#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:21 GMT TreeBASE (cc) 1994-2008 Study reference: Spooner D. 2009. DNA barcoding will frequently fail in complicated plant groups: an example in wild potatoes. American Journal of Botany, 96: 1177-1189. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9933] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=139; TAXLABELS Capsicum_pubescens_Anderson1554 Datura_inoxia_Spooner2989 Solanum_acaule_310923 Solanum_acaule_498277 Solanum_acaule_500016 Solanum_achacachense_558032 Solanum_acroscopicum_365314 Solanum_agrimonifolium_243349 Solanum_agrimonifolium_243351 Solanum_agrimonifolium_243351_14 Solanum_alandiae_498086 Solanum_alandiae_498086.1_5 Solanum_alandiae_498086.2_5 Solanum_alandiae_498088 Solanum_alandiae_498088_5 Solanum_albicans_266381 Solanum_ambosinum_498213 Solanum_andreanum_320345 Solanum_arnezii_545846 Solanum_avilesii_498091 Solanum_berthaultii_498075_5 Solanum_berthaultii_498100_7 Solanum_berthaultii_545920.1_5 Solanum_berthaultii_545920.2_3 Solanum_brevicaule_234009 Solanum_bukasovii_210042 Solanum_bukasovii_210055 Solanum_bukasovii_442700 Solanum_bulbocastanum_347757 Solanum_candolleanum_545972 Solanum_cardiophyllum_347759 Solanum_cardiophyllum_595465 Solanum_cardiophyllum_Rodriguez_2534 Solanum_chacoense_472809 Solanum_chacoense_472813_8 Solanum_chacoense_472821_5 Solanum_chacoense_498321_5 Solanum_chomatophilum_365339 Solanum_circaeifolium_498117 Solanum_circaeifolium_498120 Solanum_circaeifolium_545974 Solanum_clarum_275202 Solanum_clarum_283099 Solanum_colombianum_473462 Solanum_colombianum_498152.1_12 Solanum_colombianum_498152.2_2 Solanum_commersonii_458317 Solanum_demissum_275211 Solanum_demissum_558482 Solanum_diploconos_Bohs_445 Solanum_doddsii_Spooner_et_al._6651 Solanum_dulcamara_Spooner2988 Solanum_ehrenbergii_595480 Solanum_etuberosum_498311 Solanum_guerreroense_161730 Solanum_hougasii_161174 Solanum_hougasii_161727 Solanum_immite_458401 Solanum_incamayoense_473060 Solanum_infundibuliforme_472857 Solanum_iopetalum_275183 Solanum_jamesii_458424 Solanum_kurtzianum_472923 Solanum_laxissimum_283088 Solanum_leptophyes_442670 Solanum_leptophyes_442670.1_7 Solanum_leptophyes_442670.2_1 Solanum_leptophyes_458378 Solanum_leptophyes_458378.1_4 Solanum_leptophyes_458378.2_1 Solanum_leptophyes_545986_6 Solanum_leptophyes_545989.1_4 Solanum_leptophyes_545989.2_2 Solanum_leptophyes_545993_7 Solanum_lignicaule_473351 Solanum_longiconicum_186568 Solanum_lycopersicoides_LA1964 Solanum_lycopersicum Solanum_marinasense_458380 Solanum_megistacrolobum_545927.1_3 Solanum_megistacrolobum_545927.2_3 Solanum_microdontum_458355_6 Solanum_microdontum_473167_8 Solanum_microdontum_500036 Solanum_microdontum_500036.1_5 Solanum_microdontum_500036.2_3 Solanum_microdontum_500040 Solanum_microdontum_500040_6 Solanum_morelliforme_275218 Solanum_multiinterruptum_365336 Solanum_okadae_498065 Solanum_oplocense_435079 Solanum_oplocense_473365 Solanum_oxycarpum_498026 Solanum_palustre_558233 Solanum_palustre_558253 Solanum_pampasense_275274 Solanum_piurae_310997 Solanum_polyadenium_161728 Solanum_raphanifolium_265862 Solanum_raphanifolium_473369 Solanum_santolallae_195168 Solanum_scabrifolium_365363 Solanum_schenckii_275261 Solanum_schenckii_498280 Solanum_schenckii_558456.1_1 Solanum_schenckii_558456.2_18 Solanum_schenckii_558457 Solanum_sparsipilum_310957 Solanum_spegazzinii_472976 Solanum_spegazzinii_473214.1_5 Solanum_stoloniferum_251740 Solanum_stoloniferum_283108 Solanum_stoloniferum_558453 Solanum_stoloniferum_558453_10 Solanum_subpanduratum_498289 Solanum_tarijense_442689 Solanum_tuberosum_195188 Solanum_tundalomense_473474 Solanum_ugentii_546030 Solanum_ugentii_546030.1_5 Solanum_ugentii_546030.2_3 Solanum_ugentii_546032 Solanum_ugentii_546032_6 Solanum_vernei_458370 Solanum_vernei_458370.1_3 Solanum_vernei_458370.2_3 Solanum_vernei_458371 Solanum_vernei_458371_6 Solanum_vernei_473309 Solanum_vernei_473309_5 Solanum_vernei_473310.1_4 Solanum_vernei_473310.2_3 Solanum_vernei_500062_5 Solanum_verrucosum_558488 Solanum_villosum_Bohs_150 Solanum_violaceimarmoratum_473396 Solanum_yungasense_614703 Solanum_yungasense_Spooner_et_al._6738 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=88; TAXLABELS Capsicum_pubescens_Anderson1554 Solanum_acaule_310923 Solanum_acaule_498277 Solanum_acaule_500016 Solanum_achacacense_558032 Solanum_acroscopicum_365314 Solanum_agrimonifolium_243349 Solanum_agrimonifolium_243351 Solanum_alandiae_498086 Solanum_alandiae_498088 Solanum_albicans_266381 Solanum_ambosinum_498213 Solanum_andreanum_320345 Solanum_arnezii_545846 Solanum_avilesii_498091 Solanum_brachycarpum_234009 Solanum_bukasovii_210042 Solanum_bukasovii_210055 Solanum_bukasovii_442700 Solanum_bulbocastanum_347757 Solanum_candolleanum_545972 Solanum_cardiophyllum_347759 Solanum_cardiophyllum_595465 Solanum_chacoense_472809 Solanum_chomatophyllum_365339 Solanum_circaeifolium_498117 Solanum_circaeifolium_498120 Solanum_circaeifolium_545974 Solanum_clarum_275202 Solanum_clarum_283099 Solanum_colombianum_473462 Solanum_commersonii_458317 Solanum_demissum_275211 Solanum_demissum_558482 Solanum_ehrenbergii_595480 Solanum_etuberosum_498311 Solanum_guerreroense_161730 Solanum_hougasii_161727 Solanum_immite_458401 Solanum_incamayoense_473060 Solanum_infundibuliforme_472857 Solanum_iopetalum_275183 Solanum_jamesii_458424 Solanum_kurtzianum_472923 Solanum_lasissimum_283088 Solanum_leptophyes_442670 Solanum_leptophyes_458378 Solanum_lignicaule_473351 Solanum_longiconicum_186568 Solanum_marinasense_458380 Solanum_microdontum_500036 Solanum_microdontum_500040 Solanum_morelliforme_275218 Solanum_multiinterruptum_365336 Solanum_okadae_498065 Solanum_oplocense_435079 Solanum_oplocense_473365 Solanum_oxycarpum_498026 Solanum_palustre_558233 Solanum_palustre_558253 Solanum_pampasense_275274 Solanum_piurae_310997 Solanum_polyadenium_161728 Solanum_raphanifolium_265862 Solanum_raphanifolium_473369 Solanum_santolallae_195168 Solanum_scabrifolium_365363 Solanum_schenckii_275261 Solanum_schenckii_498280 Solanum_schenckii_558457 Solanum_sparsipilum_310957 Solanum_spegazzinii_472976 Solanum_stoloniferum_251740 Solanum_stoloniferum_283108 Solanum_stoloniferum_558453 Solanum_subpanduratum_498289 Solanum_tarijense_442689 Solanum_tuberosum_195188 Solanum_tundalomense_473474 Solanum_ugentii_546030 Solanum_ugentii_546032 Solanum_vernei_458370 Solanum_vernei_458371 Solanum_vernei_473309 Solanum_verrucosum_558488 Solanum_villosum_Bohs150 Solanum_violaceimarmoratum_473396 Solanum_yungasense_614703 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4262] TITLE 'trnH-psbA intergenic spacer'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=631; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Capsicum_pubescens_Anderson1554 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACTTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGTCTAGTCTATAGTAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTTTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTATTTTTATT--TTATTTAGTAATTTACTAGTATTTTACTTACATATACTTTTTTGTTTACATTATAGAAAAAGAAA--GAGAGGATATTTGCCTGCATTTATT-------CAGGATTGAGTATTCTATTTTAATTTTGTATGTATTTATTT------AAAATTCTAGAAATATAACTTGTTCCTCTTCTTGCTAATGTTACTATATCTTTTTTATTTCATTTCAAAAAAAAATTAATTTTTACTTCAGATTCTGATCTTTGATTCATATTCTTATCTTTG------------AAATAATAATATCATTCAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCTAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGAAC-CACAAACAA Solanum_acaule_310923 ???????ATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAAAAAA-GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACACCCC--CAAA Solanum_acaule_498277 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAAAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_acaule_500016 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCCAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAAAAAA-GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACACCCC--CAAA Solanum_achacacense_558032 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTATT------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_acroscopicum_365314 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTAGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_agrimonifolium_243349 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTATT-----AT----GAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCC-CCATGCGCGACC-CCC--CAAC Solanum_agrimonifolium_243351 ????TGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAATAAGATAAATATTTGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_alandiae_498086 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_alandiae_498088 ???ATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_albicans_266381 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTT------CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAAAAAAAGAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGC?ACAACCC--CAAA Solanum_ambosinum_498213 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_andreanum_320345 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGGTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGAGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCG??ACC-CCC--CAAA Solanum_arnezii_545846 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_avilesii_498091 ?????GCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_brachycarpum_234009 ??????CATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCAATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_bukasovii_210042 ????TGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_bukasovii_210055 ?????GCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------CAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_bukasovii_442700 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_bulbocastanum_347757 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTT--------CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGGGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_candolleanum_545972 ?GTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTATT------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_cardiophyllum_347759 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGAGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATTTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCAGATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATCTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_cardiophyllum_595465 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGAGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATTTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCAGATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTGGAATCTTTTGTTTTCGAATTTAAATAATCTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_chacoense_472809 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATGGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAACAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_chomatophyllum_365339 ??TATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT-------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATTATTGAAATAAGAAAGAAGATAAATATTCGAACTTTAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_circaeifolium_498117 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_circaeifolium_498120 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGTCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT-------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_circaeifolium_545974 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_clarum_275202 ?GTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTATTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTCGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------CAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATTT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCTAATTTAAATAATGAAAAAATGGAATGTAAGCAGGCGAGGGGGCGGATGTAGCCAAGAGGATCAAGGCAGAGGATTGAGAATCCACCATGCGCGACC-CCC--CAAA Solanum_clarum_283099 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTATTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCTAT----TTATTTTTATTTAAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATATTTTTTATTTAATTTCACAAAAAATACAATTTTTACTTCATATTCTTATTT-------------------TTTAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCTAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCA--CAAA Solanum_colombianum_473462 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATTATTTATTCATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCAAAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATAATTGAAATAAGAACGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-ACC--CAAA