#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:58 GMT TreeBASE (cc) 1994-2008 Study reference: Bills G., Polishook J., Goetz M., Sullivan R., & White J. 2002. Chaunopycnis pustulata sp. nov., a new clavicipitalean anamorph producing metabolites that modulate potassium ion channels. Mycological Progress, 1(1): 3-17. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S869] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=66; TAXLABELS Aphysiostroma_stercorarium Arachnocrea_stipata Atkinsonella_hypoxylon Atkinsonella_sp. Atricordyceps_harposporifera Balansia_aristidae Balansia_henningsiana Balansia_obtecta Balansia_sclerotica Balansia_sp Balansia_strangulans Beauveria_bassiana Beauveria_brongniartii Chaunopychnis_alba Chaunopychnis_alba_6799 Chaunopychnis_pustulata_5368 Chaunopychnis_pustulata_5785 Chaunopychnis_sp. Cladobotryum_rubrobrunnescens Claviceps_africana Claviceps_fusiformis Claviceps_paspali Claviceps_purpurea Claviceps_ranunculoides Cordycepioideus_bisporus Cordyceps_capitata Cordyceps_capitata2 Cordyceps_coccidiicola Cordyceps_cochlidiicola Cordyceps_inegoensis Cordyceps_japonica Cordyceps_jezoensis Cordyceps_kanzashiana Cordyceps_militaris Cordyceps_ophioglossoides Cordyceps_prolifica Cordyceps_ramosopulvinata Cordyceps_sp_97009 Cordyceps_subsessilis Echinodothis_tuberiformis Epichloe_amarillans Epichloe_typhina Hirsutella_thompsonii Hyperdermium_bertonii Hyperdermium_pulvinatum Hypocrea_lutea Hypocrea_schweinitzii Hypomyces_armeniacus Hypomyces_aurantius Hypomyces_chrysospermus Hypomyces_completus Hypomyces_odoratus Hypomyces_orthosporus Hypomyces_rosellus Hypomyces_sympodiophorus Hypomyces_tremellicola Myriogenospora_atramentosa Neotyphodium_coenophialum Paecilomyces_tenuipes Sphaerostilbella_aureonitens Sporophagomyces_chrysostomus Tolypocladium_cylindrosporum Tolypocladium_inflatum Ustilaginoidea_sp. Ustilaginoidea_virens Verticillium_lecanii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M328] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=861; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aphysiostroma_stercorarium GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTG?AATCTGGGGTCC-GAGTTGTAATTTGTAGAGGATG?TTTTGGCGAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGC?TCGGATCATCCGGGGTCCCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGT?GCGGGGGATAAAGGC?TCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCGCAATACCCTGCGGTGGACTGAGGACCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGG?CCGGACCCGAAAGAAGGTGAACTATGC?TGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAG--- Arachnocrea_stipata ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGAATCATCCGGGGTCCCCGGTGCACTTCGCCTCGTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCGTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTCGCGCAATACCCCACGGCGGACTGAGGACCGCGCGCAAGGATGCTGGCGTAATGGTCACCGGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Atkinsonella_hypoxylon GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAGATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTACGACCAGACTTGGACGGCGAATCATCCAGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCTCCGGGAGTGTTATAGCCCCTTGCGCAATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Atkinsonella_sp. CGGAAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGTTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTACGACCAGACTTGGGCGGCGAATCATCCAGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCTCCGGGAGTGTTATAGCCCCTTGCGCAATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Atricordyceps_harposporifera -CGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAGCGGCGAGCGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCCAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACATGGGCGGTGAATCACCCGGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGTATCAGTTCGCCGCGGGGGACAAAGGCGG-GGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGCCGCG-AATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCTTGCGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_aristidae ?CGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAGCAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCCGGTCGGAAGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTCGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTCCGCCGGGCCGGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCCCCGGGAGTGTTATAGCCCCCCGCGCAATGCCCCGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTGAAACCCCTGCGCGTAATGAAAGTGAACG-CGGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_henningsiana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAGCAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCCGGTCGGGCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGGGCGGCGGATCATCCAGCGTCGCTGGTGCACTCCGCCGGGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCCCCGGGAGTGTTATAGCCCCCTGCGCAATGCCCCGGGGCGGACTGAGGCCCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CTGGTGAGAGC-CTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_obtecta CCGGAGGAAAAG-AACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGTTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGAAGAGGATGCTTTGGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTACGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCCCCGGGAGTGTTATAGCCCCTTGCGCAATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTGAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_sclerotica GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGG-CC-GAGTTGTAATTTGCAGAGGATG?TTCTGGCGAGGCGCCCTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCCGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAA?CGCTCGCGACCA?ACTTGGGCGGCGAATCACCCGGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGCATCAGCTCGCCTCGGGGGACAAAGGCCCGGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCCTCGCGCAATGCCCTGGGGCGGGCTGAGGACCGCGCGCAA---TGCTGGCGTAATGGTCGCCAGCG??CCGTCTTGAAGCACGG{AT}CCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATGCGGGGCCGGGCCCGAAAGAAGGTGA?CTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCATTTCGATCGTCAAACATGGGCATGGGGGCGAAAGACT--------------------- Balansia_sp -----------GAAACCAACAGGGATTGCCCCAGTAACGGGGAGTGAAGCGAACAGCTCAAATTTGAAATTTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATATCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTCGGGCGGCGGATCACCCGGCGTCGCCGGGGCACTCCGCCTGGCCGGGCCAGCATCAGCTCGCGCCGGGGGACAAAGGCGGCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCGCAATGCCCTGGGGCGGGCTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACG-CGGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_strangulans GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCCGGTCGGATGCCGAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTCCGCCGGGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGGAATGTAGCTCCCTCGGGAGTGTTATAGCCCCCTGCGCAATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTGAAACCCCTACGCGTAATGAAAGTGAACG-CGGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Beauveria_bassiana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCGGTGAATCACCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-TAGGTGAGAGC-TTCGGCGCATCACCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Beauveria_brongniartii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGTCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCACCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Chaunopychnis_alba GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCATAATACCCTGTGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGAGTAATCGAACCTTCTAGTAGCTG Chaunopychnis_alba_6799 ---------------------GGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGTCGCGGGGGATAAAAGCTTCGGGAACGTAGCTCCCTCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTAAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTG-AGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Chaunopychnis_pustulata_5368 ------------------ACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCACAATACCCTGTGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTAAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG-AGCTG Chaunopychnis_pustulata_5785 ------------------------ATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTCATGACCAGACTTGGGCGGCGAATCATCCAGCGTCGCTGGTGCACTCCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCACAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTGAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Chaunopychnis_sp. GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCATAATACCCTGTGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGA--------------- Cladobotryum_rubrobrunnescens ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGACTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGGTGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_africana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGGGAGTGAAGCGAGCAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGGATCACCCAGCGTCGCTGGTGCACTCCGGCGGGCCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCGGGGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCACCGCGCAATGCCCTGGGGCGGGCTGAGGACCGCGCGCATGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_fusiformis CCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTACTTGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCGTCGGATCACCCAGCGTCGCTGGTGCACTCCGGCGGGCCAGGCCAGCATCAGCTCGTCTCGGGGGACAAAGGCGGCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCGCAATGCCCTGGGGCGGGCTGAGGACCGCGCGCATGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_paspali GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGCCCCCGAGTTGTAATTTGCAGAGGATG?TTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATTGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGG?GGATCACCCAGCGTCGCTGGTGCACTCCGGCGGGCCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCTCTGCGCAATGCCCTGGGGCGGGCTGAGGACCGCGCGCAA---TGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_purpurea GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATACTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGGGCGTCGGATCATCCAGCGTCGCTGGTGCACTCCGGCGGGCCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCAGCGGGAATGTGGCTCCTTCGGGAGTGTTATAGCCCGCTGTGTAATGCCCTGGGGCGGGCTGAGGTTCGCGCGCATGGATGCTGGCATAATGGTTATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTAAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_ranunculoides GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGCGGATCACCCAGCGTCGCTGGTGCACTCCGGCGGGCCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCGGGGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCACCGCGCAATGCCCTGGGGCGGGCTGAGGACCGCGCGCATGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordycepioideus_bisporus GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGGATCAT-CGGCGTCGCCGGTGCACTCCGCCGGGCCAGGCCAGCATCGGTTCGCGGCGGGGGACAAAGGCGTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTCGCGCAATGCCCCGCCGCGGACCGAGGTACGCCGGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGT----- Cordyceps_capitata GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACGGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCACAATGCCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGCCAAACCCCTACGCGCAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_capitata2 GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCGGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGAATCACCCAGCGTCGCTGGTGCACTTGGTCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAGGCTTCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGTTGCGCAATGCCCTGCGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAAGG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_coccidiicola GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCTCCGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGGCCAGACTCGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTCCGCCGCGCCGGGCCAGCATCGGCTCGCCGCGGGGGACAAAGGCGCCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGGCGCGCAATGCCCCGCGGCGGACCGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGCCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGCAATGAAAGTGAACG-CAGGTGAGAGC-CTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGCGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACGTGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_cochlidiicola GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCCGGCGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTCCGCCCCGCCGGGCCAGCATCAGCTCGCCGCGGGGGATAAAGGCGTCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGGCGCGCAATGCCCCGTGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCGAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGAAATGAAAGTGAACG-CAGGTGAGAGC-CTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_inegoensis GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCCGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGTGAATCACCCGGCGTCGCCGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGTTGCACAATGCCCTGCGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGCCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_japonica GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAGCAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTCGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCGGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGTGGATCACCCAGCGTCGCTGGTGCACTCCGCCGGGCCAGGCCAGCATCAGCTCGCCGCGGGGGACAAAGGCCGCGGGAACGTGGCTCCCCAGGGAGTGTTATAGCCCGTTGCGCAATGCCCCGCGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAGCCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGC-CTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_jezoensis GCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGGAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTCCGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCGTTGCACAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_kanzashiana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAAGAGCTCAAATTTGAAATCTGGGGTCC-GAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCCGGTCGGACGCCTAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGGGGATCACCCGGCGTCGCCGGGGCACTTCGCCGGCTCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGGAACGTGGCTCCCTAGGGAGTGTTATAGCCCGCTGCGCAATGCCCTGCCGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGCAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCACCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_militaris GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTG????????GGTCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTC-GGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCGGTGAATCACCCAGCGTCGCTGGTGCACTTCG-CGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGTTTCGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCGTTGCGCAATACCCTGCGCTGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC--TCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGC-- Cordyceps_ophioglossoides GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCACAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTG?CGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTA?TATCTG Cordyceps_prolifica GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGACCC-GAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCTAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCGCGCATCACCCGGCGTCGCCGGGGCACTTCGCAGGGCCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGGAACGTAGCTCCCTCGGGAGTGTTACAGCCCGCTGCGCAATGCCCTGCCGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGACGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_ramosopulvinata GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGTCC-GAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCCGGTCGGACGCCTAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGGGGATCACCCGGCGTCGCCGGGGCACTTCGCCGGCTCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGGAACGTAGCTCCCTAGGGAGTGTTATAGCCCGCTGCGCAATGCCCTGCCGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCACCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_sp_97009 GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGGCGCGGGGGACAAAGGCTCTGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCACTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_subsessilis ------AGAACGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGGAACGTAGCTCCCTCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCTTTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Echinodothis_tuberiformis GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCCGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGACGGTGAATCATCCAGCGCCGCCGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTCCCCCGGGGGATAAAGGCTCCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCGCAATACCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTTGGGTGTAAAACCCCTGCGCGGAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Epichloe_amarillans GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGCCCCGGGGGATAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCTCTGCGCAATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTGAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Epichloe_typhina -----GGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGC-TTTGGGGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGCCCCGGGGGACAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCTCTGCTGCATGCCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hirsutella_thompsonii GCGG?GGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATG?TTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGTCAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGAG?G??GGATCATCCGGCGTCGCCGGTGCACTCCGCCGTGCCAGGCCAGCATCGGTTCGCGGCGGGGGATAAAGGCGTCGGGAACGTGGCTCCTCTGGGAGTGTTATAGCCCGTCGCGCAATGCCCCGCTGCGGACCGAGGTACGC??GCAA---TGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGA?GGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCA???????????????AAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hyperdermium_bertonii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGGCGGTGAATCACCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGACAAAGGCTGTGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCACTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hyperdermium_pulvinatum GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAATTGTAATTTGTAGAGGATGCTTTTGGCACGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCGGTGAATCACCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypocrea_lutea GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGTCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGCGGATCATCCGGGGTCCCCGGTGCACTTCGCCGCGTCAGGCCAGCATCAGTTCGTCGCGGGGGATAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGACGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypocrea_schweinitzii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCGATAACGGCGAGTGAAGCGAACAGCTCAAATTTG?AACTCGGGGTCC-GAGTTGTAATTTGTAGAGGATG?TTTTGGCAAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGGCGGATCATCCGGGGTCCCCGGTGCACTTCGCCGTGTCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGA?CTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAG--- Hypomyces_armeniacus ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGGTGCGGACTGAGGTCCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTTAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_aurantius ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGACGCCGAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGGATCATCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCCCCGGGGGACAAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_chrysospermus GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCGCCGCCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCAGGCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGTTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGTCCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_completus ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCGCCGCCTGAGTGCCCTGGAACGGGCTGCCATAGAGGGTGAGAGCCCCGTCTGGCTGGCTGCCGAGCCTCTTTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTTGCCAGGTCAGGCCAGCATCAGTTCGTCGCGGGGGATAAAGGTTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGTCCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_odoratus --------------------------------AGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_orthosporus -----------------------------CCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGCACCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCTCGTCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTCGCGCAATACCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_rosellus ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGGTGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_sympodiophorus ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAACCAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGGATCACCCGGCGTCGCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGGGGCGGACTGAGGTCCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGCAAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_tremellicola -CGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTGGGTGAGGAACCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGT-GGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGGGAATCATCCAGCGTCGCTGGTGCACTTCGCCTCGTCAGGCCAGCATCAGTTCGCTTCGGGGGATAAAGACTTTGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCATTGTGTAATACCCTGAGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTAAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTACAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Myriogenospora_atramentosa GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGACGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACATGGGCCGGGAATCATCCGGCGTCGCCGGTGCACTTCACGGGGCCAGGCCAGCATCAGCTCGCGCCGGGGGGTAAAGGCGGGGGGAA-GTGGCTCCTCCGGGAGTGTTATAACCCCCCGCGTAATGCCCTGGGGCGGGCTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGCAGGTGAGAGC-CTCGGCGCATCATCGACCGATCCTGAAGTTCTTCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Neotyphodium_coenophialum GCGGAGGAAAAGAAAC?AACAG?GATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCCGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTCGCCCTGGGGGAGAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCTCTGCGCAATGCCCTGGGGCGGACTGAGGTCCGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTGAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--GGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Paecilomyces_tenuipes