#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:00 GMT TreeBASE (cc) 1994-2008 Study reference: Percy D., & Cronk Q. 2002. Different fates of island brooms: contrasting evolution in Adenocarpus, Genista and Teline (Genisteae, Leguminosae) in the Canary Islands and Madeira. American Journal of Botany, 89: 854-864. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S870] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=50; TAXLABELS Adenocarpus_anagyrifolius Adenocarpus_bacquei Adenocarpus_boudyi Adenocarpus_complicatus_MAD Adenocarpus_complicatus_PO Adenocarpus_complicatus_SP Adenocarpus_decorticans_MO Adenocarpus_decorticans_SP Adenocarpus_foliolosus Adenocarpus_mannii_ML Adenocarpus_mannii_TZ Adenocarpus_nainii_MA Adenocarpus_nainii_RIF Adenocarpus_ombriosus Adenocarpus_telonensis_MO Adenocarpus_telonensis_SP Adenocarpus_viscosus Anagyris_foetida Argyrocytisus_battandieri Genista_benehoavensis Genista_cinerea Genista_clavata Genista_florida_MO Genista_florida_PO Genista_ramosissima Genista_segonnei Genista_tenera Genista_tinctoria Genista_umbellata Teline_canariensis Teline_gomerae Teline_linifolia Teline_maderensis Teline_microphylla Teline_monspessulana_MO Teline_monspessulana_SP Teline_nervosa Teline_osyroides_ssp_osyroides Teline_osyroides_ssp_sericea Teline_paivae Teline_pallida_ssp_pallida Teline_rosmarinifolia Teline_salsoloides Teline_splendens Teline_stenopetala_ssp_microphylla_G Teline_stenopetala_ssp_microphylla_H Teline_stenopetala_ssp_pauciovulata Teline_stenopetala_ssp_sericea Teline_stenopetala_ssp_spachiana Teline_stenopetala_ssp_stenopetala ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M329] TITLE 'ITS1-5.8S-ITS2'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=637; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Adenocarpus_anagyrifolius GCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCGCCCAGCGTGG-TCTCCTCCTGGCCCAATAATAACAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACTCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAGGCTCGAGACCGGTCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACGGGA Adenocarpus_bacquei GCGAAGCATCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGTGCCCCGCCCAGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGTGGCGTTGCGACACTCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCATCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-TTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGAC-GATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACGGGA Adenocarpus_boudyi TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTAAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCTTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGCGCGTCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGAGTCGTTGCGACATGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCT-AGTGCCTTGGCCATGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCTCGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGG--CCTTGTTGGCCCCCTAAGACTGGA Adenocarpus_complicatus_MAD TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGG--CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_complicatus_PO TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGG--CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_complicatus_SP TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGG--CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_decorticans_MO TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCTGTGCGGGAGGCGTTGCGACACTCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAAAGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACGGGA Adenocarpus_decorticans_SP TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCTGTGCGGGAGGCGTTGCGACACTCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAAAGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACGGGA Adenocarpus_foliolosus TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_mannii_ML TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGATCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACAAGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCAT???????????????????????????????????????TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGGG-CCT-GTTGGCAGCCTAAGACTGGA Adenocarpus_mannii_TZ TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGATCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACAAGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCAT???????????????????????????????????????TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGGG-CCT-GTTGGCAGCCTAAGACTGGA Adenocarpus_nainii_MA TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTAAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CACCCTCGTGTCGGGAGGCGCCGCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGTCCCCCTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCGTATCCGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCAGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_nainii_RIF TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTAAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGTCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCGTATCCGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-AGTGCCTTGGCCACGTGCTAGGCACCGAGCAGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_ombriosus TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATA????????????????????????????????????????????????????????????????????????????????????????????????????????????TAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACTGGA Adenocarpus_telonensis_MO TCGAAGCCTCACAA-GCAGTGCAACCCTGTGAATTTGTTTGACTACTAAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGGGTCGGGAGGTGCCCCGCCCCGCGTGG-TCCCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAACGTGTCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGAGTCGTTGCGACACGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTTGCACATTGTTGCCCC-AGTGCCTTGGCCAAGTGCTAGGCACCGAGCGGGGTGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGC-CCT-GTTGGCCGCCTAATACTGGA Adenocarpus_telonensis_SP TCGAAGCCTCACAA-GCAGTGCAACCCCGTGAATTTGTTTGACTACTAAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGT-CCCCCTCGGGTCGGGAGGTGCCCCGCCCCGCGTGG-TCCCATCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAACGTGTCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGAGTCGTTGCGACACGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTTGCACATTGTTGCCCC-AGTGCCTTGGCCAAGTGCTAGGCACCGAGCGGGGTGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGTGACCCATGGGGC-CCT-GTTGGCCGCCTAATACTGGA Adenocarpus_viscosus TCGAAGCCTCACAA-GCAGTGCGACCCCGTGAATTTGTTTGACTACTCAGGGGTG---GCTGGAGGTGTTCG-GCACCTCGGC-CCCCCTCGTGTCGGGAGGCCCCCCGCCCCGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATTGTTCAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGCGTTGCGACACGCTTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGGCTCTGTGACCCATGGGGG-CCT-GTTGGCCGCCTAAGACTGGA Anagyris_foetida TCGAAGCCTAACAAAGCAGTGCGACCC-GCGAATTTGTTTGACTACTCAGGGGAG---GCCAGAGGTGCTTG-GCACCTCGGTCCCCTCTTGTGTC-GGAGGTGCCCCTCCTTGTGTGGGTCTCCTCCTGGCCTAACAA---CAAAA-CCCCGGCGCCGAATGCGCCAAGGAAATCAAGATTGTCTAGTCCGTCCCCGTTGGCACCGGAGACGGTGTCGGTGCGGGCGGCGTTGTGACACACATATCCCAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCCAATTCCTCAGCCTCGTGCTAGGCTTTGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAAGGTCTCACGGTTGGTTGAAAAATTGAGTCCCTGGTGGAGGGCGCCGCGATGGATGGTGGTTGAGTA--GAAGCTCGAGACCGATCGTGCGCGTCACTCGTGCCGAATTTGGGACCTTGTGACCCATGGGCG-TCTTGTTGGTCGCCCATGACGGGA Argyrocytisus_battandieri TCGAAGCCTCACAA-GCAGTGCGACCCTGTGAATTTGTTTGACTACTCAGGGGTG---ACTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCCTGCGTGG-TCTCCTCCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAAGTGAAATCGTTTAGTGCGCCCCCGTCGGC-CCGGAGACGGTGACCGTGCGGGTGGCGTTGCGACACGCGTATCCGAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCC-GTGCCATGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGTGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGTGTCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGTGACTGTGTGACCCATGGGGGGTCT-GTTGGCCGCCTAAGAAGGGA Genista_benehoavensis TCGAAGCCTCACAA-GCAATGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCCAGGGGTGTTCT-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGTCCCACCTCGTGTGG-TCTCCTTCTGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCATCGGC-CCGGAGACGGTGCC--TACGGGCGGTGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAACGTCTCACGGTTGGTTGAAAA-CTGAGTCTGCGGTGGAGGGCATCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACTAGCTTTGCGACTCTGTGACCCATGGTGG-TCT-GTTGGCCACCTAAGACGGGA Genista_cinerea TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGG------------------CCTCCTCCTGGCCAAATAA---CAAAAACCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTTGGC-CCGGAGACGGTGCT--TGCGGGTGGCGTTACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGACCATGTGCTAGGCACCTAGCGGGGCGAAAGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCGGCGGTTGAGGGCACCGTGATGGATGGTGGATGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCCCCTTCACTAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCACCTATGACGGGA Genista_clavata TCGAAGCCTCACAA-GTAGTGCGACCCTGTGAATTTGTTTGACTACTCAGGGGTGGCAGCTAGAGGTGTTCA-GCATCTCGGT-CCCCCTCGTGTCGGGAGGCGCTCCACCTTGTGTGG-TGTCCTCCTGGCCCAATAA---CAAAA--CCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTACGCCCTCGTCGGC-CCGGAGACGGTGCCCGTGCGAGCGGCGTTGCGACACGCGTATCCTAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTAGGCACCGAGTGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCCGAGTT--AATTCTCGAGACTGATCGTGTGTGTCACCCCCACTAGCTTTGTGACTCTGTCACCCCTAGGGA-TCT-GTTGATCGCCTAACACGGGA Genista_florida_MO TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCT-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGTCCCACCTCGTGTG--TCTCCTCCTGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCTGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCATGCGTGTCCCACCCACCAGCTTTGCGACTCTGTGACCCATGGCGG-TCT-GTTGGCCGCCTAAGACGGGA Genista_florida_PO TCGAAGCCTCACAA-GCAGTGCAACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCT-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGTCCCACCTCGTGTG--TCTCCTCCTGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCTGCCGGC-CCGGAGACGGTGCC--TGTGGGTGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTAGGCACCGTGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTTATAAAGCTCGAGACCGATCATGCGTGTCCCACCCACCAGCTTTGCGACTCTGTGACCCATGGCGG-TCT-GTTGGCCGCCTAAGACGGGA Genista_ramosissima TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGG------------------CCTCCTCCTGGCCAAATAA---CAAAAACCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTTGGC-CCGGAGACGGTGCT--TGCGGGTGGCGTTACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGACCATGTGCTAGGCACCTAGCGGGGCGAAAGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCGGCGGTTGAGGGCACCGTGATGGATGGTGGATGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCCCCTTCACTAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCACCTATGACGGGA Genista_segonnei TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTATAGGTGTTCT-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCTTGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTGAC--TACGGGCGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTTCTTGGCACTGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACTGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTGTACGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Genista_tenera TCGAAGCCTCACAA-GCAATGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCCAGGGGTGTTCT-GCACCTCGGT-CCCCCTCGTGTCGGGAGGTGTCCCACCTCGTGTGG-TCTCCTTCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCC--TACGGGCGGTGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGTGAGCAACGTCTCACGGTTGGTTGAAAA-CTGAGTCTGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACTAGCTTTGCGACTCTGTGACCCATGGCGG-TCT-GTTGGCCACCTAAGACGGGA Genista_tinctoria TCGAAGCCTCACAA-GCAATGCGACCC-GTGAATTTGTTTGACTACTCAGGGGCG---GCTCGAGGTGTTCCCACACCTTGGT-CCCCCTCGTGCCGGGAGGCGTCCCACCTCGTGTGG-TCTCCTTCTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCC---TCGGG-GGTGTGTCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGCGCCTTGGCCTTGTGCTAGGCACTGAGCGGGGCGAATGTTGGCTTCCCGTGAGCAACGTCTCACGGTTGGCTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGATGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACTAGCTTTGCGACTCTGTGACCCATGGTGG-TCT-GTTGGCCACCTATGACGGGA Genista_umbellata TCGAAGCCTCACAA-GCAGTGCGACCACGTGAATTTGTTTGACTACTTAGGGGTG---GCTAGAGGTGTTTG-GCATCTCGGT-CCCCCTCGTGTCGGGAGGTGCTCCACCTTGTGTGG-TGTCCTCTTGGCCCAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTCGGC-CCGGAGACGGTGCCCGTGCGGGCGGTGTTGCGACACGCATATCCTAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCATGTGCTATGCACTGAGAGGGGCGAATGTTGGCTTCCCGTGAGCAGCGTCTCATGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTT--AAATCTCGAGACCGATCGTGTGTGTCACCCCCACCAACTTTGTGACTATGTGACCCATGGGGA-TCT-GTTGATCGCCTATGACGGGA Teline_canariensis TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGGTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTGGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGC-TAGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCC-GTTGACCGCCCAAGACGGGA Teline_gomerae TCGAAGCCTCACAA-GCAGTGCGACCC-GAGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCCGGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTCCC--TACGGGAGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTTCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-GTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Teline_linifolia TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTAGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCCTGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCG-CCCCGTAGGC-CCGGAGACGGTGCC--TACGGGCGGCGTTGCGACACGCATATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTTCCAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATTGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGATCGCCTAAGACGGGA Teline_maderensis TCGAAGCCTCACAA-GCAGTGCAACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTTTGCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGTGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_microphylla TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGCG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_monspessulana_MO TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAA--CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCC--TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGTAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_monspessulana_SP TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAA--CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCC--TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGTAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_nervosa TCGAAGCCTCACAA-GCAGTGCGACCC-GAGAATTTGTTTGACTACTCAGGGGTG---GCTATAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCCGGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTCCCC--ACGGGAGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTTCTAGGCATCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-GTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Teline_osyroides_ssp_osyroides TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGGTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTGGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGC-TAGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCC-GTTGACCGCCCAAGACGGGA Teline_osyroides_ssp_sericea TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGGTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTGGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGC-TAGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCC-GTTGACCGCCCAAGACGGGA Teline_paivae TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCT--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGTGAGCAGCGTCTCATGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_pallida_ssp_pallida TCGAAGCCTCACAA-GCAGTGCGACCC-GAGAATTTGTTTGACTACTCAGGGGTG---GCTATAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCCGGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTCCCC--ACGGGAGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTTCTAGGCATCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-GTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Teline_rosmarinifolia