#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:04 GMT TreeBASE (cc) 1994-2008 Study reference: Castlebury L., Farr D., Rossman A., & Jaklitsch W.M. 2003. Genera of the Diaporthales: Diaporthopsis. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S972] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=50; TAXLABELS Apiognomonia_errabunda Cryphonectria_macrospora Cryphonectria_nitschkei Cryptodiaporthe_aesculi Cryptodiaporthe_salicella Diaporthe_arctii Diaporthe_decedens Diaporthe_detrusa Diaporthe_eres_AF362565 Diaporthe_eres_AF408350 Diaporthe_fibrosa Diaporthe_medusaea Diaporthe_oncostoma Diaporthe_padi Diaporthe_pardalota Diaporthe_perjuncta Diaporthe_pustulata_AF408357 Diaporthe_pustulata_AF408358 Diaporthopsis_angelicae_AR3724 Diaporthopsis_angelicae_AR3776 Discula_destructiva_AF362568 Discula_destructiva_AF408359 Discula_fraxinea Endothiella_gyrosa Gaeumannomyces_graminis_AF362556 Gaeumannomyces_graminis_AF362557 Gnomonia_gnomon Gnomonia_leptostyla Gnomonia_setacea Leucostoma_auerswaldii Leucostoma_cincta Leucostoma_nivea Magnaporthe_grisea Mazzantia_napelli Melanconis_alni Melanconis_stilbostoma Phomopsis_asparagi_AF439634 Phomopsis_asparagi_AF439636 Phomopsis_columnaris Phomopsis_javanica Phomopsis_sclerotioides Phomopsis_sp_AF439629 Phomopsis_sp_AF439632 Phomopsis_sp_AF439633 Phomopsis_vaccinii Phomopsis_viticola Pyricularia_grisea Valsa_ambiens Valsa_germanica Valsa_mali ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M509] TITLE 28s_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1284; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Apiognomonia_errabunda GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGATGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTTTTGTCGGAGGATAAGAATAGTAGGAACGTAGCTCTTCCTCGGAAGAGTGTTATAGCCTATT-ATACGATACTTTGATAGAGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Cryphonectria_macrospora -------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGTTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCC-GTACGATACCCTGACGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTATCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Cryphonectria_nitschkei GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGTTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGGCAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGCC-GTACGATACCCTGACGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTATCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Cryptodiaporthe_aesculi GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCATGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAACAGTAGGAATGTAGCTCTCCTTCGGGGGAGTGTTATAGCCTATT-GTACGATACTCTAACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Cryptodiaporthe_salicella ----------CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCCTTCGGGGGAGTGTTATAGCCTATT-GTACGATACTCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Diaporthe_arctii -------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCACC-GGACGATACCCTCGCGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_decedens GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGCAGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_detrusa GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCTTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_eres_AF362565 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_eres_AF408350 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_fibrosa GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCCCGTGGGGGGATAAGACCGCCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGCAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATAGGGGCGAAAGACCAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_medusaea GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAAAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthe_oncostoma GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGACAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthe_padi GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCCC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCTCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthe_pardalota -------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAAAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthe_perjuncta ---------------GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAGACCGTCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACTCCCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthe_pustulata_AF408357 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCCC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCTCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthe_pustulata_AF408358 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCCC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCTCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Diaporthopsis_angelicae_AR3724 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTTCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGCC-GGACGATACCCTCGCGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Diaporthopsis_angelicae_AR3776 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGCC-GGACGATACCCTCGCGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Discula_destructiva_AF362568 ----------CAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTCGGGGGATAAGAACAGTAGGAACGTGGCCCCCCT-C-GGGGGGTGTTATAGCCTACT-GTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Discula_destructiva_AF408359 -------------CAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTCTCGTCGGGGGATAAGAACAGTAGGAACGTGGCCCCCCT-C-GGGGGGTGTTATAGCCTACT-GTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Discula_fraxinea GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGTAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGTCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGAGGATAAGAACAGTAGGAACGTAGCTCTCTTTCGGGGGAGTGTTATAGCCTATT-GTACGATACTCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Endothiella_gyrosa ---------------GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGTTCATCCGGGGTTCTCCCCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTTGGGGGATAAGAACGACAGGAACGTGGCCCTCCTTCGGGTGGGTGTTATAGCCTGTC-GTACGATACCCTGATGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTATCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Gaeumannomyces_graminis_AF362556 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCA-GGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTTGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTT-C-GGGGAGTGTTATAGCCCGTT-GCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT-CTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGATTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCCTTCGAATGTACCGACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAGTGGACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTCCCACCCATACCCCGCCCCCAGGGTAGAAA Gaeumannomyces_graminis_AF362557 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTA-GGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTT-C-GGGGAGTGTTATAGCCCGTT-GCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT-CTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGATTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCCTTCGAATGTACCGACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAGTGGACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTCCCACCCATACCCCGCCCCCAGGGTAGAAA Gnomonia_gnomon GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTAGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAGGCCAACATCGGTTCTTGTTGGGGGATAAGAATAGTAGGAACGTAGCTCTCTT-C-GGAGAGTGTTATAGCCTATT-GTACGATACCCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Gnomonia_leptostyla GAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCGGTACCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACGCGGCTCAAGCCAACATCGGTTTTCGTTGGGGGAGAAGAACAGTGGGAACGTAGCTCCTCT-C-GGGGAGTGTTATAGCCCATT-GTACGATACCCTGGCGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Gnomonia_setacea ------------------ATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTATGGTGCAGTACCTACCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGATACTAAACCTGTGTTAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGTGCCGTGTGGCTCATCCGAGGTTCTCCCCGGTGCACTCCACACGGCTCAGGCCAACATCGGTTTTCGTTGGGGGATAAGAATAGTAGGAACGTAGCTTTCTT-C-GGAGAGTGTTATAGCCTATT-ATACGATACCCTGACGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTACCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Leucostoma_auerswaldii GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCC--GGCCCGCGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAGACCTGTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCATTTATGACCAGACTTGCGCCGGGCAGCTCATCAGGGGTTCTCCCCTGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAGAACAGCGGGAACGTGGCCCCCCTCCGGGGGGGTGTTATAGCCCGCT-GTACGATACTCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Leucostoma_cincta GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCC--GGCCCGCATTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAGACCTGTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCATTTATGACCAGACTTGCGCCGGGCAGCTCATCAGGGGTTCTCCCCTGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGAGGATAAGAACAGTGGGAACGTGGCCCCCCTCCGGGGGGGTGTTATAGCCCATT-GTACGATACTCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Leucostoma_nivea GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCC--GGCCCGCATTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAAACCTGTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCAGCTCATCAGGGGTTCTCCCCTGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGAGGATAAGAACAGTGGGAACGTGGCCCCCTCTCGGGGGGGTGTTATAGCCCATT-GTACGATACTCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Magnaporthe_grisea GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCACCTACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGTTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTTT-C-GGGGAGTGTTATAGCCCGTT-GCGTAATACCCCGGCGGGGACCGACGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTTCAGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT-CTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGATTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCCTTCGAATGTACCGACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAGTGGACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTCCCACCCATACCCCGCCCCCAGGGTAGAAA Mazzantia_napelli GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACACCAAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGTGTGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCACGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGGCAGGAACGTGGCACCCTC-C-GGGGTGTGTTATAGCCTGCC-GGAGGATACCCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA Melanconis_alni GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTATGTAATACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCGGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCATACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCCT-C-GGAGGGTGTTATAGCCTATT-GTACGATACCTTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTCATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAATACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTATTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCCCCTTCAGGGTAGAAA Melanconis_stilbostoma GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGAAGTATTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTGTGTAATACTCCTTCGACGAGTCGAATAGTTTGGGAATGCTGTTCTAAGTGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGTGCCGTGTGGCTCATCCGGGGTTCTCCCCGGTGCACTCCACACGGTTCAGGCCAACATCGGTTCTCGTTGGGGGATAAGAACAGTAGGAACGTGGCCCTCTT-C-GGAGGGTGTTATAGCCTATT-GTACGATACTCTGATGGGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGGTCATTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAAATTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGACCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGGAGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACTCCCCCTTCAGGGTAGAAA Phomopsis_asparagi_AF439634 -------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGACAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTATATAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_asparagi_AF439636 ----------------------CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGACAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTATATAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGT----- Phomopsis_columnaris GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGTCAGGAACGTGGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_javanica GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGACAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTATATAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_sclerotioides GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGCCAGGAACGTGGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGCGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGCAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_sp_AF439629 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGACGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCTCGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_sp_AF439632 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGACGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCTCGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCC------------------------ Phomopsis_sp_AF439633 GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAAAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCC------------------------ Phomopsis_vaccinii GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCTGGC-GGACGATACCCCCGTGGGGACCGAGGTCCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGTGGCCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCTATATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Phomopsis_viticola ----------------GGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC--GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCGGGAACGTAGCACCCTC-C-GGGGTGTGTTATAGCCCGGC-GGACGATACCCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTTACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTATATTGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCCCAGGGTAGAAA Pyricularia_grisea GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCACCTACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGTTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTTT-C-GGGGAGTGTTATAGCCCGTT-GCGTAATACCCCGGCGGGGACCGACGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTTCAGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT-CTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGATTTTTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCCTTCGAATGTACCGACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAGTGGACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTCCCACCCATACCCCGCCCCCAGGGTAGAAA Valsa_ambiens ---------CCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTTA--GGCCCGCATTGTAATTTGCAGAGGATGCTTCTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAGACCTGTGTGAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCAGCTCATCAGGGGTTCTCCCCTGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGAGGATAAGAACGGTAGGAACGTGGCCCCCCTCCGGGGGGGTGTTATAGCCTGCC-GTACGATACTCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCGCCCTCAGGGTAGAAA Valsa_germanica GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCC--GGCCCGCATTGTAATTTGCAGAGGATGCTTCTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAAACCTGTGTGAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCAGCTCATCAGGGGTTCTCCCCTGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGAGGATAAGAACGGTTGGAACGTGGCCCCCCTCCGGGGGGGTGTTATAGCCTACC-GTACGATACTCCCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAATGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTGCCCATACCCCGCCCTCAGGGTAGAAA Valsa_mali GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCC--GGCCCGCATTGTAATTTGCAGAGGATGCTTCTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATGGATGGACACCAAGCCTGTGTGAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGAGGATAAGAACGGTGGGAACGTGGCCCCCCTCCGGGGGGGTGTTATAGCCCACCGGTACGATACTCTCGTGGGGACCGAGGTTCGCGC-TCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAGTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGTTCTTCAGTTTTATGAGGTAAAGCGAATGATTAGGGACTCGGGGGCGCTTATTAGCCTTCATCCATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCATTCGAATGTACCAACACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGCGCCAGAGTGTACGCTCATCAGACACCACAAAAGGCGTTAGTACATCTTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCCGAATGTACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACCGCCCATACCCCGCCCTCAGGGTAGAAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28s_rDNA) = N: 1-1284; CODONPOSSET CodonPositions (CHARACTERS = 28s_rDNA) = N: 1-1284; END; BEGIN TREES; TITLE Tb6445; LINK TAXA = Taxa1; TRANSLATE 1 Valsa_ambiens, 2 Pyricularia_grisea, 3 Phomopsis_viticola, 4 Phomopsis_vaccinii, 5 Phomopsis_sp_AF439633, 6 Phomopsis_sp_AF439632, 7 Phomopsis_sp_AF439629, 8 Phomopsis_sclerotioides, 9 Phomopsis_javanica, 10 Phomopsis_columnaris, 11 Phomopsis_asparagi_AF439636, 12 Phomopsis_asparagi_AF439634, 13 Melanconis_stilbostoma, 14 Melanconis_alni, 15 Mazzantia_napelli, 16 Magnaporthe_grisea, 17 Leucostoma_nivea, 18 Leucostoma_cincta, 19 Leucostoma_auerswaldii, 20 Gnomonia_setacea, 21 Gnomonia_leptostyla, 22 Gnomonia_gnomon, 23 Gaeumannomyces_graminis_AF362557, 24 Gaeumannomyces_graminis_AF362556, 25 Endothiella_gyrosa, 26 Discula_fraxinea, 27 Discula_destructiva_AF408359, 28 Discula_destructiva_AF362568, 29 Diaporthopsis_angelicae_AR3776, 30 Diaporthopsis_angelicae_AR3724, 31 Valsa_mali, 32 Valsa_germanica, 33 Diaporthe_pustulata_AF408358, 34 Diaporthe_pustulata_AF408357, 35 Diaporthe_perjuncta, 36 Diaporthe_pardalota, 37 Diaporthe_padi, 38 Diaporthe_oncostoma, 39 Diaporthe_medusaea, 40 Diaporthe_fibrosa, 41 Diaporthe_eres_AF408350, 42 Diaporthe_eres_AF362565, 43 Diaporthe_detrusa, 44 Diaporthe_decedens, 45 Diaporthe_arctii, 46 Cryptodiaporthe_salicella, 47 Cryptodiaporthe_aesculi, 48 Cryphonectria_nitschkei, 49 Cryphonectria_macrospora, 50 Apiognomonia_errabunda; TREE Fig._15 = [&R] ((((((((((((((45,(30,29)),(7,6)),38),(42,41,4)),((39,36),5),(10,8)),40),43),44,((9,12,11),3)),((37,34,33),35)),15),((((((((50,46,26),47),21),(22,20)),(27,28)),(14,13)),((49,48),25)),((((19,18),17),(32,1)),31))),(24,23)),2),16); END;