Solanum_commersonii_458317 ???ATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTCTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGGGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_demissum_275211 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCGCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTAAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCCC????????ACC-CCC--CAAA Solanum_demissum_558482 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_ehrenbergii_595480 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATTT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATATAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_etuberosum_498311 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----AAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAG--GAGAGGGTATTTGCCTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCGAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACGATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTGACTTCATATTCTTATCT-------------------TTGAAATAATAATTAAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTACATAATGTCAAAATGGAATGTAAGTAAGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_guerreroense_161730 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_hougasii_161727 ??TATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_immite_458401 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTG???????????????ACC-CCC--CAAA Solanum_incamayoense_473060 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----ATTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_infundibuliforme_472857 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_iopetalum_275183 ???????ATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTAT--------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTTAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_jamesii_458424 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATTT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATATAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATT-TGAATCCACCATGCGCGACC-CCC--CACA Solanum_kurtzianum_472923 ??TATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCAT?????ACC-CCC--CAAA Solanum_lasissimum_283088 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTTTCTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_leptophyes_442670 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_leptophyes_458378 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_lignicaule_473351 ?GTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------CAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_longiconicum_186568 ?????GCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTT----------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTATAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTTTTTTCTAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_marinasense_458380 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTTTCTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_microdontum_500036 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_microdontum_500040 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_morelliforme_275218 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTGACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_multiinterruptum_365336 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTTAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTATT-------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_okadae_498065 ??ATTGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTTTTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_oplocense_435079 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_oplocense_473365 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTCTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_oxycarpum_498026 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT------AT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCTAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_palustre_558233 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTT------CTTTAT----AAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAG--GAGAGGGTATTTGCCTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCGAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACGATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTGACTTCATATTCTTATCT-------------------TTGAAATAATAATTAAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTACATAATGTCAAAATGGAATGTAAGTAAGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_palustre_558253 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----AAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAG--GAGAGGGTATTTGCCTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCGAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTGACTTCATATTCTTATCT-------------------TTGAAATAATAATTAAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTACATAATGTCAAAATGGAATGTAAGTAAGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_pampasense_275274 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGGGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_piurae_310997 ??????????????TAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_polyadenium_161728 ????TGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTCTTTTTTTTTTTTCTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCTATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATTT-------------TTTAATTTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC-CAAAA Solanum_raphanifolium_265862 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_raphanifolium_473369 GTTAGGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_santolallae_195168 ???ATGCATGAACGTAATGCTCCTAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTGATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_scabrifolium_365363 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTATTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_schenckii_275261 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGGTCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_schenckii_498280 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_schenckii_558457 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_sparsipilum_310957 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTT------CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTTAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_spegazzinii_472976 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCC-CCATGCGCGACC-CCC--CAAC Solanum_stoloniferum_251740 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_stoloniferum_283108 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTCTCTTGCTCTGTCAAGAG--TGTTCTTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGCCC-CCC--CAAA Solanum_stoloniferum_558453 ???ATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_subpanduratum_498289 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTATTAT---TAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_tarijense_442689 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_tuberosum_195188 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTTT-CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_tundalomense_473474 ?TTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATAAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_ugentii_546030 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_ugentii_546032 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_vernei_458370 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCGGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_vernei_458371 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCGGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_vernei_473309 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTT-----CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_verrucosum_558488 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATACCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTT----CTTTAT----TAATTTCCTAGTATTCTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_villosum_Bohs150 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAACCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTCTTTTT---CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATAGAAAAAGAAG--GAGAGGGTATTTGCCTGCATTTATT-------CATGATTGAGTATTCGATTTTGATTTTCTAT----TTATTG------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTATTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTGACTTCATATTCTTATCT------CATATTCTTATCTTTGAAATAATAATCGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCCCAAAAA Solanum_violaceimarmoratum_473396 GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTCAAAATGGAATGGAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA Solanum_yungasense_614703 ?????GCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTT--CTTTAT----TAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAAA--GAGAGGGTATTTGCTTGCATTTATT-------CATGATTGAGTATTCGATTTTTATTTTCTAT----TTATTT------AAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAATACAATTTTTACTTCATATTCTTATCT-------------------TTGAAATAATAATCAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGACC-CCC--CAAA ; END; BEGIN SETS; CHARSET gap_601 (CHARACTERS = 'trnH-psbA intergenic spacer') = 630; CHARSET gap_609 (CHARACTERS = 'trnH-psbA intergenic spacer') = 631; CHARSET gap_146_147 (CHARACTERS = 'trnH-psbA intergenic spacer') = 619; CHARSET gap_429_441 (CHARACTERS = 'trnH-psbA intergenic spacer') = 627; CHARSET gap_322_327 (CHARACTERS = 'trnH-psbA intergenic spacer') = 625; CHARSET gap_312_315 (CHARACTERS = 'trnH-psbA intergenic spacer') = 624; CHARSET gap_451_461 (CHARACTERS = 'trnH-psbA intergenic spacer') = 629; CHARSET gap_274_280 (CHARACTERS = 'trnH-psbA intergenic spacer') = 623; CHARSET gap_186_189 (CHARACTERS = 'trnH-psbA intergenic spacer') = 620; CHARSET gap_248 (CHARACTERS = 'trnH-psbA intergenic spacer') = 622; CHARSET gap_429_434 (CHARACTERS = 'trnH-psbA intergenic spacer') = 626; CHARSET gap_247_248 (CHARACTERS = 'trnH-psbA intergenic spacer') = 621; CHARSET gap_429_447 (CHARACTERS = 'trnH-psbA intergenic spacer') = 628; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'trnH-psbA intergenic spacer') = N: 1-631; CODONPOSSET * CodonPositions (CHARACTERS = 'trnH-psbA intergenic spacer') = N: 1-631; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4291] TITLE ITS_data; LINK TAXA = Taxa1; DIMENSIONS NCHAR=883; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Capsicum_pubescens_Anderson1554 ????GG-CCCGCACA-GCAAAACGACCCGCGAA-CGTGTTT---AACAAC-CGGGGA--GTCCGCGCG-GGCGGGGTGCTCCGGCACTCCGC---ACGG-GCGCCTC-CCCCC---CGGCCCC-GG---C--GCGCGCTC-------------CGGGCA---ACCAACAAACCTC-GGCGCGGAAAGCGCCA-AGGATTACTCAAA--TCGATAGCC---TGCCCCTCGCGCCCC-GTCTGCGG--GTTGCTTTGGGGAACCTTTG---CTT-CTTCTT----AAACAAAAACAACTCTCGGCAACGGATATCTCACCTCTCCCATCAATAAAAAAC-CCACCAAAATGCAATACTTGGTTTGAATTGCAAAATCCCGTGAACCATCGAGTCTTTCAACGCAAGTTG{CT}GCCCGAAGCCACTAGGCCGAGTGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCGCATCGCGCCT-----CAATCACGGGACGCGCTGTCGTCGCGGGG----C-GAATACTGGCCTCCCGTGCGCCTC-GAGCTCGCGGCTGGCCTAAACGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAACTCAACTCTCTTCG-TCGTCGCGGCTACG----GCCCGTCGCGCGTCCGGACTTCAGGACCCCTT---CGCGCTC------------AGGCGCTCCCAC-GCGACCCCAGGTCAACACACC--CCAA-AAAACAACACAACACACACAACAAAAAAA--C------AAAAACA-AAACC-CA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAAAAAAAAAAAACAAAAAAAAAAC--CAACCAACAAC-AAAA--CA-A--A-A--ACAA Datura_inoxia_Spooner2989 GCGAGA-CTTGCAAA-GCAGAACGACCCGCGAA-CCTGTTT---AAACACTTAGGGA---GCCGCGCGTGGCGGGGTGCTTCGGCCCTCCTC----CGT-GCGTCTC-CCTCC---CGTCCCC-GG---C--ACGCGCTCGTGTGCGTG--TCTGG-TG---ATTAACGAACCCC-GGCGCGAAAAGCGCCA-AGGAATACTTAAT--TGATAGCCC---GCCTC-TCGCGCCCC-GTCCGCGG--TGCGCGCGGGAGGGCCTGTG---CTT-CTTTTT----AAACAAAAACGACTCTCGGCTACGGATATCTCGGCTCTCGCATCCATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC---GCAC---TCCGCGCCCAAAATCTTGGCCGCGGTTGTGTCGTGGGA----C-GGATATTGGCCTCCCGTGAGCCCCCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGGAACTCAACTCTCGTAA--TGTCGTGGCTACA----ACCCGTCGCTCGTTTGTGCTCCTAGACCCTCA---CGCGCTT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACC--A-CA-AAAAAAA-CCAACACACACAACAAAAAAAAAAAAA-CAACAAACA-AAACC-CA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAC--ACA--AAAAAAAAAAAAAAC--CAAA-CACAAC-AAAA--CA-A--A-A--AAAA Solanum_acaule_310923 TCGAGA-CCTGCAGA-GCAGAACGACGCGCGAA-CCCGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCGGCGCGCTTGCGCGCTCG-TTTTGGGGGCCAAC-AACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCGGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGCGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAGC{CT}ATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT---------CAG---TGAA----------GGCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAAAACACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_acaule_498277 