TCGAAGCCTCACAA-GCAGTGCGACCC-GAGAATTTGTTTGACTACTCAGGGGTG---GCTATAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTAGCGTGG-TCTCCTCCGGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTCCCC--ACGGGAGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTTCTAGGCATCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-GTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Teline_salsoloides TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTTTGCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGGTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTGGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGC-TAGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCC-GTTGACCGCCCAAGACGGGA Teline_splendens TCGAAGCCTCACAA-GCAGTGCGACCC-GAGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCG-GCACCTCGGT-CCCCCTCGTGTCGGGAGGCGCCCCACCTTGCGTGG-TCTCCTCCGGGCCAAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCGCCCCCGTAGGC-CCGGAGACGGTCCC--TTCGGGAGGCGTTGCGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TATGCCTTGGCCACGTTCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATCGTCTCACGGTTGGTTGAAAA-GTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTGCGACCCATGGGGG-TCT-GTTGACCGCCTAAGACGGGA Teline_stenopetala_ssp_microphylla_G TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGG?GGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_stenopetala_ssp_microphylla_H TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATCTGTTTGACTACTCAGGGGTG---GCTATAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGTAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTCTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCACGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_stenopetala_ssp_pauciovulata TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTCT-GCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGG--TCT-GTTGACCGCCCAAGACGGGA Teline_stenopetala_ssp_sericea TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATCTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTT-GCACCTCGGC-CCCCCTCGTGTCGGTAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTCTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGCTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCACGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTCTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA Teline_stenopetala_ssp_spachiana TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATTTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTTTTTGCACCTCGGC-CCCCCTCGTGTCGGGAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGGTTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTGGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGC-TAGTCTCACGGTTGGTTGAAAA-CTGAGTCCGCGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTTTGCGACTCTGTGACCCATGGGGG-TCC-GTTGACCGCCCAAGACGGGA Teline_stenopetala_ssp_stenopetala TCGAAGCCTCACAA-GCAGTGCGACCC-GTGAATCTGTTTGACTACTCAGGGGTG---GCTAGAGGTGTCTT-GCACCTCGGC-CCCCCTCGTGTCGGTAGGTGCTCCACTTCGTGTGG-TCTCCTCTCGGCCTAATAA---CAAAA-CCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTCTAGTGCTCCCCCGTCGGC-CCGGAGACGGTGCC--TGCGGGTGGCGTCACGACACGCGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-TGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGCTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAAA-CTGAGTCCACGGTGGAGGGCACCGTGATGGATGGTGGCTGAGTT--AAAGCTCGAGACCGATCGTGTGTGTCACCTCCACCAGCTCTGCGACTCTGTGACCCATGGGGG-TCT-GTTGACCGCCCAAGACGGGA ; END; BEGIN TREES; TITLE Tb6224; LINK TAXA = Taxa1; TRANSLATE 1 Teline_stenopetala_ssp_stenopetala, 2 Teline_stenopetala_ssp_spachiana, 3 Teline_stenopetala_ssp_sericea, 4 Teline_stenopetala_ssp_pauciovulata, 5 Teline_stenopetala_ssp_microphylla_H, 6 Teline_stenopetala_ssp_microphylla_G, 7 Teline_splendens, 8 Teline_salsoloides, 9 Teline_rosmarinifolia, 10 Teline_paivae, 11 Teline_pallida_ssp_pallida, 12 Teline_osyroides_ssp_sericea, 13 Teline_osyroides_ssp_osyroides, 14 Teline_nervosa, 15 Teline_monspessulana_MO, 16 Teline_monspessulana_SP, 17 Teline_microphylla, 18 Teline_maderensis, 19 Teline_linifolia, 20 Teline_gomerae, 21 Teline_canariensis, 22 Genista_umbellata, 23 Genista_tinctoria, 24 Genista_tenera, 25 Genista_segonnei, 26 Genista_ramosissima, 27 Genista_florida_MO, 28 Genista_florida_PO, 29 Genista_clavata, 30 Genista_cinerea, 31 Genista_benehoavensis, 32 Adenocarpus_viscosus, 33 Adenocarpus_telonensis_MO, 34 Adenocarpus_telonensis_SP, 35 Adenocarpus_ombriosus, 36 Adenocarpus_nainii_RIF, 37 Adenocarpus_nainii_MA, 38 Adenocarpus_mannii_TZ, 39 Adenocarpus_mannii_ML, 40 Adenocarpus_foliolosus, 41 Adenocarpus_decorticans_MO, 42 Adenocarpus_decorticans_SP, 43 Adenocarpus_complicatus_MAD, 44 Adenocarpus_complicatus_PO, 45 Adenocarpus_complicatus_SP, 46 Adenocarpus_boudyi, 47 Adenocarpus_bacquei, 48 Adenocarpus_anagyrifolius, 49 Argyrocytisus_battandieri, 50 Anagyris_foetida; TREE Fig._2 = [&R] (50,((49,(((48,47),(42,41)),(((46,(34,33)),(37,36)),((45,44,43,40,35,32)Adenocarpus_complicatus_group,(39,38))))Adenocarpus),((((31,24),23),(28,27)),((((30,26),(((21,13,12,8,2),(18,(5,(3,1))),17,(16,15),10),6,4)Teline_monspessulana_group),(29,22)),(25,((20,(14,11,9),7),19)19_group))))Genisteae); END;