GCGGAGGA?AAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGCAC?GCTC?AATTTGAAATCTGGGGTCC-GAGTTGTAATTTGC?GAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACTCCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCGGTGAATCACCCGGCGTCGCCGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGACAAAGGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCG?TGCGTAATACCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGCCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTAT?CGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTATCTG Sphaerostilbella_aureonitens ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGAATCATCCAGGGTCCCTGGTGCACTTTGCCTCGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAGGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGGGGCGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCATCGGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Sporophagomyces_chrysostomus ----------------------------CCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGT{AG}CGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCGGCGGATCATCCGGGGTCCCCGGTGCACTTCGCCTCGCCAGGCCAGCATCAGCTCGCTGCGGGGGATAAAGGCGTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTCGTGAAATACCCTGGGGCGGGCTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCGGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGAAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Tolypocladium_cylindrosporum --GGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCACAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Tolypocladium_inflatum -------------------CAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTCGCCGGGCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGGAACGTAGCTCCCTCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGTTCGCGCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGT--TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Ustilaginoidea_sp. GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGCAGAGGATGCTTCTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCC-TCTGGTTGGACGCCGAGCCTCTATGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGGCGAATCATCCAGCGTCGCTGGTGCACTTCTCCGGGCCAGGCCAGCATCAGTTCGCCCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGGCGGACTGAGGTTCGCGCGCTAGGATGCTGGCGTAATGGTTATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTAAAACCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Ustilaginoidea_virens GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGCCC-GAGTTGTAATTTGTAGAGGATGCTTCTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGCTGGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACGTGGGCGGCGGATCATCCAGCGTCGCTGGTGCACTCCGCCGGGCCAGGCCAGCATCAGTTTGCCCTGGGGGATAAAGGCTCCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCGCAATACCCTGGGGCGGACTGAGGTTCGCGCGCTAGGATGCTGGCGTAATGGTTATCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACG-CAGGTGAGAGCCCTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTAAGAGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Verticillium_lecanii -CGGAGGAAAAGAAACCACCAGGGATTGCCCCAGTAACGGCGAGTGAAGCGAACAGCTCAAATTTGAAATCTGGGGTCC-GAGTTGTAATTTGTAGAGGATGCTTTGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGTTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCGGTGAATCATCCAGCGTCGCTGGTGCACTTTGCCGGGCCAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACG-CAGGTGAGAGC-TTCGGCGCATCATCGACCGATCCTGATGTTC-TCGGATGGATTTGAGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG ; END; BEGIN TREES; TITLE Tb6223; LINK TAXA = Taxa1; TRANSLATE 1 Tolypocladium_inflatum, 2 Cordyceps_subsessilis, 3 Balansia_sp, 4 Arachnocrea_stipata, 5 Sporophagomyces_chrysostomus, 6 Hypomyces_completus, 7 Hypomyces_orthosporus, 8 Sphaerostilbella_aureonitens, 9 Hypomyces_aurantius, 10 Hypomyces_armeniacus, 11 Hypomyces_odoratus, 12 Hypomyces_rosellus, 13 Cladobotryum_rubrobrunnescens, 14 Hypomyces_sympodiophorus, 15 Hypocrea_lutea, 16 Hypomyces_chrysospermus, 17 Cordyceps_sp_97009, 18 Beauveria_brongniartii, 19 Claviceps_ranunculoides, 20 Cordyceps_coccidiicola, 21 Cordyceps_cochlidiicola, 22 Cordyceps_japonica, 23 Cordyceps_capitata2, 24 Cordyceps_jezoensis, 25 Cordyceps_inegoensis, 26 Cordyceps_prolifica, 27 Cordyceps_ramosopulvinata, 28 Cordyceps_kanzashiana, 29 Chaunopychnis_alba_6799, 30 Chaunopychnis_pustulata_5785, 31 Chaunopychnis_pustulata_5368, 32 Ustilaginoidea_sp., 33 Ustilaginoidea_virens, 34 Cordycepioideus_bisporus, 35 Hirsutella_thompsonii, 36 Balansia_sclerotica, 37 Balansia_obtecta, 38 Hypomyces_tremellicola, 39 Epichloe_typhina, 40 Echinodothis_tuberiformis, 41 Neotyphodium_coenophialum, 42 Epichloe_amarillans, 43 Claviceps_purpurea, 44 Claviceps_fusiformis, 45 Claviceps_paspali, 46 Claviceps_africana, 47 Balansia_aristidae, 48 Balansia_strangulans, 49 Balansia_henningsiana, 50 Atkinsonella_sp., 51 Atkinsonella_hypoxylon, 52 Cordyceps_militaris, 53 Paecilomyces_tenuipes, 54 Verticillium_lecanii, 55 Hyperdermium_pulvinatum, 56 Beauveria_bassiana, 57 Hyperdermium_bertonii, 58 Chaunopychnis_sp., 59 Chaunopychnis_alba, 60 Cordyceps_ophioglossoides, 61 Cordyceps_capitata, 62 Tolypocladium_cylindrosporum, 63 Hypocrea_schweinitzii, 64 Aphysiostroma_stercorarium, 65 Atricordyceps_harposporifera, 66 Myriogenospora_atramentosa; TREE Fig._10 = [&R] (66,(((((((((65,((35,34),(21,20))),((28,27),26)),((((((62,(2,1)),24),60,((59,58),((31,30)Chaunopychnis_pustulata,29))),61),25),(23,22)),(57,((((((56,18),52),53),54),17),55))),(((((46,19),44),43),45),3)),((((((((64,(63,15)),4),5),8),(16,6)),(14,(((13,12,10),11),9))),(38,7)),(40,(33,32)))),((42,41),39)),(51,50)),(((49,47),48),37)),36)); END;