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CCCGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCGGCGCGCTTGCGCGCTCG-TTTTGGGGGCCAAC-AACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCG{AG}CGGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGCGCGGGGGGAGGAACC---CTG-CTCTTT----AAACACGAACAACTCTCCGCAACGGATATCTCGGCTCTC{CG}CCTCGATGAAGAAC-ATAG{AC}GAAATGCGATACTTGGTGTTATTTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT---------CAA---TGAA----------GGCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAAAACACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_acaule_500016 TCGA{AG}A-CCTGCAGA-GCAGAACGACCCGCGAA-CCCGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTAGTATC-GCGCCTC-TCTCT---CGCGCCC-GA---GATGGGCGCTTG{CT}GCGCTCTTTTTTGGGGGG---CCAACAAAACCC-GGCGCGGAGAGCGCCC-CGGAGTATTATAA-TCTACAGCGC---TCTCCCTCTCGCCCC-GTT{CT}TCGG--ATATCGCGGGGGGAGACGCG---CTG-CTCT{CT}T----AAACACGAGAGACACTCTGCGCCAGATATCTCTGCTCTCTCGTCTAT-AAGAAGAGTATCGAGATG{CT}GATACTTGGTGTGTATTGCAGAATCCCGTGAGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT---------CAA---TGAA----------GGCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAAAAAA-CAACCCAA-C--AAAACC-AAAAAAC-CC-ACAAAAAAAAAACAAAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_achacachense_558032 TCGAGC-CCTGCAAAAACAGAACGACCCGCGAA-CACGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTC-CGGCTACA----GCCCGTCGCGCGTCCG-ACTCCCAGACCCTCCTT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAAGTCAACAAACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAACCCAAACAAAAAAAAAAAA-C---AAA Solanum_acroscopicum_365314 TCGAGGGCC-CCACA-GCAAAACGACCCGCGAT-CACGTTTC--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GG---CTT--GCGCAA----GCTGG--TTTGGGG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACCGTGG---CTG-CTCTTT----AAACACAAACTACTCTCGGCAACGGATATCTCGGCTCTCGCATCTATGAAAAAC-GTAGCGAAATGCTATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAATCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTTTGGACTCCTAGACCCTCCCC--GCGCC----GACTAACGAAAGCGCTCCGACCGCGACCCCAGGTCAAACCACAC-ACAA-AAAA-CAAACAACACACACAAAAACAAAACAAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAC-AAAAAAAAAAAAAAAA Solanum_agrimonifolium_243349 TCGAAA-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTTT-AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGGCCCCCTCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACACGCGGCTCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCCTCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAAAACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_agrimonifolium_243351 TCGAAC-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTTT-AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGGGGATCGTTCGGGGGGACGCGCGGCTCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCGGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACAAAAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_agrimonifolium_243351_14 TCGAAA-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTTT-AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGGGGATCGTTCGGGGGGACGCGCGGCTCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACAAAAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_alandiae_498086 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGA--AGCGTGCGGGGGGACCCCCC---CTG-CTCTTT----AAACACAAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-TTAGCAAAATGCAATACTTGGTGTAAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGGTCA------------GCGCGGGG----G-GGAAACTGGCCTCCCGTGCGCCCC-GAGCGCGCGGGTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCCCCT--------ATGCCCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_alandiae_498086.1_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CGTCC---CATCACC-GA---CTTGCGCGCTTG---------TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCCCGTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCAGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGAACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTATA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ATGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAC-A-AAAAAAA-C--AACCCAA-C--ACAAAC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_alandiae_498086.2_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCTCCCC-GTTCGCGG--ATGGTGCGGGGGTACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_alandiae_498088 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-C{AG}CGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGACGCGTG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AAGCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_alandiae_498088_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGTACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_albicans_266381 TCGAGA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-AG---CCT--GCGCAA----GCTCG--TTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCCCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTG{AG}ACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC---GCACCAT---------CAA---TCAA----------GGTGCGGGGGG--C-GGAATCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAACAAAACAAAAA-CAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAC--AAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_ambosinum_498213 TCGAAC-CCTGCAAA-GCAGAACGACCCGCGAAACACGTTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACACT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACAAAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_andreanum_320345 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTTTTAAACACCTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CGTGCGCGCTTGCGCGCTCGTTTTTGGGG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCCTCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACAGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCGACTGA--------GGCGCTCCGACCGCGACCCCAAGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_arnezii_545846 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTTGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TTCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ATGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_avilesii_498091 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCCTCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAA-CTGGCCTCCCGTGCGCCCC-GAACGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCTTGCGTCCGGACTCCCAGACCCTGATTGCCCGCCTGCTTT--------CGCGCTCCAACCGCAACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CACCAAACAAAAAAAAAAAAAAAAA-C---AAA Solanum_berthaultii_498075_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ATGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_berthaultii_498100_7 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCCCGTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAAAC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_berthaultii_545920.1_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCCCGA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACAAACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_berthaultii_545920.2_3 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCGTTTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCCCGTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAAAA-C--AACCCAA-C--ACAAAC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_brevicaule_234009 TCGGGA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCC{AC}-AGGAAT{AG}{AC}T{AT}AAA-TCGG{CT}AGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCG{AC}CCGGGGGGACGCACG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACA-CGCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCTAGTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAACAAAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_bukasovii_210042 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-------------------------------------C-AAGC----CCTCC---CGCCCCC-GA---CGTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCGACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACAG{CT}CC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCAGGGGGACGCGCG---CTG-CTCTTT----AAACTCTAACGACTCTCG{AG}CAACCGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCACATCTTT-----------------------------GCGCGGGGG---C-AGAATCGGGCCTCCTGTGCGCCCA-GAGCGCGCGGGTGGCCTATATGAGACTCCATGTCGACAGATCTCGCGGCATGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCG{CT}G{CT}GTCCAGACTCCCAGACCCTGATT--GCGCCTACTAA--------CGCACTCCGACCGCGACCCCAGGTCAACACACAC-ACAA--C-------C-C-ACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAAAAAAAAAAAC-----A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_bukasovii_210055 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGCTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGC{AG}CCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTTCTTTAAAAACAAATCACTCTCGGCGACAGATATCTCGGCTCTCGCATCGATGAAG{AT}AC-GTAACGA{AC}ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACATCGACGGACGTCGCGGCAAGTGGTGGTTGAACCTCAACTCTCTCTCGTTGTCG{AC}GGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCAACCCCATGTCAACACACAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CAAAACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_bukasovii_442700 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAACGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTT--GCGCCGACTAA--------GGCGCTCCGACCGCAACCCCAGGTCAACACACAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_bulbocastanum_347757 TCGAGG-CCTGCACG-GCAAAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGCCGT-CCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCCCGCGCGCTCG--TCCGGGCG---ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCG{CT}GCGGGGGGACG{CT}GTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CGAGGCGCT------------GCCCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-AAGCGCGCGGCTGGCCTAAATGCAATTCCACTTCAACGGACTTCCCGGCAGGTGGTGGTTGAAACTCAACTCTCTCTTGCTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAAACCCTGACC--GCGCCAGCCGAAA----GCGGCCCTCCAACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA-CAAAAAACA-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_candolleanum_545972 TCGAGG-CCCGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-------------------------------------C-AAGC----CCTCC---CGTCCCC-GA---CGTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGACTCCCGTGACCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACATT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCTCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----ACCCGTCACGCGTCCGGACTCCCAGACCCTCCTT--GGGCCAACTAA--------AGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA--C-------C-C-ACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAAAAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_cardiophyllum_347759 ????????????????GAAAACCCACCCGCTAA-CGCGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCC{CT}-GCGCCTC-CCTCC---CGTCCCC-AG---CGTGCGCGCTCGCGCGCCCG---TTGGGCG---ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGATGTGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTCTCCCCCC--GCAC---GCCG-----CAAGGCGCA------------ACGCGGGGG---C-GGAAACTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCTACAGACGTCTCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGACT--GCGCCCGCTGAAA----GCGGCGCTCCGACCGCGACCCCAGGTC{AT}--AAACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA--CAAAAACA-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_cardiophyllum_595465 TCAAGG-CCCCCACA-GCAGAACAACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CAGCGCGCG-----------------------CTCTTCTT-GCGCCTC-CCCCC---CGTCCCC-GG---TTTGCGCGCTCGCGCGCCCG---TTGGGCA---ACCAAAAAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCTCCCC-GTTCGCGA--ATCTTGCGGGGGGATTCTTTG--CTG-CTCTTT----AAACACGAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCAATGAAAAAC-TTAGCGAAATGCAATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCTCGCGTCCGGACTCCCAAACCCTGACT--GCGCCCGCTGAAA----GCGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA--CAAAAACA-AAACCCAA-C--ACAACC-AAAAAAACCC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_cardiophyllum_Rodriguez_2534 TCGAAA-CCTGCACA-GCAGAACGACCCGCGAA-CGCGTTTCA-AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCTCGCGCGCCCG---TTGGGCG---ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGATGCGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CAAGGCGCA------------CCGCGGGGG---GAGGAAGCTGGCCTCCCGTGCGCCAC-CAGCTCGCGGCTGGCCTAAATGCGAGTCCACTTCGACAGACGTCGCGGC{AT}AGTGGTGGT{AT}GAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----CCCCGTCGCGCGTCC{AG}GACTCCCAGACCCTAACC--GCGCCCGCGTATAA---GCGGCGCTCCGACCGCGACC{AC}CAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA--CAAAAACA-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAACA--AAACAAAAAC---AAC-AAACAAACAAAACAAAAAAAAAAAAAAACAAAA