG-CCC-ACCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAT--TG-CCG-----GCGCC----AGCTGGCTTTCTTTGCA-TTT--CC--AGGTCTACGTT----TTTCAATATA--CCCC-ATTG-TAT-GT-AACAGAATGT---AACA---TTGGGCACT-TG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATCA--AC----TTTTGT-TG-AT-AATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTTCTTT------ACAGATGG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGCAATCA---TA-T--GGTTT-GCACTG-CTT-CC-AA-CTGTCT-GTTG-AATCAGACAAT--A----CA-TG-ACAAT?????????????????????????????????????? Hymenogaster_alnicola ????????????????????????????????????????????????????????????????TGTAGTTGTTGCTGGCCCTTTT--GGG-GGCA---TGTGCACA-CCC-ACCATCCTC--ATCT---CTCCAAC--TGCCCACCTCTTGTAGA-CTTGGGGAT-AGA----CTTTCCGA---GG-C------AACTCGG-------TCTG------GAGGAA--TG-CTT------CT--------CAAGCTTTCTTTGTA-TTT--CC--CGGTCTACGTT-TTTTTTTA-TATA--CCCC--ATG-CAT-GT-AACAGAATGT---ATCAT--TTGGGCCCT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--GT---TTATTTC-TG-AT-AGTGGCTTGGA-TG--TGGGGG-----TTTCTCTTGCTGGCT---------------CAGG-TCAGCTCCCCTTAAATG-CATTAGCTGG---TGCCCCGTGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCA--TGCATGGATGGTCTGC-----------------TTAGCACTG-CTT-TT-AA-CCGTCT---------CAGACAAT--A----CA-TG-ACAATTTGACCTCAAATAAGGTAGGAC???????????????? Hymenogaster_bulliardii ?????????????????????????????????????AAGGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCT-TCTTGTGGG-GGCA---TGTGCACA-CCC-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-GAA----TTTTCCGA---GG-T------AACTCGG-------TCGG------GAGGAG-ATG-CTGCGC--TCTTT--GCGTC-GGCTTTCTTTGCA-CTT--CC--AAGCCTACGTT--TTTTTCA-TATA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCTA-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TG--TGGGGGGG--TTTTCTTTTGCTGGCTTTC---------------G-TCAGCTCCCCTAAAATG-CATTAGCTGG---TGCCCCGCGTGGA--CT---GTCCGTTCGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTGCA--AA---TA---GGGTTT-GCACTG-CTT-CT-AA-TCGTCT-GTTC-ATTTGGACAAT--A----TA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_gardneri ??????????????????????????????????????????????????G--AAGGAACTTGGTGTGGTTGTTGCTGGCCCTATT---GG-GGCA---TGTGCACA-CCT-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-AGA----CTTTCCGA---GG-C------AACTCGG-------TTGG------GAGGAA--TG-CTG------CA-------TC-AGCTTTCTTTGCG-CTT--CC--AGGCCTATGTT----TTTCA-TAAA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCTTC-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC-----TTTGC-TG-AT-AATGGCTTGGA-CG--TGGGGG----TTTTCTTTTGCCGGTTTTTT------CACTGAAGG-TCAGCTCCCCTTAAATT-CATTAGCTGG---TGCCCCGCCTGGA--CT---ATCTATTTGGTGTAATAAT--TATTTACCCCG--TGAATGT-----CTTCC--AA-A------GGGTTT-GCATTG-CTT-CT-AA-AAGTC?-????-?TTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAG??????????????????? Hymenogaster_glacialis ????????????????????????????????????????GATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCC-CTT---GG-GGCA---TGTGCACATCCC-ACCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-------------------------------------------------------------------------------------------------------------------GGTCTACGTT---TTTTCA-TATA--CCCC-ATAG-CAT-GT-AACAGAATGT---ATCATA-TTAGGCGCT-TG-TG-CCTTATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC--------------------------T-TATCGGTTGGA-TG--TGGGGG----------TTTGCTGGCT---------------CAGG-TCAGCTCCCCTTAAATG-CATTAGCTGG---TGCCCCGTGTGGA--CT---GTCTA-TTGGCGTGATAAT--TATCTACGCCG--TGGATG--------------------------------------------AG-CACTGC-TTCC-AACACCACAATT-A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_griseus ????????????????????????????????????GAAGGATCATTATTG--AATGAACTTGGCGTGGTTGTTGCTGGCCCTCTC-GGGG-GGCA---TGTGCACA-CTC-GCCATCTCC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGAAT-AGA----CTTTCCGA---GG-C------AACTCGG-------TTGG------GAGGAA--TG-CTG-----TCGCTTTGCGTC-AGCTTTCTTTGGA-CTT--CC--AAGCCTACGTT----TTTCA-TATA--CCC--ATAG-TAT-GT-AACAGAATGT---GTCAT--TTGGGCCTC-AG-TG-CC-TATAAA---CCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TG--TGGGGGG--CTTATCTTTTGCTGGCTTCTTT-----CACA-GAGG-TCAGCTCCCCTGAAATG-CATTAGCTGG---TGCCCCGCGTGGA--CT---GTCTATTTGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTGCA--AT---T----GGTTTTGGCACTG-CTT-CT-AA-CTGTCT-GTTC-ATTTGGACAAT--A----CA-TG-GCAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_olivaceus ???????????????????????????????????????GGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCTCTCTTGTGGG-GGCA---TGTGCACA-CCC-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-GAA----TTTTCCGA---GG-T------AACTCGG-------TCGG------GAGGAA--TG-CTGCGC--TCTTT--GCGTC-GGCTTTCTTTGCA-CTT--CC--AAGCCTACGTT-TTTTTTCA-TATA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCTA-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TG--TGGGGGGGG--GTTCTTTTGCTGGCTTTC---------------G-TCAGCTCCCCTAAAATG-CATTAGCTGG---TGCCCCGCGTGGA--CT---GTCCGTTCGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTGCA--AA---TA---GGGTTT-GCACTG-CTT-CT-AA-TCGTCT-GTTC-ATTTGGACAAT--A----TA-TG-ACAATTTGACCTCAAATCAGGTAGGACTAGCCGCTGAACTTAA Hymenogaster_parksii ??????????????????????????????CCTGCGGAAGGATCATTATTG--AAGGAACTTGGTGTGGTTGTTGCTGGCCCTACC---GG-GGCA---TGTGCACA-CCT-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-AGA----CTTTCCGA---GG-C------AACTCGG-------TTGG------GAGGAA--TG-CTG------CA-------TC-AGCTTTCTTTGCG-CTT--CC--AGGCCTATGTT----TTTCA-TAAA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCTTC-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC-----TTTGC-TG-AT-AATGGCTTGGA-CG--TGGGGG----TTTTCTTTTGCCGGCTTCTT------CACTGAAGG-TCAGCTCCCCTTAAATT-CATTAGCTGG---TGCCCCGCCTGGA--CT---ATCTATTTGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTTCA--AA--------GGGTTT-GCATTG-CTT-CT-AA-TAGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAA????? Hymenogaster_populetorum ?????????????????????????????ACCTGCGGAAGGATCATTATTG--AATGAACTTGGCGTGGTTGTTGCTGGCCCTCTC--GGG-GGCA---TGTGCACA-CCC-GCCATCTCC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGAAT-AGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAA--TG-CTG-----TCACTTTGCGTC-AGCTTTCTTTGCA-CTT--CC--AAGCCTACGTT----TTTCA-TATA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCAT--TTGGGCCTC-AG-TG-CC-TATAAAA--CCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TG--TGGGGG----TTCTCTTTTGCTGGCTTCT-------------AGG-TCGGCTCCCCTGAAATC-CATTAGCTGG---TGCCCCGCGTGGA--CT---GTCTATTTGGTGTGATAAT--TATCAACGCCG--TGGATGT-----CTGCA--AT---T----GGTTTTGGCACTG-CTT-CT-AA-CCGTCT-GTTC-ATTTGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_sp._nov._Trappe20345 ??????????????????????????????????????AGGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTATT---GG-GGCA---TGTGCACA-CCT-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-AGA----CTTTCCGA---GG-C------AACTCGG-------TTGG------GAGGAA--TG-CTG------CA-------TC-AGCTTTCTTTGCG-CTT--CC--AGGCCTATGTT----TTTCA-TAAA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCTTC-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC-----TTTGC-TG-AT-AATGGCTTGGA-CG--TGGGGG----TTTTCTTTTGCCGGCTTCTT------CACTGAAGG-TCAGCTCCCCTTAAATT-CATTAGCTGG---TGCCCCGCCTGGA--CT---GTCTATTTGGTGTGATAAT--TATCTACACCG--TGGATGT-----CTTCA--AA--------GGGTTT-GCATTG-CTT-CT-AA-TAGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_subalpinus ?????????????????TTCCGTAAGGGAACCTGCGGAAGGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTATT---GG-GGCA---TGTGCACA-CCT-GCCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-AGA----CTTTCCGA---GG-C------AACTCGG-------TTGG------GAGGAA--TG-CTG------CA-------TC-AGCTTTCTTTGCG-CTT--CC--AGGCCTATGTT----TTTCA-TAAA--CCC--GTAG-TAT-GT-AACAGAATGT---ATCA---TTGGGCTTC-AG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTTAATTCT-------CAACC-TTATTA--GC-----TTTGC-TG-AT-AATGGCTTGGA-CG--TGGGGG----TTTTCTTTTGCCGGCTTCTT------CACTGAAGG-TCAGCTCCCCTTAAATT-CATTAGCTGG---TGCCCCACCTGGA--CT---ATCTATTTGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTTCA--AA--------GGGTTT-GCATTG-CTT-CT-AA-TAGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hymenogaster_tener ?????????????????????????????????????????????????????????????????????????????????????????GG-GGGA---TATGCACA-CCC-ACCATTCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGGAT-AGAA----TTTCCGA---GG-C------AACTCGG-------TCTG------GAGGAA--TG-CTGCCC--TCTTT---AGGCAAGCTTTCTTTGTA-TTT--CC--TGGTCTACGTT----TTTCA-TATA--CCCC-TTAG-CAT-GT-AACAGAATGT---ATCAT--TTGGGCCCT-TG-TG-CC-TAGAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATC?AATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--GT---TTATTTC-TG-AT-AGTGGCTTGGA-TG--TGGGGG------TTTTCTTGCTGGCT---------------GAGG-TCAGCTCCCCTTAAATG-CATTAGCTGG---TGCCCCGTGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGACC-ATGGATGT-----CTGCAATCA---TA-A-GGGTTTAGCACTG-CTTGCT-AAGCCGTCT-GTTA-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTA?????????????? Naucoria_bohemica_AF124712 ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCCCTCAAGGG-GGCA---TGTGCACG-CCC-GCCATCCTC--ATCT---CTTCACC--TGTGCACCTCTTGTAGG-CTT-GGA-T-AGA-TTTTTTTCCGA---GG-C------AACTCGG-------TCGG------GAGGAA--TG-CTGCGC--TCTGT---GAGCCAGCTTT---TGCAATTTTTCC--AAGTCTATGTT----TTTCA-TATA--CCCCATTAG-TAC-GT-AACAGAATGT-----CA---TTGGGCGCTTAG-CG-CC-TATAAA---GTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATTA--GC----TTTTGC-TG-GTAAATGGCTTGGA-TG--TGGGGG----------CTTGCTGGCTTT---------------GG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCTGTGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCA--GGGATGT-----CTGCAAT-----------GGTTTTGCGCTG-CTT-CT-AA-CCGTCT-GTTC-ATTCGGACAATT-T----CAATG-ACAAT?????????????????????????????????????? Naucoria_bohemica_IB19940290 ????????????????????????????????????????????????????????????????????????????TGGCCCCCTCAAGGG-GGCA---TGTGCACG-CCG-GC-ATCATC--ATCT---CTTCACC--TGTGCACCTTTTGTAGG-CTT-GGA-T-AGA-TTTTTTTCCGA----G-C-----ACACTCGG-------TCG-------GAGGAA--TG-CTGCGC--GCA------AGCCGGCTTT?TTTGCAATTTTTCC--AAGTGTATGTT----TTTCA-TATA--CCCCATTAG-TAC-GT-AACAGAATGT-----CA---TTGGGCGCTTAG-CG-CC-TATAAA---GTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATTA--GC----TTTTGC-TG-GTAAATGGCTTGGA-TG--TGGGGG----------CTTGCTGGCTTT---------------GG-TCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCTGTGTGGA--CT---GTCTACCTGGTGTGATAAT--TATCTAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Naucoria_escharoides ??????????????????????????????CCTGCGGAAGGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTCTC--GGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-TGA----CTTTCCG----GG-C------AACTCGG-------TCGG------GAAGAT--TG-CTGCGC--TCTGT---GAGCCAGCTTTCTTTGCA-TGT--CC--AGGACTATGTT---TTTTCA-TATA--CCCCTATAG-AAT-GT-AACAGAATGT---ATCA---TTGGGCC-T-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATTA--AC----TTTTGT-TG-AT-AATGGATTGGA-TA--TGGGGG-----TTTCTTTTGCTGGCTTCTT------CACA-GAGA-TCAGCTCCCCTTAAATG-CATTAGCTGG---TGACCCGCGTGGA--CC---ATCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTGCAATCA--ATA-T-GGGTTTTGCACTG-CTT-CT-AA-CCGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Naucoria_scolecina ??????????????????????????????????????AGGATCATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTCTC--GGG-GGCA---TGTGCACA-CCC-ACCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-T-TGA----CTTTCCGA---GG-C------AACTCGG-------TCGG------GAAGAT--TG-CTGCGC--TCTGT---GAGCCAGCTTTCTTTGCA-TGT--CC--AGGCCTATGTT----TTTCA-TATA--CCCCTATAG-AAT-GT-AACAGAATGT---ATCA---TTGGGCC-T-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATTA--AC----TTTTGT-TG-AT-AATGGATTGGATTG--TGGGGG-----TTTCTTTTGCTGGCTTCTT------CACA-GAGA-TCAGCTCCCCTTAAATG-CATTAGCTGG---TGCCCCGCGTGGA--CC---ATCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGATGT-----CTGCAATCA---TA-T-GGGTTTCGCACTG-CTT-CT-AA-CCGTCT-GTTC-ATTCGGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'Hymenogaster-Hebeloma-Naucoria clade') = N: 1-859; CODONPOSSET CodonPositions (CHARACTERS = 'Hymenogaster-Hebeloma-Naucoria clade') = N: 1-859; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M835] TITLE Descoea_clade; LINK TAXA = Taxa3; DIMENSIONS NCHAR=859; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cortinarius_anomalus ??????????????????????????????????CGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGTTTTTT--AATG-AACA---TGTGCACA-CCT-GTTATCTTT--ATAT---TTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TAAGTTTT-----CTTAA--TG--------CTAG-CA------TTAAGGTTTTTG-GG-A-CTGGCCT------T------TGTCTTT---TCCTTTCT-ATTATC---TGGTCTATGTT---TATTCA-TATA--CCCT-AATG-TAT-GT-TATAGAATGT--AATAA---TTGGGCCT--TG-TG-CC-TATAAA-----CTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTCA--GC----TTTTGCTTG-TTGAGT-G-TTGGA-TG--TGGGGGG------TCTTTTGCTGGCCTTTTTTT-------AGA-GGTCAGCTTCCCTAAAATT-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACG----CTATTGA------C-GTG--AG----GC---AGTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAG----TTTT-CA---TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAAGTTAA Cortinarius_collinitus ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AAAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAAC--C-AG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT---TTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA----CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTTAAA------TTTTGA------GAGT-GTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTCTCC---------AA-GGTCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------T-GTA--AA----GC--AAGTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATT-CTCTA-TTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_odorifer ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--GTAC---CTTCACC--TGTGCACCTTTTGTAGA-CTT-GAG-TATCTCT------CTGAA--TG-CTTTT--GTA----------TTCAGGATT--GAGG-A-TTGACTT------TC-----TGTCTT----TTCTTATA-TTT-TC---AAGTCTATGTT---TCTTCA-TATA--CCCT-AATG-TAT-GT-TCAAGAATGT--AATTA---ATGGGCCTTTTG-TG-CC-TATAAAG---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACC-TTT---------------------------GG-TTGGA-TG--TGGG------------TTTGCTGGCCTCTT------------AAGGTCAGCTCCCCTTAAATG-CATTAGCGGACAATAT--ATTGCCAA--CT---GTTCA-TTGGTGTGATAAT-TTATCTACA----CTATTAA------C-CTG--AC----GCAAT-GTT---CA--G-CTT-CT-AACGG-TCC-ATTG-ACTTGGACAA---ATTTATTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_violaceus ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTTTGTCATCTTT--ATAT---CTTCACA--TGTGCACCTCTTGTAGA-CTTTGGA-TATCTTT------CTGAA--TG---------TA---A------TTCAGGTTTT-GAGG-A-TTGACTT------TTT----GGTCTC----TCCTTACA-TTT-CC---AAATCTATGTT---CCTTCA-TATA--C----ACT--TAT-GT-TATAGAATGT--AATAAA--ATAGGCCTTTTT-TG-CCTTACAAAAA--CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC-TCTTCAA-GC----TTTTGCTTG-TCGAGT-GTTTGGA-TT--TGGGG----------TTGTGCTGGTCTTATTTTCT------GAAGGTCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CC---GTTCA-TTAATGTGATAAC--TATCTACA----TTATTGAT-----GTGTG--AG----GCAGTAGTT---CA--G-CTT-CTTAACAG-TCC-ATTG-ACTTGGACAA---ATTTT-CA---TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_antarctica_IB19630883 ?????????????????????????????????????????????????????????????????G-GGTTGTAGCTGCCTCTCTC--GGG-AGCA---TGTGCACG-CTT-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TTAAA--CTATCTGAA--GG-TTTTT-AAAAC--C------TTCAGTTT---GAGGGA-TTG-CT-------C------GGTCG-GCTTCCCTTGTG-GTT-CC---AAGCCTATGTT----TTTCA-TATA--CCCC-ATAG-TAT-GT-TTCAGAATGT--ATTCA---AAGGCCTC--AG-AG-CC-TATAA----CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCAGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG--------TTTTTGCAGGCTTCAAAC---TTTTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCCGG-AA-AACCCTTGTGGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG-CCGGAC--AGGA-CTGC-ACTTTT-TAATGGGATTT----CTG-CTT-CC-AATCG-TCC--TTA---GGGGACAATC-ATT-----TG-ACTATTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_antarctica_NZ5182 ???????????????????????????????????????GGATCATTACAG--AATAAACTTGATG-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACG-CTT-GTCACCTTT--ATCT---TTCCACC--TGTGCACCTTTTGTAGA-CTT-GGAAT-TTAAA--CTATCTGAA--GG-TTTTT-AAAAC--C------TTCAGTTT---GAGGGA-TTG-CTGTGCCC-CACAC--GGTCG-GCTTCCCTTGTG-GTT-CC---AAGCCTATGTT----TTTCA-TATA--CCCC-ATAG-TAT-GT-TTCAGAATGT--ATTCA---AAGGCCTC--AG-AG-CC-TATAA----CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG--------TTTTTGCAGGCTTCAAAC---TTTTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCCGG-AA-AACCCTTGTGGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG-CCGGAC--AGGA-CTGC-ACTTTT-TAATGGGATTT----CTG-CTT-CC-AATCG-TCC-TTTA---GGGGACAATC-ATT------G-ACTATTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_gunnii_NZ2042 ???????????????????????????????????????????????????????TAAACTTGATG-GGTTGTAGCTGGTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCTTTTGTAGA-CTT-GAAAA--------CCATCTGAAA--G-CTTTA-AAAACAGTG-----TTCAGGTT---GAGGGA-TTG-CTGTGCCC-CTTT--GGGTCA-GCTTCCCTTGCAGGTT-CC---AAGTCTATGTT----TTTCA-TACA--CCCC-ATAG-CAT-GT-CTT-GAATGT--TATCA---AAGGCCTCT-AG-TG-CC-TATAAA---ATTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAAGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAATC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC--------ATGAAG-CTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AACCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCTG--TGGAC--AGGG-CTTCC--TTTG-TAATGGGATTT----CTG-CTT-CA-AACTG-TCC--TTA----GGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTGAA Descolea_gunnii_NZ752 ???????????????????????????????????????GGATCATTACAG--AATAAACTTGATG-GGTTGTAGCTGGTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCTTTTGTAGA-CTT-GAAAT-TTAAA--CCATCTGAAA--G-CTTTA-AAAACAGTG-----TTCAGGTT---GAGGGA-TTG-CTGTGCCC-CTTT--GGGTCA-GCTTCCCTTGCAGGTT-CC---AAGTCTATGTT----TTTCA-TACA--CCCC-ATAG-CAT-GT-CTT-GAATGT--TATCA---AAGGCCTCT-AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGA{AG}GAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAATC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC--------ATGAAG-CTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AACCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCTG--TGGAC--AGGG-CTTCC--TTTG-TAATGGGATTT----CTG-CTT-CA-AACTG-TCC--TTA----GGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTGAA Descolea_maculata ????????????????????????????GAACTGCGGAAGGATCATTACAG--AATAAACTTGATG-GG-TGTCGCTGGTTCTTTC--GGG-AGCA---TGTGCACA-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT---AAA--CCATCTAAGA--G-CTTT--AAAACGGCT-----TTTGGTTT---GAGGGA-TTG-CT-------------GGGTCA-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TACA--CCCC-ATAG-TAT-GT-TTTAGAATGT--TATCA---AAGGCCCT--AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTACCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC-----CATATGAAG-TTAGCTCCCCTTAAATG-TATTAGCCGG-AA-AACCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACCTAGGA-CTGCC--TTTGTTAATGGGAATT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_phlebophora_TAS_E4912 ??????????????????????????????????????AGGATCATTACAG--AATAAACTTGATA-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACA-CCCGGTCACCTTT--ATCT---TTCCACC--TGTGCACCCATTGTAGA-CTT-GGAAT-TGAAAC-CCATTTGAA--GG-C-----CCCCCGGCC-----TTCAGTTT---GAGGGA-TTG-CTGCGCGCTTAAATAGGGTCA-GCTTCCCTTGTG-ATT-CC---AAGCCTATGTT--TTTTTAA-TATA--CCCC-ATAG-TAT-GT-CTCAGAATGT--AATAA---AAGGCCTC--TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGT-TG-AC-AA-GGCTTGGA-CT--TGGGGG---------TTTTGCGGGCTTCAAT-----CTTTCGAAG-TCGGCTCCCCTTAAATG-CATTAGCCGG-AA-AACTCTTGTAGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGAC-T-GGA-CTGC-ACTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC--CTA----GGGACAATT-ATT-----TG-ACCATTGGGACTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_phlebophora_TAS_E4946 ???????????????????????????????CTGCGGAAGGATCATTACAG--AATAAACTTGATA-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACA-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCATTGTAGA-CTT-GGAAT-TGAAAC-CCATTTGAA--GG-C-----CCCCCGGCC-----TTCAGTTT---GAGGGA-TTG-CTGCGCGCTTAAATAGGGTCA-GCTTCCCTTGTG-ATT-CC---AAGCCTATGTT--TTTTTAA-TATA--CCCC-ATAG-TAT-GT-CTCAGAATGT--AATAA---AAGGCCTC--TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGT-TG-AC-AA-GGCTTGGA-CT--TGGGGG---------TTTTGCGGGCTTCAAT-----CTTTCGAAG-TCGGCTCCCCTTAAATG-CATTAGCCGG-AA-AACTCTTGTAGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGAC-T-GGA-CTGC-ACTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC--CTA----GGGACAATT-ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTAC????????????? Descolea_phlebophora_VIC_E5331 ???????????????????????????????????????GGATCATTACAG--AATAAACTTGATA-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACA-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCATTGTAGA-CTT-GGAAT-TGAAAC-CCATTTGAA--GG-C-----CCCCCGGCC-----TTCAGTTT---GAGGGA-TTG-CT------------AGGGTCA-GCTTCCCTTGTG-ATT-CC---AAGCCTATGTT--TTTTTAA-TATA--CCCC-ATAG-TAT-GT-CTCAGAATGT--AATAA---AAGGCCTC--TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGT-TG-AC-AA-GGCTTGGA-CT--TGGGGG---------TTTTGCGGGCTTCAAT-----CTTTCGAAG-TCGGCTCCCCTTAAATG-CATTAGCCGG-AA-AACTCTTGTAGA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGAC-T-GGA-CTGC-ACTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC--CTA----GGGACAATT-ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAAC???? Descolea_recedens_NSW_E4591 ?????????????????????????????AACTGCGGAAGGATCATTACAG--AATAAACTTTATG-GGTTGTAGCTGGCTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTTTGGAATTTGAAAA-CTATCTGAAA--G-CTTT--AAAA-GGCC-----TTTGGTTT---GAGGGA-TTG-TTGG-------------GTCA-GCTTCCCTTGCAGGTT-CC---AAGTCTATGTT---TTTTAA-TATA--CCCC-ATAG-TAT-GT-TTTAGAATGT--TATCA---AAGGCCCT--AG-TG-CC-TATAAAA---TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----ATTTATTTGCAGGCTTCAAC-----CATATGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AAATGCCCTTGTGGT--CC---GTCTA-TCGGTGTGATAAT--TATCTACGCTG--TGGACA-AGG--CTGCCATTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC--TTA----CGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_recedens_Qld_E4604 ?????????????????????????????AACTGCGGAAGGATCATTACAG--AATAAACTTTATG-GGTTGTAGCTGGCTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTTTGGAATTTGAAAA-CTATCTGAAA--G-CTTT--AAAA-GGCC-----TTTGGTTT---GAGGGA-TTG-TT-------------GGGTCA-GCTTCCCTTGCAGGTT-CC---AAGTCTATGTT---TTTTAA-TATA--CCCC-ATAG-TAT-GT-TTTAGAATGT--TATCA---AAGGCCCT--AG-TG-CC-TATAAAA---TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----ATTTATTTGCAGGCTTCAAC-----CATATGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AAATGCCCTTGTGGT--CC---GTCTA-TCGGTGTGATAAT--TATCTACGCTG--TGGACA-AGG--CTGCCATTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC--TTA----CGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descolea_recedens_TAS_E4459 ??????????????????????????????????????????TCATTACAG--AATAAACTTTATG-GGTTGTAGCTGGCTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTTTGGAATTTGAAAA-CTATCTGAAA--G-CTTT--AAAA-GGCC-----TTTGGTTT---GAGGGA-TTG-TTGGC----CTTT--GGGTCA-GCTTCCCTTGCAGGTT-CC---AAGTCTATGTT----TTTTA-TATA--CCCC-ATAG-TAT-GT-TTTAGAATGT--TATCA---AAGGCCCT--AG-TG-CC-TATAAAA---TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----ATTTATTTGCAGGCTTCAAC-----CATATGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AAAAGCCCTTGTGGT--CC---GTCTA-TCGGTGTGATAAT--TATCTACGCTG--TGGACA-AGG--CTGCCATTTTG-TAATGGGATTT----CTG-CTT-CA-AACCG-TCC---TA----CGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGCTAGGACTACC???????????? Descolea_rheophylla ??????????????????????????????????????????????????G--AATCATGTCGGTA-GGTTGCAG--GGCTG-CAC--GAGCAGCA---TGTGCAAG-ACGGATGAAGATT--ATCT---TTCTACC--TGTGCACCCTTTGTAAGACTT-GGAAT-TCAAACCCATTCTGAAA-GG-CT--------CGCCT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CCTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATAAAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG---------ATTTGCGGGCTTCCC------TTTTTGAAG-TCGGCTCCTCTTAAATG-AATTAGCGGG-AA-AAC----GAAAA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC-TA----CTTTC------------GAGTTT-G--CTG-ATT-CA-AACCG-TCC--TTA----AGGACAATCGGTG---AA-G-ATCATTAGACCTC?????????????????????????????? Descolea_sp._PNG_E4527 ???????????????????????????????????????GGATCATTACAG--AATAAACTTGATG-GGTTGTCGCTGGTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TTAAA--CCATCTAAAA--G-CTCT--AAAACAGCT-----TTCAGTTT---GAGGGA-TTG-CT-------------GGGTCG-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TATA--CCCC-ATAG-TAT-GT-CTTAGAATGT--CATCA---AGGGCCAT--AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC----TTTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG--------TATTTGCAGGCTTCAAT-----CATATGAAG-TTAGCTCCCCTTAAATG-TATTAGCCGG-AA-AACCCTAGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACTTAGGA-CTGCC--TTTG-TAATGGGATTT----CTG-CTT-CA-AATCCGTCC-CTTA----GGGACAATT-ATT------G-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACT??? Descolea_sp._TAS_E1181 ???????????????????????????????????GGAAGGATCATTACAG--AATAAACTTGGTG-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACG-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAAAC-CCTTCTGAAA-GG-CT--------CGCTT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CTTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATAAAAA--GTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG---------ATTTGCGGGCTTTTC------TTTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCGGG-AA-AAC----GAAAA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC-TA----CTTTC------------AAGTTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAATC-ATT---AATG-ATCATTTGACCTCAAATCAGGT????????????????????? Descomyces_albellus ?????????????????????????????????????????????????????????????????????TTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACG-CTC-GTCACCTTT--ATAT---TTCCACC--TGTGCACCCTTTGTAGA-CTTGGGAAT-TCAAA--CTATCTGAA--GG-CTTTC-GAAAAGCCT-----TTCAGTCT---GAGGGA-TTG-C--------CT----GGGTCA-GCTTCCTTCGTG-GTT-CC---AAGCCTACGTT----TTTCA-TATA--CCCC-ACAG-TAT-GT-TTCAGAATGT--ATTCA---AAGGCCTC--AG-CG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----GCTGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG----TTTCATTTTGCAGGCTTCAACC---TTCTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCCGG-AA-AACCCTTGTGGA--CCC--GTCTA-TTGGTGTGATAAT--TATCTACGCCG-CAGGA--TGGGA-CTGC-ACTTTG-TAATGGGATTT----CTG-CTT-CC-AACCG-TCC--TTT----GGGACAATC-ATT-----TG-ACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Descomyces_sp._nov._Trappe12624 ???????????????????????????????CTGCGGAAGGATCATTACAG--AATAAACTTGATG-GGTTGTAGCTGGCTCCCTC--GGG-AGCA---TGTGCACG-CTT-GTCACCTTT--ATCT---TTCCACC--TGTGAACCCTTTGTAGA-CTT-GGAATTTCAAA--CTATCTGCAA-GG-CTTTTTCATAAGCC------TTCAGTTT---GAGGGA-TTG-CTGTGCCCTCACA--CGGTCA-GCTTCCCTTGTG-GTT-CC---AAGCCTATGTT----TTTCA-TATA--CCCC-ATAG-TAT-GT-TTCAGAATGT--ATTCA---AAGGCCCA--AG-CG-CC-TATAAA---CATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAATC-TTACCA--TC-----TTTGA-TG-GGTTA-GGTTTGGA-CT--TGGGGG----TATCATTTTGCGGGCTTCAAACC---TTTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCCGG-AA-AACCCTTGTGGA--CCC--GTCTA-TTGGCGTGATAAT--TATCTACGCCG-TGGGA--TAGGA-CTGC-ACTTTG-TAGTGGGATTT----CTG-CTT-AC-AGCCG-TCC-TTTA----CGGACAACC-AAT-----TG-ACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hebeloma_circinans ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTCGCTGGCCCTCTC--GGG-GGCA---TGTGCACA-CCC-GCCATCCTC--ATCT---CTCCACC--TGTGCACTTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGG-A-CTG-CTTA---------------TTGGCTTTCCTTGCA-TTT-CC---AGGCCTACGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCCT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATTA--GC----TTTTGC-TG-AT-AATGGCTTGGA-TA--TGGGGG-----TATATTTTGCCGGCTTCTT------CACA-GATGGTCAGCTCCCCTTAAATG-CATTAGCCAG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGC---AATT-ATAT-GGGTTT-GCACTG-CTTCCT-AACCG-TCT-GTTC-ATTCGGACAAT--A-----CATG-ACCAT?????????????????????????????????????? Hebeloma_fastibile ???????????????????????????????????????????CATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTTTC--GGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGG-ACTTG-CTG-----GCATT---AG-CTGGCTTTCCTTGCA-TTT-CC---CAGTCTATGTT---TTTTCA-TATA--CCCC-ATTG-AAT-GT-AACAGAATGT--AACATA--TTGGGCCTT-TG-TG-CC-TATAAAAA--CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACTATTATCA--GC----TTTTGC-TG-AT-GATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTT---------CACA-GAATGTCAGCTCCCCTTAAATG-CATTAGCCGG---T?CCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTAC---AATC-ATAT-GGGTTT-GCACTG-CTT-CC-AGCCG-TCT-GTTT-ACTCAGACAAT--A-----CATG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hebeloma_radicosum ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTTGCTGGCC{CT}TCTC--GGG-GGCA---TGTGCACA-CCC-ATCATTCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGG-A-TTG-CTG-----GCACT---CG-CTAGCTCTCCTTGCA-TTT-CC---AGGTCTATGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCT--TG-TG-CC-TATAAAA---CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATCA--GC----TTTTGT-TG-AT-ACTGGCTTGGA-TA--TGGGGG-----TCTATTTTGCTGGCTTCTTT------ACA-GATGGTCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGC---AATC-ATAT-GGGTTT-GCACTG-CTT-CC-AACCG-TCT-GTTC-ATTCGGACAAT--A-----CTTG-ACAAT?????????????????????????????????????? Setch_australiensis_Claridge2580 ???????????????????????????????????????????CATTACAG--AATAAACTTGATG-GGTTGTCGCTGGTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAAA--CCATCTGAAA--G-CTTTT-AGAACGGCT-----TTCGGTTT---GAGGGA-TTG-C--------CATTT-GGGTCA-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TACA--CCCC-ATAG-TAT-GT-CTTAGAATGT--TATCA---AGGGCCGT--AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC-----CATTTGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AATCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACATAGGG-CTGCC-TTTTG-TCAT?GGATTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAAT--ATT-----TG-ACCAGTTGACCTCAA???????????????????????????? Setch_australiensis_Claridge2606 ??????????????????????????????????????AGGATCATTACAGC-AATAAACTTGATG-GGTTGTCGCTGCTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGCGCACCCTTTGTAGA-CTT-GGAAT-T-AAA--CCATCTGAAA--G-CTTT--AAAACGGCT-----TTCGGTTT---GAGGGA-TTG-C--------CATTT-GGGTCA-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TACA--CCCC-ATAG-TAT-GT-CTTAGAATGT--TATCA---AGGGCCGT--AG-TG-CC-TATAAAA--CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC-----CATTTGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AATCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACATAGGG-CTGCC-TTTTG-TAATAGGATTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAAT--ATT-----TG-ACCAGTTGACCTC?????????????????????????????? Setch_australiensis_Claridge2621 ?????????????????????????????????????????ATCATTACAG--AATAAACTTGATG-GGTTGTCGCTGGTTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-T-AAA--CCATCTGAAA--G-CTTT--AAAACGGCT-----TTCGGTTT---GAGGAGATTG-C--------CATTT-GGGTCA-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TACA--CCCC-ATAG-TAT-GT-CTTAGAATGT--TATCA---AGGGCCGT--AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC-----CATTTGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AATCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACATAGGG-CTGCC-TTTTG-TAATAGGATTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Setch_australiensis_Claridge2679 ???????????????????????????????????????GGATCATTACAG--AATTAAATTGATG-GGTTGTCGCTGGCTCTTTC--GGG-AGCA---TGTGCACG-CCT-GTCACTTTT--GTCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAA---CCATCTGAAA--G-CTTTT-AGAACGGCT-----TTCGGTTT---GAGGGA-TTG-C--------CATTT-GGGTCA-GCTTCCCTTGCAGGTT-CC----AGCCTATGTT----TTTCA-TACA--CCCC-ATAG-TAT-GT-ATTAGAATGT--TATCA---AAGGCCGT--AG-TG-CC-TATAAA---CTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTTGA-TG-AA-AA-GGCTTGGA-CT--TGGGGG-----TTTTATTTGCAGGCTTCAAC-----CATTTGAAG-TTGGCTCCCCTTAAATG-TATTAGCCGG-AA-AATCCTTGTGGT--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACATAGGG-CTGCC--TTTG-TCATAGGATTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAAT--ATT-----TG-ACCATTTGACCTCAAATCAGGTAGGACGACCCGCTGAA????? Setchell_tenuipes_AF099362 ??????????????????????????????????????????????????G---AT-AACTGGGTG-GGTTGTAG-TGGCTCTTTC--GGG-AGCA---TGTGCACG-CCC-GTCAC-TTT--ATCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAAAA-CCTTCTGAAA-GG-CT--------CGCCT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CTTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATACAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAG-ATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG---------ATTTGCGGGCTTCCC------TTTTTGA-G-TCGGCTCCTCTTAAATG-AATTAGCGGG-AA-AAC----GAAAA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC--A----CTTTC------------GAGTTT----CTG-ATTGCA-AACCG-TCC--TTA----GGGACAATCCATT---AATG-AACA-TTGAACTCCAATCAGGT????????????????????? Setchell_tenuipes_AF099363.1 ??????????????????????????????????????????????????G--AAT-AACTTGG-G-GG-TGAAG-TGGTTGATT---GGG-AGCA---TGTGCACG-CCC-GTCACATTT--ATCT---TTGTAGC--TGTGCAGCCTTTGTAGA-CTT-GGAAT-TCAAAA-CCTTCTAGAAAGG-CT--------CGCCT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CTTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATACAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCAT-TC-----TTCGA-TG-GC-AA-GGCTTGGA-AT--TGGGGG---------ATTTGCGGGCTTCCC------TTTTAGAAG-TCGGCTCCTCTTAAATG-AATTAGCGGG-AA-AAC----GAAAA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC-TA----CTTTC------------CAGTTT----CTG-CTT-CA-AAGCG-TCC--TTA---GGGGAC-ATC-ATT---AATG-ATCATTTGACCTCCAATCAGGT????????????????????? Setchell_tenuipes_Trappe24524 ???????????????????????????GAACCTGCGGAAGGATCATTACAG--AATAAACTTGGTG-GGTTGTAGCTGGCTCTCTC--GAG-AGCA---TGTGCACG-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAAAC-CCTTCTGAAA-GG-CT--------CGCCT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CTTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATAAAAA--GTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG---------ATTTGCGGGCTTCCC------TTTTTGAAG-TCGGCTCCCCTTAAATG-AATTAGCGGG-AA-AAC----GAA-A--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC-TA----CT-TC------------AAGTTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAATC-ATT---AATG-ATCATTTGACCTCAAATCAGGTAGGAC???????????????? Setchell_tenuipes_Trappe24776 ???????????????????????????????????????GGATCATTACAG--AATAAACTTGGTG-GGTTGTAGCTGGCTCTCTC--GGG-AGCA---TGTGCACG-CCC-GTCACCTTT--ATCT---TTCCACC--TGTGCACCCTTTGTAGA-CTT-GGAAT-TCAAAC-CCTTCTGAAA-GG-CT--------CGCCT-----TTTAGTAT---GAGGGA-TTG-C--------CA-------TCGGGCTTCCCTTGTGGGTT-TC---AAGTCTATGTT----TTTCA-TATA--CCCC-ATAG-TAAAAT-CTTAGAATGT--AATCA---AAGGCCTC--TG-TG-CC-TATAAAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACC-TTATCA--TC-----TTCGA-TG-GC-AA-GGCTTGGA-CT--TGGGGG---------ATTTGCCGGCTTCCC------TTTTTGAAG-TCGGCTCCTCTTAAATG-AATTAGCGGG-AA-AAC----GAAAA--CC---GTCTA-TTGGTGTGATAAT--TATCTACGCCGTTGTGAC-TA----CTTTC------------GAGTTT----CTG-CTT-CA-AACCG-TCC--TTA----GGGACAATC-ATT---AATG-ATCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Descoea_clade) = N: 1-859; CODONPOSSET CodonPositions (CHARACTERS = Descoea_clade) = N: 1-859; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M834] TITLE Cortinarius_clade; LINK TAXA = Taxa2; DIMENSIONS NCHAR=859; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cortinarius_acutus ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGAACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CCTG-CAAAA---TTCAGGTTT--GAGGA--TTGATTT------TT-----TTTCTT----TCCTTGTG-TTT-TC---AGGTCTATGTT----TTTCA-TATA--CCCC--ATG-TAT-GTTTATAGAATGT--AATAA---ACGGGCCTT-TG-TG-CC-TATAAA---CTT-AAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCCTC-----------------TTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TTTCTTTTTGCTGGACTCTC-----TC----GAGG-TCAGCTCCCCTGAAATA-TATTAGCAA--AACAA--TTTGTTTA--CT---GCTCA-TTGGTGTGATACA--TATCTACGC----TATTGA------TGGTA--AA----GCACA-GTT---TA--G-CTT-CT-AAAAG-TTC-ATTG-ACTTGGACAA---TC---TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_alboviolaceus_IB19740181 ????????????????????????TGTGAACCTGCGGAAGGATCATTATTG-AAATAAAC-TGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTT------------------------------------------------------------------------------------------------------------CT---AGGTCTATGTTGCTTTTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATGAAAA---CTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCT-TCTCA--------------TTG-CTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT--------AAATGAGTTCAGCTCTCCTGAAATG-CATTAGCAG--AACAA----------CCCT---GTTCA-TTGGCGTGATAAC--TATCTACGC----TATTGA------ATGTG--AG--GGACA---GTT---CA--G-CTTTCT-AATAG-TCC--------TTGGACAACT------CATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_alboviolaceus_IB19950329 ???????????????????????????????????GGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTT------------------------------------------------------------------------------------------------------------CT---AGGTCTATGTTGCTTTTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATAAAAA---CTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCT-TCTCA--------------TTG-CTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT--------AAATGAGTTCAGCTCTCCTGAAATG-CATTAGCAG--AACAA----------CCCT---GTTCA-TTGGCGTGATAAC--TATCTACGC----TATTGA------ATGTG--AG--GGACA---GTT---CA--G-CTTTCT-AATAG-TCC--------TTGGACAACT------CATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_allutus ??????????????????????????????????CGGAAGGATCATTATTG-AAATAAAC-TGACACGGTTGTTGCTGGTTCTCT--AGGG-AACA--TTGTGCACGCCTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG--------CTTG-CG------CTCAGGTTT--GAGGA--TTGATTC-----TTT-----TGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCT-AATG-TAT-GT-TATTGAATGT--AATAA---ATCGGCCTTTTG-TG-CC-TATAAA----CATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATA-AT-----CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TACCTTTTGCTGGCCTC-------AC---TGAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AATAA--TTTGTGGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---ATT---CT--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---A----TTTCA-TTAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_anomalus_AJ236071 ?????????AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGTTTTTT--AATG-AACA---TGTGCACA-CCT-GTTATCTTT--ATAT---TTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TAAGTTTT-----CTTAA--TG--------CTAG-CA------TTAAGGTTTT-GGGGA--CTGGCCT------T------TGTCTT---TTCCTTTCT-ATTATC---TGGTCTATGTT---TATTCA-TATA--CCCT-AATG-TAT-GT-TATAGAATGT--AATAA---TTGGGCC-T-TG-TG-CC-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG---------TTTTGCTGGCCTTTTTTT-------AGAGG-TCAGCTTCCCTAAAATTTTATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GT---AG----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAGT-------TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAAGTTAA Cortinarius_anomalus_IB19950138 ??????????????????????????????????CGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGTTTTTT--AATG-AACA---TGTGCACA-CCT-GTTATCTTT--ATAT---TTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TAAGTTTT-----CTTAA--TG--------CTAG-CA------TTAAGGTTTTTG-GGA--CTGGCCT------T------TGTCTT---TTCCTTTCT-ATTATC---TGGTCTATGTT---TATTCA-TATA--CCCT-AATG-TAT-GT-TATAGAATGT--AATAA---TTGGGCC-T-TG-TG-CC-TATAAA----CT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGGG------TCTTTTGCTGGCCTTTTTTT-------AGAGG-TCAGCTTCCCTAAAATT-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AG----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAGT-------TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAAGTTAA Cortinarius_armeniacus_AJ236074 AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------C---AGGTCTATCTTGCTTTTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATAAA------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCT-TCTCTTTA---------------CTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT--------ATATGAGTTCAGCTCCCCTGAAATG-CATTAGCAG--AACAA-----------CCC---GTTCG-TTGGCGTGATAAC--TATCTACGC----TATTGA------ATGTG------GGACA---GTT---CA--G-CTTTCT-AACAG-TCC--------TTGGACAACT------TATCA-TTTATGTGACCTCAAATCAGGT????????????????????? Cortinarius_armeniacus_IB19960124 ???????????????????????????????????GGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------C---AGGTCTATCTTGCTTTTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATAAAA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCT-TCTCTTTA---------------CTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT--------ATATGAGTTCAGCTCCCCTGAAATG-CATTAGCAG--AACAA-----------CCC---GTTCG-TTGGCGTGATAAC--TATCTACGC----TATGGA------ATGTG--AG--GGACA---GTT---CA--G-CTTTCT-AACAG-TCC--------TTGGACAACT------TATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_armillatus AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG--AATAAACCTGATGGG-TTGTTGCTGGCTCTCT--TGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---TTCCACC--TGTGCACCTTTTGTAGA-CCT-------------------------------------------------------------------------------------------------------------CCCC-AGGTCTATGTT---GCTTCA-TTTA--CCCCCAATG-TAT-GTTAATAGAATGT--------------------TG-TG-TC-TATAAAT------ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCCA-CTC---------------TTG-TTGAGTGGTTTGGA-TG--TGGAGG---------TTTTGCTGGCTGCTT--------AAAAGGTGCCAGCTCCTCTGAAATG-CATTAGTGG--AACAA--CCTGTCCA--------TTCA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------ATGT---AG----GCA---GTT---CA--G-CTATCT-AACAG-TCC--------TTGGACAA---ACT--TATCATTTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_bigelowii ????????????????????????????????????GAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGTTCTCT--AGGG-AGCA--ATGTGCACG-CTT-GTCATCTTT--GTAT---CTTCTCC--TGTGCACCTTTTGTAGA-CCT-GAC-TATCTCT------CTGAA--TG-CTT----ATAG-CA------CTCAGGATT--GAGAA--TTGACTT------CT-----TGTCTC----TTCTTATA-TTT-TC---AGGTCTATGTT---TCTTCA-TATA--GCCC-AATG-TAT-GTTTATAGAATGT--AATTA---ATGGGCCTT-TG-TG-CC-TATAAA----CCTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATA-ATAT-----CAACCTT---------------------------TTTGGTTGGA-TG--TGGG------------TTTGCTGGCCTCCTT---------GAAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAAT-GTT---CA--G-CTTTCT-AACAG-TCC-ATTG-ACTTGGACAAG--ATTTTTATTA-TTAATGTGACCTCAAATCAGGTAGGACTA?????????????? Cortinarius_brunneus_AJ236076 ????GT{CG}?TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGGGTTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CATC--------------------------------------------------------------------------------------------------------TTT-CC-AGGTGTCTATGTTGATTCTTCA-TTTA--CCCC-AATG-CAT-GTCAATAGAATGT--------------------TG-TG-TC-TATAA-------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TATATAT-CGAACCC--TCTT-------------TTT-TTGAGTGGTTTGGA-TG--TGGGG------------TTGCTGGCCTCTT--------GAAGGGG-TCAGCTTCCCTGAAATG-CATTAGCAG--AACAG--CCTGTTCG-------TTCCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------ATGAT--AA---GGCAA--GTT---CA--G-CTTTCT-AACCG-TCT--------TTGGACAATTTA----TCATC-TATATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_brunneus_IB19950084 ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CATC--------------------------------------------------------------------------------------------------------TTT-CC-AGGTGTCTATGTTGATTCTTCA-TTTA--CCCC-AATG-TAT-GTCAATAGAATGT--------------------TG-TG-TC-CATAA-----TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TATATAT-CAAACCC--TCTT-------------TTG-TTGAGTGGTTTGGA-TG--TGGGG------------TTGCTGGCCTCTT--------GAAGGGG-TCAGCTTCCCTGAAATG-CATTAGCAG--AACAG--CCTGTTCG-------TTCCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------ATGAT--GA--AGGCAA--GTT---CA--G-CTTTCT-AACCG-TCT--------TTGGACAATTTA----TCATC-TATATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_callochrous ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGTTGCTGGTTCTCT--AGGG-AGCA--ATGTGCACA-CTT-GTCATCTTT--GTAT---CTTCACC--TGTGCATCTTTTGTAGA-CCT-GAT-TATCTCT------CTGAA--TG-CTTTT--GTAG-CA------CTTAGGATT--GAGAA--TTGACTT------TAT----TGTCTC----TTCTTACA-TTT-TC---AGGTCTATGTT---TCTTCA-TATA--CCCT-AATG-TAT-GTTTATAGAATGT--AATTA---ATAGGCCTT-TG-TG-CC-TATAAA---TCCTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TAT-----CAACCTT---------------------------TTTGGTTGGG-TG--TGGG------------TTTGCTGGACTCTTTT---------GAGA-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA---AGCAAT-GTT---CA--G-CTT-CT-AACAG-TCC-ATTT-ACTTGGACAA---A----CCTTA-TTAATATGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_caninus ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAAC-TGATGGG-TTGCTGCTGGTTCTTT--AATG-AACA---TGTGCACA-CCC-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTCTTGTAGA-CCT-GGA-AAAGTTT------CTTAA--TG-CTATG--CTAG-CA------TTAAGGTTTT-G-GGA--TTGATTT-------------TTTCTC----TCCTTATA-TTTT-C---GGGTCTATGTT---TATTCA-TATA--CTCT-AATG-TAT-GT-TATAGAATGT--AATAA---GTGGGCCTT-TG-TG--C-TATAACA---CT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TCCTTTTTGCTGGTCTTTTC--------AAGAGG-TCAGCTCCCCTAAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AG----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAGCT------TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_cinereobrunneus ????????????????????????????????????GAAGGATCATTATTG-AAATAAACCTGAATGGGTTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTTGGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CTTG-CA------TTCAGGTTT--GAGGA--TTGACTT------TC-----CGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTCCA-TATA--CCCC-AATG-TAT-GT-TATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TATAAAA---TTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TCCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGGG--TAATTTTTTTGCTGGCA---------TCTTTTGAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---A----TTTCA-TT????????????????????????????????????????? Cortinarius_citriolens ??????????????????????????AGGACCTGCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGAT-CTCTCT------CTGAA--TG--------CTAGCCA------CTCAGGCTT--GAGGA--TTGACTT------TAA----TGTCTA----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CTC--AATG-TAT-GT-CATAGAATGT--AATCA---ATGGGCC-T-TG-TG-CC-TATAAA----CATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCA--GC----TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TCTTTTTTGCTGGTCTTCT-----------CAGA-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA--TTTGTAGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----ACA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_collinitus ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AAAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT---TTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA------TTTT------GAGAG-TGTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------T-GTA--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATT-CTCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_corrosus ??????????????????????????????????????????????????????????????????AG-TTGCTGCTGGTTCTCT--AGG--AGCA--ATGTGCACA-CTT-GTCATCTTT--GTAT---CTTCACC--TGTGCACCTTTTGTAGA-CCT-GAG-TATCTCT------CTGAA-TTG-CTTATATATAG-CA------TTCAGGATT--GAGAA--TTGACTT------CT-----TGTCTC----TTCTTATA-TTT-TC---AGGTCTATGTT---TCTTCA-TATA--CCCC-AATG-TAT-GTTTATAGAATGT--AATTA---ATGGGCCTT-TG-TG-CC-TATAAA----CCTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TAT-----CAACCTT---------------------------TTTGGTTGGA-TG--TGGG------------TTTGCTGGCCCTCTT----------GAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--CT---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------CAGGG--AA----GCAAG-GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAAG--C-CTCTTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_corrugatus ???????????????????????????????????????????CATTATCG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AAGG-AACA---TGTGCACG-CTT-GTCATCTTT--ATAT---TTCCACC--TGTGAACACTTTGTAGA-CCT-GGAAATTATCT------CTGAA--TG-CTTTT--TTGA-CA------TTCAGGTTT--GAGGA--TTGACTC----GTCC-----AGTCTC----TCCTTGCG-TTT-CC---GGGCCTATGTTTTTTTTTCA-TACA--CCC--ATTT-CTT-GTTTTTAGAATGT--GATAA---ATGGCCTTT-TG-TG-CC-TATAAACCTTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCACA------TTTTGTTTG-TCGAG-TG-TTGGA-TG-TTGGGGG--TTTTTCTTTTTGCGGGCCCCTT----TCCT---GAGG-TCAGCTCCCCTGAAAAG-CATTAGCAG--AACAA-TTTGGCTGATCTT---GTTCA-TTGGTGTGATAAC--TGTCTACGC----TATTGA------C-GTG--AGGCAACCAA--GTT---CG--G-CTT-CT-AACTG-CCC-ATTG-ATTTGGACAA---A----TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_delibutus_AJ236065 ????????TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCGTTTTT--ATAT---CTCCACT--TGTGCACCTTTTGTAGA-CTT-GGA-TATTTTT------CTGAA--TGCCTTC---GTAG-CAT-----GTCAGGTTT--GAGGA--TTGACTT------TCT----TGTCTA----TCTTTACA-TTGTCC---AGGTCTATGTT-----TTCAATATA--CCCC-AATCTATT-GT-ATTAGAATGT--AGTA----ATAGGCCTT-TG-TG-CC-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATTATA-------CAACTTC-TTCAGC----TTTTGTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-------TTTTTTGCTGGCCTTT------TCT--GAAGGTCCAGCACCCCTAAAATG-CATTAGCGG--AACAA--TTTGTTGA--CT---GTTCA-TTGGTGTGATAAT--TATCTGCGC----TATTGAA-----CTGT---AG----GCAA--GTT---CA--G-CTT-CT-AATGG-TCC-ATTG-ACTTGGACAA---TTTT-ATTTATTTAATGTGACCTCAAATCAGGT????????????????????? Cortinarius_delibutus_IB19860263 ?????????????????????????????????????AAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCATTTTT--ATAT---TTCCACC--TGTGCACTTTTTGTAGA-CTT-GGA-TATCTTT------CTGAA--TG-CTTTTT-GTAG-CAT-----GTCAGGTTT--GAGGA--TTGACTT------TAT----TGTCTG----TCTTTACA-TTT-CC---AGGTCTATGTT---CCTTCAATATA--CCCCTAATG-TAT-GT-TATAGAATGT--AATAA---GTGGGCCTT-TG-TG-CC-TATAAA--CCTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACTTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG---------TTTTGCTGGCCTT-------TCT--GAAGG-TCAGCTCCCCTGAAATG-CATTAGCAG--AACAA--TTTGTTGA--CT---GTTCA-TTGGTGTGATAAT--TATCTGCGC----TATTGAA-----CTGTG--AG----GCAA--GTT---CA--G-CTT-CT-AATAG-TCC-ATTG-ACTTGGACAA---TTTTTTTTCATTTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_elegantior ??????????????????????????????????????????????????????????????????AG-TTGTTGCTGGTTCTCT--AGG--AGCA---TGTGCACA-CTT-GTCATCTTT--GTAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTTGGG-TATCTAT------CTGAT--TG-CT-----TTAG-CAA-----CTCAGGATT--GAGGA--TTGACTT------TC-----TGTCTC----TTCTTACA-TTT-CC---AGGCCTATGTT----TTTCA-AATA--CCCT-AATG-TAT-GTTTATAGAATGT--AATCAA--ATAGGCCTT-TG-TG-CC-TATAAA----TTGATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTT-TT--------------------TTTTTTTGGTTGGA-TG--TGGG------------TTTGCTGGCCACTTT---------AGAGG-TCAGCTCCCCTAAAATG-CATTAGCGG-CAATAT--TTTGCCAA--AC--GTTTCA-TTGGTGTGATAAT--TATCTACAC----TATTGA------T-GTG--AA----GCAAG-GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAAT--TTTTTATTTA-TTAATGTGACCTCAAATCAGGTA???????????????????? Cortinarius_evernius AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCC--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCCTTTGTAGA-CCT-------------------------------------------------------------------------------------------------------------CCC--AGGTCTATGTTGCTTCTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATATAA-----TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAAACCCTCTCTT-G----------TTTG-TTGAGTGGTTTGGA-TG--TGGGGG----------TTTGTTGGCCTCGT--------AAAAGGGTTCAGCTCCTCTGAAATG-CATTAGCAG--AACAA----------CCCT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------ATGTG---G---GGCA---GTT---CA--G-CTTTCT-AATGG-TCC-------TTTGGACAA---ATATTTATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCT???????? Cortinarius_favrei ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GACCCTA-TA-T--AA-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA------TTTT------GAGAG-TGTTTGGA-TG--TGGGGGG---TGTTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTG--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATT-CTCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_flavaurora ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--GTAT---CTTCACC--TGTGCATCTTTTGTAGA-CCT-GAG-AATCTCT------CTGAA--TG-CTT----TTAG-CA------CTCAGGATT--GAGGA--TTGACTT------GA-----TGTCTT----TTCTTACA-TTT-TC---AGGCCTATGTT----TTTCA-TATA--CCCT-AATG-TAT-GTTTATAGAATGT--AATGA---ATGGGCCTT-TG-TG-CC-TATAAA----CATTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATCTAT-----CAACCTC--------------------------TA-TGGTTGGA-TG--TGGG------------TTTGCTGGTCCTTCTT---------GAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--CT---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAAA-GTT---CA--G-CTT-AT-AGCAG-TCC-ATTG-ACTTGGACAA---AT-TTATTTA-TTAATGTGACCTCAAATCAGGTAGGAC???????????????? Cortinarius_fraudulosus ???????????????????????????????????GGAAGGATCATTATTG-AAATAAATCTGATGAG-CTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG--------CTAGTCA------CTCAGGTTT--GAGGA--TTGACTT------TA-----TGTCTC----TCTTTACA-TTT-CT---AGGCCTATGTT----CTTCA-TATA--CCCC-AATG-TAT-GT-CATAGAATGT--AATCA---AT-GGCCTT-TG-TG-CC-AATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------------TTG-TTGAG-TG-TTGGA-TG--TGGGGG--TCTTTTTTTTTGCTGGTCTTCT-----------AAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGCGGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTA--AA----GCA---GTT---CA--G-CTT-CTTAACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATG-GACCTCAAATCAGGTAGGGGTACCCGCTGAA????? Cortinarius_gentilis_IB19960825 ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACG-CCTTGTCATTTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGACCCAGGGA-TATC------------------------------------------------------------------------------------------------TTT-CC-AGGGGTCTATGTTGCTTCTTCA-TTTA--CCCC-AATG-TAT-GTCAATAGAATGT--------------------TG-TGCCCATGATAAAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TATATAT-CAAACCC--TCT--------------TTCTCTGAGTGGTTTGGA-TG--TGGGGG------------TGCTGGCCTCTT--------GAAGGGG-TCAGCTCCCCTGAAATA-CATTAGCAG--AACGA--CCTGTTT--------GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGAA-----CAGTG--AA---GGCA---GTT---CA--G-CTTCCT-AACAG-TCT--------TTGGACAA---TT---TATCA-TCTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_gentilis_U56026 ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACG-CCTTGTCATTTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGACCCAGGGA-TATC------------------------------------------------------------------------------------------------TTT-CC-AGGGGTCTATGTTGCTTCTTCA-TTTA--CCCC-AATG-TAT-GTCAATAGAATGT--------------------TG-TGCCCATGATAAAAA-TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATAT-TATATAT-CAAACCC--TCT--------------TTTTCTGAGTGGTTTGGA-TG--TGGGGG------------TGCTGGCCTCTT--------GAAGGGGTCAGCTTCCCCTGAAATA-CATTAGCAG--AACGA--CCTGTTT--------GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGAA-----C-GTG--AA---GGCA---GTT---CA--G-CTTCCT-AACAG-TCT--------TTGGACAA---TT---TATCA-ACTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_glaucopus ???????????????????????????GAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CTAGTCA------CTCAGGTTT--GAGGA--TTGACTT------TA-----TGTCTC----TCCTTGCA-TTT-CC---AGGCCTATGTT---TCTGTA-TATA--CCC--AATG-TAT-GT-CATAGAATGT--AATCA---ATGGGCCTT-TG-TG-CC-TATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAAC------TTTTGTTTG-TCGGG-TG-TTGGA-TT--TGGGGG-----TCTTTTTTGCTGGTCTTGT--------------A-TCAGCTCCCCTGAAATG-CATTAGCAG--AACAA--TTTGTGAA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------C-GTG--AA----ACAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---CT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_globuliformis ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCTCC--TGTGCACCTTTTGTAGA-CCTGGGA-TATTCTT------CTGGACTTG-CG-----CAAG-CAGG----TTCAGGTTT--GAGGA-TTTGGCAT------T------TGTCTT----TCCTTGCA-TTT--C---AGGTCTATGTT---T-TCCA-TATA--CCCC---TG-TAT-GT-TATAGAATGT--ATTTA---ATGGGCCTT-TGTTG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-CG-TTGGA-TG--TGGGGG----TA-TTTTTTGCTGGTCTCTT-----TAT---GAGG-TCGGCTCCCCTAAAATG-CATCAGCGG--AACCA--TTTGTTTA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAG-AGTT---CA--G-CTT-CT-AACAG-TCC-ATTT-ACTTGGACAC----T---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_hercynicus ???????????????????????????????????????????????????????TAAACCTGATGG--TTGTTGCTGGCTCTCCT-AGGG-AGCA---TGTGCACA-CTTTGTCATCTTT--ATAC---CTTCACA--TGTGCACCTCTTGTAGA-CTT-TGA-TATCTTT------CTGGA--TG---------TA---A------TTCACGTTTTTGAGGA--TTGACTT------TTTG---GTGCTC----TCCTTACA-TTT-CC---AAATCTATGTT---CCTTCA-TATA--C----ACT--TAT-GT-TATAGAATGT--AATAAA--ATAG-CCTTTTT-TG-CCTTACAAAAA--CCTATACAACTTTCAGCAACCGATCTCTTAGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAAGC-----TTTTGCTTG-TCGAG-TGTTTGGA-TT--TGGGG----------TTGTGCTGGTCTTATTTTCT-----GAACG-TCAACTCCCCTGAAATG-TATTTGCAG--AACAA--TTTGTTGA--CC---ATTCA-TTAATGTGATA-C--TATCTACAT----TATTGA-----TGTGTG--AG----GCAGTAGTT---CA--G-CTTCTTATACAG-TCC-ATTG-ACTTGGACTA---AT---TTTCA-TCAATGTGACCTCAAAT?????????????????????????? Cortinarius_humicola ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGGGGTTGTTGCTGGTTCTCT--AAGG-AACA--TTGTGCACA-CCTTGTCATCTTT--ATGT---CTCCACC--TGTGCACCTTTTGTAGA-CCTT------------------------------------------------------------------------------------------------------------AT--CAGGTCTATGTTGCTTCTTCA-TTTG-CCCCCTAATG-TAT-GTCAATAGAATGT--------------------TG-TG-CC-TGTAAAA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAGCCC-TC-----------------TTG-TTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT---------GACGGGTTCAGCTCTCCTGAAATG-CATTAGCAG--AACGA----------CCCT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------ATGTG--AG-GGGGCA---GTTT--CA--G-CTTTCT-AACAG-TCC-------TTGGGACAA---TT---TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_laniger_IB19740251 ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGACGGG-TTGTTGCTGGTTCCCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGG-CCTT------------------------------------------------------------------------------------------------------------TC---AGGTCTATGTT---GCTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATAATA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAAACCCTCTCTT---------------G-TCGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT---------GAAGGGTTCAGCTCCTCTGAAATG-CATTAGCAG--AACAA--------CAACCT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------ATGTG--AG---GGTAAAAGTT---CA--G-CTTTCT-AACTG-TCC--------ATGGACAATT------TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAAC???? Cortinarius_laniger_IB19990511 ???????????????????????????GAACCTGCGGAAGGATCATTATTG-AAATAAACCTGACGGG-TTGTTGCTGGTTCCCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGG-CCTT------------------------------------------------------------------------------------------------------------TC---AGGTCTATGTT---GCTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-AC-TATAATA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAAACCCTCTCTT---------------G-TCGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCCTCTT---------GAAGGGTTCAGCTCCTCTGAAATG-CATTAGCAG--AACAA--------CAACCT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------ATGTG--AG---GGTAAAAGTT---CA--G-CTTTCT-AACTG-TCC--------ATGGACAATT------TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_leucopus ??????????????????????????????????????????TCATTATTG-AAATAAA-CTGATGGG-TTGTTGCTGGTTCTCC--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCCTTTGTAGA-CCT-------------------------------------------------------------------------------------------------------------CCC--AGGTCTATGTTGATTCTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------CG-TG-AC-TATATAAAA-TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAAACCCTCTC---------------TTG-TTGAGTGGTTTGGA-TG--TGGGGGG---------TTTGCTGGCCTCGT-------AAAAAGGGTTCAGCTCCCCTGAAATA-CATTAGCAG--AACAA----------CCCT---GTTCA-TTGGTGTGATAAA-ATATCTACGC----TATTGA------ATGTG--TG--GGGCA---GTT---CA--G-CTTTCT-AACGG-TCC-------TTTGGACAA---ATATTTATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_limonius_IB19740328 ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGCTGCTGGTTCTCTT-AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATATT--CTCCACC-TTGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-CTT----TTAG-CA------CTCAGGTTT-GGAGGA--TTGACTT------TTC----TGTCTT----TCCTTACC-TTT-CC---CGGCCTATGTT---TCTTCA-AATA--CCCAATGTG-TAT-GTCATTAGAATGT--AATAA---ATGGGCTTT-TG-TG-CCTTATAAA----TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCA--AC------TTGCTTG-TTGAG-TGTTTGGA-TGGTTGGGGGG---TCATTTTTTGCTGGTCTCTTTCCT-------GAAG-TCAGCTCCCCTGAAATG-CATTAGCAG--AACAA--TTTGTGGA-CCC---GTTCA-TTGGTGTGATAAA--TATCTACGC----TATTGA------C-GTT--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TTC-ATTG-ACTTGGACAA--------TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_limonius_U56028 ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGCTGCTGGTTCTCTT-AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATATT--CTCCACC-TTGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-CTT----TTAG-CA------CTCAGGTTT-GGAGGA--TTGACTT------TTC----TGTCTT----TCCTTACC-TTT-CC---CGGCCTATGTT---TCTTCA-AATA--CCCAATGTG-TAT-GTCATTAGAATGT--AATAA---ATGGGCTTT-TG-TG-CCTTATAAA----TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCA--AC------TTGCTTG-TTGAG-TGTTTGGA-TGGTTGGGGGG---TCATTTTTTGCTGGTCTCTTTCCT-------GAAG-TCAGCTCCCCTGAAATG-CATTAGCAG--AACAA--TTTGTGGA-CCC---GTTCA-TTGGTGTGATAAA--TATCTACGC----TATTGA------C-GTT--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TTC-ATTG-ACTTGGACAA--------TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_lividoochrascens ???????????????????????????GAACCTCGG-AAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTTT--AGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC-TTGTGCACCTATTGTAGA-CCT-GGA-TGACTCT------CTGAA--TG--------CTAT-CA------TTCAGGTAT--GAGGA--TTGACTT-----TTC-----TGCCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATACT--ATGGGCCTTCTG-TG-CCTTATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC--TCAAGC-----TTTTGCTTG-TTGAG-TGTATGGA-TG--TGGGGGG----TTTATTTTGCTGGCCTTTT-----TAT---GAGG-TCAGCTCCCCTGAAATG-CATCAGCGG--AATGA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------CGGTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAAC--AT---ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_magnivelatus_hypog ??????????????????????????????????????AGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGTTCTCT--AGGG-AGCA--ATGTGCACG-CTT-GTCATCTTT--GTAT---CTTCTCC--TGTGCACCTTTTGTAGA-CCT-GAC-TATCTCT------CTGAA--TG-CTTT---ATAG-CA------CTCAGGATT--GAGAA--TTGACTT------CT-----TGTCTC----TTCTTATA-TTT-TC---AGGTCTATGTT---TCTTCA-TATA--GCCC-AATG-TAT-GTTTATAGAATGT--AATTA---ATGGGCCTT-TG-TG-CC-TATAAA----CCTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATA-ATAT-----CAACCTT---------------------------TTTGGTTGGA-TG--TGGG------------TTTGCTGGCCTCTT----------GAAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--TC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAAT-GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAAG--ATTTTTTATT-ATAATGTGACCTCAA??CAGGTAGGACTACCCGCTGAACTTAA Cortinarius_mucifluus ?????????????????????????????????GCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTATTGTAGA-CCT-GGA-TAACTTT------CTGAA--TG-CG-----CTAG-CA------TTTAGGTAC--GAGGA--TTGACTT------TC-----TGCCTC---TTCCTTACA-TTT-TC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATACT--ATGGGC-TTCTG-TG-CCCTATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTT--TCAAGC-----TTTTGCTTG-TCGAG-TGTATGGA-TG--TGGGGGG---AATTATTTTGCTGGCCTTCT-----TAT---GAGG-TTGGCTCCCCTGAAATG-CATTGGCAG--AATGA-TTTTGCTGA--CC---GTTTA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------C-GTG--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAACA??????????????????????????????????????????????????????? Cortinarius_mucosus ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACATGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTTGGTCATCTTT--ATAT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---TCAG-CAT-----TTCAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-ATTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA-----TTTTT------GAGAG-TGTTTGGA-TG--TGGGGG------TTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTA--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATTACTCT-ATTTA--TAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_muscigenus ?????????????????????????????????GCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT---TT?TCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAACATG-CCTGTGTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA------TTTT------GAGAG-TGTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTA--AA----GCAA--GTT---CA--G-CTT-ATGAACAG-TCC-AT-G-ACTTGGACAATT??????????????????????????????????????????????????????? Cortinarius_obtusus ???????????????????????????????????????????TCTTATTG-AAATAATCCTGATAAG-TTGTTGCTGGTTCTCT--CGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAAA-TCT-GAA-TATCTTT------CTGAA--TG-T------CTCG-CATA----TTCAGGTTT--GAGGA--TTGATCT------T------TTTCTT----TCCTTACA-TTT-TC---AGGTTTATGTT----TTTCA-TATA--CCCC--AAG-TAT-GT-TATAGAATGT--TATAA---ACGGGCCCTTTG-TG-CC-CATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC-----TTTTTGCATG-TTGAG-TG-TTGGA-TG--TGGGGG-------TTTTTTGCTGGACTCTTGAA--TCT---GAGG-TCAGCTCCCCTAAAATG-CATCAGCGA--AACAA--TTTGTTTA--CC---GCTCA-TTGGCGTGATAAC--TATCTACGC----TATTGA------CGGT---AA----GCATT-GTT---TA--G-CTC-CT-AACAG-TCC-ATTA-ACTTGGACAA---ACC--TCTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTGA Cortinarius_odorifer ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--GTAC---CTTCACC--TGTGCACCTTTTGTAGA-CTT-GAG-TATCTCT------CTGAA--TG-CTTTT--GTA----------TTCAGGATT--GAGGA--TTGACTT------TC-----TGTCTT----TTCTTATA-TTT-TC---AAGTCTATGTT---TCTTCA-TATA--CCCT-AATG-TAT-GT-TCAAGAATGT--AATTA---ATGGGCCTTTTG-TG-CC-TATAAAG---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACC-----------------------------TTTGGTTGGA-TG--TGGG------------TTTGCTGGCCTCTT-----------AAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAATAT--ATTGCCAA--CT---GTTCA-TTGGTGTGATAAT-TTATCTACAC----TATTAA------C-CTG--AC----GCAAT-GTT---CA--G-CTT-CT-AACGG-TCC-ATTG-ACTTGGACAA---ATTTATTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_paragaudis ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCC--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ACAT---TTCCACC--TGTGCACCTTTTGTAGACCCT-------------------------------------------------------------------------------------------------------------CCC--AGGTCTATGTT---GCTTCA-TTTA--CCCCTGATG-TAT-GTCAATAGAATGT--------------------AG-TG-CT-TATGAAA---TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAACCCCCCT---------------CTTGTTGAGCGGGTTTGGA-TG--TGGAGG--------TTTTTGCTGGCCGCTT------AAAAAAGGGTTCAGCTCCTCTGAAATA-CATTAGCGG--GACAA-GCCTGTCCA--------TTCA-TTGGTGTGATAAA--TATCTACGC----TGTTGA------ATGTG--AG----GCA---GTT---CA--G-CTTTCC-AACAG-TCC-------TTTGGCAAACC------TATCATTTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_pholideus AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCC--AGGG-AGCA---TGTGCACG-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTT------------------------------------------------------------------------------------------------------------CCC--AGGTCTATGTT---GCTTCA-TCTA--CCCC-AATG-TAT-GTCAATAGAATGT--A-----------------TG-TG-CC-TATGAA------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAAACCC--TCT--------------TTG-TTGAGTGGCTTGGA-TG--TGGAGG-------TTTTTTGCTGGCCTCTT--------AAAAGGT-CCAGCTCCTCTGAAATG-CATTAGCAG--AACAG--CCTGTTCA--------TTCA-TTGGTGTGATAAC--TATCTGCGC----TATTGA------ATGTG-------GGCA---GTT---CA--G-CTTCCT-AACAG-TCC-------TTTGGACAATT------CATCATTTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_porphyropus_AJ236069 ?????????AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTC----TCTTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GT-TATAGAATGT--AGTAA---ATAGGCCTT-TG-TG-CC-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA--C---------TTTG-TTGAG-TG-TTGGA-TG--TGGGGG-------TTTTTTGCTGGCCTCTCTC---TCT---GAGT-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA-----------TTT---GTTCATTTGGCGTGATAAT--TATCTATGC----TATTGA------C-AT---AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAAT--TTTATTATTA-TTAATGTGACCTCAAATCAGGT????????????????????? Cortinarius_porphyropus_IB19990515 ?????????AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTC----TCTTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GT-TATAGAATGT--AGTAA---ATAGGCCTT-TG-TG-CC-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA--C---------TTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TTTTTTTTGCTGGCCTCTCTC---TCT---GAGT-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA-----------TTT---GTTCATTTGGCGTGATAAT--TATCTATGC----TATTGA------C-ATG--AA----GCA---GTT---CA--G-CTT-AT-AACTG-TCC-ATTG-ACTTTGGACA---ATT-TTATTA-TTAATGTGACCTCAAATCAGGTAGGACTACC???????????? Cortinarius_pseudosalor ?????????????????????????????????GCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTATTGTAGA-CCT-GGA-TAACTTT------CTGAA--TG-CG-----CTAG-CA------TTTAGGTAC--GAGGA--TTGACTT------TC-----TGCCTC---TTCCTTACA-TTT-TC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATACT--ATGGGC-TTCTG-TG-CCCTATAAA---CCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATA-AT-------CAACCTC--TCAAGC-----TTTTGCTTG-TCG-G-TGTATGGA-TG--TGGGGGG---AATTATTTTGCTGGC-TTCT-----TAT---GAGG-TTGGCTCCCCTGAAATG-CATTGGCAG--AATGA-TTTTGCTGA--CC---GTTTA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------C-GTG--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAACA??????????????????????????????????????????????????????? Cortinarius_saginus ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGATGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCAC-TTTTGTAGA-CCT-GGG-TCTCTCT------CTGAA--TG--------CTAGCCA------TTCGGGTTT--GAGGA--TTGGCTC------TC-----TGCCTC----TCTTTACA-TTT-CT---AGGTCTATGTT---TCTTCA-TATA--ACC--AATG-TAT-GT-CTTAGAACGT--AATTAA--AT-GGCTTT-CA-TG-CC-TATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-CTCA--AC----TTTTGTTTG-TCGAG-TG-TTGGA-TG--TGGGGG-----TCTTTTTTGCTGGTCCTCT-----------CAGG-TCAGCTCCCCTAAAATG-TATTAGCAG--AACAA--TTTGTGGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTC-ACTTGGACAA---GT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_salor ???????????????????????????????????????????????????????????????????G-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCATTTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CTT-GGA-TATCTTT------CTGAA--TG-CTTTT--GTA--CAT-----GTCAGGTTT--GAGGA--TTGACTT------TAT----TGTCTG----TCTTTACA-TTT-CC---AGGTCTATGTT---CCTTCAATATA--CAC-------TA--GT-TATAGAATGT--ATTAA---GT-GGCCTT-TG-TG-CC-TATAAAT--CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTG-TTG-TAGAG-TG-TTGGA-TG--TGGGGGGG-------TTGTGCTGGCCTT-------TCT--AAAGG-TCAGCTCCCCTAAAATG-CATTAGCGG--AACAA--TCTGTTGA--CT---GTTCA-TTAGTGTGATAAT--TATCTACAT----TATTGAA-----CTGTG--AG----GCAT--GTT---CA--G-CTT-CT-AATAG-TCC-ATTG-ACTTGGACAA---TT---TTTCATTTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_scaurus_AJ236070 ???????????????????????????????????????GGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTCT------CTGAG--CG-C------TTAG-CAA-----TTCAGGTTT--GAGGA--TTGACTT------TAT----TGTCTC----TCCTTACA-TTT-CC---AGACCTATGTT---TCTTTA-TATA--CCCC-AATG-TAT-GT-CATAGAATGT--AGTTA---ATGGGCCTT-TG-TG-CC-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCTGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCTCTAACAA--C----TTTTGTTTG-TTGAGTTG-TTGGA-TG--TGGGGG--------CTCTTGCTGGCTTC-------TCT---GAGG-TCAGCTCCC-TGAAAT--CATTAGCAG--AACAT----------CCCC---GTTCA-TTGGTGTGATAAC--TATCT-CGC----TATT-A------C-GT---AA----GTA---GTT---TG--G-CTT-AT-AACAG-TCC-ATT--ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCG?????????? Cortinarius_scaurus_IB19940243 ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTTTCT--AGGG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTCT------CTGAG--TG-C------CTAG-CAA-----TTCAGGTTT--GAGGA--TTGACTT------CAT----TGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TTTTCATTATA--CCCC-AATG-TAT-GT-CATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TATAAA---TCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCTGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TACAA--C----TTTTGTTTG-TTGAGTTG-TTGGA-TG--TGGGGG--------CTTTTGCTGGCTTCTC-----TCT---GAGG-TCAGCTCCCCTGAAATA-CATTAGCGG--AACGA----------TCCC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GTA---GTT---TG--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAA---AAT--TTTCA-TTAATGTGACCTCAAATCATGTAGGACTACCCGCTGAACTTAA Cortinarius_scaurus_IB19980175 ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTTTCT--AGGG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTCT------CTGAG--TG-C------CTAG-CAA-----TTCAGGTTT--GAGGA--TTGACTT------CAT----TGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TTTTCATTATA--CCCC-AATG-TAT-GT-CATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TATAAA---TCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCTGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TACAA--C----TTTTGTTTG-TTGAGTTG-TTGGA-TG--TGGGGG--------CTTTTGCTGGCTTCTC-----TCT---GAGG-TCAGCTCCCCTGAAATA-CATTAGCGG--AACGA----------TCCC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GTA---GTT---TG--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAA---AAT--TTTCA-TTAATGTGACCTCAAATCA?GTAGGACTACCCGCTGAACTTAA Cortinarius_sp._Trappe8178 ???????????????????????????GGACCTGCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGCTGCTGGTTCTCC--AGGG-AGCA---TGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TCTCTCT------CTGAA--TG--------CTAGCCA------TTTAGGATT--GGGGA--TTGACTT------TA-----TGTCTC----TCCTTCTA-TTT-TC---AGGTCTATGTT---TCTTCA-TAAA--CCCT-AATG-TAT-GT-CATAGAATGT--AATTC---AT-GGCCTTATG-TG-CC-TATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACTTC-TTCA--GC----TTTTGCTTG-TTGAA-TG-TTGGA-TG--TGGGGG-------TCTTTTGCTGGTCTTCT-----------CAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTGGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TCT-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_sp._nov._Trappe18741 ?????????????????????????????????????????ATCATTATTG-AAATAAAC-TGATGAG-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TATCCCT------CTGAG--TG--------CTTG-CA------CTTAGGTTT--GAGGA--TTGACTT------T------TGTCTC----TCCTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-AATG-TAT-GT-TATAGAATGT--AATAT---ATGGGCCTT-TG-TG-CC-TATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC?GCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CA?????????????????????????????????????TTGGA-TG--TGGGGGG----CTTTTTTTGCTGGCCTT-------TCT---GAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TATGTGGA--CC---GTTCA-TTGGTGTGATAAC--TATATACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ATTTGGACAC---T----TTTCA-TTAATGTGC?????????????????????????????????? Cortinarius_subfoetidus ????????????????????????????????????????????????TTG-AAAT??????GATGAG-TTGATGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GACATTTTT--ATATATACTCCACC--TGTGCACCTTGTGTAGA-CCT-GGA-TATCTAT------CTAAA--TG--------CTAG--------------GTTT--GGGGT--TTGGCTT------CA-----TGTCTT----TCCTTACA-TTT-CT---AGGTCTATGTTG--TATTCAATACA--TCCC-AATG-TAT-GT-CAGTGAATGT--AATCTTT-ATGGGCCTT-TG-CA-CC-TATAAA----TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTTC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAATCTC-TTCA------------------ATGAG-TTATTGGA-TGGGTGGGGG----------TTTGCTGGTCTTCT----------CAAGG-TCAGCTCCCCTGAAATG-CATTAGAGG--AACAA--GTTGTGGA--CC---GTTCA-TTAGTGTGATAATTTAATCTACAC----TATTGA------C-GG---AA---GCCAG--TTT------------------CAG-TTT--TTC-A-TTAGT-AA---A----TTTCA-TTAA??????????????????????????????????????? Cortinarius_talus ??????????????????????????TGAACCTGCGGAAGGATCATTATTG-AAATAAAC-TGATAGG-TTGTTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG--------CTTG-CA------CTTGGGTTT--GAGGA--TT-ACTT-------------TGTCTT----TTCTTACA-TTT-CC---AGGCCTATGTA---TCTTCA-TATA--CCCT-AATG-TAT-GT-TATAGAATGT--AATAA---ATGGGCC-T-TG-TG-CC-TATAAA----CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACACACCTTGTGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATA-AT-----CAACCTC-TC---------------TTTTTGTGAG-TG-TTGGA-TG--TGGGGG------TATTTTTGCTGGCCTCTCT----------GAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AATAA---TTGATT--------GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTC--AA----CCC---ATT---CT--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---T----TTTCA-TTAACATGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_traganus_AF037224 ??????????????????TCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTTT------------------------------------------------------------------------------------------------------------C---AGGTCTATGTT---GCTTCA-TTTA--CCCCCAATG-TAT-GTCAATAGAATGT--------------------TG-TG-CC-TATAAAA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAACCT-TCTC---------------TTGTTTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCTTCTT--------AAAAGGGTTCAGCTCCTCTGAAATG-CATTAGCAG--AACAA-----------CCT---GTTCA-TTGGCGTGATAAC--TATCTATGC----TATTGA------ATATC--AG-GGGGCA---GTT---CA--G-CTTTCT-AACAG-TCC--------TTGGACAA---------TTTATCATATGTGACCTCAAATCAGGTAGGACTACCCGCTGAA????? Cortinarius_traganus_IB19960060 ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTTT------------------------------------------------------------------------------------------------------------C---AGGTCTATGTT---GCTTCA-TTTA--CCCCCAATG-TAT-GTCAATAGAATGT--------------------TG-TG-CC-TATAAAA---TCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATATAT---CAACCT-TCTC---------------TTGTTTGAGTGGTTTGGA-TG--TGGGGG----------TTTGCTGGCTTCTT--------AAAAGGGTTCAGCTCCTCTGAAATG-CATTAGCAG--AACAA-----------CCT---GTTCA-TTGGCGTGATAAC--TATCTATGC----TATTGA------ATATC--AG-GGGGCA---GTT---CA--G-CTTTCT-AACAG-TCC---------TGGACAATT------TATCA-TTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_trivialis ????????????????????????????????????AAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCTCTAGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TAACTCT------CTGAAA-TG-CCAACC-ACAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTACA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTGTATATAATG-------------GACCCTA-TA-T--AA-TATAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTCTTTTAAA------TTTT------GAGAG-TGTTTGGA-TG--TGGGGG-------TATTTTGCTGGCCTTT------TCT--AAAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GT---AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATT-CTCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_umbilicatus ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CCTTGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCTT------------------------------------------------------------------------------------------------------------TC---AGGTCTATGTT--TGCTTCA-TTTA--CCCC-AATG-TAT-GTTAATAGAATGT--------------------TG-TG-CC-TATATAA---TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATCTATAT---CAACCC-TCCTTC-TC--------TTGTGTAGGAGTGGTTTGGA-TT--TGGGGG----------TTTGCTGGCCTCTT--------TAAAAGGTTCAGCTCCCCTGAAATG-CATTAGCAG--AACAA----------TCCTT--GTTCA-TTGGCGTGATAAC--TATCTATGC----TATTGA------ATGTG--AG--GTGCA---GTT---CA--G-CTTTCT-AACAG-TCC-------TTTGGACAA---ATT--TATCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_vanduzerensis ?????????????????????????????????GCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCTA-CGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTATTGTAGA-CCT-GGA-TAACTTT------CTGAA--TG-CG-----CTAG-CA------TTTAGGTAC--GAGGA--TTGACTT------TC-----TGCCTC---TTCCTTACA-TTT-TC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATACT--ATGGGC-TTCTG-TG-CCCTATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC--TCAAGC-----TTTTGCTTG-TCGAG-TGTATGGA-TG--TGGGGGG---AATCATTTTGCTGGCCTTCT-----TAT---GAGG-TTGGCTCCCCTGAAATG-CATTGGCAG--AATGA-TTTTGCTGA--CC---GTTTA-TTGGTGTGATAAC--TATCTACGC----TGTTGA------CGTTG--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAACA??????????????????????????????????????????????????????? Cortinarius_variecolor ???????????????????????????????????????????????????????????TCTGATGAG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CAT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TCTCTCT------CTGAA--TG--------CTAGCCA------TTCGGGATT--GAGGCT-TTGACTT------CAC----GGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-AATG-TAT-GT-CGTAGAATGT--AATCA---AT-GGCCTT-TG-TG-CC-TATAAA------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCA--GC----TTTTGCTCG-TTGAG-TG-TTGGA-TG--TGGGGG-------TTTTTTGCTGGTCTTCT-----------CAGA-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA--TTTGTGGA--TC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GT---AA----GCAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---A????????????????????????????????????????????????????? Cortinarius_vernicosus ?????????????????????????????????GCGGAAGGATCATTATTG-AAATAAATCTGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATCTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GACCCTA-TA-T--AA-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAAC-TC-TTTAAA------TTTT------GAGAG-TGTTTGGA-TG--TGGGGGGG-TCATAATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTG--AA----GCAA--GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAATT??????????????????????????????????????????????????????? Cortinarius_verrucisporus ??????????????????????????????ACTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCATCTTT--GTAT---CTTCACC--TGTGCACCTTTTGTAGA-CCT-GAG-TATCTCT------CTGAA--TG-CTTT---ATAG-CA------CTCAGGATT--GAGAA--TTGACTT------CT-----TGTCTC----TTCTTATA-ATT-TT---AGGTCTATGTT---TCTTCAATATA--CCCT-AATG-TAT-GTTTATAGAATGT--AATGA---ATGGGCCTT-TG-TG-CC-TATAAA----CCTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATA-ATAT-----CAACCTC---------------------------TTTGGTTGGA-TG--TGGGG-----------TTTGCTGGCTTCTT-----------GAGG-TCAGCTCCCCTTAAATG-CATTAGCGGACAACAT--TTTGCCAA--CT---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAAG-GTT---CA--G-CTA-CT-AACAG-TCC-ATTG-ACTTGGACAAG--CCTATCTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cortinarius_vibratilis_AJ238032 ??????????????????????????????????????????TCATTATTG--AATAAACTTGATGAG-TTGCTGCTGGTTCTTTA-AGGG-AACA--CTGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACCC-TGTGCACCTTTTGTAGA-CCT-GGA-TGTCTCT------CCGAG--TG-G------CTTT-CA------CTTGGGTTT--GAGGA--TTGTATT------TAT----TGTCTT---TACCTTACA-TTT-CC---AGGTCTATGTT-----TACA-AATA-TCCCC-AATC-TAT-GT-TATAGAATGTTTAATAAT--ATGGGCCTT-TG-TG-CC-TATAAA------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCTC-TTCAGCC----TTTTTGCTTGCTTGAATTGTTTGGA-TG--TGGGGG-------TTTTTTGTTGGCTTCT------ACG--AGAGG-TCAACTCCCCTAAAATG-TATTAGCAG--AACGA--TTTGTTGATCCT---GTTCA-TTGGTGTGATAAT--TATCTATGC----TATTGA------C-AGG--AA----GCAA--GTT---CA--G-CTT-CT-AATAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT?? Cortinarius_vibratilis_IB19970078 ?????????????????????????????????????????????????????AATAAACTTGATGAG-TTGCTGCTGGTTCTTTA-AGGG-AACA--CTGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACCC-TGTGCACCTTTTGTAGA-CCT-GGA-TGTCTCT------CCGAG--TG-G------CTTT-CA------CTTGGGTTT--GAGGA--TTGATTT------TAT----TGTCTT---TACCTTACA-TTT-CC---AGGTCTATGTT-----TACA-AATA-TCCCC-AATC-TAT-GT-TATAGAATGTTTAATAAT--ATGGGCCTT-TG-TG-CC-TATAAAA---CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCTC-TTCAGC------TTTTGCTTGCTTGAG-TG-TTGGA-TG--TGGGGG-----TTTTTTTTGTTGGCTTCC------ACG--AGAGG-TCAACTCCCCTAAAATG-TATTAGCAG--AACGA--TTTGTTGATCCT---GTTCA-TTGGTGTGATAAT--TATCTATGC----TATTGA------C-AGG--AA---AGCAA--GTT---CA--G-CTT-CT-AATAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGG?????????????????? Cortinarius_violaceus_AJ236059 ?????????????AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTTTGTCATCTTT--ATAT---CTTCACA--TGTGCACCTCTTGTAGA-CTTTGGA-TATCTTT------CTGAA--TG---------TA---A------TTCAGGTTTT-GAGGA--TTGACTT------TTT----GGTCTC----TCCTTACA-TTT-CC---AAATCTATGTT---CCTTCA-TATA--C----ACT--TAT-GT-TATAGAATGT--AATAAA--ATAGGCCTTTTT-TG-CCTTACAAA------TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCTGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATGGCCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA-GC----TTTTGCTTG-TCGAG-TGTTTGGA-TT--TGGGG----------TTGTGCTGGTCTTATTTTCT-----GAAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CC---GTTCA-TTAATGTGATAAC--TATCTACAT---TAATTCA-------TGT---AG----GCAGTAGTT---CA--G-CTT-CTTAACAG-TCC-AT-G-ACTTGGACAA---ATT---TTCA-TTAATGTGACCTCAA???????????????????????????? Cortinarius_violaceus_IB19980181 ????????????????????????????AACCTGCGGAAGGATCATTATTG-AAATAAACCTGATAAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTTTGTCATCTTT--ATAT---CTTCACA--TGTGCACCTCTTGTAGA-CTTTGGA-TATCTTT------CTGAA--TG---------TA---A------TTCAGGTTTT-GAGGA--TTGACTT------TTT----GGTCTC----TCCTTACA-TTT-CC---AAATCTATGTT---CCTTCA-TATA--C----ACT--TAT-GT-TATAGAATGT--AATAAA--ATAGGCCTTTTT-TG-CCTTACAAAAA--CCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA-GC----TTTTGCTTG-TCGAG-TGTTTGGA-TT--TGGGG----------TTGTGCTGGTCTTATTTTCT-----GAAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CC---GTTCA-TTAATGTGATAAC--TATCTACAT----TATTGA-----TGTGTG--AG----GCAGTAGTT---CA--G-CTT-CTTAACAG-TCC-ATTG-ACTTGGACAA---ATT---TTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Cuphocybe_melliolens ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACTTTCTGTAGT-CCT-GGA-TATCTCT------CTGAA--TG-CTAC---CTAG-CA------TTCAGGTAT--GAGGA--TTGACTT-----TGC-----AGTCTC----TCCTTGCA-TTT-CC---AGGCCTATGTT---TTTTCA-TATA--CCC--ATCC-CCT-GTTTATAGAACGT--AATGA---ATGGGCCTT-TG-TG-CC-TATAAA--CCTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGA----TTTTTTGTTTG-TCGAG-TG-TTGGA-CG--TGGGGGG-----TTCTTTTGCTGGCCTCT------------GAGG-TCAGCTCCCCTGAAATG-CATTAGCAG--AACAT--TTTGTTAA-CCT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-ATG--GAGCAACCGA--GTT---CA--G-CTT-CC-AACAG-TCC-ATTG-ATTTGGACAA---ATT--TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_austroveneta ?????????????????????????????????????AAGGATCATTGTTG-AAATAAACCTGATGGG-TTGCTGCTGGTTCTCT--AGGG-AACA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTTT------CTGAA--TG-CA-----CTAG-CA------TTCGGGTTT--GAGGA--TTGACTT------TC-----TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC--ATG-TAT-GT-TATAGAATGT--AGTA----ATGGGCCTT-TG-TG-CC-TATAAA---TCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TATTCTTTTGCTGGTCTCTT-----TCT---GAGG-TCGGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_cinnamomea ??????????????????????????????????????????TCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGATAATCTTT------CTGAA--TG-C------CTGG-CA------TTCAGGTTT--GAGGA--TTGACTT------TT-----TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT--TTCTTCA-TATA--CCCC--ATT-TAT-GT-TATAGAATGT--AATGAA--AAAGGCCTT-TG-TG-CC-TACAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTCCTCCAGGG---TTTTTGACTTG-TCGAG-TGTTTGGA-TG--TGGGGG-------TCTTTTGCTGGTCTCT------TTT---GAGG-TCGGCTCCCCTAAAATG-CATTAGCGG--AACAA--TTTGTTGA-CCC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TTTTGA------G-GT---AA----ACAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ATTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTA? Dermocybe_crocea ???????????????????????????????????????????CATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTTT------CTGAA--TG-C------CTGG-CA------TTCGGGTTT--GAGGA--TTGACTT------T------TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT--TTCTTCA-TATA--CACC--ATT-TAT-GT-TATAGAATGT--AATGAA--AAGGGCCTT-TG-TG-CC-TACAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTCCTCCAGG----TTTTTGACTTG-TCGAG-TGTTTGGA-TG--TGGGGG-------TCTTTTGCTGGTCTCT------TTT---GAGG-TCGGCTCCCCTAAAATG-CATTAGCGG--AACAA--TTTGTTGA-CCC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TTTTGA------C-GT---AA----ACAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTA? Dermocybe_malicoria ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTTT------CTGAA--TG--------CTTGGCA------TTCAGGTTT--GAGGA--TTGACTT------T------CGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT--TTCTTCA-TATA--CCCC--ATG-TAT-GT-TATAGAATGT--AATAAA--ATGGGCCTT-TG-TG-CC-TACAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-CTCAGG-----TTTTTACTTG-TTGAG-TGTTTGGA-TG--TGGGGG----TATT-TTTTGCTGGTCTTT------TTC---GAGG-TCGGCTCCCCTAAAATG-CATTAGCGG--AACAA-TTTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCAT--GTT---CA--G-CTT-CT-AATTG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_olivaceopicta_U56049 ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGTTCCCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGACCCT-GGA-TATCTTT------CTGAA--TG-C------CTACGCAA-----TTCAGGTTT--GAGGA--TTGACTT------TGT----TGTCTT----TCTTTACA-TTT-CC---AGGCCTATGTT---TCTTTA-TATA--CCCC-AATG-TAT-GT-TACAGAATGT--AATAA---ATGGGCCTT-TG-TG--C-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-CTCAAG------TTTTGCTTG-TTGAG-CG-TTGGA-TG--TGGGGGGG--TTTT-TTTTGCTGGTCTCTCTT---TCT---GAGG-TCGGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCAG--GTT---CA--G-CTT-CT-AATAGGTCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_olivaceopicta_U56050 ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGTTCCCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGACCCT-GGA-TATCTTT------CTGAA--TG-C------CTACGCAA-----TTCAGGTTT--GAGGA--TTGACTT------TGC----TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGT---TTCTTCA-TATA--CCCCCAATG-TAT-GT-TACAGAATGT--AATAA---ATGGGCCTT-TG-TG--C-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAAG------TTTTGCTTG-TTCAG-TG-TTGGA-TG--TGGGGG------TTCTTTTGCTGGTCTCTCTT---TCT---GAGG-TCGGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCAG--GTT---CA--G-CTT-CT-AATAGGTCC-ATTG-AATTGGATAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_phoenicea ????????????????TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--TGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-TCT-GGA-TATCTTT------CTGAA--TG-C------CTGG-CA------TTCAGGTTT--GAGGA--TTGACTT------T------TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT--TTCTTCA-TATA--CACC--ATG-TAT-GT-TATAGAATGT--AATGAA--AAGGGCCTT-TG-TG-CC-TACAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTCCTTCATG-----TTTTTACTTG-TTGAG-TGTTTGGA-TG--TGGGGG----TA-TCTTTTGCTGGTCTCT------TT---GGAGG-TCGGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA-CTC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCAG--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Dermocybe_splendida ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGCTGCTGGCTCTCT--AGGG-GGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTATCCC--TGTGCACCTTTTGTAGA-CCT-AAA-TATCTTTT-----CTGAA--TG-TG-----CAAG-CA------TTCAGGTTT--GAGGA-TCTGGCAT-------------TGCCTT----TCCTTGTA-TTT------AGGCCTATGTT--TTCTTCA-TATA--CCCC-AATG-TAT-GT-TATAGAATGT--AATATA-TATGGGCCTT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TTCTCTTTTGCTGGTCTCTT-----TTT---GAGG-TCGGCTCCCCTGAAATA-CATTAGTGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GTG--AA----GCAA-GGTT---CA--G-CTT-CT-AATAG-TCC-ATTG-ACTTGGACAA---GT---ATTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hebeloma_circinans ????????????????????????????????????????????????TTG--AATGAACTTGGTGTGGTTGTCGCTGGCCCTCT--CGGG-GGCA---TGTGCACA-CCC-GCCATCCTC--ATCT---CTCCACC--TGTGCACTTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGGAC--TG-CTTA---------------TTGGCTTTCCTTGCA-TTT-CC---AGGCCTACGTT----TTTCA-TATA--CCCC-ATTG-TAT-GT-AACAGAATGT---ATCA---TTGGGCCCT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACCTTTATTA--GC----TTTTGC-T--GATAATGGCTTGGA-TA--TGGGGG-----TATATTTTGCCGGCTTCTT------CACA-GATGGTCAGCTCCCCTTAAATG-CATTAGCCAG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTGC---AATT-ATAT-GGGTTT-GCACTG-CTTCCT-AACCG-TCT-GTTC-ATTCGGACAAT--A----CA-TG-ACCAT?????????????????????????????????????? Hebeloma_fastibile ???????????????????????????????????????????CATTATTG--AATGAACTTGGTGTGGTTGTTGCTGGCCCTTT--CGGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGGAC-TTG-CTG-----GCATT---AG-CTGGCTTTCCTTGCA-TTT-CC---CAGTCTATGTT---TTTTCA-TATA--CCCC-ATTG-AAT-GT-AACAGAATGT---AACATA-TTGGGCCTT-TG-TG-CC-TATAAAAA--CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACTATTATCA--GC----TTTTGC-T--GATGATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTT---------CACA-GAATGTCAGCTCCCCTTAAATG-CATTAGCCGG---T?CCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTAC---AATC-ATAT-GGGTTT-GCACTG-CTT-CC-AGCCG-TCT-GTTT-ACTCAGACAAT--A----CA-TG-ACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Hebeloma_mesophaeum ?????????????????????????????????????????????????????????????????????TTGTTGCTGGCCCTTT--CGGG-GGCA---TGTGCACA-CCC-ATCATCCTC--ATCT---CTCCACC--TGTGCACCTCTTGTAGA-CTT-GGA-T-TGA------------------CTTTC--CGAGGCAA-----CTC-GGTCGG-GAGGAC-TTG-CTG-----GCACT---AG-CTGGCTTTCCTTGCA-TTT-CC---AAGTCTATGTT---TTTTCA-TATA--CCCC-ATTG-AAT-GT-AACAGAATGT---AACATA-TTGGGCCTT-TG-TG-CC-TATAAAAA--CTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAAATTCT-------CAACTATTATCA--GC----TTTTGC-T--GATGATGGCTTGGA-TA--TGGGGG-----TTTATTTTGCTGGCTT---------CACA-GAATGTCAGCTCCCCTTAAATG-CATTAGCCGG---TGCCCCGCGTGGA--CT---GTCTA-TTGGTGTGATAAT--TATCTACGCCG--TGGACAT-----CTAC---AATC-ATAT-GGGTTT-GCGCTG-CTT-CC-AACCG-TCT-GTTT-ACTCAGACAAT--A----CA-TG-ACAA??????????????????????????????????????? Hymenogaster_remyi ????????????????????????????????TGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGGTGCTGGTTCCCT--AGGG-GGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCATCTTTTGTAGA-CCT-GGA-TATCTCT------CTCAG--TG--------CTAGCCA------CTCAGGTTT--GAGGA--TTGACTT------GA-----TGTCTC----TCTTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCC--AATG-TAT-GT-CTTAGAATGT--AATCA---ATGGGCCTT-TG-TG-CC-TATATA----CATTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGTTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TCTTTTGTGCTGGTCTTCT-----AC----AAAG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTGGAT-CT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----ACA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---A----TTTCA-TTAATGTGA?????????????????????????????????? Hymenogaster_sublilacinus ????????????????????CGTAAGGGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGGTGCTGGTTCCCT--AGGGGGGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG--------CTAGCCA------CTCAGGTTT--GAGGA--TTGACTT------GA-----TGTCTC----TCTTTACA-CTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCC--AATG-TAT-GT-CTTAGAATGT--AATCA---ATGGGCCTT-TG-TG-CC-TATATA----CATTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAACCTC-TTCAGC------TTTTGTTTG-TCGAG-TG-TTGGA-TG--TGGGGGG--TCTTTTTTTTGCTGGTCTTCT-----AC----AAAG-TCAGCTCCCCTTAAATG-TATTAGCAG--AACAA--TTTGTGGAT-CT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----ACA---GTT---CA--G-CTT-CT-AACAG-TCT-ATTG-ACTTGGACAA---A----TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Protoglossum_luteus ?????????????????????????????ACCTGCGGAAGGATCATTATTGATAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--CGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACTTTGTGTAGA-CCT-GGA-TATCTCT------CTGAAA-TG--------CTAG-CGCA----TTCAGGTTT--GAGGA--TTGGCTT-----TCC-----AGCCTC----TCCTTGCA-TTTGCC---GGGCCTATGTT---TTTTCA-TACA--CCC---ATC-CCT-GTTTATAGAATGT--AATA----A-GGGCCTT-TG-TG-CC-TATAAA--CCTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGA----------------TTTTG-TG-TTGGA-TG--TGGGGGG----TTCTTTTTGCTGGCCCAT------TAC--ATAGG-TCAGCTCCCCTAAAATG-CATTAGCAG--AACATTTTTTGTTGA-TCC---GTTCA-TTGGTGTGATAAC--TATTTACGC----TATTGA------C-GTG--AAGCAACCAA--GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ATTTGGACAA---A----TTTCA-TTAATGTGACCTCAAATCAGGTAGGATT??????????????? Protoglossum_sp._Trappe15856 ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAATCTGATGGG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTTT------CTGAA--TG-C------CTGG-CA------TTTGGGTTT--GAGGA--TTGATTTT-----T------CTTCTT----TCCTTACA-TTTCTC---AGGTCTATGTT---TCTTCA-TATA--CCC--A-TG-TAT-GT-TTAAGAATGT--AATAA---ACGGGCCTT-TG-TG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAG--C----TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----------TTGCTGGACTCTT-----TAT---GAGG-TCAGCTCCTCTAAAATG-CATTAGCAA--AACAA--TTTGTTGA--TC---GCTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AT----GCAG--GTT---TA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA--------ATTTA-TTAATGTGACCTCAAATCAGGTAGGACT??????????????? Protoglossum_sp.1_Beever_996_OK ????????????????????????????????????????????????????????????CTGATGAG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCGTTTTT--ATAT---CTCCACC--TGTGCACTTTTTGTAGA-CCT-GGA-CATTTCT------CTGAA--TG-CG-----CTGG-CA------TTCAGGTTT--GAGGA--TTGACCT------TGC----GGTCTC----TCCTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TACA--CCCC-ATTG-CAT-GTTTATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TATAAA---CCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATATAT-----CAGCCTC-TTCA--GC----TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TCTTTTTCTGCTGGCCTTTC-----TCT---GAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAT--TTTGTTGAC-CT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCAA--GTT---CA--G-CTTACT-AACTG-TCC-ATTC-AATTGGACAA---TT---TTTCA--TAATGTGACCTCAATACAGGTAGGA????????????????? Quadrispora_oblongispora ?????????????????????????????????????AAGGATCATTATTC-AATAAAACCTGATGAG-TTGCTGCTGGCTCTCT--TGAG-AGTA--TTGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACATATTGTAGA-CCT-GGA-TAACTCT------CTGAA--TG-CTAG---CTAG-CA------TTTGGGTTC--GAGGA--TTGACTT------T------TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATATA--ATGGG-CAT-TG-TG-CC-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTAAAGC-----TTTTGCTTTTGAGAG-TGTGTGGA-TG--TGGGGG------TTATTTTGCTGGCCTTT------TC----AAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAAT--TTT--TATTA-TTAATGTGACCTCCAAATCAGGTAGG????????????????? Quadrispora_sp._nov.Trappe20012 ???????????????????????????????????????GGATCATTATTC-AATAAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACATATTGTAGA-CCT-GGA-TCACTCT------CTGAA--TG-TTAA---TTAG-CA------TTCAGGTTT--GAGGA--TTGACTT------T------TGTCTT----TCCTTGCA-TTT-CC---AGGCCTATGTT----TTTCA-TATAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATAA---ATGGGTCAT-TG-TG-CC-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACTTC-TCAAAGC-----TTTTGCTTTCGAGAA-TGTGTGGA-TG--TGGGGG----TTATCCTTTGCTGGCCTC-------------AAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAAT--TTC--TATTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Rozites_caperatus_AJ238033 ???????????????????????????????????????????TCTTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---TTCCACCT-TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG-CACA---CAAG-CA------TTTGGGTTT--GAGGGG-TTGACTT------TTTT---GGTCTC----CCTTTATA-TTT-CC---AGGCCTATGTT--TCTTTCA-TATA--CCCC-ACT--TGT-GT-TATAGAATTGT-AATAAA--ATGGGCCTT-TG-TG-CC-TGTAAA-----T-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-CTCAA--C------TTG--TG-TTGAG-TG-TTGGA-TG--TGGGGG-------TTCTTTGCTGGCTTC-------------ACGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--CCTGTTCA--CT---GTTCA-TTGGCGTGATAAC--TATCTACGC----TG----------C-TTGT-AA----GCAA--GTT---CA--G-CTT-CT-AACAG-TCC-ATTA-AATTGGACAA---AT---TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTGA Rozites_caperatus_IB19990888 ??????????????????????????????CCTGCGGAAGATTCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---TTCCACCT-TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG-CACA---CAAG-CA------TTTGGGTTT--GAGGGG-TTGACCT------TTT----GGTCTC----CCTTTATA-TTT-CC---AGGCCTATGTT--TCTTTCA-TATA--CCCC-ACT--TGT-GT-TATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TGTAAA---GCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-CTCAA--C------TTG--TG-TTGAG-TG-TTGGA-TG--TGGGGGG--TTCTTTTTTTGCTGGCTTTT------------ACGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--CCTGTTCA--CT---GTTCA-TTGGCGTGATAAC--TATCTACGCTGCTTGTTGA------CAGTG--AC----GCAA--GTT---CA--G-CTT-CT-AACAG-TCC-ATTA-AATTGGACAA---AT---TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_albocanus ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGGG-TTGTTGCTGGTTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATATCT-CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CTTG-CA------TTCAGGTTT--GAGGA--TTGACTT------TA-----TGTCTC----CCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCC--AATG-TAT-GT-TATAGAATGT--AATAA---ATGGGCCTT-TG-TG-CC-TATAAA---CTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TCCAGC------TTTTGCTTG-TTGAG-TG-TTGGA-TG--TGGGGG-----TATTTTTTGCTGGCA---------TCTTTTGAGG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_campbellae_2_Trappe19821 ??????????????????????????????????CGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTC----TCCTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GT-TATAGAATGT--AACAA---ATAGGCCTT-TG-TG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA--C--------TTTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TTTTCTTTTGCTGGACTCTC-----TCT---GAGT-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA-TTTTGTGGA-TTC---GTTCA-TTGGCGTGATAAT--TATCTATGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACT-GGACAA---A----TTTTA-TTAATGTGAC????????????????????????????????? Thaxterogaster_campbellae_3 ???????????????????????????????CTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTTGGTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTC----TCCTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GT-TATAGAATGT--AACAA---ATAGGCCTT-TG-TG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAAC----------TTTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TTTTCTTTTGCTGGACTCTC-----TCT---GAGT-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA-TTTTGTGGA-TTC---GTTCA-TTGGCGTGATAAT--TATCTATGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAA---A----TTTTA-TTAATGTGAC????????????????????????????????? Thaxterogaster_campbellae_Trappe19821_OK ????????????????????????????????????GAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTC----TCCTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GC-TATAGAATGT--AACAA---ATAGGCCTT-TG-TG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAA--C--------TTTTG-TTGAG-TG-TTGGA-TG--TGGGGG----TTTTCTTTTGCTGGACTCTC-----TCT---GAGT-TCAGCTCCCCTGAAATA-CATTAGCGG--AACAA-TTTTGTGGA-TTC---GTTCA-TTGGCGTGATAAT--TATCTATGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAA---A----TTTTA-TTAATGTGACCTCAAATCAGGTAGGA????????????????? Thaxterogaster_fragilis ??????????????????????????GGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAG--TG-C------TTAG-CAC-----TTCAGGTTT--GAGGA--TTGACTT------TATT---GTTCTA----TCTTTATA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-ATTG-TAT-GT-TATAGAATGT--AGCAA---ATAGGCCTT-TG-TG-CC-TATAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACC---TTCAA--C--------TTTTG-TTGAA-TG-TTGGA-TG--TGGGGG----TTTTCTTTTGCTGGTCTC-------TCT---GAGT-TCAGCTCCCCTGAAAAT-CATTAGCGG--AACAA-TTTTGTGGA-TTC---GTTCA-TTGGCGTGATAAAT-TATCTATGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_paveleckii_Typus ??????????????????????TAAGGGAACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAGTTTGCTGCTGGCTCTCT--AGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACC--TGTGCACCTATTGTAGA-CCT-GGA-TAACTCT------CTGAA--TG--------CTAG-CAT-----TTCAGATAT--GAGGA--TTGACTT------TC-----TGCCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---CTTTCA-TGTAA-CCTC-AATG-TAT-GT-TATGGAATGT--AATACT--ATGGGC-TTATG-TG-CCTTATAAA---CAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCC-TTGGTATTCCGAGGAGTATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC--TCAAGC----TTTTTGCTTG-CTGAG-TGTATGGA-TG--TGGGGGGG----TTATTTTGCTGGCCTTTT-----TAT---GAGG-TCAGCTCCCCTGAAATG-CATTGGCAG--AATGA--TTTGCTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------CGTTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-ACTTGGACAAC--AT---ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_pingue_IB19760501 ?????????????????????????????ACCTGCGGAAGGATCATTATTG--AATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---TTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA--------TT-C-T--GAGAG-TGTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTA--AA----GCAA--GTT---CA--G-CTT-ATAACCAG-TCC-ATTG-ACTTGGACAATT-ATCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_pingue_IB19951102 ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---TTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA--------TT-C-T--GAGAG-TGTTTGGA-TG--TGGGGG----TGTTATTTTGCTGGCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTA--AA----GCAA--GTT---CA--G-CTT-ATAACCAG-TCC-ATTG-ACTTGGACAATT-ATCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_piriformis ?????????????????????????????????????????????????????AATAAACCTGATGAG-TTGTTGCTGGTTCTCCC-AGAG-GACA--TTGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACATATTGTAGA-CCT-GGA-TGACTTT------CTGAA--TG-CTAGTT-CTAG-CA------GTCAGGTTT--GAGGA--TTGACTT------TTT----TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT---CTTTCA-TATAA-CCTC-AGTG-TAT-GT-TATAGAATGT--AATAA---ACGGGCCAC-TG-TG-CC-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TCAAAGC--TTTTTTTGCCTTCGAGAG-TGTTTGGA-TG--TGGGGGG-TTA-CTTTTTTGCTGGCCTT-------TC----AAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--GACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AGCAG-TCC-ATTG-ACTTGGACAATT-TTC--TATTA-TTAATGTGACCTCAAATCAGGTAGGTATAGCCGTGCAATTTAA Thaxterogaster_porphyreum_HNBO36 ???????????????????????????????????????????????????????TAAACCTTTAGAG-TTGCTGCTGGTTCTCT--AGAG-A-CA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG-CTGT---CTAG-CA------TTGAGGTTTT-GAGGA--TTGACTT------TAC----TGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATAA-CCCC-AATG-TAT-GT-TATAGAATGT--AATACA--ATGGGCCCT-TG-CG-CC-TATAAA---TCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TGTTTGGA-TG--TGGGGGG----TTTTTTTTGCTGGCCTCT------TCC---GAGG-TCAGCTCCCCTGAAATA-CATTAGCAG--AACAA--TTTGTTGA-CTC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTT-ACTTGGACAAT-------TTCTA-TTAATGTGACCTCAAATCAGGTAGGACTA?????????????? Thaxterogaster_porphyreum_NZ8468 ???????????????????????????????????????GGATCATTATTG--AATAAACCTGTAGAG-TTGCTGCTGGTTCTCT--AGAG-AGCA---TGTGCACA-CTT-GTCGTCTTT--ATAT---CTCCACT--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG-CTAT---CTAG-CA------TTGAGGTTTT-GAGGA--TTGACTT------TAC----TGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATAA-CCCC-AATG-TAT-GT-TATAGAATGT--AATACA--ATGGGCCCT-TG-CG-CC-TATAAA---TCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTCAGC------TTTTGCTTG-TTGAG-TGTTTGGA-TG--TGGGGGG----TTTTTTTTGCTGGCCTCT------TCC---GAGG-TCAGCTCCCCTGAAATA-CATTAGCAG--AACAA--TTTGTTGA-CTC---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-GTG--AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTT-ACTTGGACAA-------TTTCTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCG?????????? Thaxterogaster_redactus ??????????????????????????????CCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGTTCTCT--AGGG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACATATTGTAGA-CCT-CGA-TCGCTCT------CTGAA--TG--------CTAG-CA------TTCAGGCTT--GAGGA--TTGACTT------T------TGTCTT----TCCTTACA-TTT-CC---AGGCCTATGTT-TTTTTTCA-TATAA-ACTC-AATG-TAT-GT-TATGGAATGT--AATAA---ACGGGCTAT-TG-TG-CC-TATAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTAAAGC-----TTTTGCTTT-GAGAG-TGTGTGGA-TG--TGGGGG--TTATTTTTTTTGCTGGCCC--------TC----AAGG-TCAGCTCCCCTGAAATG-TATTAGCAG--AACAA--TTTGTTGA--CT---GTTCA-TTGGTGTGATAAC--TATCTACGC----TATTGA------C-ATGA-AA----GCA---GTT---CA--G-CTT-AT-AACAG-TCC-ATTG-AATTGGACAATC-TTC--TATTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_sp._Trappe17869 ???????????????????????????????????????????????????????????????????G-TTGTTGCTGGTTCTCT--AGAG-AGCA--TTGTGCACG-CTT-GTCATCTTT--ATGT---CTCCACC--TGTGCACATTTTGTAGA-CCT-GGA-TCACTCT------CTGAAA-TG-CTAA---CCAG-CAT-----TTTAGGTTG--GAGGAATTTGACTT------TGT----TGTCTT----TCCTTGCA-TTT-CT---AGGTCTATGTT-CTTTTTCA-TATAA-TCT-------TATTGTG-ATATAATG-------------GGCCCTA-TA-T--AA-TATAAA---TTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAGGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACCTC-TTTAAA--------TT-C-T--GAGAG-TGTTTGGA-TG--TGGGGGG---AGTTATTTTGCTGCCCTTC------TCC---AAGG-TCAGCTCCCCTGAAATG-TATTAGCGG--AACAA--TTTGTTGA--CC---GTTCA-TTGGTGTGATAGCA-TATCTACGC----TATTGA------C-GTA--AA----GCAA--GTT---CA--G-CTT-ATAACCAG-TCC-ATTG-ACTTGGACAATT-ATCT-ATTTA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGCAATTAA Thaxterogaster_violaceum_DAO ?????????????????????????????ACCTGCGGAAGGATCATTATTG-AAATAAACCTGATGAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CTAG-CA------TTCGGGTTT--GAGGGA-TTGACTT------TCT----AGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-TTTG-TAT-GT-TATAGAATGT--AAAAA---ATGGGCCTT-TG-AG-CC-TATAA----CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAAGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACTTC-TTCAA--C----TTTTGTCTG-TTGAG-TG-TTGGA-TG--TGGGGG---TCTTTTTTTTGCTGGCCTCTCT----TCT---GAAG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA-CCC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GAG--AA----ACA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA Thaxterogaster_violaceum_Hallin ?????????????????????????????????????????????????????????????????GAG-TTGCTGCTGGCTCTCT--AGGG-AGCA---TGTGCACA-CTT-GTCATCTTT--ATAT---CTCCACC--TGTGCACCTTTTGTAGA-CCT-GGA-TATCTCT------CTGAA--TG--------CTAG-CA------TTCGGGTTT--GAGGGA-TTGACTT------TCT----AGTCTC----TCCTTACA-TTT-CC---AGGCCTATGTT---TCTTCA-TATA--CCCC-TTTG-TAT-GT-TATAGAATGT--AAAAA---ATGGGCCTT-TG-AG-CC-TATAA----CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT-GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC-TTGGTATTCCGAAGAGCATG-CCTGTTTGAGTGTCATTAATATAT-------CAACTTC-TTCAA--C----TTTTGTCTG-TTGAG-TG-TTGGA-TG--TGGGGG---TCTTTTTTTTGCTGGCCTCTCT----TCT---GAAG-TCAGCTCCCCTGAAATG-CATTAGCGG--AACAA--TTTGTTGA-CCC---GTTCA-TTGGTGTGATAAT--TATCTACGC----TATTGA------C-GAG--AA----ACA---GTT---CA--G-CTT-CT-AACAG-TCC-ATTG-ACTTGGACAA---AT---TTTCA-TTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Cortinarius_clade) = N: 1-859; CODONPOSSET CodonPositions (CHARACTERS = Cortinarius_clade) = N: 1-859; END; BEGIN TREES; TITLE Tb6199; LINK TAXA = Taxa2; TRANSLATE 1 Cortinarius_acutus, 2 Cortinarius_alboviolaceus_IB19740181, 3 Cortinarius_alboviolaceus_IB19950329, 4 Cortinarius_allutus, 5 Cortinarius_anomalus_AJ236071, 6 Cortinarius_anomalus_IB19950138, 7 Cortinarius_armeniacus_AJ236074, 8 Cortinarius_armeniacus_IB19960124, 9 Cortinarius_armillatus, 10 Cortinarius_bigelowii, 11 Cortinarius_brunneus_AJ236076, 12 Cortinarius_brunneus_IB19950084, 13 Cortinarius_callochrous, 14 Cortinarius_caninus, 15 Cortinarius_cinereobrunneus, 16 Cortinarius_citriolens, 17 Cortinarius_collinitus, 18 Cortinarius_corrosus, 19 Cortinarius_corrugatus, 20 Cortinarius_delibutus_AJ236065, 21 Cortinarius_delibutus_IB19860263, 22 Cortinarius_elegantior, 23 Cortinarius_evernius, 24 Cortinarius_favrei, 25 Cortinarius_flavaurora, 26 Cortinarius_fraudulosus, 27 Cortinarius_gentilis_IB19960825, 28 Cortinarius_gentilis_U56026, 29 Cortinarius_glaucopus, 30 Cortinarius_globuliformis, 31 Cortinarius_hercynicus, 32 Cortinarius_vanduzerensis, 33 Cortinarius_variecolor, 34 Cortinarius_vernicosus, 35 Cortinarius_verrucisporus, 36 Cortinarius_vibratilis_AJ238032, 37 Cortinarius_vibratilis_IB19970078, 38 Cortinarius_violaceus_AJ236059, 39 Cortinarius_violaceus_IB19980181, 40 Cuphocybe_melliolens, 41 Dermocybe_austroveneta, 42 Thaxterogaster_sp._Trappe17869, 43 Thaxterogaster_violaceum_DAO, 44 Thaxterogaster_violaceum_Hallin, 45 Cortinarius_humicola, 46 Cortinarius_laniger_IB19740251, 47 Cortinarius_laniger_IB19990511, 48 Cortinarius_leucopus, 49 Cortinarius_scaurus_IB19940243, 50 Cortinarius_scaurus_IB19980175, 51 Cortinarius_sp._Trappe8178, 52 Cortinarius_sp._nov._Trappe18741, 53 Cortinarius_subfoetidus, 54 Cortinarius_talus, 55 Cortinarius_traganus_AF037224, 56 Cortinarius_traganus_IB19960060, 57 Cortinarius_trivialis, 58 Cortinarius_umbilicatus, 59 Dermocybe_cinnamomea, 60 Dermocybe_crocea, 61 Dermocybe_malicoria, 62 Dermocybe_olivaceopicta_U56049, 63 Dermocybe_olivaceopicta_U56050, 64 Dermocybe_phoenicea, 65 Dermocybe_splendida, 66 Hebeloma_circinans, 67 Hebeloma_fastibile, 68 Hebeloma_mesophaeum, 69 Hymenogaster_remyi, 70 Hymenogaster_sublilacinus, 71 Protoglossum_luteus, 72 Protoglossum_sp._Trappe15856, 73 Protoglossum_sp.1_Beever_996_OK, 74 Quadrispora_oblongispora, 75 Quadrispora_sp._nov.Trappe20012, 76 Rozites_caperatus_AJ238033, 77 Rozites_caperatus_IB19990888, 78 Thaxterogaster_albocanus, 79 Thaxterogaster_campbellae_Trappe19821_OK, 80 Thaxterogaster_campbellae_2_Trappe19821, 81 Thaxterogaster_campbellae_3, 82 Thaxterogaster_fragilis, 83 Thaxterogaster_paveleckii_Typus, 84 Thaxterogaster_pingue_IB19760501, 85 Thaxterogaster_pingue_IB19951102, 86 Thaxterogaster_piriformis, 87 Thaxterogaster_porphyreum_HNBO36, 88 Thaxterogaster_porphyreum_NZ8468, 89 Thaxterogaster_redactus, 90 Cortinarius_limonius_IB19740328, 91 Cortinarius_limonius_U56028, 92 Cortinarius_lividoochrascens, 93 Cortinarius_magnivelatus_hypog, 94 Cortinarius_mucifluus, 95 Cortinarius_mucosus, 96 Cortinarius_muscigenus, 97 Cortinarius_obtusus, 98 Cortinarius_odorifer, 99 Cortinarius_paragaudis, 100 Cortinarius_pholideus, 101 Cortinarius_porphyropus_AJ236069, 102 Cortinarius_porphyropus_IB19990515, 103 Cortinarius_pseudosalor, 104 Cortinarius_saginus, 105 Cortinarius_salor, 106 Cortinarius_scaurus_AJ236070; TREE Fig._5 = [&R] (((((43,44),(77,76)),(((((79,80,81),(82,(101,102))),(106,(50,49))),((((83,(94,103,32)),92),((((74,75),89),86),(((84,85,42),(34,24,57),96,17),95))),(87,88))),(((72,97),1),(((36,37),(4,54)),52),(((((((28,27),(11,12)),(((100,9),99),(55,56))),(((23,48),(46,47)),((7,8),(2,3)))),45),58),(78,15))),(((105,(20,21)),(14,(6,5))),(41,((30,65),((64,(60,59)),61)),(63,62))),((((91,90),(69,70)),29,(26,((51,(16,33)),104)),53),((((((93,10),35,18),13),98),25),22))),(31,39,38)),((40,(19,71)),73)),((68,67),66)); END; BEGIN TREES; TITLE Tb6197; LINK TAXA = Taxa3; TRANSLATE 1 Cortinarius_anomalus, 2 Cortinarius_collinitus, 3 Cortinarius_odorifer, 4 Cortinarius_violaceus, 5 Descolea_antarctica_IB19630883, 6 Descolea_antarctica_NZ5182, 7 Descolea_gunnii_NZ2042, 8 Descolea_gunnii_NZ752, 9 Descolea_maculata, 10 Descolea_phlebophora_TAS_E4912, 11 Descolea_phlebophora_TAS_E4946, 12 Descolea_phlebophora_VIC_E5331, 13 Descolea_recedens_NSW_E4591, 14 Descolea_recedens_Qld_E4604, 15 Descolea_recedens_TAS_E4459, 16 Descolea_rheophylla, 17 Descolea_sp._PNG_E4527, 18 Descolea_sp._TAS_E1181, 19 Descomyces_albellus, 20 Descomyces_sp._nov._Trappe12624, 21 Hebeloma_circinans, 22 Hebeloma_fastibile, 23 Hebeloma_radicosum, 24 Setch_australiensis_Claridge2580, 25 Setch_australiensis_Claridge2606, 26 Setch_australiensis_Claridge2621, 27 Setch_australiensis_Claridge2679, 28 Setchell_tenuipes_AF099362, 29 Setchell_tenuipes_AF099363.1, 30 Setchell_tenuipes_Trappe24524, 31 Setchell_tenuipes_Trappe24776; TREE Fig._7 = [&R] ((((((20,19),(5,6)),((((13,14),15),(8,7)),((9,17),(((25,24),26),27)))),((18,30),(31,(28,29),16))),(12,11,10)),(((4,(1,2)),3),(22,(21,23)))); END; BEGIN TREES; TITLE Tb6198; LINK TAXA = Taxa1; TRANSLATE 1 Hymenogaster_populetorum, 2 Hymenogaster_parksii, 3 Hymenogaster_olivaceus, 4 Hymenogaster_griseus, 5 Hymenogaster_glacialis, 6 Hymenogaster_gardneri, 7 Hymenogaster_bulliardii, 8 Hymenogaster_alnicola, 9 Hebeloma_velutipes, 10 Hebeloma_radicosum, 11 Hebeloma_mesophaeum, 12 Hebeloma_helodes, 13 Hebeloma_fastibile, 14 Hebeloma_crustuliniforme, 15 Hebeloma_circinans, 16 Gymnopilus_spectabilis, 17 Gymnopilus_sapineus, 18 Gymnopilus_penetrans, 19 Cortinarius_violaceus, 20 Cortinarius_odorifer, 21 Cortinarius_collinitus, 22 Cortinarius_anomalus, 23 Hymenogaster_sp._nov._Trappe20345, 24 Hymenogaster_subalpinus, 25 Hymenogaster_tener, 26 Naucoria_bohemica_AF124712, 27 Naucoria_bohemica_IB19940290, 28 Naucoria_escharoides, 29 Naucoria_scolecina; TREE Fig._6 = [&R] (((((29,28),((((11,13),(9,(12,14))),10),15)Hebeloma),((8,25),5)),((26,27),((23,((2,6),24)),((4,1),(7,3))))),((((19,20),22),21)Cortinarius,((17,18),16)Gymnopilus)); END;