Solanum_chacoense_472809 TCGAGG-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTTGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAACCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GAGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_chacoense_472813_8 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCGTTTTTGGGG-----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GAGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAA-C----AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_chacoense_472821_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCGTTTTTGGGG-----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGACTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAA-C----AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_chacoense_498321_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCGTTTTTGGGG-----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GAGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAAAAAAAA-C----AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_chomatophilum_365339 TCGAGG-CCTGCAGCAGC{AT}TAACGACCCGCGAA-CACGTTTT--A{AG}ACACTTGGGGG--CGG----------------------------------CTC-GCGCCTC-CCTCC---CGTCCCC-GG---CTT{AG}CAC-TAA-----CTCG--TTCGGGG----ACC{AT}{AT}CGAACCCC-GGCGCGGAAAG{CT}GCCA-AGGAATACTGAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--GTCGCGCGGGGGGACACCTT---CTG-CTCTTT----AGGGGGGGACAACTCTCGGCTACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTACAGAATCCCGTAAACCATCGAGTCTTTGAACTCGAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCAAATAA--------GGCGCTCCGACCGCGACCCCAGGTCAACAAACAC-ACAA-AAC------CAACACACACAAAAAAACAA-CAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_circaeifolium_498117 TCGAGG-CCTGCGAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTCGGGGG--CGGCGC------------------------------TCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGT--GCGCAA----GCTCG--TTCGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TTGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGCGCGGGGGGACGCGCG---CTG-GTCTTTT---AAACACAAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAGGCCTCGAGTCTAAGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCAT--GCGCCGACCGA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAC----ACAACACACACAAAAACAAAACAAAAA-CAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CACAACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_circaeifolium_498120 TCGAGG-CCTGCGAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTCGGGGG--CGGGGC------------------------------TCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGC--GCGCAA----GCTCG--TTCGGGGG----CCAACTAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TTGACAGGCCC--TCCCC-TCACGCCCC-GTTCGCGG--AACGCGCGGGGGGACGCGCG---CTA-GTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC{AG}CGTC{AG}CCCCCC--GCACCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCC{AG}TGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCTGATT--GCGCCT------------CGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAC----ACAACACACACAAAAACAAAACAAAAA-CAAAAAA-C--AACCCAAAAC-ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_circaeifolium_545974 TCAAGG-CCTGCGAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTCGGGGG--GGG----------------------------------CGC-GAGCCTC-CCTCC---CGTCCCC-GG---CGC--GCGCAA----GCTCG--CTCGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TTGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGCGCGGGGGGACGCGCG---CTG-GTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCAC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCTGACT--GCGCCT------------CGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAC------CAACACACACAAAAACAAAACAAAAA-CAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_clarum_275202 TCAAGG-CCTGCCTA-GCAAAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CGTGCGCGCTTGCGCGCTCG--TTTGGCG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TTGACGGCCC---TCCCC-TCGCGCCCC-GTCCGCGG--AGCGTGCGGGGGGAAGCGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTAGA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTGAAA----TTGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_clarum_283099 TCGAGA-CCTGCATA-TCAGAA{CT}GACCTGCGAA-CACGTTCTC-ATACACATGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CGTGCGCGCTTGCGCGCTCG--TTTGGCG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TTGACGGCCC---TCCCC-TCGCGCCCC-GTCCGCGG--AGCGTGCGGGGGGAAGCGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTAGA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTGAAA----TTGGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_colombianum_473462 TCGAGG-CCTGCAGA-GCAGAACGACCGGCGAA-CACGTTTT--AAACACTCGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTCCCT--GCGCCGACTGA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_colombianum_498152.1_12 TCGAAA-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_colombianum_498152.2_2 TCGAAA-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GAGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_commersonii_458317 ?????????????AA-GCATAACGACCCGCTAA-CACGTTTTT-AAACACTTGGGGGG-CGACGCGCG-----------------------CCGGTCGC-GCGCCTCACCTCC---CGTCCCC-GG---GCT--GCGCAAGCTCGCTCG-----GGG-----AACAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---ACCCCCT--------------------------GGGGGAACGCGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCA-----------------CGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGTGCGCCCGGACTCCCATACCCTGATTGCGCGCCTCCT----------GGCGCTCCGACCGCGACCC-AGGTCA--ACACAACAAAACAAAA-CAAACAAAACACACAAAAACAAAAAAAAAA---CAC-A-A-AAACCCAA-C--AAAC---AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAA-C-----AC-CAACAAACAAAAAAAAAAAAAA--C-----ACA Solanum_demissum_275211 TCGAAA-CCTGCAGA-GCAGAACTACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-AA---CCTGTGCGCTTG{CT}GCGCTCG-TTTTGGGGGCCAAC-AACGAACCCC-GGCGCGGATAGCGCCAATGAAATACTATAA-TCGACGGCCC---TCCCCCTCGCGCTCC-GTTCGCGG--ATCGCGCGGGGGGATGCGCG---CTG-CTCTTTT---AAAAGAAAACAATTCTCGGAAACGAATATCTCGGCTCTCGCATCAATAAAAAAT--TACCAAATTGCAATACTTGGTGTAAATTGCAGAATCCCGTGAAC-ATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT---------CAA---TCGA----------GGTGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAAACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAAAACACACAA-C--AAAACC-AAAAAAC-CACAA-CAACAAAAA-CAAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_demissum_558482 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGTCCCC-AA---CCGGCGCGCTTGCGCGCTCG-TTTTGGGGGCCAAC-AACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACGGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGCGCGGGGGGATGCCCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAACGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCCTCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT---------CAA---TCAA----------GGTGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAAAACACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAACAA-ACAAAA-CAAAACCAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_diploconos_Bohs_445 T-----------ACA-AAATACCGACCCGCGAA-CACGTTC---AAACAC-CGGGGG----GCGTGCG-GCGGGGGTGCTTCGGCGCCCCTT---ACGA-ACGTCTC-CCTCC---CGTCCGC-GA---C--GCGCGCTCGCGCGCTCG-TTTCGGGCG---ACTAACAAACCCC-GGCGCGAAAAGCGCCA-AGGAATACTTAAC--GGACAGCCC---GTCCC-TCGCGCCCC-GTCCGCGG--AGCGCGCGGGGG-ATTCGTG---CTT-CTTTCG----AAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATA-CGTCGCCCCCC--GCAC---GCCG-----CGCTGCG--------------TCGTGGGG----C-GGATACTGGCCTCCCGTGCGCCTC-GAGCTCGCGGCTGGCCTAAACGCGAGTCTACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAACTCAACTCTCTTGG--TGTCGTGGCTACA----GCCCGTCGCGCGTCCGGACTCCCCGACCCTCAT--CGCGCTC------------AGGCGCTCCGACCGCGACCCCAGGTCAC--CACC--C--C-AAAACAACACAACACACACAACAAAAAAAAAAAAACAAAAAAACA-AAACC-CA-C--ACAACC-CAAAAAC-CC-AACAAAAAACAA-CACA--AAACAAACA----AC--CAAC-CACAAACAAAA--CA-A--A-A--AAAA Solanum_doddsii_Spooner_et_al._6651 TCGAGA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCATGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAACGCGCGGCTGGCCTAAATACGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------ACGCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_dulcamara_Spooner2988 TCGAA{AG}-CCTGCACG-GCAGAACGACCCGCGAA-CACGTTCT--AAACAC-CGGGGG--AGGCGCGCG-ACGGGGGTGCTCCGGATGCCCCCTCCGCCTCGCGTCTC-TCCCC-----TCCCC-TA---C---GGCGCAAGC-------TTTTCGGGCT---ACAAACGAACCCC-GGCGCGGAAAGCGCCC-AAGAATACTGAAC--TGA-AGGCC--TTCCCCCTCGCACCCC-TTCCGCGT--ATCGCGCGGGGGGGAAA--TTTTCTT-CTTTCG----AAACAAATTCCACTCTCCGCAACGGATCTCTCGGCTCTCGCATCCATAAACAAC-ATTGCGAAATGGAATCCTTGGTGTGAATCGCATAATCCCGTTAACCCTCTACTCTTTCAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCAC{AG}CATCGCGTCGCCCCCC--GCAC---GCCT-----CAGGGCG--------------TCGTGGGG----C-GGATACTGGCCTCCC{AG}TGCGCCTC-GAGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCTCTT-CCGTCTCGGCCACA----GCCCGTCGCGCGCTGGGGCTCCCAGACCCTTTTTTCGCGCCT---TACTTA----AGCGCTCCGACCGCGACCCCAGGTCAACACACAC-CCAA-AAAACAAAAAAACA-CCACAA-CAAAAAAAAAACAAAAAAAAACA-AAACC-CCCAAAAAAACC-AAAC-AAACC-AACAAAAAAAAA-CACA--AAACAAACA----AC--CAACCAACAAAAAAAACAAAAAAAAAAAACAAA Solanum_ehrenbergii_595480 TCGAGGGCC-GCACA-GCAAAACGACCCGCTAA-CGCGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCC{CT}-GCGCCTC-CCTCC---CGTCCCC-AG---CGTGCGCGCTCGCGCGCCCG---TTGGGCG---ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGATGTGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------ACGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGACT--GCGCCCGCTGAAA----GCGGCGCTCCGACCGCGACCCCAGGTC{AT}AACCACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA--CAAAAACA-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_etuberosum_498311 TCGAAC-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTCGGGGG--AGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CATCCCC-GG---CCTGCGCGCCCGCGTGCTCG---TCGGGCG---{AG}CCAACGAACCCC-GGCGCGGAAATTGCCA-AGGAATACTAAAA-TTGACAGCCC---TCACCCCCGCGCCCC-CCTCCAGAG-{AT}GTGTGTGGGGGGATGGGCG---TTG-CTCTTT----AAACACAAAAAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGTGATACTTGGTGTGAATTACAGAATCTCGTGACCCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGGCCCCT--ACAC---GCCG-----CAAGGCATCA------------CGTGGGG----A-GGAAGCTGGCCTCCCATGCGCCCC-GAGCGCACGGCTGGCCTAAATGCGAGTCCACGTCGACGGATGTCGCGGCAAGTGGTGGTCGAAACTCAACTCTCTGTTGTTGTCGCGGCTACA----GCCCGTTATGCGTCCGGACTCCTGGACCCTGATT--GCACCGACTAACTAA----GGCGCTTCGACCGCGTCCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA--CAAAAACA-AAACCCAA-C--AAAACACAAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAA---CC--CAACAAACAAAACAAAAAAAAAAAAAAAACAAA Solanum_guerreroense_161730 TCGAGGCCCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--GAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGGAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAAAACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_hougasii_161174 TCGAGG-CCCCCAAAAGCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-------------TCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGAC--TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACAAACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--A-CA-C-AAAAAAC-CC-AACAAA-CAAAACAACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_hougasii_161727 TCGAGGACCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--GAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCACG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAAC-ATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAAAACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAACAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_immite_458401 TCGAGG-CCTGCACA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGGG-CGC----------------------------------CGC-GCGCCTC-CCTCC---CGTCCCC-GG---CCT--GCGCAA----ACTCG--CTTGGGG----ACCAACGAACCCCCGGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGTG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCAGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCG------------TCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTCCCT--GCGCCGATCGA--------AGCGCTCCGACCGCGACCCCAGGTCAACACACAC-AAAACAAC------CAACACACACAAAAACAAAACAAAAA-CAAAACA-A-AAAACCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAAAAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_incamayoense_473060 TCGAGG-CCTGCAAA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAGA-TCGGCAGCCC---TCCC--TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAAACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--C-AACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_infundibuliforme_472857 TCGAGG-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTTT-AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAAAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAAAAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_iopetalum_275183 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGGAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCATGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCAGCCACGGATATCTCGGCTCTCGCATCGATGAAGAAC-ATAACGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGGTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTTAATGCTAGTCCGCGT{CT}GACGGACGT{CT}GCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCC{CT}GTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_jamesii_458424 TCGAAC-CCTGCACA-GCAGAACGACCCGCGAA-CGCGTTTC--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-AAAGGGGCGCGCGCAAGCGCGCTCG-TTTTGGCG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCCC--TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGATGCGTG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCAC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAGGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCTCACC--GCGCCTGATAAATAAAGACGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACAAAAAAAAAAAAAAAAAACAAAAACA-A-AAACCCAAAAC-ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAAAAAAAAAA Solanum_kurtzianum_472923 TCGAGG-CCTGCAAA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCCTCTCGTCCAC-GA---GTTGCGCGCTTGCCCGCTCG-TTTTGGGGG----CCAACCAACCCC-GGGGCGGAAAGCGCCG-AAGAATACTATAA-TCGGCAGCCC---TCCCC-TCGCGCCTC-GTTCGATG--ATC{CG}TGCGGGGGGACCCCCG---CTC-CTCTTT----AAACACAAACTACTCTCGGCAAATGATATCTCTGC?????????????????????????????????????????????????GCAGAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGC-CCT------------AAGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACAAACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-A-----AAAAAACAACA--AAACAAAAAC---AAC-CAAAAAACAAAAAACA--CA-A--A-A--AAAA Solanum_laxissimum_283088 TCGAGG-ACTGCATA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGG----------------------------------CTT-GCGCCTC-CCTCC---CGTCCCCCGA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGGGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------AGCGCTCCGAACGCGACCCCAGGTCAACACACAC-ACAA-AAC------CAACACAAACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_leptophyes_442670 TCGAGG-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCCAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-CAGCGCGCGGCTGGCCTAAATGCGAGTCCACATCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCCCAACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAA-C------A----AAACCAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_442670.1_7 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-CAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAA-C------A----AAACCAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_442670.2_1 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTTT-AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_458378 TCGAGG-CCTGCAAA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCTT-CCGCCGC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCG-G---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCAACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAACAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_458378.1_4 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCGC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_458378.2_1 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCGC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGC---------------TCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-CACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_545986_6 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCGC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT--------GCGCGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_545989.1_4 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCCCGTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAAAC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_leptophyes_545989.2_2 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_leptophyes_545993_7 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_lignicaule_473351 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTTT-----------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTT--GCGCCGACCGA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAAAAC-----A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_longiconicum_186568 TCGAGGCCCCGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCG--GCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCACAATCCCGTGA-CCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGGCGGC-GGAAACTGGCTTCCCGTGCGCCCC-TAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCCCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAAAACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAA-CAACC-AACAACAAAAAA-CAAAAA-C------A----AAAACAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_lycopersicoides_LA1964 TCGAGC-CCTGCATA-ACAGAACGACCCTCGAA-CACGTTTT--AAACAC-TGGGGG--GGGCGCTCG-----------------------CTCCCCCT-GCGCCTC-CCTCC---CTTCG{CT}CCAA---CGCCCGC-CAAGC-------ACTTCGGGCG---ACCTTCGAACCCC-TGCACGGAAATCTCCG-AGGAATACTAAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ACCGTGCGTGGGGACGCTCG---CTG-CTCTTT----AAACTCAAACTACTCTCCGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-ATAGCGAAATGCGATACTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CAGGGCGAT------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTTTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCTGACCCTCACT--GCGCCTTTC--------GAGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-CCAA-AAAA-CAAACAACACAAACAAAAAAACAAAAAACAAAAAAAAACA-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAACAA-A--AAAA Solanum_lycopersicum TCGAAA-CCTGCACA-GCAGAACGACCCGCGAA-CTCGTTTT--AAACAC-CGGGGG--CGGCGCTCG-----------------------CTCGTCGC-GCGCCTC-CCC-----CGTCGCCCGA------GGGCGCAAGC-------TCTTCGGGCG---ACCAACCGACCCC-GGCGCGGAAAGCGCCA-AGGAATACTACAA-TCGACAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTGT----TAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACG-ATCGCGTCGCCCCCT-CGCAC---GCCG-----CAAGGCTTTA-----------GCGCGGGGG---C--GAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCCGACCCTCACC--GCGCCTCAC--------CAGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-CCAA-AAAA-CAAACAACC-AAA--C-AAAAAAAAAAACAAAAAAAAACA-AAACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAACAAACAACA--AAACAAAAAA--CAAC--CACAAACAAAACAAAAAAAAACAA-A--AAAA Solanum_marinasense_458380 TCGAGG-CCCGCAAA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCCCAATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACATT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAACTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCGAT----------GGGCGCCCCGACCGCGACCCCAGGTCAACACACAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAAAAAACAAAACAAAAAAACA--A-A--AAAA Solanum_megistacrolobum_545927.1_3 TCGAAA-CCTGCAAAAGCAGAACGACCCGCGAA-CCCGTTTTA-AAACACTCGGGGG--CGGCGCGCG-----------------------CTCATCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCGT---------CAAG-----------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGCCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTT--GCGCCT--------GCACAGGCGCTCCGACCGCGACCCCAGGTCAACAAACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAACAA-AAC-A----AAACCAACAAACAAAACAAA-CAAAAAAAAAAAAAAA Solanum_megistacrolobum_545927.2_3 TCGAAA-CCTGCAAAAGCAGAACGACCCGCGAA-CCCGTTTTA-AAACACTCGGGGG--CGGCGCGCG-----------------------CTCATCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCGT---------CAAG-----------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTTGCGC-CAA-------------GGCGCTCCGACCGCGACCCCAGGTCAACAAACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAACAA-AAC-A----AAACCAACAAACAAAAAACA---C-A--------AAA Solanum_microdontum_458355_6 TCGAAA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_microdontum_473167_8 TCGAAA-CCTGCACA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--AGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_microdontum_500036 TCGAGA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TTGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCACCGGATATCTCGGCTCTCGCATCGATGAAGAAC-GT{AT}GCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ACGTGTGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_microdontum_500036.1_5 TCGAAA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGACC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGATGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ACGTGTGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_microdontum_500036.2_3 TCGAAA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGACC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGATGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_microdontum_500040 TCGAGA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGACC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGATGCACG---CTG-CTCTTT----AAACACAAACGACTCTCGGCACCGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAACGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCG------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATACGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGG{AC}TACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GC{AG}CCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_microdontum_500040_6 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCAC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_morelliforme_275218 ????????????????GCAAAACGACC-GCGAA-CACGTTTC--AAACACATGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-{AG}G---CGTGCGCGCTTGCGCGCTCG--TTCGGGG----ACCAACGAACCCC-GGAGCGGAAAGCGCCA-AGGAATACTACAA-TTGACGGCCC---TCCCC-TCGCGCCCC-GTCCGCGG--AATGTGTGGGGGGACTCGCG---CTG-GTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAGGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----TCCCGTCGTGCGTCCGGACTCCCAGACCCTGACT--GCGGCCGCTGAAA----GCGG{AG}GCTCCGACCGCGACCCCAGGTCA--AACCAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_multiinterruptum_365336 TCGAGA-CC{CT}GCAAA-GCAAAACGACCCGCGAA-ACCGTTTC--AAACACTCGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GG---CTT--GCGCAA----GCTGG--TTTGGGG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGTG---CTG-CTCTTT----AGACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAATCTGGCCTCCCGTGCGCCCC-GAACGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGT{AT}GTCGCGGCTACA----GCCCGTCACGCGTTTGGACTCCCAGACCCTCCCT--GCGTC----GACTAACTGAAGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAACAAAACAAAAA-CAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAC-AAAAAAAAAAAAAAAA Solanum_okadae_498065 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAA{AG}-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCCTGCGGGGGGACGCGCG---CTGACTCTTT----AAACACAAACGACTCTCGGCTACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATACGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGATACA----GCCCGTCGTGCGTCCGGACTCC{AC}AGACCCTGATTGCACGCCT--------TCGTTCGCGCTCCGACCACAACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-AC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_oplocense_435079 TCGAAG-CCTGCAAA-GCAAAACGACCCGCGAA-CACGTTT---AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACC--ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAA-C------A----AAACCAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_oplocense_473365 TCGAGG-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCTCC-GTTCGCGG--ATCCTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAAAAC-GTTTCGAAATGCGATACTTGGTGT-AATTGCAGAATCCCGTGGGCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCTACAGACATCTCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCTTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------ATGTGCGCGCTCCGAACGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACACAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_oxycarpum_498026 TCGAGG-CCTGCAGA-GCAGAACGACCTGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGAGGGG---CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACT{AG}AAA-TCGGCAGGCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCGGCTCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCCT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGT{GT}GAAGCTCGGCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCACGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTAA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAA-CAACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_palustre_558233 TC{AG}AGG-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTCGGGGG--{CT}GACGCGCA-----------------------CTCGTCGT-GCGCCTC-CCTCC---CATCCCC-GG---GTTGCGCTCTCGTGCGCTCG-TTCTGGGAG---ACCATTTAACCT--GGCGCTAAAGTCGCCA-AGGAATACTGGAA-TTGACAGCCC---TCTCC-CCGCGCCCC-ACACCTGG--AATTCGTGGGGTGGGACGCTTCGCTG-CTCTTT----AAACACGAACGACTCTCGGCAAAGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGTGATACTTGGTGTGAATTGCAGAAT{CT}CCGTGAACCATTGAGTTTTTGAAAGCAAGTTGGGCCCGAAGCCAATAGGCCG{AG}{AG}GGGAAGTTTGCCTGGGGGTTAAGGATTGGGTTGCCCCCC-CGGAA------------CATTAAAGAA---------GGGCGCGGGGGG--CGG{AG}AAGCTGGCCTCCCGTGCGCCCCGGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAGCTCTCTCTTGTTGTCGCGGCTACCTACAGCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCTGCTAA--------GGCGCTCCGACCGCGACCCC??????ACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAACA-AAC-CCAA-C--ACAACC-AAAAAAAACC-AACAAAAAAAAACAA-C---AA-AAAAAACAAAAACAAAAAAAAAAAACAAAAAAAAAAAA-C---AA- Solanum_palustre_558253 ????AA-CCTGCAAA-GCAGAACGACCC{AG}CGAA-CACGTTTT--AAACACTC{AG}GGGG--{CT}GACGCGCG-----------------------CTCGTC{AG}C-GCGCCTCCCATCC---CATCCCC-GG---CTTGC{AT}CTCTCGCGCGCTCA---TCGGGGAG--ACCAAATTACACT-{AG}GCGCGGAAGTCACCA-AGGAATACTAAAA-TTGACAGCCC---TCACC-CCGCGCCCC-ATCTGTGG--AATTCGTGGGTGGAC---ATTCACTG-CTCTTT----AAACACAAACGACTCTCAGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GC-----GCCTC-------------------------GCGCGGGGG---CGGGAAGCTGGCTTCCCGTGCGCCCCGGAGCGCGCGGCTGGCC{AT}AAATGCGAGTCCGCGTCGACG{AG}ACGTCGCGGCAAGTGGTGGTTGAAACTCAACTTTCTTTGGTTGTCGCGGAAACG----GCCCGTCGCGCGTCCGGATTCCCGGACCCTCACC--GCGCTTCTT---------GGGCGCTCCGACCGCGACCCC??????ACACACAC-ACAA-AAAA-CAAACAAAACACACAAAAAAAAAAAAAAAA--CAAAAAAACAAACCCAA-C--ACAACC-AACAAAAACC-AACAAAAAAAAA-CC-A--AAAAC---A----AAC-AAAAAAACAAAACAAAAAAAAA-CA-A--AAA- Solanum_pampasense_275274 TCGAG{AG}-CCTGCATA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGGG-CG-----------------------------------CTT-GCGCGTC-CCTCC---CGTCCCC-GA---CGTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCACCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACATT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCCCGAACGCGCGGCTGGCCTAAATGCGAGTCC{AG}CATCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTC{AG}GCTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCTT--GCGCCGA{CG}TAA--------CGCGCTCCGACAGCGACCCCAGGTCAACACACAC-AAAACCA-------CAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAAAAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_piurae_310997 TCGAGG-CC{CT}GCATA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CTTGCGCG-A-----GCTCG--TTCGGGG----ACCAACGAACCCC-GGCGCGGAAAGCGCCAGAGGAATACTGAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGTG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GT{AT}GCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CGAGGCGCA------------GCGCGGGG----C-GGAAACTGGCCTCCCGTGCGCCCC-GAACGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCGACTCTCTCTTGTTATCGCGGCTACA----GCCCGTCGCGCGTCCAGACTCCCAGACCCTCCCT--GCGCCGAACGA--------AGCACTCCAACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAACC-AAAAA-CAAAACA-A-AAACACAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_polyadenium_161728 ????????CTGCACA-ACAGAACGACCCGCGAA-CACGTTTT--AAACACCGGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTTCCC-AA----ACGCGCGCTTGCGCGCTCGTTTTTGGGG----ACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-CTGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTATCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTGACT--GCGCCCGCTTCGA----ACGGCGCTCCGACCGCGACCCCAGGTCA--ACACAC-ACAA-AAAA-CAAACAACACACA-CAAAAAAAAAAAAAAAAAAAAACA-A-AAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAAAAC-AAAA Solanum_raphanifolium_265862 TCGAG{AG}-CCTGCAAAAGCAGAACGACCCGCGAA-CACGTTTC--AAACACTTGGGGGG-CG-----------------------------------CTT-GCGCGTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCACGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTA-CTCTTT----AAACACAAACGACTCTCAGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GT{AT}GCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCGCCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAACCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTTA--------AGCGCTCCGACCGCGACCCCAGGTCAACAAACAC-AAAACCA-------CAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_raphanifolium_473369 TCGAGG-CCTGCAAAAGCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGGG-CG-----------------------------------CTT-GCGCGTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GC{AG}CCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAACCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTTA------TGCGCGCTC{AC}GAGCGAGACCCCC-----ACAAACAC-AAAACCA-------CAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAACA--AAAC Solanum_santolallae_195168 TCGAGG-CCTGCATA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTGGTCGC-GCGCCTC-CCTCC---CGTCCCCCGA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGACAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CCCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGGGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGATACTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCCCT--GCGCCGACTGA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACAAACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_scabrifolium_365363 TCGAGA-CC{CT}GCACA-GCAAAACGACCCGCGAA-CCCGTTTT--AAACACTCGGGGGG-CGGCGCGCG-----------------------CTCGTCTC-GCGCCTC-CCTCC---CGTCCCC-AA---CTTG-------------------TTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGACGGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CCG-CTCTTT----AAACAGGGACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAATCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTC{AG}GCTCTCTCTTGTTGTCGCGGCTACA----GCCCATCGTGCGTCCGGACTCCCGGACCCTGATT--GCGCCGAATGA--------AGCGCTCCGACCGCGACCCCAGGTCAACACACAC-AAAACAAAA-CAAACAACACACACAAAAAAC-----A------AAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_schenckii_275261 TCGAGA-CCTGCAGA-GCAAAACGACCCGCGAA-CACGTTTTTTAAACACTTGGGGG--CGACGCGCG-----------------------CTCGACGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCTCGCGCGCTCG-TTTTGGGGG----CCAACCAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAGA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCATGCGGGGGGACGCTCG---CTG-CTCTTT----AATCACGAACAACTCTCGGCAACGGATATCT{CT}GGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGATTTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCCTCGTGCGTCCGGACTCCCAAACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAAGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_schenckii_498280 TCGAGG-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTTTTAAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCTCGCGC{AG}CTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGA{AG}TACTAAG{AG}-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCGACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGAT{AG}CTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTC{AG}CCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACTTCGACGGACGTCACGGCAAGTGGTGGTTGAAGGTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAAACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCAACCCCAGGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_schenckii_558456.1_1 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTTTTAAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCTCGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTC--------CGCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAACA-AACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_schenckii_558456.2_18 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTTTTAAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGTCCCC-GG---CGTGCGCGCTCGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_schenckii_558457 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTCTTAAAC{AT}CTTGGGGG--{AC}GACGCGCG-----------------------CT{CT}GTCGC-GCGCCTC-{CT}CTCC---TGTCCTC-GG---CGTGCGCTCTCGCGCTCT{CT}T-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGAAGGCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCTTGCGGGGGGAGACGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCGACGGATATCTCGGCTCTCGCGTCGATGAAGAAC-GTATCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAGCCCCCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CATGGCT{CG}{AT}------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGATTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAAGTCAACACACAAAACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_sparsipilum_310957 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCGC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCA-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACT{AG}AAA-TCGGCAGGCCC--TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAATCTGGCCTCCCGTGCGCCCCCGAACGCACGGCTGGCCTAAATGCAAGTCCAGATCAACGGACGTCGCGGCAATTGGTGGTTGAAGCTCAACTCTCACTTGTTGTCGCGACTACA----GCCCGTCGTGCGTCCGGACTCACAGACCCTGACTGCGCTCCT------------GCGCGCTCCGACCACGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAC-AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAAAAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_spegazzinii_472976 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGTGCCCC-CTTCCCCG--AACCTTCGGGGGG{AG}-ACACC---C{CT}T-CTC{CT}TT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCCTCGATGAAGAAC-TTAGCAAAATGCAATACTTGGTTTGAATTGCAGAATCCCCTGAACCATCGAGTCT{GT}TGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGA{AG}GGCACGTCTGCCTGGGCGTCACGCATCGCGTC{AG}CCCCCC--GCAC---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCAGCTGGCCTAAATACGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-ACAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_spegazzinii_473214.1_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_stoloniferum_251740 TCGAGA-CCTGCAGA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCAGCAGCCC---TCCCC-TCGCGCCCC-GTCCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTC{AG}CCCCCC--GCAA---GCCG-----CAAAGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCAGCTGGCCTAAATACGAGTCCACGTCAACAGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCCGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_stoloniferum_283108 TCGAAA-CCTGCACT-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCACCCCCC--GCAA---GCCG-----CAAGGCTC{AG}------------GCTCGGGG----C-AGAAGCTGGCCTCC{CT}GTGCGCCGC-GAGCGCGCGGCTGGCCTAAATACGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTATTGTTGTCGCGGATACA----GTCCGTCGTGCGTCCGGACTCCAGGACCCCGATT--GCACCT------------GCGCGCTCCTACCGCGACCGCGAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_stoloniferum_558453 ??????????GCAAA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACAAACCCC-GGCGCGGAAAGCCCCA-AGGAATACTAAAT-TCAGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCTTGCGGGGGGACTCTCG---CTG-CTCTTT----AAACCCGAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC{AG}CGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----{CT}-GGAAG{AC}TGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATG{CT}GAGTCCACGTCGACG{AG}ACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCA--ACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_stoloniferum_558453_10 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CGCGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCGGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_subpanduratum_498289 TCGGAA-CCTGCAGA-ACAGAACGACCGGCGAA-CACGTTTT--AAACACTCGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCGGACCCTCCCT--GCGCCGACTGA--------GGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_tarijense_442689 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTTCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCGC-GAGCGCGCGGCTGGCCTAAATGCGAATCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCGGGTCTCTCTTGTTGTCGCAGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCCCCC--------ATGCGCGCACTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_tuberosum_195188 TCGAAC-CCTGCAAA-ACAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG-----------------------------------CTT-GCGC----CCTCC---CGTCCCC-GACGACTTGCGCGCTTGCGCGCTCG-TTTTTGGGGCCAACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGCCCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCACCCCCC--GCACATT------------------------------GCG{AC}GGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCACGGCTGGCCTAAATGCGAGTCCACATCAACCGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACC----GCCCGTCGCGCGTCCGGACTCCCAGACCCTGATT--GCGCCA------------TGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-CA-------C-C-ACACAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_tundalomense_473474 TCGAGG-CCTGCAGA-GCAAAACGACCTGCTAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTTCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGGCCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCACCTT------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGATACA----GCCCGTCGCGCGTCCGGATTCCCAGACCCTCCTT--GCGCCGAGTAA--------GGCGCTCCGACGGCGACCCTATGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAAAAAAAAAAA-C---AAA Solanum_ugentii_546030 TCGAGG-ACTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG{AG}CGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-CTTCGCGG--ATCGTTCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTTGCGAAATGCGATACTTGGTGTTAATTGCAGAATCCCGTGAGCCCTCGAGTCTAAGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGAGGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----G{CG}CCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCC-AGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAAAAAAAAA-C------A----AAACCAACAAACAAAAAAAA-CAAAAAAAAAAAAACA Solanum_ugentii_546030.1_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCCCGTTCGCGG--AGCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAAAC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_ugentii_546030.2_3 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAA-C------A----AAACCAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_ugentii_546032 TCGAGA-CCTGCAAA-GCAAAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAACGGGGG------------GCGCAGGGG---C-GGAACCTGGCCTCCCGTACGCCCC-GAGCGCGCGGCTGGCCTATATGCGAGTCCACGTCTACGGACATCTCGGCAAGTAGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTACGTCCGGACTCCCAGACCCTGATTGCGCTCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_ugentii_546032_6 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CGTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATGGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCACCTT------------------------------GCGCGGGGGG--C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAAAAAA-C------A----AAACCAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_vernei_458370 TCGAGG-ACTGCAAA-GCAAAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCCCCCCCC-GTTCGCCG--ATCCTTCGGGGGGAACCCCC---CTG-CTCTTT----AAACACAAACGACTCTCCGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCG------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCA{CT}GT{AC}GACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCC{AT}GATTGCGCGCCT--------CCGTGCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_vernei_458370.1_3 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CGAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCAC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_vernei_458370.2_3 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGGCGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_vernei_458371 TCGAGG-ACTGCAAA-GCAAAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAGCCCCCGAGTCTAAGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CGAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCAC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCTAG------------GCGCTCCGACCGCGACCCCAAGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAACAAAAAAA-C--------AAA Solanum_vernei_458371_6 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCCCTCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CGAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCAC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--AAAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_vernei_473309 TCGAGA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGC{AG}GCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CAAGGCTCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCCCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_vernei_473309_5 TCGAAA-CCTGCAAA-GCAGCACGACCCGCGAA-CACGTTTA--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGAAGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CAAGGCTCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCCCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_vernei_473310.1_4 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGGGGCGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCCTCCCGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ACCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-CGCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-AAAAAAAAA-CAAACAACAAACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAACAACA--AAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_vernei_473310.2_3 TCGAAA-CCTGCATA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGGGGCGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCCTCCCGTCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ACCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAAC--GCCG-----CAAGGCTCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCCCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACG----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGACTGCGCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-AAAAAAAAA-CAAACAACAAACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CAAA-CAAACAAAAAC---AAC-CAACAAACAAAAAAAA--CA-A--A-A--AAAA Solanum_vernei_500062_5 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTAA-AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGC-GCGCCTC-CCTCC---CGCCCCC-GA---CCTGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGACC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCGCA------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------AGGCGCTCCGACCGCGACCCCAGGTCAACACACAACACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AAC-CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_verrucosum_558488 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGACGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGTCCCC-GA---CGAGCGCGCTTGCGCGCTCG-TTTTGGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAA-TCGGCAGCCC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAA---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATT--GCGCCT------------GCGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAACAAA--CA-A--A-A--AAAA Solanum_villosum_Bohs_150 TCGAGG-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTC--AAACAC-CGGGGG--AGCCGCGCG-GCGTGGGTGCTTCGGCGTCCC--TCCGCGT-GCGT-TC-CCCCT---CGTCCCC-GG---C--------TCGT---------TCCGGGCG---ACTAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTTAAA-TTGAGAGGCCC--TCCCC-TCGCGCCCC-GTCCGCGG--AGTGTGTGGGGGGATACGCG---CTT-CTTTTG----AAACCAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCAC{AG}CATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCG--------------TCGTGGGG----CGGAATACTGGCCTCCCGTGCGCCTAGAACCTCGCGGCTGGCCTAAATGCAATTCCACTTCAACGGACTTCCCGGCAATTGGTGGTTGAAACTCAACTCTCTTTT--TTTCGCGGCTACG----AACCGTCGCCCTTCTGGACTCC-GAACCCTCTTA-----------CTCTTA----GGCTCTCCAACCGCAACCCCAGGTCAACACACAC-CCAA-AAAACACAACCACACACACAA--C-A--AAAAA-C--AAAAAACA-AAACCCAAAAC-ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAACA----AC--AAAA-CACACAA-C---AAAAAAAAAAAACAAA Solanum_violaceimarmoratum_473396 TCGAAA-CCTGCAGA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTGGTCGC-GCGCCTC-CCTCC---CGTCCCC-GA---CTGGCGCGCTTGCGCGCTCG-TTTTGGGGGCCAACCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTAAAAATCGGCAGCCCCC-TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCGGCGCTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCGCCTC------------------------------GCGCGGGGG---C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAGCTCAACTCTCTCTCGTTGTCGCGGCTACA----GCCCGTCGCGCGTCCGGACTCCCAGACCCTCTTT--GCGCCT--------TAGTCGGCGCTCCGACCGCGACCCCAGGTCAACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAAAAAAAACCAAAAAACACAACC-AAAAAAAACC-AACAAAAAAAAA-CAAAAA-C------A----AAC-CAACAAACAAAACAAA-CAAAAAAAAAAAAAAA Solanum_yungasense_614703 TCGAAA-CCTGCAAA-GCAGAACGACCCGCGAA-CACGTTTT--AAACACTTGGGGG--CG{AG}CGCGCG-----------------------CTCGTCGT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTTGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGACC---TCCCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------{AG}TGCGCGCGCTCCGACCGCGAC{CT}CCAGGTC{AG}ACACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA Solanum_yungasense_Spooner_et_al._6738 ??????????GCAAA-GAAAAACGACCCGCTAA-CACGTTTT--AAACACTTGGGGG--CGGCGCGCG-----------------------CTCGTCCT-GCGCCTC-CCTCC---CGCCCCC-GA---CTTGCGCGCTTGCGCGCTCG-TTTTTGGGG----CCAACGAACCCC-GGCGCGGAAAGCGCCA-AGGAATACTGAAA-TCGGCAGCCC---T{CT}CCC-TCGCGCCCC-GTTCGCGG--ATCGTGCGGGGGGACGCGCG---CTG-CTCTTT----AAACTCTAACGACTCTCGGCATCGGATATCTCGGCTCTCGCATCGATGAAGAAC-GTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCGAGTTGCGCCCGAAGCCATTAGGCCGAAGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCAC---GCCG-----CAAGGCTCA------------GCGCGGGG----C-GGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACA----GCCCGTCGTGCGTCCGGACTCCCAGACCCTGATTGCGCGCCT--------GTGCGCGCGCTCCGACCGCGACCCCAGGTC{AT}--ACACAC-ACAA-AAAA-CAAACAACACACACAAAAAAAAAAAAAAAACAAAAAAA-C--AACCCAA-C--ACAACC-AAAAAAC-CC-AACAAAAAAAAA-CACA--AAACAAAAAC---AC--CAACAAACAAAAAAAA-CAAAAAAAAAAAAAAA ; END; BEGIN SETS; CHARSET gap_552_556 (CHARACTERS = ITS_data) = 829; CHARSET gap_123 (CHARACTERS = ITS_data) = 733; CHARSET gap_347_348 (CHARACTERS = ITS_data) = 811; CHARSET gap_343_344 (CHARACTERS = ITS_data) = 807; CHARSET gap_704_705 (CHARACTERS = ITS_data) = 856; CHARSET gap_554_565 (CHARACTERS = ITS_data) = 833; CHARSET gap_463 (CHARACTERS = ITS_data) = 821; CHARSET gap_340 (CHARACTERS = ITS_data) = 805; CHARSET gap_210_212 (CHARACTERS = ITS_data) = 761; CHARSET gap_765_772 (CHARACTERS = ITS_data) = 868; CHARSET gap_203 (CHARACTERS = ITS_data) = 755; CHARSET gap_764_767 (CHARACTERS = ITS_data) = 866; CHARSET gap_229_233 (CHARACTERS = ITS_data) = 777; CHARSET gap_172_174 (CHARACTERS = ITS_data) = 746; CHARSET gap_755_757 (CHARACTERS = ITS_data) = 861; CHARSET gap_768_777 (CHARACTERS = ITS_data) = 875; CHARSET gap_417 (CHARACTERS = ITS_data) = 817; CHARSET gap_170_171 (CHARACTERS = ITS_data) = 745; CHARSET gap_239_241 (CHARACTERS = ITS_data) = 782; CHARSET gap_325 (CHARACTERS = ITS_data) = 803; CHARSET gap_272 (CHARACTERS = ITS_data) = 789; CHARSET gap_536 (CHARACTERS = ITS_data) = 824; CHARSET gap_704 (CHARACTERS = ITS_data) = 855; CHARSET gap_137_139 (CHARACTERS = ITS_data) = 736; CHARSET gap_344_345 (CHARACTERS = ITS_data) = 808; CHARSET gap_142_175 (CHARACTERS = ITS_data) = 741; CHARSET gap_315 (CHARACTERS = ITS_data) = 801; CHARSET gap_576_587 (CHARACTERS = ITS_data) = 847; CHARSET gap_541_548 (CHARACTERS = ITS_data) = 825; CHARSET gap_145_174 (CHARACTERS = ITS_data) = 742; CHARSET gap_558_586 (CHARACTERS = ITS_data) = 836; CHARSET gap_625 (CHARACTERS = ITS_data) = 854; CHARSET gap_548 (CHARACTERS = ITS_data) = 827; CHARSET gap_576_586 (CHARACTERS = ITS_data) = 846; CHARSET gap_229_231 (CHARACTERS = ITS_data) = 776; CHARSET gap_240_242 (CHARACTERS = ITS_data) = 785; CHARSET gap_761 (CHARACTERS = ITS_data) = 865; CHARSET gap_767_778 (CHARACTERS = ITS_data) = 872; CHARSET gap_130 (CHARACTERS = ITS_data) = 734; CHARSET gap_570_586 (CHARACTERS = ITS_data) = 840; CHARSET gap_179 (CHARACTERS = ITS_data) = 748; CHARSET gap_719_722 (CHARACTERS = ITS_data) = 858; CHARSET gap_222_230 (CHARACTERS = ITS_data) = 773; CHARSET gap_573_586 (CHARACTERS = ITS_data) = 841; CHARSET gap_596_598 (CHARACTERS = ITS_data) = 849; CHARSET gap_229_230 (CHARACTERS = ITS_data) = 775; CHARSET gap_799_803 (CHARACTERS = ITS_data) = 883; CHARSET gap_210_217 (CHARACTERS = ITS_data) = 762; CHARSET gap_765_767 (CHARACTERS = ITS_data) = 867; CHARSET gap_254_255 (CHARACTERS = ITS_data) = 787; CHARSET gap_324_325 (CHARACTERS = ITS_data) = 802; CHARSET gap_220_223 (CHARACTERS = ITS_data) = 768; CHARSET gap_710 (CHARACTERS = ITS_data) = 857; CHARSET gap_561_565 (CHARACTERS = ITS_data) = 837; CHARSET gap_255 (CHARACTERS = ITS_data) = 788; CHARSET gap_383_397 (CHARACTERS = ITS_data) = 815; CHARSET gap_191_195 (CHARACTERS = ITS_data) = 752; CHARSET gap_121_123 (CHARACTERS = ITS_data) = 731; CHARSET gap_237_241 (CHARACTERS = ITS_data) = 779; CHARSET gap_595_598 (CHARACTERS = ITS_data) = 848; CHARSET gap_359_362 (CHARACTERS = ITS_data) = 813; CHARSET gap_774_777 (CHARACTERS = ITS_data) = 880; CHARSET gap_238_242 (CHARACTERS = ITS_data) = 781; CHARSET gap_137_140 (CHARACTERS = ITS_data) = 737; CHARSET gap_238_241 (CHARACTERS = ITS_data) = 780; CHARSET gap_767_776 (CHARACTERS = ITS_data) = 871; CHARSET gap_172_175 (CHARACTERS = ITS_data) = 747; CHARSET gap_206_208 (CHARACTERS = ITS_data) = 757; CHARSET gap_305 (CHARACTERS = ITS_data) = 798; CHARSET gap_141_177 (CHARACTERS = ITS_data) = 740; CHARSET gap_148_170 (CHARACTERS = ITS_data) = 744; CHARSET gap_89 (CHARACTERS = ITS_data) = 727; CHARSET gap_555 (CHARACTERS = ITS_data) = 832; CHARSET gap_576_585 (CHARACTERS = ITS_data) = 845; CHARSET gap_212_213 (CHARACTERS = ITS_data) = 763; CHARSET gap_213_231 (CHARACTERS = ITS_data) = 764; CHARSET gap_463_464 (CHARACTERS = ITS_data) = 822; CHARSET gap_548_549 (CHARACTERS = ITS_data) = 828; CHARSET gap_757_758 (CHARACTERS = ITS_data) = 863; CHARSET gap_344 (CHARACTERS = ITS_data) = 809; CHARSET gap_605 (CHARACTERS = ITS_data) = 853; CHARSET gap_216 (CHARACTERS = ITS_data) = 765; CHARSET gap_338 (CHARACTERS = ITS_data) = 804; CHARSET gap_745 (CHARACTERS = ITS_data) = 860; CHARSET gap_532 (CHARACTERS = ITS_data) = 823; CHARSET gap_768_776 (CHARACTERS = ITS_data) = 874; CHARSET gap_95 (CHARACTERS = ITS_data) = 728; CHARSET gap_417_418 (CHARACTERS = ITS_data) = 818; CHARSET gap_768_775 (CHARACTERS = ITS_data) = 873; CHARSET gap_184 (CHARACTERS = ITS_data) = 749; CHARSET gap_555_556 (CHARACTERS = ITS_data) = 831; CHARSET gap_341_343 (CHARACTERS = ITS_data) = 806; CHARSET gap_442 (CHARACTERS = ITS_data) = 819; CHARSET gap_221_229 (CHARACTERS = ITS_data) = 771; CHARSET gap_220_232 (CHARACTERS = ITS_data) = 770; CHARSET gap_220_226 (CHARACTERS = ITS_data) = 769; CHARSET gap_557_586 (CHARACTERS = ITS_data) = 835; CHARSET gap_286 (CHARACTERS = ITS_data) = 790; CHARSET gap_789 (CHARACTERS = ITS_data) = 881; CHARSET gap_797 (CHARACTERS = ITS_data) = 882; CHARSET gap_770_775 (CHARACTERS = ITS_data) = 876; CHARSET gap_187 (CHARACTERS = ITS_data) = 751; CHARSET gap_569_571 (CHARACTERS = ITS_data) = 839; CHARSET gap_222_228 (CHARACTERS = ITS_data) = 772; CHARSET gap_193_195 (CHARACTERS = ITS_data) = 753; CHARSET gap_307_332 (CHARACTERS = ITS_data) = 800; CHARSET gap_141_175 (CHARACTERS = ITS_data) = 739; CHARSET gap_575_586 (CHARACTERS = ITS_data) = 843; CHARSET gap_81_91 (CHARACTERS = ITS_data) = 725; CHARSET gap_304_305 (CHARACTERS = ITS_data) = 797; CHARSET gap_352 (CHARACTERS = ITS_data) = 812; CHARSET gap_562_586 (CHARACTERS = ITS_data) = 838; CHARSET gap_122_123 (CHARACTERS = ITS_data) = 732; CHARSET gap_360_362 (CHARACTERS = ITS_data) = 814; CHARSET gap_773_775 (CHARACTERS = ITS_data) = 879; CHARSET gap_739 (CHARACTERS = ITS_data) = 859; CHARSET gap_229 (CHARACTERS = ITS_data) = 774; CHARSET gap_770_777 (CHARACTERS = ITS_data) = 877; CHARSET gap_137_138 (CHARACTERS = ITS_data) = 735; CHARSET gap_219_223 (CHARACTERS = ITS_data) = 767; CHARSET gap_554_556 (CHARACTERS = ITS_data) = 830; CHARSET gap_193_197 (CHARACTERS = ITS_data) = 754; CHARSET gap_297_299 (CHARACTERS = ITS_data) = 794; CHARSET gap_346_348 (CHARACTERS = ITS_data) = 810; CHARSET gap_138 (CHARACTERS = ITS_data) = 738; CHARSET gap_600_601 (CHARACTERS = ITS_data) = 852; CHARSET gap_239_242 (CHARACTERS = ITS_data) = 783; CHARSET gap_576_584 (CHARACTERS = ITS_data) = 844; CHARSET gap_240_241 (CHARACTERS = ITS_data) = 784; CHARSET gap_547_549 (CHARACTERS = ITS_data) = 826; CHARSET gap_573_589 (CHARACTERS = ITS_data) = 842; CHARSET gap_113 (CHARACTERS = ITS_data) = 730; CHARSET gap_210_211 (CHARACTERS = ITS_data) = 760; CHARSET gap_600 (CHARACTERS = ITS_data) = 851; CHARSET gap_206_211 (CHARACTERS = ITS_data) = 759; CHARSET gap_86 (CHARACTERS = ITS_data) = 726; CHARSET gap_184_187 (CHARACTERS = ITS_data) = 750; CHARSET gap_410 (CHARACTERS = ITS_data) = 816; CHARSET gap_291 (CHARACTERS = ITS_data) = 792; CHARSET gap_107 (CHARACTERS = ITS_data) = 729; CHARSET gap_205_208 (CHARACTERS = ITS_data) = 756; CHARSET gap_206_209 (CHARACTERS = ITS_data) = 758; CHARSET gap_756_757 (CHARACTERS = ITS_data) = 862; CHARSET gap_286_287 (CHARACTERS = ITS_data) = 791; CHARSET gap_557_565 (CHARACTERS = ITS_data) = 834; CHARSET gap_305_317 (CHARACTERS = ITS_data) = 799; CHARSET gap_765_776 (CHARACTERS = ITS_data) = 869; CHARSET gap_298_299 (CHARACTERS = ITS_data) = 795; CHARSET gap_765_777 (CHARACTERS = ITS_data) = 870; CHARSET gap_757_767 (CHARACTERS = ITS_data) = 864; CHARSET gap_244 (CHARACTERS = ITS_data) = 786; CHARSET gap_299 (CHARACTERS = ITS_data) = 796; CHARSET gap_597_598 (CHARACTERS = ITS_data) = 850; CHARSET gap_236 (CHARACTERS = ITS_data) = 778; CHARSET gap_217 (CHARACTERS = ITS_data) = 766; CHARSET gap_772_775 (CHARACTERS = ITS_data) = 878; CHARSET gap_461 (CHARACTERS = ITS_data) = 820; CHARSET gap_148 (CHARACTERS = ITS_data) = 743; CHARSET gap_297_298 (CHARACTERS = ITS_data) = 793; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_data) = N: 1-883; CODONPOSSET CodonPositions (CHARACTERS = ITS_data) = N: 1-883; END; BEGIN TREES; TITLE Tb10294; LINK TAXA = Taxa1; TRANSLATE 1 Solanum_morelliforme_275218, 2 Solanum_multiinterruptum_365336, 3 Solanum_okadae_498065, 4 Solanum_oplocense_435079, 5 Solanum_oplocense_473365, 6 Solanum_oxycarpum_498026, 7 Solanum_palustre_558233, 8 Solanum_palustre_558253, 9 Solanum_pampasense_275274, 10 Solanum_piurae_310997, 11 Solanum_polyadenium_161728, 12 Solanum_raphanifolium_265862, 13 Solanum_raphanifolium_473369, 14 Solanum_santolallae_195168, 15 Solanum_scabrifolium_365363, 16 Solanum_schenckii_275261, 17 Solanum_schenckii_498280, 18 Solanum_schenckii_558456.1_1, 19 Solanum_schenckii_558456.2_18, 20 Solanum_schenckii_558457, 21 Solanum_sparsipilum_310957, 22 Solanum_spegazzinii_472976, 23 Solanum_spegazzinii_473214.1_5, 24 Solanum_stoloniferum_251740, 25 Solanum_stoloniferum_283108, 26 Solanum_stoloniferum_558453, 27 Solanum_stoloniferum_558453_10, 28 Solanum_subpanduratum_498289, 29 Solanum_tarijense_442689, 30 Solanum_tuberosum_195188, 31 Solanum_tundalomense_473474, 32 Solanum_ugentii_546030, 33 Solanum_ugentii_546030.1_5, 34 Solanum_ugentii_546030.2_3, 35 Solanum_ugentii_546032, 36 Solanum_ugentii_546032_6, 37 Solanum_vernei_458370, 38 Solanum_vernei_458370.1_3, 39 Solanum_vernei_458370.2_3, 40 Solanum_vernei_458371, 41 Solanum_vernei_458371_6, 42 Solanum_vernei_473309, 43 Solanum_vernei_473309_5, 44 Solanum_vernei_473310.1_4, 45 Solanum_vernei_473310.2_3, 46 Solanum_vernei_500062_5, 47 Solanum_verrucosum_558488, 48 Solanum_villosum_Bohs_150, 49 Solanum_violaceimarmoratum_473396, 50 Solanum_yungasense_614703, 51 Solanum_yungasense_Spooner_et_al._6738, 52 Capsicum_pubescens_Anderson1554, 53 Datura_inoxia_Spooner2989, 54 Solanum_acaule_310923, 55 Solanum_acaule_498277, 56 Solanum_acaule_500016, 57 Solanum_achacachense_558032, 58 Solanum_acroscopicum_365314, 59 Solanum_agrimonifolium_243349, 60 Solanum_agrimonifolium_243351, 61 Solanum_agrimonifolium_243351_14, 62 Solanum_alandiae_498086, 63 Solanum_alandiae_498086.1_5, 64 Solanum_alandiae_498086.2_5, 65 Solanum_alandiae_498088, 66 Solanum_alandiae_498088_5, 67 Solanum_albicans_266381, 68 Solanum_ambosinum_498213, 69 Solanum_andreanum_320345, 70 Solanum_arnezii_545846, 71 Solanum_avilesii_498091, 72 Solanum_berthaultii_498075_5, 73 Solanum_berthaultii_498100_7, 74 Solanum_berthaultii_545920.1_5, 75 Solanum_berthaultii_545920.2_3, 76 Solanum_brevicaule_234009, 77 Solanum_bukasovii_210042, 78 Solanum_bukasovii_210055, 79 Solanum_bukasovii_442700, 80 Solanum_bulbocastanum_347757, 81 Solanum_candolleanum_545972, 82 Solanum_cardiophyllum_347759, 83 Solanum_cardiophyllum_595465, 84 Solanum_cardiophyllum_Rodriguez_2534, 85 Solanum_chacoense_472809, 86 Solanum_chacoense_472813_8, 87 Solanum_chacoense_472821_5, 88 Solanum_chacoense_498321_5, 89 Solanum_chomatophilum_365339, 90 Solanum_circaeifolium_498117, 91 Solanum_circaeifolium_498120, 92 Solanum_circaeifolium_545974, 93 Solanum_clarum_275202, 94 Solanum_clarum_283099, 95 Solanum_colombianum_473462, 96 Solanum_colombianum_498152.1_12, 97 Solanum_colombianum_498152.2_2, 98 Solanum_commersonii_458317, 99 Solanum_demissum_275211, 100 Solanum_demissum_558482, 101 Solanum_diploconos_Bohs_445, 102 Solanum_doddsii_Spooner_et_al._6651, 103 Solanum_dulcamara_Spooner2988, 104 Solanum_ehrenbergii_595480, 105 Solanum_etuberosum_498311, 106 Solanum_guerreroense_161730, 107 Solanum_hougasii_161174, 108 Solanum_hougasii_161727, 109 Solanum_immite_458401, 110 Solanum_incamayoense_473060, 111 Solanum_infundibuliforme_472857, 112 Solanum_iopetalum_275183, 113 Solanum_jamesii_458424, 114 Solanum_kurtzianum_472923, 115 Solanum_laxissimum_283088, 116 Solanum_leptophyes_442670, 117 Solanum_leptophyes_442670.1_7, 118 Solanum_leptophyes_442670.2_1, 119 Solanum_leptophyes_458378, 120 Solanum_leptophyes_458378.1_4, 121 Solanum_leptophyes_458378.2_1, 122 Solanum_leptophyes_545986_6, 123 Solanum_leptophyes_545989.1_4, 124 Solanum_leptophyes_545989.2_2, 125 Solanum_leptophyes_545993_7, 126 Solanum_lignicaule_473351, 127 Solanum_longiconicum_186568, 128 Solanum_lycopersicoides_LA1964, 129 Solanum_lycopersicum, 130 Solanum_marinasense_458380, 131 Solanum_megistacrolobum_545927.1_3, 132 Solanum_megistacrolobum_545927.2_3, 133 Solanum_microdontum_458355_6, 134 Solanum_microdontum_473167_8, 135 Solanum_microdontum_500036, 136 Solanum_microdontum_500036.1_5, 137 Solanum_microdontum_500036.2_3, 138 Solanum_microdontum_500040, 139 Solanum_microdontum_500040_6; TREE ITS = [&R] (52,(53,(101,((48,103),(((((((((105,(7,8)),98),(((67,(((56,55,54),100),99)),((((((((60,61),59),31,(95,28),127,6,96),49),(((115,14),(12,13),(9,81)),((((130,76),30),68),(78,79)))),57,126),(131,132)),77)),(20,(17,16),(18,19)),47,(((((((71,(123,33),125),124),122),21),120,121),119),37,35),5,(((40,139,38,41),46),(64,66),23),(((42,43),39),((134,133,(138,137)),(135,136))),(((26,27),(25,24)),112),(102,65),(((((85,(87,86,88),97),(29,(72,74))),70,51,50),62),63),((32,4,116,36,117),34),111,(114,44),107,(108,106),22,3,110,(73,75),45,118)),69),15),((((80,84),(82,104)),83),(((94,93),1),11))),113),((90,(92,91)),(((109,(58,2)),10),89))),(129,128)))))); END; BEGIN TREES; TITLE Tb10295; LINK TAXA = Taxa2; TRANSLATE 1 Capsicum_pubescens_Anderson1554, 2 Solanum_acaule_310923, 3 Solanum_acaule_498277, 4 Solanum_acaule_500016, 5 Solanum_achacacense_558032, 6 Solanum_acroscopicum_365314, 7 Solanum_agrimonifolium_243349, 8 Solanum_agrimonifolium_243351, 9 Solanum_alandiae_498086, 10 Solanum_alandiae_498088, 11 Solanum_albicans_266381, 12 Solanum_ambosinum_498213, 13 Solanum_andreanum_320345, 14 Solanum_arnezii_545846, 15 Solanum_avilesii_498091, 16 Solanum_brachycarpum_234009, 17 Solanum_bukasovii_210042, 18 Solanum_bukasovii_210055, 19 Solanum_bukasovii_442700, 20 Solanum_bulbocastanum_347757, 21 Solanum_candolleanum_545972, 22 Solanum_cardiophyllum_347759, 23 Solanum_cardiophyllum_595465, 24 Solanum_chacoense_472809, 25 Solanum_chomatophyllum_365339, 26 Solanum_circaeifolium_498117, 27 Solanum_circaeifolium_498120, 28 Solanum_circaeifolium_545974, 29 Solanum_clarum_275202, 30 Solanum_clarum_283099, 31 Solanum_colombianum_473462, 32 Solanum_commersonii_458317, 33 Solanum_demissum_275211, 34 Solanum_demissum_558482, 35 Solanum_ehrenbergii_595480, 36 Solanum_etuberosum_498311, 37 Solanum_guerreroense_161730, 38 Solanum_hougasii_161727, 39 Solanum_immite_458401, 40 Solanum_incamayoense_473060, 41 Solanum_infundibuliforme_472857, 42 Solanum_iopetalum_275183, 43 Solanum_jamesii_458424, 44 Solanum_kurtzianum_472923, 45 Solanum_lasissimum_283088, 46 Solanum_leptophyes_442670, 47 Solanum_leptophyes_458378, 48 Solanum_lignicaule_473351, 49 Solanum_longiconicum_186568, 50 Solanum_marinasense_458380, 51 Solanum_microdontum_500036, 52 Solanum_microdontum_500040, 53 Solanum_morelliforme_275218, 54 Solanum_multiinterruptum_365336, 55 Solanum_okadae_498065, 56 Solanum_oplocense_435079, 57 Solanum_oplocense_473365, 58 Solanum_oxycarpum_498026, 59 Solanum_palustre_558233, 60 Solanum_palustre_558253, 61 Solanum_pampasense_275274, 62 Solanum_piurae_310997, 63 Solanum_polyadenium_161728, 64 Solanum_raphanifolium_265862, 65 Solanum_raphanifolium_473369, 66 Solanum_santolallae_195168, 67 Solanum_scabrifolium_365363, 68 Solanum_schenckii_275261, 69 Solanum_schenckii_498280, 70 Solanum_schenckii_558457, 71 Solanum_sparsipilum_310957, 72 Solanum_spegazzinii_472976, 73 Solanum_stoloniferum_251740, 74 Solanum_stoloniferum_283108, 75 Solanum_stoloniferum_558453, 76 Solanum_subpanduratum_498289, 77 Solanum_tarijense_442689, 78 Solanum_tuberosum_195188, 79 Solanum_tundalomense_473474, 80 Solanum_ugentii_546030, 81 Solanum_ugentii_546032, 82 Solanum_vernei_458370, 83 Solanum_vernei_458371, 84 Solanum_vernei_473309, 85 Solanum_verrucosum_558488, 86 Solanum_villosum_Bohs150, 87 Solanum_violaceimarmoratum_473396, 88 Solanum_yungasense_614703; TREE trnH_psbA = [&R] (((9,75,26,38,58,17,80,69,10,73,68,45,70,(3,(2,11,4)),(61,32,20),40,65,(18,48),5,33,66,87,54,24,15,52,63,(7,72),13,76,84,49,(82,83),8,(22,23),16,39,25,85,62,42,53,77,50,12,37,55,74,14,19,57,64,(41,46),67,81,78,31,56,51,6,34,(43,35),88,27,28,(29,30),47,79,44,21,71),(60,(36,59)),86),1); END;